TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-150-5p
miRNA Sequence: UCUCCCAACCCUUGUACCAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000217chr1294986 4689 4638 3465 1986 1741 1247 1241 1234 --23734 167 --
NM_000337chr596432 5822 5226 5169 4904 4749 2499 1022 623 11866 16015 --
NM_000793chr1421931 1872 14122 --25061 4681
NM_001004065chr932800 898 252 1841 --33835 3018 40
NM_001004304chr1282446 2311 1981 1182 1176 826 354 26 33126 2762 1170 ----
NM_001007023chr1421931 1872 14122 --25061 4681
NM_001009993chr2114013 3878 3157 3139 2853 1743 1541 751 589 510 48 33713 1548 1410 --23283 610
NM_001017440chr797781 7599 6693 6376 5958 5775 2114 1284 911 21840 1748 15628 23183 1214
NM_001034841chr16105512 5050 4284 3966 3806 3505 1827 1532 1401 59 12081 33910 3605 2158 15075
NM_001040284chr1644920 2300 2272 1461 21137 77 14888 14764
NM_001042603chr1285028 4494 1755 1463 1443 427 30 22 --25141 1293 --
NM_001106chr3149646 8336 7763 6395 3586 3437 3338 3314 2233 2215 2081 1976 655 320 13032 36506 6233 3901 16365
NM_001113490chrX62406 2316 1457 1422 1211 539 22633 739 11443 12684
NM_002499chr1582361 2112 2037 1903 1774 806 798 788 12123 22164 1846 --
NM_002655chr894998 4189 1885 1645 1633 1626 1558 1036 795 --11838 --
NM_003559chr17103792 3687 3225 2922 1513 1277 934 315 99 91 13305 23350 117 23704 1461
NM_004726chrX85596 5284 4929 3647 2246 1384 1105 454 11709 11720 --
NM_004799chr13383 136 130 --1169 1145
NM_005056chr1285272 4738 1999 1707 1687 671 274 266 --25385 1537 --
NM_005188chr1167961 7102 3247 1344 950 757 --146 27908 1537
NM_005375chr6153 193 1974 2911 836
NM_005910chr17144029 3520 3428 3375 3094 3081 1098 1090 709 589 517 414 384 187 4757 645 596 367 --11038
NM_005933chr1152643 2014 1173 635 84 11834 --32895 544 324
NM_006546chr17146389 6364 6080 6042 5379 5086 5039 4762 4373 4079 4060 2304 2088 760 25433 1382 11913 26550 5485
NM_006599chr1648112 6083 5715 2594 28158 3302 17369 15206
NM_007203chr932800 898 252 1841 --33835 3018 40
NM_007324chr13383 136 130 --1169 1145
NM_012199chr154024 1837 844 831 440 1851 --23892 2860
NM_012316chr195109 4524 2179 1807 1650 1054 782 480 473 --34966 4786 4653 1739
NM_013989chr1421931 1872 14122 --25061 4681
NM_014586chr2184742 4400 4122 3517 3382 1096 1089 22 --33262 1850 293 24629 4306
NM_014747chr1145716 5362 4738 4601 4561 4218 4152 2330 2232 1701 1685 1130 1086 1057 25318 2121 ----
NM_015609chr1112863 2715 2550 2391 2283 2029 1994 533 373 325 257 --22298 275 1843
NM_016260chr267061 2485 2197 2005 1666 838 ----16075
NM_016834chr17144029 3520 3428 3375 3094 3081 1098 1090 709 589 517 414 384 187 4757 645 596 367 --11038
NM_016835chr17144029 3520 3428 3375 3094 3081 1098 1090 709 589 517 414 384 187 4757 645 596 367 --11038
NM_016841chr17144029 3520 3428 3375 3094 3081 1098 1090 709 589 517 414 384 187 4757 645 596 367 --11038
NM_017811chr972827 2510 2305 894 846 830 715 --1401 1931
NM_020205chr1133099 3052 2989 1390 895 867 821 586 417 362 343 337 113 --22852 886 --
NM_020699chr1105245 5159 5095 3949 3942 1595 1194 877 846 606 22057 1776 25102 652 14652
NM_022048chr15116135 5730 5318 5114 4628 4557 2306 2237 1846 569 435 --34297 2443 820 21231 98
NM_024551chr1282511 2494 2391 2020 1663 1573 432 253 --21969 752 2459 215
NM_024551chr1282511 2494 2391 2020 1663 1573 432 253 --21969 752 2459 215
NM_031417chr1972068 1996 1063 1054 684 678 551 22546 671 1400 --
NM_031468chr797781 7599 6693 6376 5958 5775 2114 1284 911 21840 1748 15628 23183 1214
NM_032932chr17166338 5658 5391 4818 4024 3900 2173 1875 1575 1391 1120 1110 858 804 425 265 14405 34525 4310 419 --
NM_033224chr797613 7414 5858 5128 2084 1809 1601 1465 573 --36501 5249 821 --
NM_052906chr22184958 4129 3739 3720 3641 3423 1965 1889 1763 1594 1507 788 707 692 452 380 353 45 24088 1064 24952 1684 157
NM_133265chrX62406 2316 1457 1422 1211 539 22633 739 11443 12684
NM_138473chr1275108 3863 3762 3642 1744 684 475 ----23960 1486
NM_138713chr1648112 6083 5715 2594 28158 3302 17369 15206
NM_138714chr1648112 6083 5715 2594 28158 3302 17369 15206
NM_147150chr932800 898 252 1841 --33835 3018 40
NM_152424chrX144436 4430 4424 4245 4144 3956 3119 1839 1734 749 546 279 85 77 14026 --14176
NM_172071chr136526 1722 1535 --35082 1870 662 22762 2089
NM_173214chr1648112 6083 5715 2594 28158 3302 17369 15206
NM_173642chr198676 8255 6245 6091 3544 3367 3307 1369 990 48122 8099 7131 6417 12859 11198
NM_175907chr1842512 2141 2068 812 ----3536 392 175
NM_181521chr16127068 4921 4681 2881 2586 2501 1599 1587 855 676 204 131 16443 56859 1643 1116 1106 180 --
NM_182970chr20104158 3923 3588 3382 2974 2719 1269 872 866 636 23196 1131 23231 830 12773
NM_198859chr331081 891 35 2106 26 34472 1402 92 --