TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-151a-3p
miRNA Sequence: CUAGACUGAAGCUCCUUGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr8----12374 1510
NM_000038chr521279 503 ------
NM_000041chr19--1119 ----
NM_000052chrX63044 2990 2170 866 818 642 12859 1881 128
NM_000074chrX4903 668 651 332 ------
NM_000081chr14602 412 130 68 ------
NM_000084chrX45197 4221 1593 985 36625 5339 5109 14675 15696
NM_000088chr1731283 1225 985 ------
NM_000089chr72690 178 ------
NM_000092chr231349 1315 1296 --13027 --
NM_000109chrX52587 2332 833 233 162 12227 ----
NM_000110chr12920 317 ------
NM_000125chr624013 3145 --1296 --
NM_000138chr1532214 2077 917 --22575 1809 11713
NM_000153chr1411684 11137 ----
NM_000163chr512260 12382 12336 1646
NM_000165chr641580 1482 1351 1344 ----1586
NM_000168chr72680 211 1541 ----
NM_000176chr543116 464 327 70 11302 ----
NM_000202chrX73251 3112 2580 2470 567 217 182 ------
NM_000217chr1264799 4626 2118 1583 1202 289 --13459 --
NM_000222chr441869 1456 854 337 12065 ----
NM_000232chr453202 3099 1962 1151 137 ------
NM_000248chr351979 1125 734 707 524 2673 378 ----
NM_000252chrX21306 247 11298 ----
NM_000259chr15115993 5663 5479 5079 2253 2183 1752 1437 729 616 243 12145 24632 465 --
NM_000264chr942754 1171 1023 331 22523 1205 12356 --
NM_000284chrX31540 598 156 11976 11886 11404
NM_000297chr42791 108 ----1770
NM_000310chr151218 1162 273 257 67 1208 ----
NM_000314chr1032784 1222 296 12838 13074 --
NM_000325chr41545 ------
NM_000328chrX3372 149 93 ------
NM_000330chrX31949 397 321 ------
NM_000332chr677172 7025 6613 6404 5986 1573 1547 25491 2805 ----
NM_000337chr556515 5884 5418 4126 1467 22024 974 --15013
NM_000346chr1741736 1276 785 679 ------
NM_000362chr2243540 2778 686 140 22732 1096 13435 --
NM_000368chr933992 564 442 34685 4334 355 11807 34596 3868 1184
NM_000391chr11----21650 602 --
NM_000393chr231919 1899 703 1497 1230 --
NM_000399chr102945 192 ------
NM_000408chr253238 2704 1264 1095 617 13297 1201 --
NM_000411chr2163027 2787 1298 886 360 217 3724 684 575 ----
NM_000439chr532210 2201 1709 12522 ----
NM_000441chr751962 917 788 773 380 ------
NM_000458chr173903 741 191 ------
NM_000459chr92870 693 ------
NM_000489chrX53362 3283 2237 1172 1124 1510 ----
NM_000495chrX21001 366 ------
NM_000503chr841800 1484 133 68 ------
NM_000509chr41146 ------
NM_000555chrX115864 5573 5030 4776 2174 1394 1173 1091 921 679 337 26769 5941 15554 --
NM_000560chr11718 ------
NM_000596chr71173 ------
NM_000598chr72228 141 ------
NM_000599chr244409 3954 1343 1318 ----11837
NM_000615chr1132613 914 406 --1461 11872
NM_000618chr1274776 4434 2324 2294 1275 937 481 --16191 --
NM_000618chr1274776 4434 2324 2294 1275 937 481 --16191 --
NM_000627chr22699 220 ------
NM_000633chr1864455 4309 3658 3620 3251 175 11377 11675 --
NM_000668chr441331 1075 425 32 11095 ----
NM_000681chr1031382 1134 1099 ------
NM_000719chr1286512 6484 6216 6120 5560 1989 1593 746 ------
NM_000724chr104629 564 489 85 ------
NM_000726chr241374 1068 405 173 ------
NM_000756chr81450 ------
NM_000780chr83371 281 168 ------
NM_000782chr202820 283 ------
NM_000801chr204980 827 292 286 ------
NM_000806chr521563 703 11647 1164 11692
NM_000807chr41682 ----171
NM_000809chr479096 8134 8111 7408 6128 3705 3399 2883 646 ----
NM_000812chr42301 140 ------
NM_000813chr555573 5113 4497 3631 832 25203 930 ----
NM_000814chr1534115 3465 3080 2497 436 1534 --
NM_000816chr51574 ------
NM_000826chr42894 457 22219 917 ----
NM_000833chr161534 11565 11245 --
NM_000844chr31386 ------
NM_000857chr42449 46 ------
NM_000866chr321901 1504 ----11531
NM_000868chrX52312 1789 1713 1662 548 ------
NM_000872chr1041588 326 250 43 --1997 1187
NM_000875chr1595896 5703 4595 2480 2389 2367 2340 400 292 ------
NM_000880chr8173 1699 ----
NM_000899chr1253784 3320 2958 1495 1193 --23061 771 --
NM_000901chr451602 1000 693 561 118 22490 129 --1198
NM_000917chr103314 84 67 2858 249 ----
NM_000933chr2031299 654 432 ------
NM_000937chr171421 1411 ----
NM_000944chr422022 544 --22151 147 1619
NM_000949chr52774 601 1897 ----
NM_000950chrX43236 3176 2269 947 ------
NM_001001132chr213936 925 529 --1165 --
NM_001001323chr12103175 2986 2446 2284 2011 1286 1256 593 233 74 1674 ----
NM_001001331chr312301 ------
NM_001001344chrX42555 2374 1586 375 ------
NM_001001395chr123606 519 333 12734 ----
NM_001001396chr193409 3206 2857 1561 1520 1167 996 646 281 12810 ----
NM_001001419chr551784 1682 1088 869 427 --14241 --
NM_001001420chr551784 1682 1088 869 427 --14241 --
NM_001001481chr833139 2891 70 ------
NM_001001549chr742137 2111 1811 61 12468 1697 --
NM_001001550chr742137 2111 1811 61 12468 1697 --
NM_001001555chr742137 2111 1811 61 12468 1697 --
NM_001001557chr832066 1972 686 ----1434
NM_001001664chr243896 3856 1106 663 1423 ----
NM_001001668chr1953732 3633 3362 3141 1330 1362 ----
NM_001001715chr13--1437 ----
NM_001001890chr2134315 4265 3925 ------
NM_001001928chr2268334 6680 6293 3237 1403 451 --25539 2302 1126
NM_001001933chr11606 1584 ----
NM_001001937chr18136 ------
NM_001001971chr103522 335 51 1150 ----
NM_001001974chr1062407 2169 1536 1509 813 44 ----21728 310
NM_001001994chrX2360 76 ------
NM_001001996chrX2360 76 ------
NM_001002243chr22364 21 ------
NM_001002269chr91394 ------
NM_001002295chr102779 437 1364 11125 --
NM_001002838chrX31501 186 114 --21875 1605 --
NM_001002901chr13451 323 169 ------
NM_001002909chr1731865 1485 302 --21561 175 --
NM_001002919chr21163 ------
NM_001002926chr752846 2344 2196 101 24 1642 --1729
NM_001003396chr6128 ------
NM_001003397chr6128 ------
NM_001003407chr1043968 3279 1781 134 14377 --14419
NM_001003408chr1043968 3279 1781 134 14377 --14419
NM_001003652chr1868689 8518 8169 6632 2191 1790 --48046 2704 1245 923 21490 1353
NM_001003674chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_001003675chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_001003679chr141828 1737 605 212 22013 249 155 --
NM_001003681chr2232030 1652 1617 1425 ----
NM_001003688chr451064 970 958 378 210 ------
NM_001003698chr621762 1233 --1678 11901
NM_001003699chr621762 1233 --1678 11901
NM_001003712chr1263844 3450 3342 3090 618 317 23792 1099 11288 11215
NM_001003760chr62982 398 --21368 695 --
NM_001003792chr331130 956 78 ------
NM_001003793chr331130 956 78 ------
NM_001003810chr41632 1165 ----
NM_001004106chr5165 ------
NM_001004317chr683533 3438 3360 3285 2917 1629 255 46 23011 2866 ----
NM_001004342chr166079 4941 4674 1857 1816 879 11276 ----
NM_001004441chr51362 --11286 1611
NM_001004720chr211061 1984 ----
NM_001004722chr211230 11153 ----
NM_001005266chr151751 ------
NM_001005267chr151751 ------
NM_001005268chr151751 ------
NM_001005269chr151751 ------
NM_001005360chr191788 ------
NM_001005361chr191788 ------
NM_001005362chr191788 ------
NM_001005366chr12--1985 ----
NM_001005375chrY41507 1464 1200 1173 2457 303 ----
NM_001005386chr222343 325 1190 --12460
NM_001005404chr1783775 3299 2920 1714 1437 1150 888 731 --13630 --
NM_001005473chr596622 5340 5063 4304 4221 4056 1436 561 274 15955 16562 --
NM_001005739chr2------1766
NM_001005746chr241374 1068 405 173 ------
NM_001005747chr241374 1068 405 173 ------
NM_001006600chr52958 761 ------
NM_001006610chr162987 45 ------
NM_001006618chr91197 ------
NM_001006623chr231712 441 24 ------
NM_001007075chr42961 886 11003 ----
NM_001007097chr974249 4118 3773 3510 1929 1789 918 21221 454 11285 13423
NM_001007226chr1721288 448 --1263 --
NM_001007227chr1721288 448 --1263 --
NM_001007228chr1721288 448 --1263 --
NM_001007229chr1721288 448 --1263 --
NM_001007230chr1721288 448 --1263 --
NM_001007237chr142562 2254 367 179 ------
NM_001007246chr21--11909 11971 --
NM_001007257chr1--1993 ----
NM_001007278chr1395054 4749 3334 2075 1855 1555 1144 888 23 24981 718 11416 --
NM_001007466chr6104765 4245 3733 3362 3287 2013 1911 1595 1435 992 --1421 --
NM_001007468chr222298 220 ------
NM_001007471chr92792 66 ------
NM_001007527chr52674 54 1160 ----
NM_001007553chr121196 133 ------
NM_001007559chr183808 702 666 ------
NM_001007794chr11694 ------
NM_001008225chr7----1730 --
NM_001008239chr1843816 2349 1448 344 23342 1108 12983 --
NM_001008392chr343118 2733 694 470 ------
NM_001008405chr771747 1632 1584 1545 1507 1448 654 21554 1226 ----
NM_001008408chr756436 5847 5167 1846 1045 ------
NM_001008495chr851618 1443 434 392 51 11780 ----
NM_001008540chr23483 443 95 1148 ----
NM_001008541chr1022045 90 --1505 --
NM_001008541chr1022045 90 --1505 --
NM_001008564chr13156 22200 1667 ----
NM_001008660chr1131131 516 171 11257 1196 --
NM_001008800chr11147 ------
NM_001008883chr11147 ------
NM_001008895chr1321184 195 21451 1344 ----
NM_001008897chr6--2210 182 --1439
NM_001008925chr463221 2973 900 566 426 94 13374 ----
NM_001008938chr112376 39 165 ----
NM_001009552chr81228 ----1222
NM_001009567chr103688 463 447 ------
NM_001009880chr2254421 4018 3584 1362 352 --24590 511 --
NM_001009899chr352023 1657 1354 1164 118 2857 492 ----
NM_001009955chr11545 --1607 --
NM_001009955chr11545 --1607 --
NM_001009993chr284564 3568 3255 2876 1424 786 669 166 ------
NM_001010000chr1843336 3262 2177 497 ------
NM_001010853chr622989 1300 22496 940 13218 --
NM_001010861chr152736 2550 2440 999 95 1776 ----
NM_001010870chr61516 ------
NM_001010891chr575923 2561 2376 2365 1469 727 706 36065 5910 569 15946 11629
NM_001010895chr92272 42 ------
NM_001010927chr61220 ------
NM_001010942chr121157 ------
NM_001010984chr132457 1660 222 22605 937 ----
NM_001010986chrX12427 11624 ----
NM_001011513chr433032 1555 503 23617 151 ----
NM_001011537chr381755 1670 1555 848 840 724 708 624 21777 632 ----
NM_001011553chr72870 95 ----1263
NM_001011666chr756220 4303 2049 604 239 15939 ----
NM_001011708chr232824 2698 2635 ------
NM_001012321chr3164 ------
NM_001012393chr1144330 3580 3523 1701 23343 3308 --11984
NM_001012420chr1522311 1926 1141 --12078
NM_001012423chr1522311 1926 21028 141 --12078
NM_001012478chr192595 536 ------
NM_001012614chr41268 ------
NM_001012751chr1011649 --1170 --
NM_001012755chrX104696 4344 3869 3360 1900 1437 1164 700 221 210 --24833 1073 14492
NM_001012968chrX31718 506 87 1880 ----
NM_001012980chrX1220 1211 ----
NM_001013398chr72228 141 ------
NM_001013399chr61906 2828 434 ----
NM_001013406chr761681 1363 1290 1163 546 403 ------
NM_001013415chr431288 1247 1207 11464 ----
NM_001013438chr33912 247 175 ------
NM_001013439chr33758 93 21 ------
NM_001013659chr1943608 3296 1631 1387 11293 ----
NM_001013674chr11753 1315 --1710
NM_001013843chr15----1628 --
NM_001014342chr11123 --1559 167
NM_001014434chr11174 ------
NM_001014794chr111250 ------
NM_001014795chr111250 ------
NM_001014797chr1037151 6468 1457 --47394 2918 2834 2011 15347
NM_001014809chr4187 ------
NM_001015045chr421910 46 1981 --1812
NM_001015508chr82559 206 1691 ----
NM_001015877chrX32932 2726 219 1714 ----
NM_001015881chrX4998 807 332 62 1348 ----
NM_001015887chr311534 1368 ----
NM_001017368chr1762211 2107 2042 811 532 326 12457 ----
NM_001017369chr42861 221 1949 ----
NM_001017395chr322291 979 13108 --11041
NM_001017523chr1221222 530 2540 201 ----
NM_001017922chr121729 1123 --31570 1556 241 11368
NM_001017923chr1431588 513 392 ------
NM_001017926chr8----11232 21174 356
NM_001017962chr103314 84 67 2858 249 ----
NM_001017969chr9123 ------
NM_001017999chr122165 733 ------
NM_001017999chr122165 733 ------
NM_001018000chr122165 733 ------
NM_001018000chr122165 733 ------
NM_001018001chr122165 733 ------
NM_001018004chr151237 ------
NM_001018006chr151237 ------
NM_001018007chr151237 ------
NM_001018020chr151237 ------
NM_001018038chr93541 451 50 ------
NM_001018054chr111135 ------
NM_001018057chr111235 11260 1192 --
NM_001018064chr921318 401 ------
NM_001018065chr955028 4634 4454 1895 295 25384 4078 24663 3676 --
NM_001018066chr955028 4634 4454 1895 295 25384 4078 24663 3676 --
NM_001018067chr165251 4276 4250 3637 1472 200 13256 24219 3992 1343
NM_001018068chr165251 4276 4250 3637 1472 200 13256 24219 3992 1343
NM_001018069chr165251 4276 4250 3637 1472 200 13256 24219 3992 1343
NM_001018072chr1221222 530 2540 201 ----
NM_001018074chr543116 464 327 70 11302 ----
NM_001018075chr543116 464 327 70 11302 ----
NM_001018076chr543116 464 327 70 11302 ----
NM_001018077chr543116 464 327 70 11302 ----
NM_001018090chr1522162 143 1183 --1448
NM_001018091chr1522272 253 1293 --1558
NM_001018102chr1522162 143 1183 --1448
NM_001018111chr743872 2869 2819 1443 --12639 --
NM_001020658chr141346 1227 622 607 195 ----
NM_001020658chr141346 1227 622 607 195 ----
NM_001023567chr1511947 22134 141 ----
NM_001024094chr543116 464 327 70 11302 ----
NM_001024226chr131138 1062 203 ------
NM_001024227chr131138 1062 203 ------
NM_001024228chr131138 1062 203 ------
NM_001024401chr1612919 --12335 --
NM_001024455chrX2700 381 ------
NM_001024460chr61259 ------
NM_001024649chr562804 2705 2455 407 318 144 11147 ----
NM_001024807chr191243 ------
NM_001024808chr1221849 121 ------
NM_001024948chr152998 2482 620 456 248 13205 --13362
NM_001025076chr10155460 5233 5212 5072 4682 4471 4291 4241 3909 2208 1872 1821 1720 852 472 ------
NM_001025077chr10146818 6591 6570 6430 6040 5829 5649 5599 5267 2210 1830 1104 977 174 ------
NM_001025079chr353434 3304 3089 796 237 ----1342
NM_001025108chr2104123 3934 3692 3167 2601 1518 1445 1329 1295 595 ------
NM_001025366chr621814 657 ------
NM_001025366chr621814 657 ------
NM_001025367chr621814 657 ------
NM_001025367chr621814 657 ------
NM_001025368chr621814 657 ------
NM_001025368chr621814 657 ------
NM_001025369chr621830 673 ------
NM_001025369chr621830 673 ------
NM_001025370chr621814 657 ------
NM_001025370chr621814 657 ------
NM_001025580chrX73580 3538 3202 2954 1384 427 74 ------
NM_001025777chr221515 44 --1392 --
NM_001029835chr72376 326 ------
NM_001029839chr311154 1539 ----
NM_001029840chr311154 1539 ----
NM_001029858chr643090 2820 1126 1061 --1101 --
NM_001029863chr632836 140 57 ----13205
NM_001029875chr542486 2416 2003 549 ------
NM_001029882chr11276 ------
NM_001029882chr11276 ------
NM_001029884chr632642 2526 2377 12700 --1520
NM_001029891chrX--1267 --1231
NM_001030007chr163974 805 659 23392 2994 --11292
NM_001030055chr1444483 4375 4124 3689 --13607 11777
NM_001031623chr631213 377 250 ------
NM_001031679chr1242845 2823 295 108 21197 546 ----
NM_001031684chr221500 1335 ------
NM_001031695chr2265187 4500 1615 1597 1255 485 11076 14246 --
NM_001031711chr521747 306 ------
NM_001031723chr4------1419
NM_001031732chr493636 3489 3439 3065 2682 1379 1074 1024 549 12813 11230 --
NM_001031801chr221161 ------
NM_001031803chr171230 ------
NM_001031804chr1664415 3534 3244 1717 1114 851 --13448 11356
NM_001031812chr521812 1754 11597 ----
NM_001032280chr611091 11469 ----
NM_001032296chr1362066 2047 1936 835 560 157 --12824 --
NM_001032393chrX1201 1195 ----
NM_001033049chr2131930 605 333 --32102 1691 783 --
NM_001033057chr322093 654 1394 ----
NM_001033059chr611706 12076 ----
NM_001033081chr131650 1306 46 --1107 --
NM_001033082chr131650 1306 46 --1107 --
NM_001033087chr2023099 2332 ------
NM_001033503chr51462 ------
NM_001033506chr111440 ------
NM_001033507chr121788 442 1195 --11855
NM_001033566chr17--1742 ----
NM_001033568chr17--1742 ----
NM_001033578chr831596 310 40 11993 ----
NM_001033602chr1362685 808 767 449 309 47 1200 ----
NM_001033756chr621748 591 ------
NM_001033756chr621748 591 ------
NM_001034841chr1633778 3515 1180 --45309 4049 1910 1344 11464
NM_001034850chr531650 670 344 --1366 --
NM_001034954chr1032962 2666 2115 --1885 1477
NM_001034955chr1032962 2666 2115 --1885 1477
NM_001034956chr1032962 2666 2115 --1885 1477
NM_001034957chr1032962 2666 2115 --1885 1477
NM_001035chr121290 1059 1866 ----
NM_001035260chr1021111 209 ------
NM_001037132chr742252 1453 538 512 11497 ----
NM_001037133chr742252 1453 538 512 11497 ----
NM_001037163chr7173 1149 1866 --
NM_001037164chr741896 1474 685 602 ------
NM_001037165chr778221 7561 7307 6959 6357 6000 1400 18840 16667 --
NM_001037172chr361228 1163 994 969 916 506 ------
NM_001037317chr152736 2550 2440 999 95 1776 ----
NM_001037334chr1821515 683 ------
NM_001037339chr151666 1660 1249 537 457 ------
NM_001037340chr151666 1660 1249 537 457 ------
NM_001037341chr151666 1660 1249 537 457 ------
NM_001037341chr151666 1660 1249 537 457 ------
NM_001037535chrX21551 610 --1162 --
NM_001037536chrX21551 610 --1162 --
NM_001037540chrX21551 610 --1162 --
NM_001037637chr51265 ------
NM_001037954chr1153469 2620 2415 2354 1014 --11254 --
NM_001038493chr221490 559 ------
NM_001039199chr2034964 4900 89 --1239 15036
NM_001039459chr731107 944 803 11039 ----
NM_001039465chr14--1365 ----
NM_001039538chr243210 2711 1452 734 33260 2780 439 12349 --
NM_001039577chr144192 3250 991 489 ------
NM_001039590chrX83717 3630 3565 3420 3383 2938 1003 127 --1806 --
NM_001039591chrX83717 3630 3565 3420 3383 2938 1003 127 --1806 --
NM_001039618chr1175257 4916 4302 2357 616 360 212 24602 4546 24077 826 --
NM_001039690chr1622131 327 ----11669
NM_001039693chr274014 3891 3715 3655 1620 1599 607 --13201 --
NM_001039762chr1012009 22217 53 12088 --
NM_001039802chr131278 559 473 11197 ----
NM_001039840chrX65336 5256 4802 2264 1233 928 ----11601
NM_001040033chr11718 ------
NM_001040057chr71930 11228 ----
NM_001040092chr82434 26 ------
NM_001040100chr321045 272 ------
NM_001040101chr431223 1100 1079 ------
NM_001040108chr1493257 3125 3043 2037 472 415 352 297 149 ------
NM_001040110chr72495 34 --1454 --
NM_001040144chr1622131 327 ----11669
NM_001040146chr1622131 327 ----11669
NM_001040152chr764160 3570 1457 1432 529 332 24606 4236 14309 --
NM_001040158chr51110 ----2150 50
NM_001040159chr411512 --1230 --
NM_001040202chr412321 1395 ----
NM_001040260chr421022 280 ------
NM_001040261chr421022 280 ------
NM_001040284chr1655842 5389 5149 4308 941 14423 14748 --
NM_001040402chr452833 2806 2559 200 43 ------
NM_001040446chr522712 916 --1298 --
NM_001040665chr743562 1863 1448 695 --13701 --
NM_001040708chr81202 135 ----
NM_001040712chr943552 3150 780 749 ----1185
NM_001040715chr163995 368 72 ------
NM_001042355chr1675039 4779 4009 3964 3508 545 453 2324 235 ----
NM_001042368chr91117 ------
NM_001042404chr121868 1813 --11341 --
NM_001042412chr1675039 4779 4009 3964 3508 545 453 2324 235 ----
NM_001042413chr941591 1566 1253 1218 --12848 --
NM_001042425chr611091 11469 ----
NM_001042453chrX31561 1341 1255 --11541 --
NM_001042481chr1421916 754 ------
NM_001042494chr1521329 812 12468 ----
NM_001042495chr1521329 812 12468 ----
NM_001042496chr1521329 812 12468 ----
NM_001042497chr1521329 812 12468 ----
NM_001042510chr812212 11418 ----
NM_001042511chr812212 11418 ----
NM_001042533chr343359 2804 610 236 22086 646 ----
NM_001042537chrX--1867 12431 12127
NM_001042552chr11905 21357 1027 ----
NM_001042555chr1251926 1431 1019 850 718 14745 ----
NM_001042576chr201180 ------
NM_001042599chr286954 4983 4821 2258 2112 1877 547 531 26268 2302 ----
NM_001042603chr1294938 4721 4522 3752 1862 1804 1732 1484 765 14146 25121 557 --
NM_001042604chr363738 3484 1338 987 597 204 34843 4461 1409 ----
NM_001042632chr2052413 2048 1709 622 191 1874 --22502 1642
NM_001042633chr2052413 2048 1709 622 191 1874 --22502 1642
NM_001042749chrX41468 678 214 157 11245 12025 --
NM_001042750chrX41468 678 214 157 11245 12025 --
NM_001042751chrX41468 678 214 157 11245 12025 --
NM_001044305chr61278 ------
NM_001044722chr521812 1754 11597 ----
NM_001044723chr521812 1754 11597 ----
NM_001046chr552718 1206 1171 1078 425 12914 ----
NM_001048183chr133768 3239 350 --13290 13054
NM_001049chr1442315 1769 1750 1507 11717 ----
NM_001083620chr42893 456 22217 916 ----
NM_001084chr72293 271 ------
NM_001099678chr3125697 5581 5424 4673 2373 2243 2196 2125 2110 1165 245 120 15760 15268 --
NM_001100108chr147921 5956 2907 155 37949 2851 1514 35292 2998 713 17886
NM_001106chr3118863 8806 7536 3055 2264 2059 1700 1685 1091 850 196 37890 1565 807 --19053
NM_001113490chrX73227 2874 2626 2489 1389 945 577 --1175 --
NM_001117chr1852393 2151 2050 2020 1737 22252 1830 11972 12305
NM_001119chr4--11419 ----
NM_001121chr101643 21245 705 ----
NM_001128chr163974 805 659 23392 2994 --11292
NM_001135chr151248 ------
NM_001144chr1611106 11232 ----
NM_001146chr852028 1812 1715 1613 703 ------
NM_001148chr421653 702 ------
NM_001149chr10----1291 --
NM_001152chrX192 ------
NM_001160chr1232143 511 217 ------
NM_001167chrX96488 6399 6048 5693 5533 5379 4628 2587 2302 31622 1215 684 14472 --
NM_001173chr1444483 4375 4124 3689 --13607 11777
NM_001174chrX11832 --1223 --
NM_001186chr2182782 2749 2555 2019 1202 724 670 117 1393 12178 --
NM_001198chr61412 ------
NM_001200chr202993 449 ------
NM_001201chr483839 3819 3630 3568 1584 1245 539 45 13318 33366 3353 635 --
NM_001204chr2157182 6915 6222 5297 5177 5135 2449 2400 2027 1652 1360 520 350 340 222 22761 2245 26161 3109 17041
NM_001206chr933030 2919 521 1694 ----
NM_001207chr51265 ------
NM_001237chr431001 317 62 ------
NM_001237chr431001 317 62 ------
NM_001241chr21910 11696 ----
NM_001241chr21910 11696 ----
NM_001248chr31348 ----1318
NM_001256chr1742710 2291 2186 2078 ------
NM_001259chr7105911 5800 5172 2165 1721 1241 763 731 574 163 15705 --16183
NM_001260chr132249 219 --1297 --
NM_001261chr9184 ------
NM_001268chr1321026 172 ------
NM_001278chr103438 296 176 ------
NM_001280chr191686 ------
NM_001284chr5156 1465 ----
NM_001304chr1773685 3599 2627 2476 1139 1078 160 1713 ----
NM_001313chr4187 ------
NM_001326chr111316 ------
NM_001328chr41268 ------
NM_001331chr1121137 295 2911 183 --1412
NM_001332chr541314 1132 633 364 ------
NM_001346chr322557 1756 ------
NM_001356chrX32491 2423 657 31857 971 825 ----
NM_001357chr11219 ------
NM_001364chr1164547 4457 4224 4161 3271 1467 1905 ----
NM_001389chr211236 ------
NM_001391chr182273 74 ------
NM_001394chr82597 265 ------
NM_001395chrX1895 --11008 --
NM_001396chr2142613 2462 2440 2365 --11767 --
NM_001401chr911050 --11168 --
NM_001402chr651606 784 195 90 55 31760 1694 1643 11932 --
NM_001406chr1741528 1512 1416 1133 --1588 160
NM_001408chr131617 1313 409 ------
NM_001418chr113689 589 184 --1278 --
NM_001418chr113689 589 184 --1278 --
NM_001419chr1964717 4390 3201 2986 1531 1490 14268 11963 --
NM_001430chr211859 ------
NM_001438chr133338 869 85 32238 902 415 21209 1171 12870
NM_001448chrX41692 1115 167 113 ------
NM_001449chrX1826 ------
NM_001452chr61689 1535 ----
NM_001453chr641667 1646 1444 1234 ------
NM_001494chr101291 ------
NM_001495chr811114 ------
NM_001514chr11470 ------
NM_001526chr6------1161
NM_001530chr143798 300 216 --161 --
NM_001542chr142562 2254 367 179 ------
NM_001543chr534233 1109 975 23008 3001 ----
NM_001546chr621063 932 ------
NM_001614chr171476 ------
NM_001614chr171476 ------
NM_001616chr243292 3134 2714 2364 --178 --
NM_001620chr111584 ------
NM_001634chr611706 12076 ----
NM_001635chr73872 745 674 ------
NM_001642chr1111042 ----11330
NM_001650chr1853572 3358 1395 1372 854 1413 --1135
NM_001658chr131138 1062 203 ------
NM_001663chr1462679 2354 1964 471 412 135 ------
NM_001664chr321058 982 ------
NM_001668chr1--12020 21575 1540 --
NM_001681chr121714 ------
NM_001682chr1272889 2700 2160 1998 1000 970 307 1388 ----
NM_001683chr312301 ------
NM_001684chr183126 2923 2574 1278 1237 884 713 363 ------
NM_001688chr13236 107 60 1287 ----
NM_001690chr342027 1833 1649 1047 ------
NM_001693chr83354 300 97 ----1404
NM_001695chr8113802 3752 1703 1486 1232 1055 849 807 794 260 240 1915 21308 1067 --
NM_001704chr61526 ------
NM_001706chr32801 324 ------
NM_001707chr72780 290 1859 ----
NM_001718chr611193 ------
NM_001726chr11138 ------
NM_001730chr13----11092 --
NM_001730chr13----11092 --
NM_001731chr121271 ------
NM_001735chr9129 ------
NM_001746chr562804 2705 2455 407 318 144 11147 ----
NM_001754chr2134315 4265 3925 ------
NM_001759chr1243838 3338 2070 1673 25272 4251 34007 1075 938 --
NM_001761chr1651758 1486 1448 1262 223 ------
NM_001777chr353434 3304 3089 796 237 ----1342
NM_001788chr72870 95 ----1263
NM_001791chr131278 559 473 11197 ----
NM_001796chr161104 ------
NM_001800chr192487 121 ------
NM_001806chr1932914 2175 873 ----12676
NM_001829chr4143 ------
NM_001854chr121390 1064 ------
NM_001855chr9198 ------
NM_001858chr684782 4152 3183 1712 1488 1247 801 748 14623 23471 3356 --
NM_001859chr973900 3868 3298 3086 1573 170 164 --32760 1075 598 --
NM_001861chr16----1121 --
NM_001865chr62135 34 ------
NM_001880chr2273 25 ------
NM_001881chr101401 ------
NM_001884chr52476 25 ------
NM_001901chr62957 171 --11012 --
NM_001904chr3137 --1996 --
NM_001933chr142974 52 ------
NM_001938chr151681 1503 728 719 307 11665 ----
NM_001939chrX93760 3670 2707 2673 1369 924 833 517 88 ------
NM_001942chr1831912 1326 745 ------
NM_001946chr1241127 755 462 50 ------
NM_001949chr612674 23104 2188 13080 1566
NM_001951chr81521 ------
NM_001957chr412325 11537 --2707 687
NM_001970chr17--1639 ----
NM_001977chr411647 31741 399 23 ----
NM_001981chr11737 ----11528
NM_001987chr1263863 3305 3122 1267 1149 348 13657 ----
NM_002006chr4103710 3616 3594 2289 1261 799 616 489 403 101 24884 4545 ----
NM_002009chr1562482 2413 1995 1909 1086 959 ------
NM_002017chr114935 337 232 219 ------
NM_002024chrX21766 344 --1449 --
NM_002025chrX128866 7886 7174 6432 6301 2690 2549 2405 2259 1920 1044 809 11779 --28654 7794
NM_002026chr21951 1800 ----
NM_002031chr61799 1776 196 --
NM_002033chr1163227 3162 3126 1556 1148 1128 --23844 920 --
NM_002040chr2111023 22613 255 32713 881 361 1114
NM_002051chr102779 437 1364 11125 --
NM_002069chr731667 1471 421 ------
NM_002076chr1222047 82 --12296 --
NM_002082chr5128 ------
NM_002092chr484243 4057 3812 1388 876 776 700 193 --189 --
NM_002106chr4--1141 ----
NM_002107chr11174 ------
NM_002126chr1763568 2725 1077 562 436 43 24088 898 ----
NM_002128chr1342029 969 780 518 ------
NM_002137chr772334 2209 1740 871 826 785 256 ------
NM_002138chr41632 1165 ----
NM_002154chr51109 ------
NM_002158chr253785 3298 2932 1373 1258 --22651 1241 --
NM_002166chr21591 ------
NM_002193chr211599 ----11907
NM_002203chr543181 2707 274 150 ------
NM_002210chr243363 2348 1202 843 --1461 --
NM_002214chr765103 4323 1988 1746 689 361 21964 1943 ----
NM_002222chr331355 908 124 ----11192
NM_002224chr6----1236 --
NM_002229chr192418 406 ------
NM_002232chr121260 887 21070 494 ----
NM_002242chr2--21506 317 1386 --
NM_002247chr102524 344 1755 --12207
NM_002264chr344227 3762 1992 1849 --14790 --
NM_002267chr1322256 289 31921 916 588 22053 297 12372
NM_002268chr321655 1525 11836 ----
NM_002270chr565272 4927 4909 1088 981 47 35495 4102 3896 32204 994 299 1863
NM_002271chr131625 ----11827
NM_002285chr2104123 3934 3692 3167 2601 1518 1445 1329 1295 595 ------
NM_002293chr152111 1088 979 890 383 1153 ----
NM_002295chr3164 ------
NM_002296chr141546 1485 1233 280 11178 ----
NM_002310chr565425 4592 2391 2324 2010 433 1170 --16282
NM_002313chr1043968 3279 1781 134 14377 --14419
NM_002336chr1244364 3748 3349 1245 24666 1451 ----
NM_002351chrX1324 11593 ----
NM_002356chr621938 642 --12081 --
NM_002360chr721926 383 --21888 1014 --
NM_002374chr243210 2711 1452 734 33260 2780 439 12349 --
NM_002375chr322300 1652 ------
NM_002395chr6------1124
NM_002397chr51754 --11922 --
NM_002398chr221461 1289 ------
NM_002408chr14279 27 1619 ----
NM_002438chr103688 463 447 ------
NM_002442chr1211767 ------
NM_002469chr12--1405 ----
NM_002480chr1231045 437 79 ------
NM_002486chr941974 962 868 254 12116 12348 --
NM_002487chr151725 ------
NM_002500chr21920 1247 ----
NM_002501chr1923981 2853 22915 2694 ----
NM_002508chr121990 1783 ------
NM_002515chr1421392 581 1294 ----
NM_002539chr2133 ------
NM_002545chr1144330 3580 3523 1701 23343 3308 --11984
NM_002556chr1122114 2052 ------
NM_002577chr343552 1339 658 403 13361 23158 2726 --
NM_002581chr995504 4289 4237 3990 3466 2060 1747 1696 127 1222 2926 589 --
NM_002594chr202875 767 11780 11722 --
NM_002595chr1221339 533 ------
NM_002600chr151666 1660 1249 537 457 ------
NM_002605chr152956 264 ------
NM_002608chr2211545 ------
NM_002612chr791790 1763 1682 741 437 338 277 246 42 ------
NM_002613chr1635396 3818 338 --15124 --
NM_002628chr32855 382 ----11174
NM_002641chrX31856 1504 348 ------
NM_002645chr1132371 1059 523 12517 12166 --
NM_002646chr11260 11956 ----
NM_002655chr864156 4120 3266 832 501 194 11528 ----
NM_002657chr2073481 1393 1094 1079 920 839 27 11126 ----
NM_002660chr201422 ------
NM_002670chr31997 11324 153 1417
NM_002687chr142520 326 11162 ----
NM_002709chr221267 646 --12950 --
NM_002710chr121847 --21038 277 --
NM_002713chr13871 773 452 ------
NM_002715chr541298 1077 523 241 ------
NM_002716chr1153548 1440 1054 929 530 23645 816 --13430
NM_002734chr1742017 1868 845 579 1523 --12227
NM_002736chr721463 552 ------
NM_002737chr1736610 2023 1507 16294 11700 2617 231
NM_002740chr332521 855 237 21867 1728 ----
NM_002745chr2213966 23957 3260 ----
NM_002828chr182989 706 --1953 --
NM_002829chr91247 ------
NM_002834chr1273961 3917 3447 2913 2557 1014 87 22889 1326 --1385
NM_002835chr71782 1289 --1597
NM_002837chr1273751 3566 3394 1700 1666 1622 1196 ------
NM_002839chr943552 3150 780 749 ----1185
NM_002844chr611332 ------
NM_002847chr71471 --1138 --
NM_002851chr71633 1596 175 --
NM_002852chr31483 ----1238
NM_002858chr131176 424 417 ------
NM_002868chr1252340 1674 963 871 741 ------
NM_002873chr51106 --1356 --
NM_002886chr385052 4787 4156 3419 2076 1136 924 802 13408 25063 1754 --
NM_002890chr5------165
NM_002892chr1441383 1340 1186 30 ------
NM_002906chr1152083 1481 787 528 114 ------
NM_002911chr1911705 ----1665
NM_002918chr1931128 1093 898 ------
NM_002941chr31503 ------
NM_002942chr321215 903 --11175 --
NM_002955chr621762 1233 --1678 11901
NM_002956chr1221148 163 --11137 --
NM_002959chr183176 1757 1717 1508 1485 1429 951 872 --11196 --
NM_002971chr311096 ------
NM_002976chr2--1210 ----
NM_002977chr252824 898 335 253 78 ------
NM_002998chr832250 2208 855 ------
NM_003010chr1732131 875 744 ------
NM_003011chr921177 71 11340 11543 1633
NM_003013chr42762 109 1275 ----
NM_003016chr172367 294 12011 11744 --
NM_003026chr91839 ----11048
NM_003031chr162987 45 ------
NM_003034chr1267328 7162 2491 2141 908 699 47499 7182 4962 1729 --17543
NM_003068chr821029 393 1218 ----
NM_003071chr331663 711 27 11878 11686 --
NM_003072chr191306 ------
NM_003073chr222298 220 ------
NM_003074chr371879 1785 1489 907 883 348 286 ------
NM_003081chr2011165 11197 ----
NM_003096chr21179 ------
NM_003106chr321087 430 --1999 --
NM_003107chr622342 2250 193 --11840
NM_003108chr2146751 5790 5562 5304 5225 5175 2450 1611 1551 940 778 474 464 314 46867 6275 1409 1272 ----
NM_003146chr11174 ------
NM_003149chr321304 349 ------
NM_003151chr2--149 ----
NM_003155chr822515 66 1725 ----
NM_003156chr1121087 331 ------
NM_003161chr1772744 2580 2412 1186 1166 1108 93 12555 ----
NM_003162chr22705 305 ------
NM_003170chr171426 ------
NM_003178chr32628 621 ------
NM_003179chrX1212 --1513 --
NM_003185chr202319 110 ------
NM_003188chr61629 ------
NM_003194chr62386 63 --1583 --
NM_003199chr1843575 1998 1515 928 31830 378 124 ----
NM_003217chr1232002 1465 1248 ------
NM_003220chr611091 11469 ----
NM_003221chr61269 ------
NM_003234chr352129 2113 786 760 41 ------
NM_003246chr151173 11575 ----
NM_003247chr651587 1490 1325 682 229 ------
NM_003257chr151106 ------
NM_003262chr371966 1802 1649 1330 1159 897 413 ----24198 190
NM_003286chr2011073 ------
NM_003288chr2011127 1612 ----
NM_003292chr132053 1893 838 172 11621 1196
NM_003298chr3106104 5707 5338 5086 4929 4565 2054 1432 1400 1274 --35389 4398 1743 --
NM_003302chr71144 ------
NM_003315chr17------149
NM_003317chr142782 762 ------
NM_003330chr1251619 1573 587 306 260 ------
NM_003337chr551749 1496 1191 1073 684 --1133 --
NM_003338chr101368 ------
NM_003340chr411123 11146 1990 --
NM_003342chr1713166 12887 12832 1420
NM_003344chr721626 234 ----11371
NM_003347chr2241786 396 163 143 --1542 --
NM_003348chr12184 2481 387 --11531
NM_003350chr81708 2914 647 ----
NM_003370chr192799 637 ------
NM_003372chrX----1316 --
NM_003374chr5------1753
NM_003376chr621814 657 ------
NM_003376chr621814 657 ------
NM_003380chr102199 97 ------
NM_003381chr62642 194 ------
NM_003389chr92460 196 ------
NM_003392chr344192 3928 3308 2989 13861 23531 1504 --
NM_003405chr221153 ------
NM_003409chr1831288 1226 422 --1296 --
NM_003410chrX63100 3044 2177 1928 192 72 1471 ----
NM_003411chrY2181 67 ------
NM_003412chr352871 1102 1072 606 300 1686 12232 --
NM_003418chr32787 186 ------
NM_003423chr196749 636 583 555 521 254 ------
NM_003430chr1971611 1557 1214 1130 482 408 240 ------
NM_003432chr52389 63 ------
NM_003442chr112875 282 1739 ----
NM_003452chr92840 56 ------
NM_003453chr13187 ------
NM_003458chr343901 3710 2883 889 --11532 --
NM_003463chr622049 125 192 ----
NM_003467chr23483 443 95 1148 ----
NM_003468chr244181 2811 1266 671 --1545 --
NM_003470chr1621845 148 ------
NM_003471chr322230 79 22036 945 ----
NM_003472chr6--1203 11255 --
NM_003477chr111499 ------
NM_003478chr1143272 3203 2325 2152 32632 2550 762 22976 1217 --
NM_003482chr1252484 2469 2462 2296 2143 ------
NM_003483chr1222623 1083 ------
NM_003488chr171279 ----1980
NM_003489chr2132925 857 21 1403 ----
NM_003498chr1622230 789 ------
NM_003508chr71271 ------
NM_003557chr111374 ------
NM_003558chr91637 1466 ----
NM_003563chr1721288 448 --1263 --
NM_003566chr1221221 246 --1576 --
NM_003567chr1--1351 ----
NM_003576chr1362066 2047 1936 835 560 157 --12824 --
NM_003580chr81526 ------
NM_003581chr211061 1984 ----
NM_003583chr1222676 2588 ------
NM_003589chr1321184 195 21451 1344 ----
NM_003590chr264090 3893 3672 2885 2793 482 23903 1357 1922 12902
NM_003597chr262169 835 799 789 297 102 11515 11628 --
NM_003615chr3114033 3933 3602 2995 2778 2611 2580 1606 938 731 433 33412 3386 1308 1285 13183
NM_003620chr174873 243 137 114 ------
NM_003629chr173278 2597 2536 667 430 248 49 11054 33488 2436 1372 --
NM_003630chr62197 85 ------
NM_003632chr17----1570 --
NM_003633chr521981 1578 191 ----
NM_003659chr22964 454 ------
NM_003660chr191289 ------
NM_003663chr363146 3042 975 957 941 704 ------
NM_003670chr32902 385 ------
NM_003672chr161917 1668 1323 627 617 238 --1602 --
NM_003676chr12628 187 ------
NM_003692chr93933 171 153 ------
NM_003718chr73563 474 392 1148 ----
NM_003743chr21668 ------
NM_003749chr1332398 2073 97 ------
NM_003758chr1521584 408 ----11289
NM_003758chr1521584 408 ----11289
NM_003759chr464217 3281 1479 1448 1395 238 ------
NM_003768chr131733 1526 1314 ------
NM_003774chr1253164 2892 2239 2209 410 ------
NM_003778chr31748 --1740 --
NM_003783chr131088 996 940 ------
NM_003787chr1831351 100 43 132 ----
NM_003791chr163463 127 102 ------
NM_003795chr61134 ------
NM_003799chr1874205 4076 4029 3478 3375 2785 1026 1500 11287 --
NM_003816chr811497 11191 ----
NM_003825chr1521094 572 177 ----
NM_003850chr131231 --1275 --
NM_003873chr103866 735 589 --12215 --
NM_003875chr3137 ------
NM_003884chr321543 405 ------
NM_003885chr1742630 535 122 67 ------
NM_003887chr242296 2007 761 79 --21844 937 --
NM_003888chr1541480 1357 1280 178 ------
NM_003899chr1332336 1827 667 ------
NM_003902chr12825 787 1813 ----
NM_003909chr852809 2340 2331 2294 626 12649 1539 --
NM_003913chr653721 3354 2962 2841 2687 --21443 65 --
NM_003916chrX1258 1248 ----
NM_003922chr151371 ------
NM_003924chr421415 351 --11219 --
NM_003930chr732070 1648 313 12587 ----
NM_003932chr2221847 1630 ------
NM_003934chr921152 347 ------
NM_003939chr1073523 3191 3038 3003 2672 1004 114 --23360 192 13114
NM_003941chr71220 22149 278 ----
NM_003947chr321132 889 1251 ----
NM_003948chr422592 1712 21958 937 ----
NM_003955chr1721275 642 ------
NM_003958chr631564 1312 535 ----12759
NM_003972chr102483 75 ----11226
NM_003980chr611125 1451 ----
NM_003985chr172671 249 ------
NM_003993chr12314 216 ------
NM_003994chr1253784 3320 2958 1495 1193 --23061 771 --
NM_003996chr6131 ------
NM_004006chrX52587 2332 833 233 162 12227 ----
NM_004007chrX52587 2332 833 233 162 12227 ----
NM_004009chrX52587 2332 833 233 162 12227 ----
NM_004010chrX52587 2332 833 233 162 12227 ----
NM_004011chrX52587 2332 833 233 162 12227 ----
NM_004012chrX52587 2332 833 233 162 12227 ----
NM_004013chrX52587 2332 833 233 162 12227 ----
NM_004014chrX52587 2332 833 233 162 12227 ----
NM_004015chrX52587 2332 833 233 162 12227 ----
NM_004016chrX52501 2246 747 147 76 12141 ----
NM_004017chrX52587 2332 833 233 162 12227 ----
NM_004018chrX52501 2246 747 147 76 12141 ----
NM_004020chrX52587 2332 833 233 162 12227 ----
NM_004021chrX52501 2246 747 147 76 12141 ----
NM_004022chrX52501 2246 747 147 76 12141 ----
NM_004023chrX52501 2246 747 147 76 12141 ----
NM_004028chr1853572 3358 1395 1372 854 1413 --1135
NM_004040chr221345 1084 ------
NM_004046chr18136 ------
NM_004050chr1432636 1992 215 12780 11007 --
NM_004056chr821089 24 --1104 --
NM_004061chr51194 ------
NM_004067chr731463 1289 313 ------
NM_004080chr741372 216 180 126 --11108 --
NM_004081chrY41507 1464 1200 1173 2457 303 ----
NM_004085chrX2748 584 ------
NM_004087chr311506 ----1421
NM_004089chrX4998 807 332 62 1348 ----
NM_004090chr1711311 13414 ----
NM_004094chr1442799 1852 754 500 12689 ----
NM_004097chr21338 ------
NM_004100chr662676 2368 2298 1782 1056 1010 ------
NM_004107chr191153 ------
NM_004109chr1121542 618 12361 ----
NM_004111chr11------1243
NM_004114chrX11180 11205 ----
NM_004119chr131648 ------
NM_004124chr14123550 3513 3435 2819 2614 2219 1268 1161 710 647 550 104 22969 825 1381 --
NM_004132chr10--11114 ----
NM_004136chr1533188 1251 724 1553 12132 --
NM_004156chr81228 ----1222
NM_004161chr231632 419 345 ------
NM_004170chr951886 1823 1389 1380 555 ------
NM_004171chr11159009 8947 8324 7630 7216 6872 6799 6188 5996 3431 3425 2981 1176 1163 592 28547 799 ----
NM_004183chr11--1321 ----
NM_004193chr101427 ------
NM_004226chr21249 ------
NM_004227chr731952 1170 495 12694 --12768
NM_004229chrX31673 893 786 ----174
NM_004232chr1863713 3378 3234 2599 136 112 23197 1147 162 --
NM_004242chr61318 ------
NM_004253chr92835 667 ------
NM_004261chr12301 101 ------
NM_004268chr112458 193 --1423 1253
NM_004272chr551951 1884 1437 1321 671 ------
NM_004274chr1422560 1159 ------
NM_004316chr1211018 ------
NM_004331chr81233 --12655 --
NM_004337chr831533 1493 33 ------
NM_004338chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_004342chr752076 1816 1711 1694 1574 1327 1173 --
NM_004349chr831190 953 872 11169 ----
NM_004359chr19128 ------
NM_004368chr191362 ------
NM_004370chr66780 700 330 289 96 35 1633 31719 1541 206 --
NM_004384chr521812 1754 11597 ----
NM_004385chr52593 471 ------
NM_004392chr1332239 1907 867 1139 ----
NM_004397chr1154269 4260 2654 2632 1129 --1813 --
NM_004407chr41888 ------
NM_004430chr821804 831 ------
NM_004432chr91485 1507 ----
NM_004442chr121444 353 --11658 --
NM_004443chr31487 ------
NM_004449chr2131391 1104 390 ------
NM_004450chr14----1355 --
NM_004454chr332192 1851 1632 --1793 --
NM_004456chr7194 ------
NM_004457chr231263 334 23 1689 ----
NM_004459chr1721558 616 ------
NM_004460chr2164 ------
NM_004474chr12246 86 ------
NM_004485chr151742 1027 309 300 266 24193 281 ----
NM_004494chr121284 1213 ------
NM_004496chr141436 1251 ----
NM_004501chr121652 1330 23619 2883 11613 1184
NM_004504chr231190 1050 596 12745 ----
NM_004516chr191172 1794 ----
NM_004517chr111250 ------
NM_004521chr102301 276 --1247 1383
NM_004524chr171202 ------
NM_004535chr201497 21446 1090 ----
NM_004538chrX1143 --1186 --
NM_004549chr1151484 1215 239 191 26 ------
NM_004571chr2153351 2925 2784 2131 60 12419 --1989
NM_004575chr441253 1203 1195 187 1388 ----
NM_004576chr51283 ------
NM_004578chr12830 353 ------
NM_004586chrX54976 4854 3695 2042 1264 15325 1382 --
NM_004587chr201180 ------
NM_004588chr1134051 3707 765 --13417 --
NM_004593chr31379 ----1247
NM_004612chr954643 3947 1600 1039 237 1524 ----
NM_004615chrX1165 --1659 --
NM_004631chr111135 ------
NM_004645chr172327 26 ------
NM_004654chrY1385 --1447 --
NM_004656chr31952 ------
NM_004660chrY41897 849 772 506 11787 ----
NM_004663chr1511276 21121 220 ----
NM_004687chr1721380 1340 --1632 12107
NM_004713chr142650 163 ------
NM_004725chr1031461 268 255 21408 1177 ----
NM_004726chrX95701 5423 5382 3863 2296 2043 1410 763 291 11729 14754 --
NM_004730chr52624 263 ------
NM_004733chr32204 42 1437 ----
NM_004734chr1333021 1272 188 ------
NM_004736chr11772 12037 1434 --
NM_004744chr433343 2939 1082 ------
NM_004745chr874861 4850 4360 2209 1405 1363 1087 21025 666 --11063
NM_004747chr1021311 88 ----1999
NM_004748chr1543472 3447 3404 265 1120 ----
NM_004760chr762503 2280 2259 1996 1734 1638 1462 ----
NM_004766chr31167 ------
NM_004768chr131151 796 233 --11130 --
NM_004772chr531073 421 171 ----11232
NM_004774chr1742474 1053 308 57 12983 ----
NM_004775chr1842240 2139 1945 396 12187 ----
NM_004781chr111119 ------
NM_004781chr111119 ------
NM_004788chr1142527 1847 648 238 --12351 --
NM_004795chr1321719 1489 ------
NM_004805chr21409 ------
NM_004808chr1022868 1064 ------
NM_004815chr194352 4118 3783 3514 3495 1441 1090 624 329 34722 3036 1327 ----
NM_004824chr631269 1260 364 ------
NM_004834chr221159 1002 --31147 908 174 --
NM_004836chr22664 229 1966 --1822
NM_004840chrX175 ------
NM_004841chr11813 ------
NM_004842chr621766 62 1420 11702 --
NM_004850chr231454 700 609 1682 11317 --
NM_004857chr1474544 4038 3715 3302 606 357 159 --1887 --
NM_004859chr1732309 1936 859 11109 22242 69 --
NM_004863chr1445206 1431 967 543 11391 14744 24581 689
NM_004866chr574927 4832 4012 3538 1764 1743 746 ------
NM_004874chr81188 --1506 --
NM_004893chr51110 ----2150 50
NM_004896chr1021026 124 ------
NM_004898chr42778 98 ----12685
NM_004904chr756220 4303 2049 604 239 15939 ----
NM_004906chr62605 532 ------
NM_004912chr761681 1363 1290 1163 546 403 ------
NM_004921chr141936 929 269 136 ------
NM_004923chr115666 571 135 55 39 ------
NM_004924chr1911015 ------
NM_004926chr1421331 528 --1355 11842
NM_004929chr861171 544 526 330 212 179 11076 ----
NM_004945chr191788 ------
NM_004956chr733062 2882 1685 13653 24299 4215 24316 505
NM_004966chr101402 3770 271 262 ----
NM_004973chr621639 1220 ------
NM_004976chr1174236 4007 2004 1238 1095 1024 654 23898 3278 193 --
NM_004984chr12139 ------
NM_004985chr1263642 2959 1764 1734 1119 848 24004 1384 ----
NM_004992chrX108278 7181 6238 3415 3270 2300 2132 1966 1713 570 --23015 880 --
NM_004992chrX108278 7181 6238 3415 3270 2300 2132 1966 1713 570 --23015 880 --
NM_005010chr742252 1453 538 512 11497 ----
NM_005011chr72495 34 --1454 --
NM_005016chr121118 --1305 --
NM_005023chr531285 1119 349 157 ----
NM_005036chr2268334 6680 6293 3237 1403 451 --25539 2302 1126
NM_005054chr231647 1621 1516 11375 11295 --
NM_005056chr1295182 4965 4766 3996 2106 2048 1976 1728 1009 14390 25365 801 --
NM_005063chr1073619 3480 3428 2563 2363 1386 300 ------
NM_005065chr1465198 4898 2147 2111 1556 1486 2450 432 ----
NM_005066chr12247 29 --1114 --
NM_005068chr611424 21065 56 ----
NM_005080chr222772 36 ------
NM_005087chr33758 93 21 ------
NM_005088chrX2883 213 ------
NM_005114chr41550 ------
NM_005116chr2063385 3059 2869 2862 1287 1275 ------
NM_005119chr11339 ------
NM_005121chr1721400 1044 33560 552 110 --1667
NM_005124chr63881 761 268 1981 ----
NM_005126chr32782 513 ------
NM_005128chr21--1670 ----
NM_005135chr1521329 812 12468 ----
NM_005151chr1821515 683 ------
NM_005153chr162606 303 --2781 720 --
NM_005154chr151233 1453 ----
NM_005156chr9135310 5178 4967 4084 4064 3952 3639 3317 2150 1368 908 887 881 21092 463 15154 --
NM_005164chr1232630 814 504 22646 1962 11937 --
NM_005166chr191243 ------
NM_005168chr211276 174 --1708
NM_005171chr1221344 1102 --11192 21261 256
NM_005180chr101586 --21463 1331 --
NM_005188chr11148243 7875 7640 6877 5469 2821 2407 2298 2136 2078 1747 1491 1135 943 27255 2192 15880 11761
NM_005190chr61906 2828 434 ----
NM_005203chr10165 ------
NM_005206chr1731460 291 147 --1229 --
NM_005207chr2263563 2657 2390 1219 652 50 ----11420
NM_005215chr18--1259 ----
NM_005219chr531788 621 379 ------
NM_005227chr11499 ------
NM_005230chr122137 66 ------
NM_005233chr3----22528 2431 --
NM_005235chr286954 4983 4821 2258 2112 1877 547 531 26268 2302 ----
NM_005252chr141615 ------
NM_005256chr11----168 --
NM_005257chr1831376 1035 505 ------
NM_005264chr102371 253 --191 --
NM_005273chr71338 ------
NM_005277chr421736 768 1417 ----
NM_005278chrX2360 76 ------
NM_005295chr71196 ------
NM_005296chrX1439 ------
NM_005308chr10----1361 --
NM_005311chr742137 2111 1811 61 12468 1697 --
NM_005313chr15----1196 --
NM_005316chr111446 1871 ----
NM_005327chr41210 ----2729 113
NM_005328chr81728 ------
NM_005329chr161106 11512 ----
NM_005339chr484122 4032 3787 3779 3067 1736 982 961 12843 --23440 2995
NM_005359chr1876497 5667 5334 4531 1932 1108 615 15590 16297 --
NM_005376chr121137 61 ------
NM_005382chr82417 167 ------
NM_005385chr351914 972 718 358 298 12760 2596 74 11875
NM_005397chr743872 2869 2819 1443 --12639 --
NM_005399chr153704 3334 1090 468 69 --11566 --
NM_005409chr43756 300 194 21053 60 ----
NM_005410chr5135 --1327 --
NM_005415chr21792 --1606 --
NM_005433chr1821735 446 ------
NM_005436chr1054101 4045 3737 3701 179 11027 --13782
NM_005443chr42140 63 ------
NM_005450chr171226 ------
NM_005455chr131732 1606 1151 ------
NM_005456chr11----1180 --
NM_005461chr2041934 1769 769 589 ------
NM_005465chr12448 189 ----1221
NM_005475chr1222961 134 12101 --1710
NM_005477chr1552338 1010 958 909 731 1652 1646 --
NM_005477chr1552338 1010 958 909 731 1652 1646 --
NM_005487chr2232030 1652 1617 1425 ----
NM_005493chr61141 1666 ----
NM_005497chr17136169 6006 5435 4536 4157 2112 1271 1258 804 565 558 291 37 --13970 --
NM_005499chr193586 532 42 ------
NM_005501chr1711213 ------
NM_005504chr12106617 5801 5662 4924 4243 2573 2065 1228 911 321 --25107 1260 --
NM_005509chr521570 554 ------
NM_005517chr1148 ----1924
NM_005520chr51203 1597 --1197
NM_005522chr731089 942 99 ------
NM_005524chr31339 ------
NM_005537chr131840 11105 ----
NM_005542chr761794 1226 742 650 361 151 --1733 --
NM_005562chr121516 1092 ------
NM_005570chr1821125 985 2385 89 11160 --
NM_005578chr351497 1126 1069 374 94 15168 --11553
NM_005595chr11631 ------
NM_005596chr975702 5425 4726 4143 1002 759 695 22444 140 11241 --
NM_005599chr121442 1336 1591 ----
NM_005600chr12198 21 ------
NM_005604chr642461 1839 845 546 12271 ----
NM_005607chr81692 1160 ----
NM_005611chr1621126 834 ----11000
NM_005637chr183808 702 666 ------
NM_005638chrX51726 1515 1320 322 105 --1179 11118
NM_005647chrX83264 3063 2526 2299 2288 1197 486 146 ------
NM_005650chr2221322 364 ------
NM_005665chr144400 1712 1483 155 24709 3604 1527 --
NM_005667chr2189 195 ----
NM_005668chr574447 4323 4251 4058 1685 427 236 1491 --11845
NM_005669chr531776 952 589 ----12004
NM_005711chr52848 776 1162 ----
NM_005715chr632519 2312 2193 12558 12472 --
NM_005717chr121195 387 1285 ----
NM_005722chr222343 325 1190 --12460
NM_005725chr151911 1820 1558 573 386 ------
NM_005730chr1253058 2818 2469 963 702 ------
NM_005734chr111251 ------
NM_005738chr741896 1474 685 602 ------
NM_005744chr15--1151 ----
NM_005746chr732776 2717 422 12112 --12328
NM_005748chr1233178 3065 285 --11062 --
NM_005749chr171721 1581 ----
NM_005759chr234516 4297 1313 1171 24680 3489 --
NM_005768chr121715 ------
NM_005779chr583275 3108 2776 953 766 315 182 59 23047 2405 ----
NM_005789chr1732083 1536 35 1135 --11872
NM_005798chr1395054 4749 3334 2075 1855 1555 1144 888 23 24981 718 11416 --
NM_005801chr172762 186 ------
NM_005802chr91655 --175 --
NM_005807chr11697 --1105 --
NM_005808chr343118 2733 694 470 ------
NM_005810chr122911 759 --1924 --
NM_005813chr262368 2036 2024 1706 1618 1058 1759 ----
NM_005819chr122663 536 23107 1175 ----
NM_005828chr1764383 1715 1469 1038 931 629 24532 4335 24363 1327 --
NM_005840chrX55872 5212 2355 1826 209 11912 ----
NM_005843chr241622 1260 1231 189 1531 11681 --
NM_005853chr162132 125 1403 ----
NM_005859chr541472 1414 1084 179 ------
NM_005862chr331096 1062 877 ------
NM_005863chr10159 ------
NM_005871chr1011066 1990 ----
NM_005875chr3----1266 --
NM_005880chr1631410 303 117 ------
NM_005896chr23144 127 49 ------
NM_005898chr1132634 2097 783 ----12279
NM_005899chr171225 ------
NM_005900chr451064 970 958 378 210 ------
NM_005901chr1868689 8518 8169 6632 2191 1790 --48046 2704 1245 923 21490 1353
NM_005903chr551784 1682 1088 869 427 --14241 --
NM_005905chr13------1445
NM_005906chr621674 1316 ----11648
NM_005909chr593289 2978 2677 1461 1102 1008 697 547 166 11532 24121 3454 1581
NM_005911chr2------11473
NM_005917chr2----1161 --
NM_005920chr143441 2832 2743 841 ------
NM_005935chr453494 1762 988 354 286 ------
NM_005941chr843752 3077 1059 573 2478 364 ----
NM_005955chr144853 4158 2139 2094 --25023 4686 --
NM_005962chr1022045 90 --1505 --
NM_005962chr1022045 90 --1505 --
NM_005964chr1711201 ------
NM_005966chr262122 2067 1814 1546 442 145 1363 1382 1540
NM_005967chr121510 ------
NM_005977chr132993 895 ------
NM_005996chr1221347 557 ------
NM_005998chr11147 ------
NM_005999chr121220 538 ------
NM_006007chr924132 1348 --21671 424 24248 3295
NM_006015chr121078 904 --1105 --
NM_006016chr622020 840 ----1349
NM_006024chr72170 30 ------
NM_006035chr1451325 1252 492 384 158 ------
NM_006036chr22150 51 --1318 --
NM_006037chr284425 4395 3979 3945 3389 776 446 425 1726 ----
NM_006040chr1631253 1011 528 --11172 --
NM_006047chr2043219 3085 2465 294 ----1803
NM_006048chr131174 873 282 ------
NM_006060chr734049 3541 1692 1318 13674 --
NM_006080chr722532 2404 22318 381 ----
NM_006089chrX31897 661 82 --2303 215 --
NM_006090chr11694 ------
NM_006094chr811900 --1736 21792 568
NM_006095chr444237 4179 1373 596 23512 1588 3338 87 69 --
NM_006100chr3--167 ----
NM_006106chr1142110 1120 1062 85 11081 11100 --
NM_006136chr71268 2410 212 1206 1994
NM_006139chr232167 1941 566 ------
NM_006141chr1642144 825 371 97 1364 ----
NM_006153chr31266 ------
NM_006160chr171532 ----11640
NM_006166chr1231658 314 45 3869 754 549 ----
NM_006180chr921318 401 ------
NM_006186chr23958 304 96 ----1294
NM_006190chr21944 ------
NM_006194chr1431226 927 330 11039 --11347
NM_006196chr21109 --1300 --
NM_006197chr831958 618 453 1152 ----
NM_006203chr563888 1862 1482 1092 320 171 --24991 4057 --
NM_006209chr82434 26 ------
NM_006210chr1921140 179 --1425 --
NM_006224chr1731908 616 340 --1743 12555
NM_006237chr1332247 1506 925 --11931 --
NM_006242chr2021534 874 1193 --11426
NM_006246chr142266 73 11257 ----
NM_006251chr51925 --22697 471 --
NM_006252chr1147378 6773 6539 6462 5713 5656 5571 5222 4669 4647 2222 1303 1222 379 22054 1738 25508 4948 --
NM_006256chr162338 2063 793 512 286 218 22108 230 11914 --
NM_006265chr831470 1308 1033 ----1386
NM_006266chr91117 ------
NM_006268chr111240 ------
NM_006275chr2032431 939 620 ------
NM_006282chr2074619 4168 1719 1398 1287 669 438 ----14498
NM_006283chr883813 3489 3081 930 870 690 441 198 13845 ----
NM_006292chr11191 ------
NM_006293chr15----1209 --
NM_006300chr1912356 ------
NM_006313chr1221687 212 21486 93 ----
NM_006315chr494545 4400 4369 4342 3837 3620 3325 1746 203 --1356 --
NM_006322chr131596 ------
NM_006325chr12132 ----1172
NM_006328chr111670 ------
NM_006330chr831042 402 76 ------
NM_006350chr5150 ------
NM_006352chr131522 394 86 --11816 177
NM_006353chr621442 506 ------
NM_006357chr21450 ------
NM_006359chrX--1867 12431 12127
NM_006364chr1431153 1038 281 --1883 --
NM_006371chr364545 4375 3744 1275 766 641 24684 3965 ----
NM_006375chrX51688 1519 1417 768 741 ------
NM_006380chr1753079 2763 1479 941 217 24113 344 ----
NM_006386chr221889 12077 21813 212 1798
NM_006393chr10104464 4385 4322 4183 3217 3107 3006 2783 1432 661 --1507 --
NM_006409chr71242 ------
NM_006411chr64997 891 650 216 ------
NM_006420chr2073066 2859 2162 719 629 226 158 1520 ----
NM_006425chr52561 245 ------
NM_006431chr12135 ------
NM_006434chr1032962 2666 2115 --1885 1477
NM_006451chr52210 24 --138 11060
NM_006457chr433032 1555 503 23617 151 ----
NM_006459chr1031473 1462 199 21974 259 --11319
NM_006467chr531911 1580 154 ------
NM_006469chr131483 622 615 ------
NM_006482chr1222676 2588 ------
NM_006489chr1421392 581 1294 ----
NM_006496chr131958 1630 1318 ------
NM_006504chr1052804 2776 1884 1047 502 22011 570 ----
NM_006526chr2022089 492 --11537 --
NM_006529chr421652 1320 ------
NM_006534chr2043311 3299 2527 2457 --12250 --
NM_006537chr15153 ------
NM_006538chr254074 3829 1278 476 75 12567 23121 759 --
NM_006544chr14115952 5908 5531 5382 5188 4909 2439 1268 964 689 438 24892 854 14551 14575
NM_006546chr1776613 6395 5369 4637 2524 1784 912 15439 15884 14772
NM_006547chr72474 288 ------
NM_006559chr131236 1222 1176 ------
NM_006561chr10155460 5233 5212 5072 4682 4471 4291 4241 3909 2208 1872 1821 1720 852 472 ------
NM_006572chr1753409 2991 2490 2181 619 1768 181 --
NM_006577chr21523 11178 ----
NM_006584chr17----1112 --
NM_006599chr16128145 6791 6355 5423 2984 2657 2374 1900 1356 1204 827 515 26544 786 --1309
NM_006603chrX41468 678 214 157 11245 12025 --
NM_006609chr282663 2504 2183 1925 1911 1840 888 475 12121 ----
NM_006614chr352608 2567 1115 628 385 ----1511
NM_006618chr121560 1149 ------
NM_006620chr644206 3485 3098 352 34607 559 205 14520 --
NM_006622chr51214 ------
NM_006624chr10--3651 342 150 ----
NM_006628chr1574216 3935 3189 2840 1718 1106 867 2425 176 --13286
NM_006654chr1251926 1431 1019 850 718 14745 ----
NM_006660chr151246 ----174
NM_006670chr6----1612 --
NM_006699chr12821 306 1647 2779 618 --
NM_006706chr51138 1802 1829 --
NM_006711chr16153 ------
NM_006713chr52742 309 ------
NM_006717chr952742 2170 1197 494 214 22216 536 --184
NM_006720chr1043968 3279 1781 134 14377 --14419
NM_006722chr351979 1125 734 707 524 2673 378 ----
NM_006726chr431169 248 149 ------
NM_006729chrX84828 4569 4080 3513 2235 1793 1228 624 21364 690 11906 --
NM_006731chr9105821 5228 5044 4475 4148 3798 1644 1505 1186 1035 1474 45723 4579 1195 852 13722
NM_006734chr6----183 --
NM_006735chr7181 ------
NM_006738chr1544524 4287 3560 1663 --21564 478 11677
NM_006745chr42861 221 1949 ----
NM_006746chrX21551 610 --1162 --
NM_006749chr81965 ------
NM_006751chr22777 122 ------
NM_006766chr822035 1840 ------
NM_006775chr632774 2322 2195 11142 12105 --
NM_006777chrX32266 2038 640 ----1295
NM_006803chr831844 1671 27 12101 --11329
NM_006805chr51394 ------
NM_006807chr1721348 1074 ------
NM_006808chr91155 ------
NM_006813chr61648 1122 ----
NM_006815chr121325 --21258 397 --
NM_006822chr173693 604 505 ------
NM_006823chr8--1391 ----
NM_006826chr241232 1092 878 127 1824 ----
NM_006827chr1442394 1153 1107 234 ----13260
NM_006832chr143940 848 756 ------
NM_006851chr1222550 908 12313 12053 --
NM_006856chr121984 1896 ----
NM_006857chr21334 ------
NM_006861chr1241447 284 87 81 11355 ----
NM_006873chr273103 2892 2775 2764 2314 1361 143 21203 894 ----
NM_006874chr431012 987 783 1771 ----
NM_006885chr1644046 3668 565 423 11648 --13475
NM_006888chr1493062 2493 2409 2168 1351 1092 854 309 218 --1825 --
NM_006889chr351579 1381 1000 969 551 --1450 --
NM_006892chr2041421 1378 950 314 1422 ----
NM_006892chr2041421 1378 950 314 1422 ----
NM_006910chr161265 ------
NM_006912chr132551 2485 403 11789 ----
NM_006914chr921331 147 ------
NM_006915chrX4778 294 241 120 ------
NM_006922chr262125 1737 888 613 563 408 11879 --12067
NM_006924chr1744403 3661 1218 45 23988 3170 ----
NM_006925chr14--1365 ----
NM_006930chr541649 1324 522 70 ------
NM_006938chr183790 190 74 1302 ----
NM_006939chr1421202 755 ------
NM_006948chr2142492 2138 2120 1899 ------
NM_006951chr102789 762 ------
NM_006965chr181255 1415 --1755
NM_006988chr211293 ------
NM_006996chr121829 189 --11207 --
NM_007005chr921450 1232 1128 ----
NM_007007chr1284762 4478 4364 4319 3133 1620 75 41 ----23420 1149
NM_007008chr23374 306 105 ------
NM_007011chr1576318 6225 5171 1965 1365 836 262 --22629 1062 11119
NM_007033chr141760 1713 505 41 --11443 --
NM_007034chr12836 64 1760 ----
NM_007038chr2155659 4983 3978 1663 76 24783 821 14479 13768
NM_007050chr2087810 6843 6068 5901 1860 1696 933 677 --36721 2150 514 15621
NM_007054chr573886 3873 3587 2539 660 586 161 13802 1287 --
NM_007067chr1711444 ------
NM_007078chr1042409 2369 2052 792 ----1717
NM_007084chr131363 11569 ----
NM_007087chr161766 122 ----
NM_007114chr342807 2513 1296 651 ------
NM_007146chr1721024 997 1206 ----
NM_007150chrX41969 1644 550 66 1326 ----
NM_007158chr121196 133 ------
NM_007159chr351368 1344 1231 1188 447 ------
NM_007166chr1131131 516 171 11257 1196 --
NM_007173chr112561 219 ------
NM_007175chr843529 2875 2737 1105 --1208 --
NM_007192chr142987 952 ------
NM_007195chr1843550 2446 2376 1052 ------
NM_007200chr1544524 4287 3560 1663 --21564 478 11677
NM_007207chr12321 307 ------
NM_007212chr142155 1415 748 133 ------
NM_007217chr31391 ------
NM_007222chr8----11232 21174 356
NM_007236chr1552019 1826 583 473 387 --128 1292
NM_007246chr421002 258 1786 ----
NM_007249chr1379030 8691 8467 7184 5833 3030 2739 29323 7221 39197 8952 2133 --
NM_007279chr192595 536 ------
NM_007315chr241460 514 474 36 ------
NM_007317chr16_random164 ------
NM_007347chr1522054 367 ------
NM_007350chr1264103 3580 1290 1260 1076 98 33819 612 504 ----
NM_007358chr141981 789 323 73 ------
NM_007361chr14132 1220 ----
NM_007375chr122358 2235 12721 ----
NM_012062chr124349 304 249 235 ------
NM_012081chr521239 280 --23409 3077 --
NM_012082chr81786 ----1810
NM_012096chr342643 1470 946 44 1435 ----
NM_012124chr111153 ------
NM_012129chr772427 2247 2043 2024 1715 869 406 ------
NM_012134chr111455 --11540 --
NM_012137chr142903 2714 2674 985 11069 11990 --
NM_012153chr111223 1515 ----
NM_012154chr8----1293 1734
NM_012158chr1331433 1245 1140 --1272 1280
NM_012164chr997244 6476 5687 5101 4634 2938 2759 2686 543 --1506 11050
NM_012193chr1154361 3776 1211 1183 97 --24245 958 12018
NM_012199chr143873 3783 1322 565 11226 ----
NM_012207chr102824 46 2960 843 ----
NM_012214chr264626 4297 2310 1205 525 107 16409 11582 1788
NM_012215chr1021670 405 1500 ----
NM_012218chr1942352 1936 410 311 ------
NM_012234chr373258 3077 3032 2456 632 462 426 --33513 3125 1018 --
NM_012243chr1--3253 136 87 ----
NM_012249chr233244 3140 3053 1262 ----
NM_012250chr1121357 297 --167 --
NM_012252chr774902 4278 4210 937 694 417 372 --13617 --
NM_012255chr20144 ------
NM_012259chr621390 910 ------
NM_012262chr154825 4118 3457 1473 761 1284 176 --
NM_012266chr91257 ------
NM_012281chr72512 187 11575 11958 --
NM_012286chrX2124 61 1541 ----
NM_012297chr452298 2252 1966 1605 922 12559 ----
NM_012300chr5138 12289 --1794
NM_012301chr731765 1610 754 21478 298 21735 780 11584
NM_012302chr11481 11239 1326 --
NM_012307chr183766 363 279 1380 ----
NM_012309chr1174584 3813 1979 1749 1711 207 87 11691 ----
NM_012327chr1831499 1246 995 ------
NM_012328chr721080 311 ------
NM_012333chr11547 1275 1318 --
NM_012334chr574544 3765 1291 1166 833 717 213 11829 34162 688 205 --
NM_012341chr102422 396 ------
NM_012345chr1341788 1526 1436 1285 ----11192
NM_012399chr2251963 1952 1792 1358 702 --1515 --
NM_012402chr1121110 141 ----1533
NM_012412chr7----1812 --
NM_012416chr911077 --1112 --
NM_012419chr61655 --195 --
NM_012420chr1032286 2016 527 ------
NM_012426chr161359 ------
NM_012454chr61220 ------
NM_012464chr411791 --22759 2269 1311
NM_012479chr742702 716 541 47 12631 21734 589 --
NM_012482chr11139 ------
NM_013227chr151248 ------
NM_013229chr1232143 511 217 ------
NM_013230chrY21590 373 ------
NM_013231chr1433677 1239 208 1739 13336 1767
NM_013232chr51407 ------
NM_013244chr12125 ------
NM_013252chr742119 833 271 188 ----21848 485
NM_013253chr111235 11260 1192 --
NM_013255chr7127577 7395 7109 6802 6134 5988 5798 2773 2571 2083 1739 1718 16019 26298 312 --
NM_013257chr831596 310 40 11993 ----
NM_013261chr422598 2592 13464 ----
NM_013264chr11137 ------
NM_013286chr353792 1424 739 660 523 --1470 13242
NM_013293chr73753 605 595 ------
NM_013322chr711613 21415 1266 ----
NM_013341chr232824 2698 2635 ------
NM_013352chr63905 287 47 1853 ----
NM_013372chr1563302 2625 2237 1169 971 208 11155 --1524
NM_013374chr352999 2712 2646 2594 546 --12362 --
NM_013377chr12150 1118 ----
NM_013390chr92508 108 2703 396 ----
NM_013437chr81180 21241 90 ----
NM_013438chr911709 --1297 --
NM_013448chr142521 183 ------
NM_013449chr1252589 2507 2180 1098 576 --12387 --
NM_013995chrX----12363 --
NM_014007chr921236 1224 ------
NM_014008chrX----1198 1265
NM_014010chr92433 406 ------
NM_014011chr272600 2535 2427 2383 738 550 247 --11706 1775
NM_014016chr321240 388 11401 2644 536 --
NM_014021chr162976 2937 2741 1301 1117 368 --23158 2481 --
NM_014023chr1072730 2668 2594 2450 1973 652 554 11961 ----
NM_014028chr652670 2048 1182 1010 505 ------
NM_014030chr172781 432 ------
NM_014034chr63383 342 129 ------
NM_014038chr71404 ------
NM_014043chr341484 1415 1088 198 --1298 --
NM_014048chr1684483 4116 1967 1854 1748 1625 597 66 25024 1764 --1199
NM_014055chr122441 211 --1453 --
NM_014089chr13156 22200 1667 ----
NM_014106chr1542464 2009 1045 866 ------
NM_014110chr13871 773 452 ------
NM_014117chr1652445 1071 947 905 728 --12485 --
NM_014141chr764929 3296 1685 922 754 554 21281 255 14978 --
NM_014154chr321534 1196 2528 406 --11524
NM_014155chr1145255 5092 1069 294 11953 ----
NM_014157chr1633022 861 428 23745 3677 1417 --
NM_014178chr142555 59 ------
NM_014189chr4--11419 ----
NM_014190chr4--11771 ----
NM_014203chr19163 ------
NM_014241chr10--1332 ----
NM_014243chr422021 1962 ------
NM_014245chr331083 344 170 ----1418
NM_014248chr221118 ------
NM_014250chr2232030 1652 1617 1425 ----
NM_014253chrX52233 1768 1716 354 259 ------
NM_014263chr103452 155 65 ------
NM_014279chr9----1670 --
NM_014283chr12602 183 1978 160 1523
NM_014294chr82965 225 --197 11306
NM_014296chr311222 11058 ----
NM_014300chr151137 ------
NM_014309chr2265177 4490 1605 1587 1245 475 11066 14236 --
NM_014315chr141164 ------
NM_014319chr1241638 1373 610 205 --11579 --
NM_014325chr1221499 856 ------
NM_014333chr111508 ------
NM_014344chr111767 1909 ----
NM_014363chr1351100 974 429 307 291 ------
NM_014372chr131956 1501 1297 --1593 --
NM_014381chr1493257 3125 3043 2037 472 415 352 297 149 ------
NM_014382chr311208 1306 11513 145
NM_014392chr431223 1100 1079 ------
NM_014394chr103966 449 99 ------
NM_014415chr32326 96 11653 11391 --
NM_014418chr1411370 --21807 1348 --
NM_014423chr555469 4612 4272 2233 2014 55635 4430 1614 1362 345 ----
NM_014445chr321567 344 1324 11859 --
NM_014456chr1041741 1230 1208 21 ------
NM_014469chr112253 185 ------
NM_014482chr21129 ------
NM_014494chr1651589 962 634 595 149 1540 ----
NM_014504chr731827 700 386 1512 ----
NM_014507chr221902 ------
NM_014517chr321689 385 ------
NM_014547chr15--1224 ----
NM_014547chr15--1224 ----
NM_014554chr1222161 1810 1890 ----
NM_014572chr1321640 1566 --1256 11758
NM_014574chr1421382 1357 31089 1056 292 ----
NM_014575chr31455 ------
NM_014584chr1431320 176 87 1239 11594 --
NM_014585chr221085 368 11191 --1226
NM_014588chr20197 ------
NM_014612chr92491 341 1275 ----
NM_014614chr241317 1239 572 147 11484 1331 --
NM_014615chr1663071 2931 1218 437 409 233 --13515 --
NM_014616chr333487 3089 2572 12760 22300 290 1926
NM_014620chr121625 --1676 --
NM_014630chr1533529 3332 494 --13223 13101
NM_014635chr231625 1599 1488 --11258 11343
NM_014636chr954279 4081 1556 1412 1105 ------
NM_014637chr81260 --1389 --
NM_014647chr161728 ------
NM_014655chr142031 1666 1461 804 1826 ----
NM_014660chr711003 ------
NM_014667chr331564 910 763 ------
NM_014670chr22342 237 ------
NM_014671chr731372 1088 271 ------
NM_014674chr362504 1562 1395 1233 780 692 1805 13229 174
NM_014676chr141346 1227 622 607 195 ----
NM_014677chr82856 291 --21341 1297 --
NM_014679chr1121252 287 ------
NM_014682chr831795 1739 362 ------
NM_014683chr1731667 431 254 ------
NM_014686chr1912255 ------
NM_014699chr161348 1374 ----
NM_014701chr1523408 1308 12893 ----
NM_014702chr651186 1106 934 746 127 23322 682 ----
NM_014705chr7--21315 296 ----
NM_014707chr772088 1511 832 465 443 343 312 11681 152 1353
NM_014709chr22424 93 ------
NM_014711chr164816 793 240 127 ------
NM_014721chr677465 7160 7144 6822 2398 1793 1499 22362 643 11299 12991
NM_014729chr811722 12122 22014 499 11789
NM_014735chrX52087 1444 859 164 144 ------
NM_014743chr432658 2407 2277 ------
NM_014747chr155829 4938 4830 1095 77 11433 ----
NM_014751chr832102 857 427 ------
NM_014752chr1141218 257 205 137 11981 ----
NM_014755chr244262 3262 2842 1678 23914 2697 1576 --
NM_014756chr112376 39 165 ----
NM_014762chr122367 2163 ------
NM_014764chr122524 503 --199 --
NM_014765chr152669 2518 2069 560 327 ------
NM_014787chr122844 2611 12216 12759 11945
NM_014800chr731107 944 803 11039 ----
NM_014810chr183024 2826 2369 1115 510 431 398 308 1336 ----
NM_014812chr121868 1813 --11341 --
NM_014819chr51125 22425 848 ----
NM_014820chr33557 187 40 ------
NM_014822chr42274 225 ------
NM_014827chr161411 1364 1219 1134 334 98 --1477 --
NM_014828chr1452469 1711 767 689 251 1638 --12266
NM_014829chr532200 2078 36 --168 21798 1515
NM_014830chr1222821 325 ------
NM_014832chr1341795 1630 713 656 ----11896
NM_014839chr112091 ------
NM_014841chr6------11351
NM_014848chr1552663 2461 2061 1779 137 --1902 --
NM_014859chr1711379 11109 --1431
NM_014860chr242628 1633 431 181 ------
NM_014869chr321463 325 ------
NM_014872chr952271 2093 2085 1496 664 --2908 117 --
NM_014873chr174486 3818 1699 1280 1098 1019 383 --2526 503 24355 1000
NM_014877chr1777687 7528 5409 2236 1975 1624 1579 15437 15695 --
NM_014883chr421910 46 1981 --1812
NM_014893chrY22293 687 ------
NM_014903chr1262315 2192 1904 1753 337 197 1153 --1851
NM_014904chr1043783 2606 2492 387 23755 1364 1447 --
NM_014905chr221694 754 1438 1365 11551
NM_014906chr1743499 2641 1255 192 13197 ----
NM_014912chr1033369 2707 2242 ------
NM_014917chr1----1911 --
NM_014918chr1521243 73 ------
NM_014923chr1321550 1466 21790 435 1649 --
NM_014932chr331551 1276 403 1530 ----
NM_014939chr1871364 1213 1088 1036 475 388 40 21390 290 ----
NM_014946chr263043 1121 748 559 482 96 12402 22805 656 --
NM_014947chr163001 2752 2332 436 394 275 --21151 338 --
NM_014950chr141499 11407 ----
NM_014962chr2052564 2117 853 678 300 12665 --1786
NM_014964chr172658 625 ------
NM_014969chr14345 240 225 183 --121 --
NM_014974chr1021518 236 ------
NM_014982chr1465106 4189 3568 3512 2023 832 35063 588 476 ----
NM_014989chr641633 1543 1330 605 ------
NM_014997chr732566 2264 810 12343 21895 161 11966
NM_015000chr1252988 2079 728 631 436 1653 ----
NM_015001chr11978 ------
NM_015002chr123684 656 270 1150 ----
NM_015008chr322291 979 13108 --11041
NM_015017chr11435 11183 ----
NM_015018chr6--1178 ----
NM_015023chr111334 ------
NM_015025chr242455 2269 1961 945 ------
NM_015026chr1283683 3590 3047 1544 883 762 377 303 138 ----
NM_015039chr174125 1641 1543 1334 838 561 202 13069 13998 --
NM_015040chr253181 3161 2733 2217 817 ------
NM_015044chr1642825 1972 1207 473 --22781 763 1899
NM_015045chr1052221 1870 804 732 278 ------
NM_015046chr932489 394 255 ------
NM_015051chr933368 2181 1187 ----12275
NM_015054chr12----1157 --
NM_015061chr91209 1810 ----
NM_015068chr743012 2422 309 284 23458 3088 13161 --
NM_015076chr653299 1795 1724 819 785 1578 13906 --
NM_015080chr111924 ------
NM_015082chr522026 1759 ------
NM_015091chr141747 ------
NM_015093chr631765 656 56 11189 ----
NM_015097chr341710 1689 1656 115 1375 1173 1383
NM_015100chr111847 ----12051
NM_015115chr452833 2806 2559 200 43 ------
NM_015138chr1542766 1845 675 385 1574 3848 664 534 --
NM_015144chr1673095 2790 2649 1208 743 682 75 ------
NM_015149chr161982 1626 1463 766 711 421 11356 ----
NM_015153chr61501 ------
NM_015155chr1032520 1098 678 1246 ----
NM_015156chr1452690 1199 1105 391 350 12679 ----
NM_015162chr152107 22 --182 1219
NM_015176chr11336 1360 ----
NM_015184chr3131 --1137 --
NM_015191chr1162565 1094 968 942 870 835 ----12663
NM_015192chr2032462 770 532 ------
NM_015200chr42460 358 31902 724 322 12023 --
NM_015206chr1532683 2659 1538 33199 2851 2482 --12467
NM_015208chr1853465 1359 839 476 194 22971 2481 1454 13374
NM_015209chr122165 733 ------
NM_015213chr112616 168 ------
NM_015215chr133018 1009 147 1719 ----
NM_015233chr1362685 808 767 449 309 47 1200 ----
NM_015238chr52708 619 ------
NM_015239chr92130 86 ------
NM_015247chr1675039 4779 4009 3964 3508 545 453 2324 235 ----
NM_015264chr2254421 4018 3584 1362 352 --24590 511 --
NM_015271chr444238 3066 1554 232 ----11280
NM_015272chr162585 282 ------
NM_015275chr121628 ------
NM_015282chr262676 2168 2161 649 303 203 1729 --21027 545
NM_015294chr1721123 283 1169 1163 --
NM_015308chr113851 274 69 --1752 --
NM_015310chr8158094 7913 7566 6027 5780 5074 2595 2547 2388 1871 1547 1392 1192 842 98 --32143 810 301 --
NM_015313chr1134627 1708 1523 ------
NM_015314chr732420 2167 2130 11014 ----
NM_015317chr262735 2367 1769 1044 795 394 --22575 385 --
NM_015326chr162581 1889 921 558 521 437 ------
NM_015328chr742634 1253 1041 679 --12407 11175
NM_015336chr123668 353 136 --1403 --
NM_015338chr2021890 387 ------
NM_015344chr821610 812 ------
NM_015349chr612400 --12977 21079 238
NM_015355chr17------11957
NM_015358chr211837 1439 ----
NM_015359chr842110 1816 505 196 12431 ----
NM_015361chr21821 ------
NM_015365chrX73580 3538 3202 2954 1384 427 74 ------
NM_015384chr5--1133 133 --
NM_015385chr1032962 2666 2115 --1885 1477
NM_015387chr251988 1981 1516 406 260 ------
NM_015393chr463152 3091 2832 1324 1185 1062 12802 --13120
NM_015396chr321160 512 --1133 --
NM_015397chr941480 582 132 49 21302 604 ----
NM_015415chr12168 59 ------
NM_015435chr831323 1004 590 1421 ----
NM_015436chr463040 2792 1353 719 385 245 13193 ----
NM_015439chr6148 --1404 --
NM_015443chr171105 --1368 --
NM_015455chr533454 2736 1250 ------
NM_015458chr8125087 5052 4816 4562 4278 3337 3262 1559 1300 1276 1183 1087 14604 11601 --
NM_015472chr32439 83 ----1144
NM_015472chr32439 83 ----1144
NM_015475chr21351 ------
NM_015477chr152711 285 ------
NM_015483chr71419 ------
NM_015497chr15166 1340 ----
NM_015530chr21697 ------
NM_015532chr1522162 143 1183 --1448
NM_015534chr14960 898 386 75 --1372 --
NM_015548chr61296 2221 108 ----
NM_015550chr763333 2604 1188 938 921 141 2522 441 1905 23392 887
NM_015553chr633602 1835 1107 ----14422
NM_015554chr1552175 1060 773 284 272 ----12809
NM_015555chr631213 377 250 ------
NM_015556chr14--1235 ----
NM_015569chr154484 1502 887 593 122 14002 11231 --
NM_015575chr253253 2633 2577 1439 528 1419 ----
NM_015576chr342516 2331 1949 28 1844 ----
NM_015578chr1931757 1544 69 ------
NM_015601chr101867 --126 --
NM_015602chr131329 619 193 ------
NM_015634chr101111 ------
NM_015635chr912218 --1697 --
NM_015640chr165251 4276 4250 3637 1472 200 13256 24219 3992 1343
NM_015646chr121157 ------
NM_015652chr101252 ------
NM_015660chr71246 ------
NM_015678chr13--1350 ----
NM_015686chrX11772 ------
NM_015695chr641884 1848 522 156 11513 ----
NM_015713chr842826 2607 1362 52 21327 268 ----
NM_015723chr71572 ------
NM_015833chr2131930 605 333 --32102 1691 783 --
NM_015859chr14162 ------
NM_015866chr1--1993 ----
NM_015878chr82339 224 1484 ----
NM_015881chr111235 11260 1192 --
NM_015886chr895366 5358 5341 3558 1803 1716 1259 1167 681 11076 14948 13492
NM_015888chr172830 1189 1008 993 966 431 102 ------
NM_015906chr184651 4156 3693 3606 895 879 671 207 --23936 3769 --
NM_015920chr152557 152 ------
NM_015955chr21194 ------
NM_015976chr11362 ------
NM_015982chr172332 53 ------
NM_015990chr42961 886 11003 ----
NM_016009chr183807 3346 3210 1932 1703 1619 1284 426 14417 --11558
NM_016018chr822520 876 --12481 --
NM_016019chr71227 ------
NM_016023chr831412 396 114 12012 ----
NM_016037chr121121 201 ----1126
NM_016039chr141169 ------
NM_016040chr13813 611 412 1725 1336 --
NM_016072chr1262140 2046 2034 2027 1554 713 22242 120 ----
NM_016073chr1531030 955 125 ------
NM_016076chr131072 727 124 12090 11226 --
NM_016083chr673068 1199 1012 864 166 146 68 1291 ----
NM_016087chr721639 1152 ------
NM_016096chr812212 11418 ----
NM_016103chr51462 ------
NM_016120chrX21216 156 --1386 --
NM_016129chr4157 ------
NM_016131chr232093 1932 1644 1860 ----
NM_016132chr1553418 1340 798 311 203 12351 --1217
NM_016156chr1162358 2201 2045 1671 377 146 --12142 --
NM_016166chr151180 ------
NM_016201chr34928 734 639 560 ------
NM_016227chr12602 183 1978 160 1523
NM_016230chr62119 36 ------
NM_016234chr103745 663 392 --1269 --
NM_016248chr1343102 2653 749 505 33158 426 269 ----
NM_016252chr2------1139
NM_016258chr12738 227 ----1132
NM_016260chr277606 7234 6971 2879 2804 1380 1358 26425 804 ----
NM_016269chr411146 --1852 --
NM_016271chr1862306 2193 2021 1539 941 689 31891 1843 1795 1863 11761
NM_016272chr2232767 1075 380 12730 22114 1842 --
NM_016275chr342278 2132 1090 477 1424 2519 510 --
NM_016287chr111560 --1149 --
NM_016297chr213531 --12416 13480
NM_016300chr31532 ------
NM_016302chr32584 143 --1207 --
NM_016322chr942219 2176 757 426 ----1142
NM_016357chr1241225 1051 506 441 21237 853 ----
NM_016377chr621766 62 1420 11702 --
NM_016395chr1531520 57 32 --1280 --
NM_016396chr1541179 1069 661 301 --1270 --
NM_016401chr11--1105 ----
NM_016410chr9--1122 --1231
NM_016422chr1143237 3223 653 469 22316 415 ----
NM_016423chr141315 ------
NM_016424chr171548 ------
NM_016436chr202364 330 ----11687
NM_016448chr141768 1329 584 269 ------
NM_016462chr61451 ------
NM_016467chr221339 432 ------
NM_016485chr652258 865 702 176 86 1567 ----
NM_016507chr1752807 1238 748 653 342 --13179 --
NM_016516chr2------1766
NM_016525chr94918 854 293 143 ----1692
NM_016529chr132139 43 ------
NM_016530chr1563204 3048 2899 2853 1211 632 12664 ----
NM_016542chrX31561 1341 1255 --11541 --
NM_016545chr13828 769 690 ------
NM_016559chr32575 159 ------
NM_016569chr1221347 557 ------
NM_016588chr61902 ------
NM_016607chrX197 --1401 --
NM_016612chr81686 ------
NM_016620chr12169 29 --1943 --
NM_016623chr8166 ------
NM_016626chr1851572 1290 445 378 244 --1564 --
NM_016631chr213934 785 189 ------
NM_016644chr51490 ------
NM_016824chr101643 21245 705 ----
NM_016936chr1651661 1645 857 669 569 ------
NM_016946chr143553 2760 2209 1056 ------
NM_016950chr411512 --1230 --
NM_016953chr235790 5264 5036 26158 5343 1994 --
NM_017415chr553346 3229 1557 1191 733 --31573 512 379 1994
NM_017423chr42347 132 ------
NM_017426chr42449 133 ------
NM_017440chr12----1136 --
NM_017444chr851681 1279 1237 437 418 ------
NM_017447chr2153906 3615 3150 2721 172 --13569 23741 1484
NM_017449chr121444 353 --11658 --
NM_017519chr6--11239 ----
NM_017520chr133218 142 66 ------
NM_017522chr111135 ------
NM_017583chr1121249 169 1709 ----
NM_017599chr1261747 1674 1642 1498 459 91 11596 --11757
NM_017610chr151758 1433 21568 158 --
NM_017626chr1021343 537 ------
NM_017628chr465240 5066 4902 4186 389 113 13871 11080 1299
NM_017629chr131834 1533 348 ------
NM_017633chr632820 2557 2385 --1445 --
NM_017635chr1161200 1190 1103 496 325 82 1166 ----
NM_017637chr9109130 9097 9043 7275 6225 3568 3467 2830 1360 345 --25838 1779 11972
NM_017641chr121382 11076 1465 --
NM_017643chr1741971 949 788 320 12516 1745 12290
NM_017644chr341888 1378 460 269 35149 3290 941 ----
NM_017657chr22364 21 ------
NM_017658chr1463756 3537 1462 1011 772 70 34484 3879 751 14153 --
NM_017666chrX32192 1418 111 ------
NM_017667chr72513 67 ------
NM_017668chr16----127 --
NM_017694chr21799 ------
NM_017703chr19134 ------
NM_017709chr193595 3398 3161 3150 2929 2750 1719 1228 164 ------
NM_017714chr202831 660 1648 ----
NM_017719chr322287 1806 ----12064
NM_017736chr1663014 2742 2208 634 161 91 12044 ----
NM_017737chr121707 635 11914 1764 12071
NM_017741chr432101 1014 447 ------
NM_017744chr12943 783 ------
NM_017745chrX1190 ------
NM_017752chrX71989 1948 1669 600 561 58 33 ------
NM_017753chr94869 803 753 323 ------
NM_017758chr1721450 413 ------
NM_017761chr121501 229 ------
NM_017762chr15--11854 21980 1616 --
NM_017778chr831136 84 44 --1446 --
NM_017780chr81817 ------
NM_017786chr82598 87 ------
NM_017787chr1022842 2577 1399 ----
NM_017811chr962702 2552 2088 1251 358 155 ----13036
NM_017813chr885549 5435 5123 4173 2340 1179 785 288 1553 15326 --
NM_017824chr1032207 2055 1776 --32457 1006 819 --
NM_017825chr12533 382 ------
NM_017830chr42247 92 ------
NM_017845chr42593 585 --1230 --
NM_017848chrX64516 3824 3141 1809 269 240 --13215 13619
NM_017849chr2----11076 --
NM_017857chr112651 615 ------
NM_017864chr8173 ------
NM_017902chr1085639 4499 4470 4330 4271 4066 534 310 1504 1520 --
NM_017915chr1221158 111 2432 193 ----
NM_017919chr954636 2308 1527 1027 982 15314 ----
NM_017938chrX--1820 11787 11525
NM_017944chr1121165 1027 23075 1065 ----
NM_017988chr12137 ------
NM_017994chr722770 1912 --1418 --
NM_017998chr92356 302 ------
NM_018008chr31275 ------
NM_018015chrX61150 1087 1066 919 423 131 1720 ----
NM_018017chr1021879 523 22231 1074 ----
NM_018025chr19------1228
NM_018027chr1043059 2957 2563 2416 13091 1574 --
NM_018030chr181693 ------
NM_018043chr111955 ------
NM_018046chr551947 1795 561 393 236 21495 1408 1108 11231
NM_018062chr21443 ------
NM_018063chr103451 433 293 ------
NM_018070chr11545 --1607 --
NM_018078chr421045 236 ------
NM_018084chr221151 57 --1611 --
NM_018085chr167059 6483 5257 2940 2217 1114 23173 796 15738 12837
NM_018086chr221832 1413 194 11570 --
NM_018121chr1033219 825 494 --12060 --
NM_018126chr471530 1295 1258 1093 355 251 226 ------
NM_018128chr175982 585 450 396 82 ------
NM_018133chr331813 328 49 ------
NM_018144chr101102 ------
NM_018155chr353250 2340 2298 920 306 ------
NM_018157chr1222994 2010 22629 762 --1978
NM_018164chr121219 ------
NM_018171chr121325 1674 ----
NM_018177chr41260 1270 ----
NM_018179chr12--1495 1197 --
NM_018181chr181618 1188 ----
NM_018182chr1751973 1487 513 256 58 ------
NM_018184chr342112 1472 870 123 ------
NM_018200chr1541977 895 558 401 ------
NM_018202chr13679 179 88 1159 1222 --
NM_018227chr453206 2146 902 575 400 1372 1542 --
NM_018237chr101284 ------
NM_018243chr443677 3593 1108 856 13049 ----
NM_018247chr632143 2075 133 --1541 12312
NM_018257chr2062269 2132 1631 979 863 309 --12331 --
NM_018263chr222212 996 3436 355 196 22574 475 11658
NM_018270chr201766 ------
NM_018290chr411114 ------
NM_018293chr341846 273 216 76 11919 1242 --
NM_018299chr833139 2891 70 ------
NM_018307chr17--1742 ----
NM_018312chr112621 567 ------
NM_018313chr342619 469 422 247 1435 ----
NM_018314chr112763 130 ------
NM_018315chr431288 1247 1207 11464 ----
NM_018323chr441608 1229 155 149 1254 ----
NM_018327chr2031635 754 664 ------
NM_018351chr1264676 4135 4061 3919 3027 1020 11250 ----
NM_018359chr4------166
NM_018362chr1153546 2881 1481 471 446 ------
NM_018364chr143980 3184 978 863 14137 ----
NM_018374chr764697 3517 3425 1617 400 110 11463 ----
NM_018393chr111212 ------
NM_018416chr1272665 2337 2287 2241 2133 452 275 --2606 381 --
NM_018429chr542011 1971 1067 38 1487 1726 --
NM_018437chr93504 458 53 ------
NM_018440chr8128726 8601 8217 7189 6543 5547 3202 3078 2137 1070 726 159 38580 7049 5505 --12872
NM_018444chr82348 182 22335 753 21953 453 --
NM_018452chr6_random33673 917 316 11466 ----
NM_018482chr832545 1860 629 32230 2224 730 1492 --
NM_018486chrX2371 77 ------
NM_018490chr1111547 --1138 11361
NM_018566chr1104639 4562 4472 3953 3528 3286 3135 947 924 178 ------
NM_018571chr23676 425 161 ------
NM_018590chr1031636 1453 596 21674 1080 ----
NM_018602chr1531186 1083 221 ------
NM_018638chr12105244 5090 4927 4230 4195 4085 1333 987 782 663 21500 1384 --1252
NM_018640chr123606 519 333 12734 ----
NM_018650chr121820 55 21922 1477 12199 11423
NM_018657chr31733 --1752 --
NM_018682chr71750 ------
NM_018695chr52958 761 ------
NM_018696chr184829 805 393 65 188 ----
NM_018703chr161265 ------
NM_018710chr821170 1131 ------
NM_018719chr731169 1117 500 ----2419 273
NM_018834chr51837 ------
NM_018844chr771989 1874 1826 1787 1749 1690 187 21796 1468 ----
NM_018945chr622497 932 --12303 1671
NM_018947chr774991 3916 3814 3722 3254 1189 181 11476 ----
NM_018948chr12211 62 ----11286
NM_018958chr1522969 562 --11601 --
NM_018959chr191731 ------
NM_018970chr782413 1957 1263 1206 1153 593 136 108 --12929 --
NM_018979chr1232600 2006 666 ------
NM_018999chr1083755 3377 1868 1275 1223 1179 389 304 23435 3104 24860 230 --
NM_019000chr531650 670 344 --1366 --
NM_019001chr363738 3484 1338 987 597 204 34843 4461 1409 ----
NM_019004chr722314 1528 --1826 --
NM_019018chr51636 1291 ----
NM_019022chr1863154 2806 1259 1205 189 52 --1960 --
NM_019050chr452307 1973 1914 1823 302 11522 ----
NM_019074chr152936 924 ------
NM_019080chr1321564 340 11040 ----
NM_019084chr1052566 2375 1780 1728 405 1503 ----
NM_019087chr531207 1142 675 ------
NM_019091chr21372 ------
NM_019116chr1653695 2444 2424 703 378 --12467 --
NM_019117chrX43058 2959 1252 381 12582 2727 252 --
NM_019555chr331561 1348 127 ------
NM_019556chrX31269 1240 1047 ------
NM_019592chr92919 815 --2557 103 --
NM_019594chr91649 ------
NM_019597chrX1201 1195 ----
NM_019600chr151125 ------
NM_019610chr122023 1577 --11423 --
NM_019842chr61288 --1124 --
NM_019857chrX21672 473 ----1611
NM_019859chr1041619 357 281 74 --11028 1218
NM_019860chr1041667 405 329 122 --11076 1266
NM_019885chr21560 ------
NM_019903chr101643 21245 705 ----
NM_020066chr12856 236 1811 ----
NM_020116chr441757 585 352 91 11512 ----
NM_020120chr221515 44 --1392 --
NM_020122chr231765 1287 1220 14611 14068 12096
NM_020123chr1021580 322 ------
NM_020141chr132010 1591 843 ----11613
NM_020144chr741932 1894 1445 378 ------
NM_020148chr1832905 2357 230 22411 748 --1361
NM_020152chr211138 ------
NM_020156chr72505 451 ------
NM_020159chr431440 1207 250 --11179 --
NM_020177chr522328 446 12620 22952 2781 --
NM_020178chr171934 ------
NM_020180chr1821163 953 11024 ----
NM_020193chr1151326 1284 1045 497 292 ------
NM_020204chr11174 ------
NM_020205chr132775 1182 696 1594 ----
NM_020225chr43277 105 49 --1365 --
NM_020226chr42745 511 1692 ----
NM_020228chr1132532 1731 124 22418 57 11682 --
NM_020245chr6104671 4151 3639 3268 3193 1919 1817 1501 1341 898 --1327 --
NM_020307chr31146 ------
NM_020309chr192199 28 1734 ----
NM_020311chr23647 553 198 ------
NM_020336chr2053624 3308 657 62 35 ------
NM_020337chr432587 2046 619 1642 1713 1596
NM_020341chr2021984 1628 ------
NM_020342chr241987 1024 958 294 ----22242 674
NM_020348chr1051882 890 734 262 149 12729 ----
NM_020353chr32627 457 11736 ----
NM_020357chr331419 660 54 ------
NM_020369chr7----1126 --
NM_020379chr11649 --1368 --
NM_020381chr641356 744 594 198 --11640 --
NM_020390chr334376 3510 3151 --14628 --
NM_020418chr32564 181 ------
NM_020420chrY41507 1464 1200 1173 2457 303 ----
NM_020429chr742305 1236 747 26 ------
NM_020432chr71189 12326 12047 1515
NM_020440chr1--13380 ----
NM_020452chr11498 11931 11882 --
NM_020463chr221314 147 ------
NM_020465chr162159 78 ------
NM_020466chr654254 4148 3274 572 86 --14812 13229
NM_020473chrX31856 1504 348 ------
NM_020478chr8----12374 1510
NM_020532chr23374 306 105 ------
NM_020640chr361679 1497 689 272 202 33 ------
NM_020645chr112256 169 ----1531
NM_020648chr1862793 2736 2163 1801 1106 67 1304 ----
NM_020651chr251627 363 357 205 84 1258 ----
NM_020655chr161158 ------
NM_020666chr55888 821 733 597 580 ------
NM_020673chr20127511 7363 6340 5767 5749 5417 5372 1009 989 891 98 83 21452 458 22418 180 --
NM_020696chr32106 24 ------
NM_020697chr821000 154 ------
NM_020699chr134147 890 241 24484 1632 14957 --
NM_020715chr1452036 1913 1586 854 135 191 ----
NM_020717chrX73890 3877 3183 1134 478 104 75 33654 3412 1120 --24416 3801
NM_020718chr1676228 2433 1728 1466 1133 590 534 12265 15316 --
NM_020727chr2154005 3655 3310 1065 260 13489 1727 1801
NM_020732chr6--11239 ----
NM_020734chr1243151 2380 758 508 2821 719 ----
NM_020737chr61112 ------
NM_020739chr1543472 3447 3404 265 1120 ----
NM_020742chrX32667 1834 928 2646 409 ----
NM_020747chr53890 829 795 ------
NM_020748chr1731807 354 145 ------
NM_020750chr621524 1195 ------
NM_020751chr1331256 261 102 ------
NM_020754chr32486 213 ------
NM_020760chr221472 1433 ------
NM_020766chrX34338 3194 1720 13623 13273 --
NM_020768chr5--12162 1505 1981
NM_020772chr17118237 7735 7423 6669 5543 2208 2120 1957 1705 1583 1501 37205 6149 5954 13061 --
NM_020773chr452550 2223 2094 2083 351 ----12426
NM_020783chr182532 465 ------
NM_020796chr532767 2217 555 ------
NM_020810chr1443653 2910 753 569 ------
NM_020818chr141120 ------
NM_020841chr1263844 3450 3342 3090 618 317 23792 1099 11288 11215
NM_020854chr1841479 1386 513 95 ------
NM_020856chr1921080 31 ----1302
NM_020858chr1532195 862 480 ------
NM_020860chr4----1243 --
NM_020865chr3133 ------
NM_020870chr421559 195 ----163
NM_020871chrX52104 1836 763 613 437 12449 ----
NM_020872chr331288 1181 1102 1265 ----
NM_020899chr1732319 1585 212 ------
NM_020917chr1963962 3549 2456 1520 595 256 --1703 11292
NM_020918chr104906 646 478 284 13411 32466 2361 1328 --
NM_020922chrX31501 186 114 --21875 1605 --
NM_020926chrX129 ------
NM_020929chr11----150 --
NM_020935chr264252 3983 1830 574 502 391 ----24084 1626
NM_020937chr14--1263 ----
NM_020940chr1032382 2184 986 --1707 --
NM_020948chr173557 2482 2464 1004 800 484 101 21059 560 12884 --
NM_020951chr1951843 920 433 308 107 --11535 --
NM_020952chr92792 66 ------
NM_020971chr191580 ------
NM_020974chr111529 ------
NM_020977chr421653 702 ------
NM_020981chr21821 1563 ----
NM_020987chr10----1291 --
NM_020993chr1221849 121 ------
NM_021003chr14126 ------
NM_021005chr1531037 1031 275 --1451 --
NM_021033chr1363416 3170 2178 666 209 189 ------
NM_021045chr10144 ------
NM_021079chr1743100 2048 1257 884 11196 12637 --
NM_021097chr22975 689 1661 32196 2166 232 --
NM_021102chr19--1416 ----
NM_021109chrX--2409 111 --1326
NM_021109chrX--2409 111 --1326
NM_021111chr911134 ------
NM_021132chr104926 531 299 100 ------
NM_021136chr141526 ------
NM_021140chrX1892 ------
NM_021141chr231046 844 206 ------
NM_021145chr73425 338 297 ----11159
NM_021149chr161423 --11216 --
NM_021156chr202927 67 ------
NM_021183chrX2609 333 11011 ----
NM_021190chr151089 1059 1045 1011 923 ----1250
NM_021194chr11231 ----1120
NM_021202chr2062674 2434 2263 1119 827 574 32597 2276 2060 12641 --
NM_021204chr41762 ------
NM_021222chr131337 1275 486 ------
NM_021237chr31240 ------
NM_021238chr1252113 1953 1790 1541 596 ------
NM_021239chr1411055 2890 470 ----
NM_021240chr92539 256 1241 ----
NM_021252chr1081999 1590 1433 1281 318 202 188 95 11669 1196 --
NM_021255chr1474054 3942 3856 3843 3629 1617 215 ------
NM_021622chr1062407 2169 1536 1509 813 44 ----21728 310
NM_021627chr31800 1981 11170 --
NM_021629chr353738 3476 1577 1378 1255 24939 1350 ----
NM_021633chr121409 1093 ----1413
NM_021639chr11765 ------
NM_021643chr21552 1757 ----
NM_021644chr102824 46 2960 843 ----
NM_021728chr14162 ------
NM_021813chr665440 5045 4642 3769 265 126 23875 1110 24865 4185 15311
NM_021814chr631482 592 96 1455 11424 1647
NM_021911chr555573 5113 4497 3631 832 25203 930 ----
NM_021912chr1534115 3465 3080 2497 436 1534 --
NM_021914chr14--32470 2397 527 ----
NM_021931chr201794 ------
NM_021940chr61278 ------
NM_021943chr622144 154 11500 ----
NM_021949chrX52850 2669 1881 1768 670 ------
NM_021951chr92698 137 2888 222 1741 --
NM_021956chr631509 1122 439 ------
NM_021960chr152045 2025 717 599 221 32498 1961 1051 161 --
NM_021961chr11136864 6524 5387 5173 4906 2861 2704 2674 2525 2159 1276 1083 887 --12370 --
NM_021964chr3116562 6535 5973 5833 4852 4711 2515 2378 1658 1460 734 2613 446 16419 --
NM_021970chr42559 264 --1240 --
NM_021979chr14--1155 ----
NM_021998chrX21061 355 ------
NM_022048chr15106152 6131 5789 4753 4609 4523 2438 1757 1062 343 22342 1894 25279 641 --
NM_022049chr131852 730 332 ------
NM_022062chr1121711 1414 ------
NM_022073chr1441658 1374 1357 1072 ------
NM_022079chr101867 --126 --
NM_022080chr203449 425 146 ------
NM_022117chrX1137 ------
NM_022133chr831489 1348 130 1444 ----
NM_022340chr353253 3015 665 602 387 ----1679
NM_022351chr883890 3582 3567 3243 2846 2766 2528 455 ------
NM_022454chr82309 172 --1787 --
NM_022459chr13106305 6029 5759 5688 5145 5133 4610 2480 1971 348 22229 1064 15868 --
NM_022470chr31445 1973 ----
NM_022473chr1551037 451 357 320 143 13994 23852 3421 --
NM_022474chr1462195 1907 1874 928 633 171 12163 21883 1789 --
NM_022484chr71361 11403 1414 --
NM_022485chr31377 ------
NM_022496chr121333 ------
NM_022551chr6133 ------
NM_022552chr211190 --1791 --
NM_022650chr5------165
NM_022652chr1241127 755 462 50 ------
NM_022730chr221008 308 ------
NM_022735chr13512 417 27 --199 --
NM_022753chr132733 2107 353 12524 ----
NM_022763chr321261 933 12086 2887 349 --
NM_022768chr11128 ------
NM_022771chr121925 ------
NM_022778chr111431 ------
NM_022781chr932584 1011 169 12082 ----
NM_022782chr121378 ------
NM_022784chr151883 1792 1178 --
NM_022824chr5--11938 --1670
NM_022826chr221167 461 1816 ----
NM_022828chr511426 --1254 --
NM_022831chr151832 1433 1338 373 264 ------
NM_022841chr1532580 2204 954 ------
NM_022843chr1311511 --11118 --
NM_022893chr242750 697 547 516 1917 ----
NM_022894chr2--11329 11175 1124
NM_022897chr54974 336 227 193 ------
NM_022898chr1463941 3928 3468 3062 1570 566 ------
NM_022910chr162159 78 ------
NM_022912chr232698 2605 695 ----12145
NM_022913chr5154 ------
NM_023000chr1441383 1340 1186 30 ------
NM_023001chr1441383 1340 1186 30 ------
NM_023016chr262827 2769 2550 1080 635 360 ------
NM_023071chr1241129 970 336 100 ------
NM_023074chr192307 219 --11273 --
NM_023076chr1632263 877 328 --1509 --
NM_023923chr133768 3239 350 --13290 13054
NM_023929chr831967 996 573 ------
NM_024007chr532046 968 802 1962 ----
NM_024034chr201159 ------
NM_024052chr1762685 2299 953 560 225 197 12894 11039 --
NM_024069chr19--1667 ----
NM_024076chr1922078 2055 155 ----
NM_024090chr41171 ------
NM_024094chr83841 567 103 ------
NM_024311chr171163 ------
NM_024312chr122374 97 ------
NM_024321chr191108 ------
NM_024345chr975499 5361 5139 4211 2050 1222 585 15790 ----
NM_024423chr1853716 2720 1616 1323 956 1577 11080 --
NM_024490chr152430 149 1217 ----
NM_024503chr11269 ------
NM_024511chr412638 1843 12342 11000
NM_024524chr372777 2737 2688 2280 552 396 352 --22947 101 1742
NM_024525chr11651 ------
NM_024529chr13882 411 199 ------
NM_024539chrX3892 847 816 ------
NM_024548chr33688 642 478 --11602 --
NM_024551chr1222579 1002 --1341 --
NM_024551chr1222579 1002 --1341 --
NM_024556chr111380 ------
NM_024557chr1121614 278 --11334 21680 1492
NM_024561chr133925 374 207 11128 ----
NM_024567chr82102 36 ------
NM_024582chr41880 ------
NM_024583chr21909 ------
NM_024613chr811388 ----11415
NM_024617chr92297 180 ------
NM_024624chr231182 644 596 21302 1169 ----
NM_024638chr342340 2295 2162 853 1755 ----
NM_024639chr622298 1958 1709 ----
NM_024645chr821414 632 ------
NM_024646chr163751 3718 3674 282 158 119 ------
NM_024665chr364499 3933 3710 528 414 323 34357 4205 1213 ----
NM_024680chr112527 212 124 ----
NM_024692chr221328 1255 ------
NM_024709chr1--1544 ----
NM_024713chr1511582 1485 ----
NM_024715chr541609 423 271 67 1363 ----
NM_024721chr862502 1820 973 662 604 386 1997 --11744
NM_024740chr1164200 3736 3638 2776 718 150 1163 44025 3371 1430 1080 --
NM_024744chr252033 1795 1024 296 110 32454 1013 282 ----
NM_024755chr15----1628 --
NM_024757chr931109 1097 906 ------
NM_024769chr1121013 942 ------
NM_024772chr11439 --1544 --
NM_024786chr52953 84 ------
NM_024798chr1522360 1133 ------
NM_024803chr101306 ------
NM_024824chr1441672 592 172 35 --11332 --
NM_024834chr101364 1268 ----
NM_024847chr1661273 933 324 304 122 76 1909 ----
NM_024900chr422017 1617 --11900 12200
NM_024900chr422017 1617 --11900 12200
NM_024920chr431288 643 292 ----1419
NM_024945chr92899 453 ----1126
NM_024947chr3139207 8215 8032 7514 6665 6235 5924 3644 1948 682 638 79 33 11018 ----
NM_024949chr4104757 4358 4029 3681 3633 3220 1935 1810 1186 1006 24855 3702 11220 --
NM_024969chr23744 701 183 ------
NM_024971chr92792 66 ------
NM_024989chr2138130 7347 6247 5934 5195 3072 2842 1430 800 422 348 283 112 26890 310 26390 6327 --
NM_024991chr1032962 2666 2115 --1885 1477
NM_024993chr221323 404 ------
NM_025040chr1932441 1537 490 --21875 1821 --
NM_025054chr854126 3274 1058 957 832 ------
NM_025079chr1--1257 ----
NM_025106chr111881 11404 ----
NM_025126chr12----1689 --
NM_025133chr231187 984 803 --1910 --
NM_025134chr1652130 1889 1734 613 604 42570 2475 2148 1038 ----
NM_025135chr181107 1521 ----
NM_025138chr1311188 11428 ----
NM_025146chr342688 2644 1768 606 2861 631 12562 --
NM_025160chr183433 2976 1584 1441 1286 1233 1087 754 53974 3202 1314 425 360 1393 --
NM_025181chr22780 113 1100 1231 --
NM_025205chr41244 ------
NM_025208chr1132041 1945 1599 148 ----
NM_025211chr9198 134 ----
NM_025214chr1812569 ------
NM_025238chr152639 123 11145 ----
NM_025268chr141395 ------
NM_030579chr1693637 3347 3078 2943 2837 2557 1482 958 917 --1376 --
NM_030621chr1461503 1103 870 690 640 333 21571 1192 14184 --
NM_030625chr1032099 303 283 1114 12362 --
NM_030627chr543004 1444 1304 432 --2421 109 --
NM_030637chr142191 104 1215 ----
NM_030647chr7145585 5034 4931 4865 4419 4266 4232 3994 1780 1678 1405 1297 514 93 21823 1502 25405 44 --
NM_030648chr444618 4191 1462 1268 21175 273 ----
NM_030652chr61281 ------
NM_030674chr1264564 4484 1203 1165 306 89 --14495 --
NM_030751chr1041701 1639 1269 242 --1577 --
NM_030751chr1041701 1639 1269 242 --1577 --
NM_030752chr6--2210 182 --1439
NM_030755chr1463002 2768 2692 775 563 137 1287 21083 112 --
NM_030759chr10----1640 --
NM_030762chr1231672 1358 625 ----11319
NM_030777chr2052345 1776 965 878 234 22185 163 ----
NM_030784chr61370 ------
NM_030791chr14------1710
NM_030799chr5--11995 ----
NM_030806chr1108316 6729 6528 5876 3246 3052 2164 1914 1858 1214 29378 928 25803 456 --
NM_030816chr142752 1400 951 902 --12678 --
NM_030820chr62946 299 1355 ----
NM_030881chr221889 12077 21813 212 1798
NM_030884chr322300 1652 ------
NM_030885chr312306 ------
NM_030914chr92777 264 ----1333
NM_030918chr165234 1496 1423 550 262 170 ------
NM_030920chr141699 398 372 168 ------
NM_030923chr21257 1532 1703 --
NM_030934chr141744 1564 1317 143 1623 ----
NM_030938chr1721061 438 --1135 --
NM_030939chr621167 48 189 ----
NM_030953chr531382 641 31 ------
NM_030954chr83605 205 23 --1358 --
NM_030963chr63662 586 230 ------
NM_030969chr61451 ------
NM_031216chr1832177 2119 626 --1193 --
NM_031217chr112118 54 ------
NM_031243chr772334 2209 1740 871 826 785 256 ------
NM_031244chr621125 87 ------
NM_031267chr73563 474 392 1148 ----
NM_031268chr1635396 3818 338 --15124 --
NM_031271chr821373 1357 ------
NM_031291chr4--1258 ----
NM_031292chr1231501 1432 1193 ----11077
NM_031296chr412169 11817 ----
NM_031369chr41632 1165 ----
NM_031370chr41632 1165 ----
NM_031418chr1162687 986 845 797 390 254 --22589 503 --
NM_031427chr143578 340 248 23861 1841 15225 --
NM_031431chr1331768 1513 1181 1596 168 11340
NM_031435chr1222336 2315 --1998 --
NM_031442chrX33151 274 110 --12313 --
NM_031443chr72376 326 ------
NM_031453chr1042384 2300 2238 754 22371 612 ----
NM_031461chr841968 1781 1397 152 ------
NM_031476chr1611100 --12659 --
NM_031483chr2021355 268 31044 650 498 ----
NM_031844chr121652 1330 23619 2883 11613 1184
NM_031845chr243210 2711 1452 734 33260 2780 439 12349 --
NM_031847chr243210 2711 1452 734 33260 2780 439 12349 --
NM_031858chr171225 ------
NM_031862chr171225 ------
NM_031942chr271214 977 915 877 860 300 203 --11003 --
NM_031989chr121118 --1305 --
NM_032012chr964771 4384 3573 1233 1092 586 33848 1844 1592 ----
NM_032047chr32499 411 32412 2033 636 --11732
NM_032102chr1143131 3081 912 142 2554 480 31196 725 66 --
NM_032144chr2--11196 ----
NM_032146chr31359 ------
NM_032148chr121374 ------
NM_032160chr1844325 1340 1284 1041 14175 ----
NM_032182chr102417 337 11205 11296 --
NM_032186chr12169 29 --1943 --
NM_032189chr1375082 5073 4945 4855 4809 1991 563 ------
NM_032195chr21----1525 --
NM_032208chr263367 3109 3018 902 742 622 ----22240 880
NM_032221chr2082052 1808 1743 1637 1578 1436 1384 205 11467 ----
NM_032228chr1132368 1356 767 ------
NM_032229chr1321102 199 1764 ----
NM_032246chr15--11171 ----
NM_032288chr381755 1670 1555 848 840 724 708 624 21777 632 ----
NM_032354chr1751048 888 858 224 150 ------
NM_032373chr10125662 5448 5120 4877 4609 4212 1673 1325 1251 1218 627 371 ------
NM_032408chr731042 795 488 --11133 --
NM_032433chr1931553 1357 1273 ------
NM_032440chr1042390 2356 1988 1065 ----22547 1925
NM_032445chr1521029 503 1575 1697 --
NM_032446chr533872 3682 2830 13102 1404 --
NM_032451chr161357 --1124 --
NM_032457chr453887 2840 1179 1086 733 ----13671
NM_032458chrX33262 3056 549 11044 ----
NM_032494chr23570 542 95 ------
NM_032499chr151260 ----11096
NM_032505chr351857 1774 936 638 561 42409 1106 729 582 --12665
NM_032521chr201847 2399 64 ----
NM_032539chrX1682 ------
NM_032560chr142994 415 ------
NM_032575chr1612041 ------
NM_032598chr17240 21 ------
NM_032632chr1441768 1538 465 435 --11808 --
NM_032682chr343609 2295 1462 1315 12805 22456 105 --
NM_032689chr192177 116 ------
NM_032741chr64997 891 650 216 ------
NM_032765chr53861 188 92 ------
NM_032778chr343359 2804 610 236 22086 646 ----
NM_032801chr1142363 1743 949 500 1691 ----
NM_032826chr743386 1938 1527 1448 ------
NM_032859chr1343561 2695 2435 1127 13627 23138 713 1242
NM_032867chr111428 ----1460
NM_032869chr841876 1367 495 444 1480 ----
NM_032870chr62125 100 ------
NM_032876chr1431967 633 351 21732 1596 --1235
NM_032932chr1766471 1669 1335 1143 887 729 ------
NM_032968chrX53641 782 499 407 396 ------
NM_032969chrX53641 782 499 407 396 ------
NM_032973chrY53633 782 499 407 396 ------
NM_032978chr182273 74 ------
NM_032979chr182273 74 ------
NM_032981chr182273 74 ------
NM_032983chr7143 --32915 2858 2357 --
NM_033008chr32564 181 ------
NM_033009chr32564 181 ------
NM_033010chr32564 181 ------
NM_033016chr2211545 ------
NM_033020chr184651 4156 3693 3606 895 879 671 207 --23936 3769 --
NM_033030chr221587 1458 ------
NM_033055chr121028 172 ------
NM_033081chr2041374 1206 1122 969 ------
NM_033082chr121157 ------
NM_033083chr343282 652 367 344 2301 216 ----
NM_033132chr1331993 1829 1532 2618 118 ----
NM_033135chr1132041 1945 1599 148 ----
NM_033138chr752076 1816 1711 1694 1574 1327 1173 --
NM_033139chr752076 1816 1711 1694 1574 1327 1173 --
NM_033140chr752076 1816 1711 1694 1574 1327 1173 --
NM_033157chr752076 1816 1711 1694 1574 1327 1173 --
NM_033181chr673068 1199 1012 864 166 146 68 1291 ----
NM_033208chr161125 ------
NM_033211chr5--1499 ----
NM_033224chr777380 6934 6317 6042 5573 5560 810 --18059 25996 1166
NM_033285chr854471 4344 3884 3665 1609 --13083 14291
NM_033300chr111135 ------
NM_033360chr1253763 3080 1855 1240 969 24125 1505 ----
NM_033364chr321913 59 11253 ----
NM_033380chrX21001 366 ------
NM_033381chrX21001 366 ------
NM_033389chr1734281 3219 1716 1968 1991 --
NM_033393chr41351 12928 ----
NM_033421chr2031757 1392 424 1218 --11846
NM_033425chr1153469 2620 2415 2354 1014 --11254 --
NM_033430chr453599 2720 1625 1321 30 ----13824
NM_033437chr453599 2720 1625 1321 30 ----13824
NM_033505chr232127 909 274 35938 5924 5361 36218 6108 1435 --
NM_033515chr631142 944 253 ------
NM_033540chr331121 1025 957 ------
NM_033624chr123684 656 270 1150 ----
NM_033631chr183736 3579 3284 2885 2410 1437 621 407 --11354 --
NM_033632chr431288 1247 1207 11464 ----
NM_033637chr1073523 3191 3038 3003 2672 1004 114 --23360 192 13114
NM_033642chrX11180 11205 ----
NM_033644chr5138 12289 --1794
NM_033645chr5138 12289 --1794
NM_033656chr2165970 5815 4397 3846 1197 1059 16034 35947 5562 2067 --
NM_052811chr1395054 4749 3334 2075 1855 1555 1144 888 23 24981 718 11416 --
NM_052818chr133224 54 42 ------
NM_052820chr92460 196 ------
NM_052832chr822213 2019 12927 ----
NM_052840chr1531619 621 341 ------
NM_052865chr204677 341 179 45 ------
NM_052879chr1283838 3734 3308 2636 1392 1260 720 639 13594 1965 --
NM_052885chr1274636 4266 4242 1647 1553 872 451 23202 267 13959 --
NM_052900chr831585 1411 553 --1233 --
NM_052905chr231355 1214 565 --11511 --
NM_052913chr621044 853 ------
NM_052923chr61193 ------
NM_052927chr531748 1513 340 --1133 --
NM_052932chr1142255 2083 1770 548 175 ----
NM_052937chr852138 1767 974 691 44 ------
NM_052951chr201211 ------
NM_052953chr31113 ------
NM_052965chr111069 ----1231
NM_053002chr331205 1042 833 ------
NM_053016chr987063 6700 5491 2140 1746 1614 1326 512 --37422 6539 959 11576
NM_053023chr1133015 2485 732 1870 ----
NM_053024chr311177 ----11496
NM_053025chr331420 559 24 --11545 --
NM_053026chr331420 559 24 --11545 --
NM_053027chr331420 559 24 --11545 --
NM_053028chr331420 559 24 --11545 --
NM_053031chr331420 559 24 --11545 --
NM_053032chr331420 559 24 --11545 --
NM_053043chr756436 5847 5167 1846 1045 ------
NM_053044chr41954 ------
NM_053046chr191555 ------
NM_053053chr12796 718 2959 405 ----
NM_053067chr9----1297 --
NM_053281chrX186 --150 --
NM_054016chr141853 1830 1335 185 11815 11239 --
NM_054016chr141853 1830 1335 185 11815 11239 --
NM_054016chr141853 1830 1335 185 11815 11239 --
NM_057158chr82597 265 ------
NM_057159chr911050 --11168 --
NM_057168chr721639 1152 ------
NM_057175chr462610 1656 692 663 642 199 --21772 981 11765
NM_057178chr1762211 2107 2042 811 532 326 12457 ----
NM_057749chr811166 --1269 --
NM_058172chr411789 ------
NM_058241chr21810 11596 ----
NM_058241chr21810 11596 ----
NM_079421chr192487 121 ------
NM_080546chr962030 1715 817 647 512 389 ------
NM_080594chr16153 ------
NM_080597chr181693 ------
NM_080629chr121390 1064 ------
NM_080630chr121390 1064 ------
NM_080645chr66780 700 330 289 96 35 1633 31719 1541 206 --
NM_080650chr152809 86 ------
NM_080654chr114945 473 212 161 1525 ----
NM_080676chr2023099 2332 ------
NM_080732chr191555 ------
NM_080759chr1332239 1907 867 1139 ----
NM_080760chr1332239 1907 867 1139 ----
NM_080764chr2232534 2379 955 ------
NM_080798chr10165 ------
NM_080799chr10165 ------
NM_080800chr10165 ------
NM_080801chr10165 ------
NM_080802chr10165 ------
NM_080803chr10165 ------
NM_080804chr10165 ------
NM_080805chr10165 ------
NM_080806chr10165 ------
NM_080807chr10165 ------
NM_080808chr10165 ------
NM_080809chr10165 ------
NM_080810chr10165 ------
NM_080811chr10165 ------
NM_080812chr10165 ------
NM_080813chr10165 ------
NM_080814chr10165 ------
NM_080815chr10165 ------
NM_080821chr2022013 356 --11533 1436
NM_080867chr1484938 4693 4356 4219 4128 1704 1439 1139 ------
NM_130391chr943552 3150 780 749 ----1185
NM_130392chr943552 3150 780 749 ----1185
NM_130393chr943552 3150 780 749 ----1185
NM_130435chr1052804 2776 1884 1047 502 22011 570 ----
NM_130436chr2142613 2462 2440 2365 --11767 --
NM_130438chr2153190 3039 3017 2942 183 --12344 --
NM_130439chr1022045 90 --1505 --
NM_130439chr1022045 90 --1505 --
NM_130442chr731107 944 803 11039 ----
NM_130787chr19163 ------
NM_130798chr1521094 572 177 ----
NM_130809chr573121 2287 2274 2232 1037 1029 426 190 ----
NM_130811chr2011165 11197 ----
NM_133170chr2087810 6843 6068 5901 1860 1696 933 677 --36721 2150 514 15621
NM_133265chrX73227 2874 2626 2489 1389 945 577 --1175 --
NM_133326chr11239 ------
NM_133329chr2----1155 --
NM_133334chr466218 5852 5231 4695 1260 544 --15366 --
NM_133338chr51106 --1356 --
NM_133339chr51106 --1356 --
NM_133340chr51106 --1356 --
NM_133341chr51106 --1356 --
NM_133342chr51106 --1356 --
NM_133343chr51106 --1356 --
NM_133344chr51106 --1356 --
NM_133370chr493636 3489 3439 3065 2682 1379 1074 1024 549 12813 11230 --
NM_133433chr54747 682 306 91 2341 231 ----
NM_133443chr1621892 1833 ------
NM_133445chr973785 2672 2396 1367 1234 133 110 11429 ----
NM_133499chrX1709 ------
NM_133631chr31503 ------
NM_133638chr51383 ------
NM_133646chr234772 1987 1205 21717 1476 21681 70 --
NM_133647chr1521329 812 12468 ----
NM_138270chrX53362 3283 2237 1172 1124 1510 ----
NM_138288chr1462225 2134 2103 1581 548 211 1832 ----
NM_138316chr1011109 ------
NM_138357chr103736 486 236 ------
NM_138370chr22284 186 ------
NM_138395chr211018 11190 ----
NM_138423chr1521767 439 --32198 2084 731 --
NM_138426chr71173 1526 11881 --
NM_138444chr1374351 4169 4054 1945 1461 510 320 13894 11191 --
NM_138459chr663334 3266 2705 1462 1175 651 23215 2447 --11401
NM_138473chr1295162 4830 4771 4668 4568 4322 1198 1025 261 --13692 --
NM_138554chr972597 2350 2212 1023 644 523 499 ------
NM_138558chr13871 773 452 ------
NM_138576chr1463941 3928 3468 3062 1570 566 ------
NM_138609chr51110 ----2150 50
NM_138610chr51110 ----2150 50
NM_138621chr254074 3829 1278 476 75 12567 23121 759 --
NM_138633chr621766 62 1420 11702 --
NM_138635chr733103 2814 2629 23151 333 12885 --
NM_138638chr14--32470 2397 527 ----
NM_138694chr653564 3355 2310 675 261 ----1417
NM_138713chr16128145 6791 6355 5423 2984 2657 2374 1900 1356 1204 827 515 26544 786 --1309
NM_138714chr16128145 6791 6355 5423 2984 2657 2374 1900 1356 1204 827 515 26544 786 --1309
NM_138727chr12943 783 ------
NM_138728chr12943 783 ------
NM_138730chr61343 ------
NM_138732chr111924 ------
NM_138734chr111924 ------
NM_138782chr522114 2064 11762 --1842
NM_138799chr211696 1659 ----
NM_138811chr741072 893 318 245 1202 ----
NM_138931chr32801 324 ------
NM_139015chr1231236 453 434 11676 ----
NM_139048chr31826 11041 1849 --
NM_139053chr11101 ------
NM_139135chr121078 904 --1105 --
NM_139136chr122966 319 1685 ----
NM_139168chr51428 11303 ----
NM_139169chr1061894 1712 1513 496 301 140 ------
NM_139201chr121633 ------
NM_139246chr922331 749 11569 12220 --
NM_139283chr1231951 573 472 1385 1694 --
NM_139312chr103452 155 65 ------
NM_139316chr73872 745 674 ------
NM_139321chr2032898 2871 680 --13004 --
NM_144567chr132596 1062 451 ------
NM_144571chr465389 2423 1643 1454 933 737 ----16472
NM_144578chr1495320 4736 4255 1855 1601 1555 1159 1117 649 32021 1305 1016 ----
NM_144590chr1032910 420 232 --1508 --
NM_144600chr1611508 ------
NM_144633chr3155 --11315 11433
NM_144642chr321375 129 ------
NM_144643chr41372 ------
NM_144645chr41196 ------
NM_144657chrX131 ----1262
NM_144664chr1122090 395 12470 11757 12117
NM_144710chr211448 ----1325
NM_144721chr422679 616 12625 12132 --
NM_144728chr12321 307 ------
NM_144729chr12321 307 ------
NM_144767chr1544524 4287 3560 1663 --21564 478 11677
NM_144778chr1331004 881 273 32698 2425 576 1363 1865
NM_144949chr272600 2535 2427 2383 738 550 247 --11706 1775
NM_144963chr822531 342 ------
NM_144964chr9--1933 ----
NM_144965chr91140 ------
NM_144973chr1284606 2031 1398 1270 1261 894 582 517 2937 468 ----
NM_144979chr4--1192 1524 --
NM_144982chr121537 1724 --1732
NM_145000chr51252 1123 ----
NM_145005chr92820 394 ------
NM_145008chr114864 804 716 606 --168 --
NM_145025chr631109 879 109 ------
NM_145037chr311198 31461 1205 1142 ----
NM_145049chr51131 ------
NM_145055chr1843816 2349 1448 344 23342 1108 12983 --
NM_145117chr1153299 3003 2291 2038 1021 ------
NM_145174chr2231475 1060 466 --11086 --
NM_145175chr211089 11207 ----
NM_145185chr191668 ------
NM_145206chr1012551 ------
NM_145259chr286805 6032 5579 5563 4862 2728 2578 2179 11985 ----
NM_145274chr172676 131 ------
NM_145307chr10104588 4145 3496 3248 2918 1173 1137 686 526 226 ----13989
NM_145320chr763333 2604 1188 938 921 141 2522 441 1905 23392 887
NM_145321chr763333 2604 1188 938 921 141 2522 441 1905 23392 887
NM_145322chr763333 2604 1188 938 921 141 2522 441 1905 23392 887
NM_145331chr61629 ------
NM_145332chr61777 ------
NM_145333chr61777 ------
NM_145341chr1041741 1230 1208 21 ------
NM_145686chr221159 1002 --31147 908 174 --
NM_145687chr221159 1002 --31147 908 174 --
NM_145716chr11545 --1607 --
NM_145793chr102371 253 --191 --
NM_145808chr722526 2265 1710 12114 --
NM_145810chr271214 977 915 877 860 300 203 --11003 --
NM_145859chr31391 ------
NM_145860chr31391 ------
NM_145891chr1611386 ------
NM_145892chr1611386 ------
NM_145893chr1611508 ------
NM_145913chr123725 190 142 ------
NM_147175chrX31747 1461 125 12202 ----
NM_147223chr21851 ------
NM_147233chr21668 ------
NM_148174chr82339 224 1484 ----
NM_148894chr431033 917 219 ------
NM_148921chr172658 625 ------
NM_148977chr1011109 ------
NM_148978chr1011109 ------
NM_152238chr11362 ------
NM_152240chr31445 1973 ----
NM_152261chr1232320 2300 287 1520 ----
NM_152265chr11225 ------
NM_152271chr81439 1928 ----
NM_152275chr241875 541 504 129 11830 11514 --
NM_152277chr511994 11554 ----
NM_152282chr361228 1163 994 969 916 506 ------
NM_152284chr81652 ------
NM_152309chr1051995 634 593 362 49 ------
NM_152330chr1421916 754 ------
NM_152332chr1462652 2093 1123 1032 947 275 1668 ----
NM_152344chr1731316 1251 1188 ------
NM_152375chr12987 338 ----12431
NM_152384chr241975 1930 662 167 148 ----
NM_152387chr21225 1763 ----
NM_152409chr533154 2308 1373 --22813 2419 --
NM_152410chr61392 ------
NM_152424chrX104358 3559 3398 3209 3079 1446 1173 1012 527 236 ------
NM_152450chr152197 33 2596 142 2779 208 --
NM_152455chr1542742 2304 1811 418 11132 --22649 179
NM_152470chr1853784 3542 3114 1399 770 13803 12600 --
NM_152520chr2180 ------
NM_152522chr21747 ------
NM_152538chr311534 1368 ----
NM_152581chrX21307 1300 1261 ----
NM_152594chr1532064 1881 484 ------
NM_152605chr1921408 1311 1465 ----
NM_152608chr131936 504 458 12211 12379 11582
NM_152622chr553328 1180 878 783 73 12201 2912 613 12515
NM_152624chr5106575 5683 5552 5097 4926 4695 2212 1916 795 620 37189 2054 228 11017 --
NM_152629chr941591 1566 1253 1218 --12848 --
NM_152630chrX11307 1603 ----
NM_152636chr1132989 1035 874 22479 991 --1580
NM_152641chr1242703 2416 1880 832 ----1603
NM_152647chr15------161
NM_152678chr372458 2342 2260 2025 738 693 506 11990 ----
NM_152694chrX1317 ------
NM_152699chr321399 192 21359 28 13402 --
NM_152713chr11193 ------
NM_152737chr661993 1731 1589 1447 719 590 ------
NM_152745chr71884 1921 11118 --
NM_152756chr554302 3331 1403 862 233 --12856 --
NM_152758chr832725 2360 2074 22802 488 --1788
NM_152774chr732327 2251 81 ------
NM_152787chrX43782 3220 2534 2446 12862 1377 13080
NM_152789chr71930 11228 ----
NM_152793chr754859 4210 1536 700 293 --34671 4285 415 --
NM_152835chr122001 287 21841 659 ----
NM_152836chr831489 1348 130 1444 ----
NM_152837chr831489 1348 130 1444 ----
NM_152838chr2043219 3085 2465 294 ----1803
NM_152890chr111096 ----1411
NM_152897chr2021027 323 ----21116 256
NM_152924chr1576318 6225 5171 1965 1365 836 262 --22629 1062 11119
NM_152991chr111457 ------
NM_152998chr7194 ------
NM_152999chr743562 1863 1448 695 --13701 --
NM_153020chr621325 1212 11424 ----
NM_153035chr122310 426 --32969 1140 670 --
NM_153038chr2------1749
NM_153182chr343359 2804 610 236 22086 646 ----
NM_153188chr565272 4927 4909 1088 981 47 35495 4102 3896 32204 994 299 1863
NM_153207chr1273901 3848 2902 2514 1530 363 49 --12855 --
NM_153223chr521563 248 138 --1441
NM_153235chr611750 1391 --12034
NM_153261chr1631193 1030 308 ------
NM_153262chr132328 2113 1077 ------
NM_153371chr1341920 493 223 201 1878 --12344
NM_153426chr41545 ------
NM_153427chr41545 ------
NM_153607chr522337 785 12191 --1951
NM_153616chr1532195 862 480 ------
NM_153617chr1532195 862 480 ------
NM_153618chr1532195 862 480 ------
NM_153619chr1543433 2510 440 345 --12400 --
NM_153620chr731480 1333 490 ------
NM_153633chr121625 --1676 --
NM_153634chr1241153 1135 366 106 1644 ----
NM_153686chr462379 2338 1849 802 678 577 1258 12473 --
NM_153689chr221726 104 --1821 --
NM_153695chr9--2280 203 ----
NM_153702chr41243 ------
NM_153704chr81406 1390 ----
NM_153706chr5--1222 ----
NM_153712chr253057 2992 806 655 619 ------
NM_153748chr122966 319 1685 ----
NM_153759chr211190 --1791 --
NM_153810chr1064211 3995 3276 1055 889 239 11829 11427 11706
NM_153812chr122285 706 --11686 --
NM_153828chr23374 306 105 ------
NM_153831chr81692 1160 ----
NM_170606chr71336 --1617 --
NM_170665chr1244549 4291 3612 640 ----1446
NM_170679chr52954 306 ------
NM_170692chr11813 ------
NM_170696chr1541480 1357 1280 178 ------
NM_170697chr1541480 1357 1280 178 ------
NM_170706chr174125 1641 1543 1334 838 561 202 13069 13998 --
NM_170709chr831596 310 40 11993 ----
NM_170710chr442946 2091 606 542 1623 ----
NM_170711chr191907 ------
NM_170719chr1311188 11428 ----
NM_170751chr631269 1260 364 ------
NM_170752chr631269 1260 364 ------
NM_172020chr731989 1850 668 ------
NM_172037chr831107 364 305 ------
NM_172058chr841800 1484 133 68 ------
NM_172059chr841800 1484 133 68 ------
NM_172060chr841800 1484 133 68 ------
NM_172069chr232072 1929 136 ------
NM_172070chr211776 2571 519 ----
NM_172071chr1106416 6318 4585 2573 2220 1917 1422 1334 1060 43 37186 4787 2517 14940 11488
NM_172097chr15--1314 ----
NM_172103chr662676 2368 2298 1782 1056 1010 ------
NM_172105chr662676 2368 2298 1782 1056 1010 ------
NM_172127chr41498 1694 12053 11389
NM_172128chr41454 1650 12009 11345
NM_172159chr322230 79 22036 945 ----
NM_172160chr322230 79 22036 945 ----
NM_172337chr14162 ------
NM_172344chr2----1155 --
NM_173082chr63527 134 89 ------
NM_173083chr121253 464 21194 1071 ----
NM_173171chr23958 304 96 ----1294
NM_173172chr241266 1080 612 404 ----1602
NM_173173chr23958 304 96 ----1294
NM_173214chr16128145 6791 6355 5423 2984 2657 2374 1900 1356 1204 827 515 26544 786 --1309
NM_173355chr2--11066 --1225
NM_173362chr5171 1554 ----
NM_173454chr152956 264 ------
NM_173468chr475790 1957 1469 1434 1234 853 515 35912 4731 4188 15125 --
NM_173469chr1521564 1196 ------
NM_173470chrX52217 1991 1038 524 474 ----1842
NM_173475chr162626 433 ------
NM_173478chr17--1396 ----
NM_173503chr17--1142 ----
NM_173508chr151221 1078 1062 94 42 ------
NM_173510chr221211 ------
NM_173511chr283983 3755 3605 3366 3201 2788 2585 1299 1803 ----
NM_173517chr72181 28 --151 --
NM_173533chr1--1258 ----
NM_173552chr311710 1303 --11721
NM_173576chr1011478 1759 ----
NM_173582chr1196184 5767 5693 5484 5009 2446 1551 547 189 45897 5658 3953 1665 11133 1995
NM_173595chr1254305 1660 1539 1331 1020 167 14270 --
NM_173602chr1233206 3092 1482 33371 1242 361 11037 1864
NM_173607chr1452110 2072 1972 1798 377 1353 ----
NM_173609chr151751 ------
NM_173642chr158901 2674 2172 1610 975 47254 6451 5810 1915 1778 --
NM_173647chr221082 856 1873 ----
NM_173670chr5--145 ----
NM_173683chr81704 ------
NM_173797chr531225 1169 419 1366 ----
NM_173808chr143871 1173 336 73 12983 13701 12795
NM_173814chr152478 423 ------
NM_173822chr232159 506 121 12103 ----
NM_173834chrX1368 ------
NM_173848chr82258 150 1746 1669 --
NM_174887chr171321 ------
NM_174890chr101279 ------
NM_174916chr1552005 1569 918 427 376 ------
NM_174934chr1172377 2275 1312 1183 551 307 121 --13575 --
NM_174938chr9--1173 ----
NM_175056chr342133 699 296 163 11585 ----
NM_175061chr731374 884 702 12106 ----
NM_175607chr31460 --1250 --
NM_175610chr151106 ------
NM_175612chr31460 --1250 --
NM_175629chr211190 --1791 --
NM_175634chr831190 953 872 11169 ----
NM_175635chr831190 953 872 11169 ----
NM_175636chr831190 953 872 11169 ----
NM_175736chr1267424 6546 4737 2251 440 399 43093 2242 1553 940 67599 7113 6149 2888 2374 2330 --
NM_175768chr631713 1326 643 ------
NM_175848chr2041421 1378 950 314 1422 ----
NM_175848chr2041421 1378 950 314 1422 ----
NM_175849chr2041421 1378 950 314 1422 ----
NM_175849chr2041421 1378 950 314 1422 ----
NM_175850chr2041421 1378 950 314 1422 ----
NM_175850chr2041421 1378 950 314 1422 ----
NM_175854chr1332769 2141 860 ------
NM_175859chrX21672 473 ----1611
NM_175862chr351579 1381 1000 969 551 --1450 --
NM_175863chr6--11239 ----
NM_175907chr1842603 2470 1980 358 ------
NM_175924chr33847 786 109 2103 97 ----
NM_176787chr1831499 1246 995 ------
NM_176801chr4--11771 ----
NM_176812chr201673 ------
NM_176814chr71286 ------
NM_176863chr1732083 1536 35 1135 --11872
NM_177398chr121788 442 1195 --11855
NM_177399chr121788 442 1195 --11855
NM_177424chr15627 444 415 323 143 ------
NM_177438chr1461503 1103 870 690 640 333 21571 1192 14184 --
NM_177452chr1421688 700 22059 620 ----
NM_177553chr11----168 --
NM_177947chrX197 --1401 --
NM_177948chrX197 --1401 --
NM_177952chr14126 ------
NM_177974chr1521767 439 --32198 2084 731 --
NM_177976chr31359 ------
NM_177990chr2021984 1628 ------
NM_178011chr1053088 2704 461 405 179 23303 2141 ----
NM_178120chr221312 381 ------
NM_178123chr21274 11021 ----
NM_178126chr1722240 457 --11730 --
NM_178151chrX115864 5573 5030 4776 2174 1394 1173 1091 921 679 337 26769 5941 15554 --
NM_178152chrX115864 5573 5030 4776 2174 1394 1173 1091 921 679 337 26769 5941 15554 --
NM_178153chrX115864 5573 5030 4776 2174 1394 1173 1091 921 679 337 26769 5941 15554 --
NM_178426chr1--12120 21675 1640 --
NM_178427chr1--12020 21575 1540 --
NM_178565chr821319 522 ------
NM_178584chr211448 ----1325
NM_178812chr82646 567 ------
NM_178815chr1031932 1869 400 11742 22636 861 --
NM_178864chr112706 214 ------
NM_180989chr1321847 345 21570 484 1647 --
NM_181054chr143944 446 362 --1207 --
NM_181077chr1511945 22127 141 ----
NM_181265chr442946 2091 606 542 1623 ----
NM_181332chrX32667 1834 928 2646 409 ----
NM_181349chr742305 1236 747 26 ------
NM_181351chr1132613 914 406 --1461 11872
NM_181354chr851629 1613 1431 154 117 ----1384
NM_181358chr194167 3108 3102 2855 2779 2747 1661 574 193 13007 ----
NM_181443chr2052564 2117 853 678 300 12665 --1786
NM_181453chr231625 1599 1488 --11258 11343
NM_181481chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_181482chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_181483chr18125997 5186 5177 4834 4562 4489 2450 2172 1936 917 131 88 36692 6135 2778 15252 --
NM_181492chr2221260 302 ------
NM_181504chr563531 2842 1397 1020 882 844 ----23559 80
NM_181523chr563531 2842 1397 1020 882 844 ----23559 80
NM_181524chr563531 2842 1397 1020 882 844 ----23559 80
NM_181645chr111295 ----1266
NM_181659chr2043311 3299 2527 2457 --12250 --
NM_181659chr2043311 3299 2527 2457 --12250 --
NM_181670chr121416 ------
NM_181674chr51283 ------
NM_181675chr51283 ------
NM_181676chr51283 ------
NM_181677chr51283 ------
NM_181678chr51283 ------
NM_181723chr831703 1637 503 122 12212 --
NM_181780chr342030 1448 1378 453 1796 --1487
NM_181782chr652177 2018 912 538 420 ------
NM_181836chr572530 2312 2194 2011 913 661 466 11640 ----
NM_181839chr8--1391 ----
NM_181861chr1232143 511 217 ------
NM_181868chr1232143 511 217 ------
NM_181869chr1232228 596 302 ------
NM_181886chr411123 11146 1990 --
NM_181887chr411123 11146 1990 --
NM_181888chr411123 11146 1990 --
NM_181889chr411123 11146 1990 --
NM_181890chr411123 11146 1990 --
NM_181891chr411123 11146 1990 --
NM_181892chr411170 11193 11037 --
NM_181893chr411123 11146 1990 --
NM_182314chrX51688 1519 1417 768 741 ------
NM_182398chr14----131 1167
NM_182481chr2111303 ------
NM_182482chr2111303 ------
NM_182485chr433612 3393 3322 22493 904 23651 316 --
NM_182488chr13--1701 --1771
NM_182503chr665478 5340 4633 1655 662 372 1176 23567 778 --
NM_182540chrX1764 ------
NM_182559chr121303 ------
NM_182569chr171110 ------
NM_182580chr112025 ------
NM_182641chr1721558 616 ------
NM_182643chr811900 --1736 21792 568
NM_182646chr433612 3393 3322 22493 904 23651 316 --
NM_182648chr142521 183 ------
NM_182678chr21450 ------
NM_182689chr11315 ------
NM_182690chr11377 ------
NM_182691chr731153 210 187 ------
NM_182692chr731153 210 187 ------
NM_182697chr721626 234 ----11371
NM_182700chr72733 655 11217 1675 --
NM_182717chr1031176 1031 113 ------
NM_182720chr1031176 1031 113 ------
NM_182721chr1031176 1031 113 ------
NM_182722chr1031176 1031 113 ------
NM_182723chr1031176 1031 113 ------
NM_182729chr1251619 1573 587 306 260 ------
NM_182742chr1251619 1573 587 306 260 ------
NM_182743chr1251619 1573 587 306 260 ------
NM_182757chr673321 3031 2951 2884 2787 773 393 21389 696 --22541 1304
NM_182763chr152034 2014 706 588 210 32487 1950 1040 150 --
NM_182765chr1021800 739 --1481 --
NM_182767chr1231740 1553 312 ------
NM_182789chr52210 24 --138 11060
NM_182797chr2031319 674 452 ------
NM_182811chr201422 ------
NM_182830chr1422109 1480 ------
NM_182848chr13----21523 215 --
NM_182853chr1031176 1031 113 ------
NM_182898chr756220 4303 2049 604 239 15939 ----
NM_182899chr756220 4303 2049 604 239 15939 ----
NM_182907chr61412 ------
NM_182918chr2131391 1104 390 ------
NM_182920chr32923 547 1227 ----
NM_182931chr71750 ------
NM_182964chr1153299 3003 2291 2038 1021 ------
NM_182976chr11190 ----1550
NM_183011chr1031176 1031 113 ------
NM_183012chr1031176 1031 113 ------
NM_183013chr1031176 1031 113 ------
NM_183043chr132993 895 ------
NM_183044chr132993 895 ------
NM_183049chr4--2404 111 --1322
NM_183065chr1751048 888 858 224 150 ------
NM_183075chr463009 2969 2771 2749 1842 1068 --12235 --
NM_183078chr631470 1218 441 ----12665
NM_183237chr331145 406 232 ------
NM_183323chr52210 24 --138 11060
NM_183353chrX21216 156 --1386 --
NM_183380chr61296 2221 108 ----
NM_183416chr12371 197 ------
NM_183419chr831323 1004 590 1421 ----
NM_194247chr2103916 3765 3754 3670 2799 1719 1490 445 405 207 11311 --1557
NM_194271chr12----1689 --
NM_194291chr852919 2864 2218 1146 724 11027 ----
NM_194292chr11620 --1154 --
NM_194314chr1135414 4320 3887 3509 2002 1857 1849 1694 1470 1412 1390 337 124 11534 ----
NM_194317chr222744 2080 1187 ----
NM_194318chr1342046 1889 587 280 12132 --11971
NM_194328chr932584 1011 169 12082 ----
NM_194329chr932584 1011 169 12082 ----
NM_194330chr932584 1011 169 12082 ----
NM_194332chr932584 1011 169 12082 ----
NM_194435chr62642 194 ------
NM_194442chr141546 1485 1233 280 11178 ----
NM_194454chr761681 1363 1290 1163 546 403 ------
NM_194455chr761681 1363 1290 1163 546 403 ------
NM_194456chr761681 1363 1290 1163 546 403 ------
NM_194463chrX3892 847 816 ------
NM_197941chr542438 2121 1047 719 1684 ----
NM_197968chr13187 ------
NM_197970chr221587 1458 ------
NM_197977chr92840 56 ------
NM_197978chr93504 458 53 ------
NM_198057chrX4998 807 332 62 1348 ----
NM_198086chr1431967 633 351 21732 1596 --1235
NM_198123chr831585 1411 553 --1233 --
NM_198124chr831585 1411 553 --1233 --
NM_198128chr1862306 2193 2021 1539 941 689 31891 1843 1795 1863 11761
NM_198158chr351979 1125 734 707 524 2673 378 ----
NM_198159chr351979 1125 734 707 524 2673 378 ----
NM_198177chr351979 1125 734 707 524 2673 378 ----
NM_198178chr351979 1125 734 707 524 2673 378 ----
NM_198181chr1512072 62511 1045 210 180 152 122 --11924
NM_198186chr92433 406 ------
NM_198187chr92433 406 ------
NM_198215chr103522 335 51 1150 ----
NM_198217chr131840 11105 ----
NM_198218chr131840 11105 ----
NM_198219chr131840 11105 ----
NM_198240chr1221148 163 --11137 --
NM_198243chr15--1242 ----
NM_198268chr194167 3108 3102 2855 2779 2747 1661 574 193 13007 ----
NM_198269chr194167 3108 3102 2855 2779 2747 1661 574 193 13007 ----
NM_198270chrX23436 211 --11058 --
NM_198279chrX31248 1068 216 ------
NM_198336chr761706 1138 654 562 273 63 --1645 --
NM_198401chr82548 66 ------
NM_198465chrX52879 2762 604 280 90 --22308 52 --
NM_198468chr621361 1211 13825 44482 3515 3390 1077 --
NM_198503chr122226 458 ------
NM_198513chr811402 1489 ----
NM_198531chr18--1667 ----
NM_198552chr12197 134 --1179 --
NM_198581chr2127041 6074 5766 5657 5439 5384 5163 2268 2233 1877 880 85 26931 2978 27331 7065 --
NM_198715chr1105287 4498 4227 3982 3824 1246 848 381 292 226 32400 571 471 21036 208 --
NM_198793chr353430 3300 3085 792 233 ----1338
NM_198892chr4156 ------
NM_198900chr1267424 6546 4737 2251 440 399 43093 2242 1553 940 67599 7113 6149 2888 2374 2330 --
NM_198903chr51574 ------
NM_198904chr521804 574 ------
NM_198935chr2042880 2761 2227 547 ------
NM_198956chr72733 655 11217 1675 --
NM_198995chr181477 1548 ----
NM_199039chr42961 886 11003 ----
NM_199051chr1----2220 66 --
NM_199136chr7----173 --
NM_199188chr1283838 3734 3308 2636 1392 1260 720 639 13594 1965 --
NM_199189chr51837 ------
NM_199190chr1283838 3734 3308 2636 1392 1260 720 639 13594 1965 --
NM_199229chr211704 11352 --11180
NM_199244chr92787 78 ----1950
NM_199262chr174861 838 251 169 11865 1637 --
NM_199324chr431165 337 198 ------
NM_199342chr1157 ------
NM_199355chr16--11203 ----
NM_199359chr2011127 1612 ----
NM_199360chr2011127 1612 ----
NM_199361chr2011127 1612 ----
NM_199362chr2011127 1612 ----
NM_199363chr2011127 1612 ----
NM_199421chr1484938 4693 4356 4219 4128 1704 1439 1139 ------
NM_199436chr263043 1121 748 559 482 96 12402 22805 656 --
NM_199437chr1132532 1731 124 22418 57 11682 --
NM_199438chr1132532 1731 124 22418 57 11682 --
NM_199439chr1132532 1731 124 22418 57 11682 --
NM_199461chr1031446 393 215 12748 11228 --
NM_199482chr251988 1981 1516 406 260 ------
NM_201269chr12169 29 --1943 --
NM_201278chr1162358 2201 2045 1671 377 146 --12142 --
NM_201281chr1162358 2201 2045 1671 377 146 --12142 --
NM_201436chr7----1812 --
NM_201439chr122157 38 ------
NM_201440chr122157 38 ------
NM_201515chr122157 38 ------
NM_201516chr7----1868 --
NM_201517chr7----1812 --
NM_201548chr221086 102 ------
NM_201570chr104629 564 489 85 ------
NM_201571chr104629 564 489 85 ------
NM_201572chr104629 564 489 85 ------
NM_201590chr104629 564 489 85 ------
NM_201591chr421736 768 1417 ----
NM_201592chr421736 768 1417 ----
NM_201593chr104629 564 489 85 ------
NM_201595chr14162 ------
NM_201596chr104629 564 489 85 ------
NM_201597chr104629 564 489 85 ------
NM_201624chr11435 11183 ----
NM_201999chr431012 987 783 1771 ----
NM_203301chr1421456 1283 --11327 --
NM_203327chr2063385 3059 2869 2862 1287 1275 ------
NM_203341chr12374 174 ------
NM_203349chr1551812 1623 1415 1360 175 11896 --11437
NM_203350chr131627 1501 681 ------
NM_203364chr1121035 55 --11067 --
NM_203372chr231263 334 23 1689 ----
NM_203379chr103745 663 392 --1269 --
NM_203380chr103745 663 392 --1269 --
NM_203394chr1272460 2277 1694 1666 831 530 518 ----1413
NM_203406chr522260 1075 1161 ----
NM_203437chr22364 21 ------
NM_203446chr2132115 1110 482 1353 1502 --
NM_203459chr132426 2141 880 32227 2044 1786 ----
NM_203504chr452298 2252 1966 1605 922 12559 ----
NM_203505chr452298 2252 1966 1605 922 12559 ----
NM_205768chr131522 394 86 --11816 177
NM_205833chrX2608 36 ------
NM_205836chr51678 ------
NM_206594chr133338 869 85 32238 902 415 21209 1171 12870
NM_206595chr133338 869 85 32238 902 415 21209 1171 12870
NM_206852chr141526 ------
NM_206853chr673087 2954 2693 932 833 166 61 22589 296 14083 --
NM_206854chr674348 4215 3954 2094 1427 1322 1278 23850 1557 25344 762 --
NM_206855chr695313 5180 4919 2392 2287 2243 530 198 59 34815 2522 400 26309 1727 1508
NM_206857chr141526 ------
NM_206866chr2182782 2749 2555 2019 1202 724 670 117 1393 12178 --
NM_206876chr221267 646 --12950 --
NM_206907chr51925 --22697 471 --
NM_206909chr8158094 7913 7566 6027 5780 5074 2595 2547 2388 1871 1547 1392 1192 842 98 --32143 810 301 --
NM_206943chr22699 220 ------
NM_206944chr92792 66 ------
NM_206945chr92792 66 ------
NM_206946chr92792 66 ------
NM_206947chr92792 66 ------
NM_207032chr202603 277 --11340 --
NM_207033chr202511 185 --11248 --
NM_207034chr202511 185 --11248 --
NM_207043chr132254 572 170 12132 ----
NM_207044chr132254 572 170 12132 ----
NM_207047chr132254 572 170 12132 ----
NM_207171chr111847 ----12051
NM_207189chr11138 ------
NM_207299chr94869 803 753 323 ------
NM_207303chr1061305 1116 724 382 210 122 --12590 1557
NM_207304chr133891 768 160 32585 2312 463 1250 1752
NM_207317chr51406 ------
NM_207336chr7138 ------
NM_207337chr122885 366 ------
NM_207344chr1211395 ------
NM_207359chr341659 622 267 49 21967 210 ----
NM_207371chr1031491 1292 388 ------
NM_207387chr1711765 ----11716
NM_207396chr131808 1501 1332 ------
NM_207406chr475364 1782 750 726 653 170 107 35819 4772 1562 ----
NM_207442chr1411046 133 ----
NM_207481chr21973 ------
NM_207491chr411255 1124 11396 --
NM_207520chr23374 306 105 ------
NM_207521chr23374 306 105 ------
NM_207577chr1152909 2419 2169 1993 1892 ------
NM_207647chr932495 2412 892 22329 792 11670 --
NM_207660chr1441672 592 172 35 --11332 --
NM_207661chr1441672 592 172 35 --11332 --
NM_207662chr1441672 592 172 35 --11332 --
NM_212460chr741896 1474 685 602 ------
NM_212471chr1742017 1868 845 579 1523 --12227
NM_212472chr1742017 1868 845 579 1523 --12227
NM_212474chr21951 1800 ----
NM_212475chr21951 1800 ----
NM_212476chr21951 1800 ----
NM_212478chr21951 1800 ----
NM_212482chr21951 1800 ----
NM_212543chr31748 --1740 --
NM_212551chr121023 167 ------
NM_212554chr101398 11466 11277 --
NM_212558chr954221 4001 2801 1380 941 ------
NM_213589chr284279 3759 2181 2042 2028 1584 1366 1229 ------
NM_213590chr1395054 4749 3334 2075 1855 1555 1144 888 23 24981 718 11416 --
NM_213608chr21131 ------
NM_213654chr321534 1196 2528 406 --11524