TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-151a-5p
miRNA Sequence: UCGAGGAGCUCACAGUCUAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5261 25 ------
NM_000024chr53446 435 212 ------
NM_000037chr872191 1727 1659 922 832 610 137 ------
NM_000038chr51428 ----11285
NM_000044chrX2107 83 ------
NM_000051chr1132204 1224 671 --11236 --
NM_000061chrX2152 32 ------
NM_000074chrX5852 773 674 655 114 ------
NM_000084chrX136538 6126 5852 5830 5562 5366 4854 2548 2537 1760 1482 633 532 1829 34816 1999 725 --
NM_000088chr1751187 1174 1146 403 366 1999 ----
NM_000090chr24812 618 161 55 ------
NM_000104chr2398 82 44 ------
NM_000109chrX21924 592 ------
NM_000110chr121046 74 ------
NM_000114chr2041172 1073 207 96 1399 ----
NM_000125chr6104064 3330 1718 1630 1573 1447 1219 1161 436 278 ------
NM_000127chr8162 ------
NM_000138chr1562315 2291 1764 903 376 201 ------
NM_000141chr1031095 1034 309 1994 ----
NM_000151chr1761777 1494 1457 1360 1210 266 --21683 1364 --
NM_000153chr1421673 323 ------
NM_000161chr1471469 1328 1267 1218 677 396 118 ------
NM_000163chr521885 731 ------
NM_000165chr611098 ------
NM_000166chrX3255 141 61 ------
NM_000168chr7133219 3038 2829 2814 2490 2429 2184 2170 2154 2111 769 696 444 ------
NM_000170chr92478 436 ------
NM_000175chr19357 45 25 --148 --
NM_000176chr543518 3456 1098 346 ------
NM_000183chr21100 ------
NM_000188chr103485 207 41 ------
NM_000189chr242271 1923 39 28 12307 11884 --
NM_000192chr1221339 309 ------
NM_000202chrX92721 2638 2490 2483 2449 2439 2416 1478 1156 ------
NM_000208chr19134535 4398 4026 3952 3303 1887 1750 1395 758 728 561 238 51 14011 14539 --
NM_000217chr12125227 4966 4936 3788 3593 3447 2031 1954 1775 1696 1002 828 ------
NM_000221chr24620 226 212 60 ----1280
NM_000222chr441502 566 305 43 12006 ----
NM_000232chr422671 155 ------
NM_000233chr2----1736 --
NM_000238chr72153 128 ------
NM_000240chrX4877 839 669 627 ------
NM_000248chr342394 2142 1954 357 ------
NM_000259chr15126010 5542 5034 5019 4019 2474 1936 1915 1870 1015 535 406 ------
NM_000264chr993132 3091 2876 2332 1060 897 750 575 243 --1823 --
NM_000266chrX1203 ------
NM_000267chr1783457 3443 3189 2139 1123 894 71 46 --13461 1159
NM_000271chr182232 221 ------
NM_000276chrX3448 271 153 --1511 --
NM_000278chr10111990 1891 1702 1637 1627 1594 1541 908 838 750 740 11962 12225 --
NM_000280chr11--1642 ----
NM_000284chrX51990 1756 1497 1286 268 --11869 --
NM_000286chr17189 ------
NM_000304chr17----1925 --
NM_000314chr1043105 2690 2426 913 ------
NM_000318chr832746 280 122 ------
NM_000325chr41162 ------
NM_000330chrX42183 1522 611 437 ------
NM_000332chr6106504 6212 5801 5470 4885 4694 2853 2137 961 289 22308 2298 15917 --
NM_000333chr32400 335 ------
NM_000334chr17122178 1903 1893 1869 1816 1800 1580 880 672 600 293 272 --22207 2034 --
NM_000346chr1751589 1336 1225 705 305 ------
NM_000353chr163389 179 67 ------
NM_000362chr22143545 2899 2883 2876 2688 2678 1213 1103 844 819 412 398 274 67 --11250 --
NM_000369chr143715 617 341 ------
NM_000378chr11179 --1784 --
NM_000386chr173230 145 23 ------
NM_000389chr6101479 1120 980 532 378 329 284 278 262 125 ------
NM_000393chr231323 743 154 ------
NM_000408chr272744 2525 1333 806 800 547 528 ------
NM_000412chr31264 ------
NM_000425chrX2712 587 ------
NM_000430chr17236 24 ----13530
NM_000435chr199866 631 286 259 245 130 102 74 57 ------
NM_000448chr1121013 68 ------
NM_000449chr171268 1045 1014 955 943 116 78 ------
NM_000450chr1----180 --
NM_000451chrX71882 1769 540 457 424 315 94 ------
NM_000461chr384340 4135 3582 3307 3233 1372 1094 131 --11118 13342
NM_000462chr1511805 ------
NM_000474chr71528 ------
NM_000478chr14647 493 468 95 ------
NM_000484chr211431 ------
NM_000489chrX31055 426 293 ------
NM_000500chr64370 152 119 42 ------
NM_000503chr821383 347 ------
NM_000505chr5----129 --
NM_000522chr71135 ------
NM_000525chr1141501 1206 1032 203 ------
NM_000533chrX4760 749 334 109 ----1765
NM_000555chrX207650 7547 5819 5691 5661 5541 4830 3024 2898 2890 2706 2699 2573 1961 1618 999 990 783 509 177 12309 ----
NM_000560chr12702 101 ------
NM_000578chr231632 1512 1311 ------
NM_000587chr56981 450 266 195 119 102 ------
NM_000599chr2114316 4103 3980 3466 3292 2992 2836 1087 675 608 566 ----14591
NM_000609chr1092368 2160 2141 2080 854 532 502 452 288 --1921 --
NM_000610chr1142945 2262 2105 787 22606 688 ----
NM_000611chr11167041 6414 6403 6340 5698 5626 2759 2261 2250 2187 1052 699 612 330 255 22 --26103 340 --
NM_000612chr11103779 3680 3629 2744 2419 693 633 517 121 51 --1170 --
NM_000615chr1152900 2159 1095 891 188 ------
NM_000618chr1285639 4660 2613 1739 1279 805 533 348 ------
NM_000618chr1285639 4660 2613 1739 1279 805 533 348 ------
NM_000620chr12102023 1985 1906 1399 1371 503 411 159 106 67 --2141 132 1183
NM_000621chr1331432 1323 1152 ------
NM_000633chr1835229 2106 1046 --13184 --
NM_000635chr1951635 1580 1047 1031 291 --11586 124
NM_000660chr191231 ------
NM_000680chr8175 --160 --
NM_000684chr1041248 1116 200 105 ------
NM_000686chrX41356 1204 520 361 ------
NM_000687chr204492 201 59 39 ------
NM_000689chr93425 49 30 ------
NM_000706chr122646 636 ------
NM_000719chr12136563 6306 6278 5927 5272 5000 4561 4445 2630 2359 2343 2033 82 ------
NM_000721chr1102703 2241 2116 1988 1834 1815 1734 1686 436 31 1723 --12537
NM_000723chr1761425 493 447 363 276 111 ------
NM_000724chr1031452 1383 245 --11228 --
NM_000725chr122641 260 --1782 --
NM_000726chr221348 1061 ------
NM_000793chr14115032 4629 4536 4013 3978 3649 3366 3189 1271 1075 208 1462 14204 13317
NM_000795chr116919 760 322 286 154 108 1314 1710 --
NM_000801chr2031009 994 186 1893 1202 --
NM_000806chr511629 ------
NM_000809chr4118794 8649 8561 6815 6760 5693 5620 3347 3224 2842 1539 ------
NM_000811chr53675 175 95 ------
NM_000812chr4137 191 ----
NM_000813chr595078 3810 2104 2080 1848 1771 362 193 38 ------
NM_000814chr1553842 3396 2721 2649 559 13108 ----
NM_000816chr53648 519 171 ------
NM_000817chr21983 ------
NM_000818chr102216 31 ------
NM_000824chr42276 55 ------
NM_000826chr422027 1862 ------
NM_000829chr1142043 2032 2017 1940 ----12253
NM_000831chr183842 2049 1768 1069 973 765 297 196 ------
NM_000833chr1641388 1336 1171 1009 ------
NM_000836chr194993 921 854 628 ------
NM_000838chr662680 851 630 585 562 237 --1546 --
NM_000842chr113679 653 275 ------
NM_000855chr11126 ------
NM_000859chr531374 365 182 ------
NM_000861chr352109 1731 571 559 325 --12611 --
NM_000870chr571308 654 629 518 237 152 96 --1206 --
NM_000872chr101145 ------
NM_000875chr15166417 4966 4896 4746 4373 4327 2220 2179 1989 1578 1398 954 634 338 296 151 --14377 15173
NM_000876chr641398 1259 920 170 ------
NM_000883chr74625 618 516 118 ------
NM_000883chr74625 618 516 118 ------
NM_000891chr1763256 2948 2861 1277 662 321 --11124 --
NM_000899chr1253506 3146 3093 1686 607 ------
NM_000901chr421031 250 ------
NM_000903chr1631403 597 289 ------
NM_000912chr863435 2403 251 214 33 21 ------
NM_000914chr61137 ------
NM_000921chr122133 56 ------
NM_000933chr2041443 1384 316 177 ------
NM_000935chr321133 978 ------
NM_000944chr411780 12142 ----
NM_000945chr251706 1561 658 543 42 ------
NM_000949chr52731 117 ------
NM_000958chr51482 ------
NM_000959chr133564 3219 2921 ------
NM_000964chr1741312 1229 1173 503 --2958 162 --
NM_000965chr331059 256 161 ------
NM_000966chr125938 930 884 672 340 --1128 --
NM_000983chr161307 551 524 371 196 73 ------
NM_000990chr1153947 3597 3349 733 46 13459 ----
NM_001001323chr1222874 243 --12937 --
NM_001001331chr352479 1929 1910 1875 1860 ------
NM_001001344chrX62623 2183 2059 730 281 201 ------
NM_001001389chr1142945 2262 2105 787 22606 688 ----
NM_001001390chr1142945 2262 2105 787 22606 688 ----
NM_001001391chr1142945 2262 2105 787 22606 688 ----
NM_001001392chr1142991 2308 2151 833 22652 734 ----
NM_001001395chr1222265 2234 ------
NM_001001438chr21----2263 81 --
NM_001001481chr863087 2698 2628 2615 723 329 --12430 --
NM_001001484chr103958 873 147 ------
NM_001001502chr5186 ------
NM_001001522chr111159 --2323 45 --
NM_001001549chr742569 1908 1060 406 ----1855
NM_001001550chr742569 1908 1060 406 ----1855
NM_001001555chr742569 1908 1060 406 ----1855
NM_001001560chr224719 707 157 125 ------
NM_001001664chr243757 2557 1115 45 11000 --12858
NM_001001701chr432308 2170 2135 ------
NM_001001890chr2154248 2860 2827 2797 1110 ------
NM_001001936chr1051139 998 977 910 467 ------
NM_001001971chr10270 59 ------
NM_001001995chrX31514 351 330 ------
NM_001002032chr171597 170 ----
NM_001002033chr172697 40 1170 ----
NM_001002233chr842155 1953 775 539 ------
NM_001002269chr91162 ------
NM_001002296chr861119 1025 378 366 358 79 ------
NM_001002838chrX41786 1162 402 79 ------
NM_001002840chr73636 583 165 ------
NM_001002860chr1474020 3451 3366 2923 1682 619 516 --14290 14251
NM_001002909chr17101717 1641 1579 433 371 342 334 317 227 206 ------
NM_001002919chr21126 ------
NM_001003652chr1868332 7162 3455 2223 454 48 25722 609 --11095
NM_001003674chr1885912 4720 2662 2514 2310 1755 1116 552 22749 1150 --14620
NM_001003675chr1885912 4720 2662 2514 2310 1755 1116 552 22749 1150 --14620
NM_001003679chr121744 1550 1618 ----
NM_001003698chr651831 1698 583 329 70 ------
NM_001003699chr651831 1698 583 329 70 ------
NM_001003712chr1211118 11258 ----
NM_001003792chr31419 ------
NM_001003793chr31419 ------
NM_001003800chr993291 3193 3135 2832 1509 1221 397 188 181 --11487 --
NM_001003805chr14166 ------
NM_001003809chr18261 46 ------
NM_001003940chr15102980 2761 2540 2508 1252 1175 1029 1011 860 565 1289 12765 --
NM_001003942chr15102980 2761 2540 2508 1252 1175 1029 1011 860 565 1289 12765 --
NM_001003943chr15112984 2765 2544 2512 1256 1179 1033 1015 864 569 22 1293 12769 --
NM_001004065chr943477 3350 1382 556 ------
NM_001004127chr131787 ------
NM_001004317chr651639 1362 1349 1027 957 ------
NM_001004342chr1325816 5759 5603 5561 5350 5075 4620 4387 4202 2225 2147 1974 1906 1871 1601 1482 1422 1410 1313 1031 978 961 842 794 775 751 739 725 711 700 679 456 --14776 --
NM_001004419chr1264332 4253 4037 3532 1329 544 ------
NM_001004720chr23668 103 76 ------
NM_001004722chr23837 272 245 ------
NM_001005217chr42361 64 ------
NM_001005242chr1251591 1365 669 109 22 ------
NM_001005266chr151209 ------
NM_001005267chr151209 ------
NM_001005268chr151209 ------
NM_001005269chr151209 ------
NM_001005271chr1761125 1091 1044 858 275 149 ------
NM_001005273chr1761125 1091 1044 858 275 149 ------
NM_001005340chr71855 ------
NM_001005366chr122767 186 ------
NM_001005404chr1773751 3659 1734 1566 1222 1077 222 23605 275 21586 1081 --
NM_001005463chr1032090 2013 1844 ------
NM_001005473chr596496 6305 5986 5001 2285 1545 1475 1339 173 16253 --15005
NM_001005476chr22748 673 ------
NM_001005505chr331799 1632 1223 --148 --
NM_001005527chr32410 385 ------
NM_001005611chrX3512 451 121 ------
NM_001005746chr221348 1061 ------
NM_001005747chr221348 1061 ------
NM_001005782chr21219 ------
NM_001005845chr81366 1191 ----
NM_001005849chr171398 ------
NM_001005920chr164994 825 724 358 ------
NM_001006115chr382753 1932 1747 874 833 405 208 32 11895 12587 --
NM_001006605chr12946 108 ------
NM_001006605chr12946 108 ------
NM_001006612chrX1383 ------
NM_001006613chrX1383 ------
NM_001006614chrX1383 ------
NM_001006617chr941084 910 335 92 11074 ----
NM_001006619chr941084 910 335 92 11074 ----
NM_001006620chr941084 910 335 92 11074 ----
NM_001006621chr941084 910 335 92 11074 ----
NM_001006623chr231716 360 131 12225 ----
NM_001006665chr14767 507 187 166 --1190 --
NM_001006932chr693197 2694 2552 988 848 617 568 180 42 --22082 572 --
NM_001007023chr14115032 4629 4536 4013 3978 3649 3366 3189 1271 1075 208 1462 14204 13317
NM_001007024chr1794237 3754 3738 3585 2723 1650 957 844 351 ------
NM_001007025chr1794237 3754 3738 3585 2723 1650 957 844 351 ------
NM_001007097chr9104075 3974 3827 3722 3696 3639 3158 1830 322 265 14869 ----
NM_001007098chr12859 317 ------
NM_001007156chr1571884 1762 1687 1519 747 673 221 --2721 22 --
NM_001007226chr1721027 534 ------
NM_001007227chr1721027 534 ------
NM_001007228chr1721027 534 ------
NM_001007229chr1721027 534 ------
NM_001007230chr1721027 534 ------
NM_001007246chr2111378 ------
NM_001007466chr6125155 4915 4437 1491 1484 1474 1326 1185 1177 841 479 148 ------
NM_001007471chr91566 181 ----
NM_001007527chr5186 ------
NM_001007538chr1341560 1538 1381 1168 160 ----
NM_001007553chr131010 146 82 ------
NM_001007559chr181836 ------
NM_001008220chr573315 1034 706 545 303 140 122 --1561 --
NM_001008222chrX61334 1183 1168 1001 890 298 ------
NM_001008225chr71125 ------
NM_001008239chr1893510 3297 2353 1411 1009 700 143 46 22 --1663 --
NM_001008272chr32290 91 --1227 --
NM_001008273chr32290 91 --1227 --
NM_001008392chr373389 2999 2819 2708 2622 1345 993 ----1803
NM_001008393chr442801 2403 2017 1812 ------
NM_001008408chr765796 5616 4039 3931 468 440 12430 ----
NM_001008410chr271883 1612 847 806 751 663 529 ------
NM_001008495chr81754 ------
NM_001008529chr1721295 1056 ------
NM_001008541chr1032273 1772 94 11801 ----
NM_001008541chr1032273 1772 94 11801 ----
NM_001008566chr221439 ------
NM_001008660chr112596 110 11039 ----
NM_001008701chr19152976 2935 2896 2739 2495 2477 2025 1895 1194 1061 880 869 612 504 434 --12968 --
NM_001008707chr1431386 697 307 ------
NM_001008708chr23591 566 491 ------
NM_001008711chr82529 33 1249 ----
NM_001008723chr102394 80 ------
NM_001008738chr532345 2162 1091 ------
NM_001008938chr112387 172 ------
NM_001009554chr494032 3985 3848 3427 1759 1503 1379 1373 433 --151 --
NM_001009554chr494032 3985 3848 3427 1759 1503 1379 1373 433 --151 --
NM_001009566chr151074 1067 960 521 194 ------
NM_001009899chr395838 5293 4982 4499 4433 4068 2345 1975 874 ----15351
NM_001009923chr202595 579 ------
NM_001009958chr73395 221 69 1493 ----
NM_001009996chr32560 199 ------
NM_001010853chr632529 919 475 ------
NM_001010857chr11106 ------
NM_001010861chr132486 1717 713 ----1175
NM_001010867chr176247 5948 5772 4097 2230 963 641 ----11762
NM_001010888chrX54094 3797 3042 1579 1263 ------
NM_001010891chr546504 6442 6316 5634 ------
NM_001010895chr942001 639 497 51 1785 ----
NM_001010897chr132392 358 ------
NM_001010908chr101232 ------
NM_001010911chr101213 ------
NM_001010924chr1021198 903 ------
NM_001010926chr13606 115 55 ------
NM_001010934chr721168 965 11083 ----
NM_001011537chr342162 1676 541 266 ------
NM_001011553chr71398 ------
NM_001011645chrX2107 83 ------
NM_001011658chrX32105 690 201 ------
NM_001011666chr7125867 5687 4784 4761 4731 2099 1631 1576 611 575 565 101 ----11721
NM_001011708chr2102806 2793 2762 2744 2025 1191 1168 1162 1077 346 ------
NM_001012264chr146784 769 734 606 239 226 --1213 --
NM_001012333chr111319 ------
NM_001012334chr111319 ------
NM_001012338chr15141 ------
NM_001012393chr11133913 2047 1756 1722 1705 1606 1493 1348 945 889 291 283 38 ------
NM_001012426chr692465 1330 1188 1173 950 922 707 309 248 ----12880
NM_001012427chr692465 1330 1188 1173 950 922 707 309 248 ----12880
NM_001012642chr15102105 1760 1749 1544 1415 505 321 153 137 32 ------
NM_001012732chr461264 1092 1006 868 350 300 ------
NM_001012751chr1021295 1259 ------
NM_001012755chrX105075 4568 4392 3172 1121 1056 807 502 445 297 11096 ----
NM_001012977chrX81160 1105 499 482 283 204 190 153 ------
NM_001012989chrX133 ------
NM_001013031chr1062406 1303 1068 814 401 248 ------
NM_001013399chr611160 ------
NM_001013415chr431425 1063 312 ------
NM_001013438chr31270 ------
NM_001013439chr31116 ------
NM_001013620chr12128206 7975 6605 5911 3353 3123 2360 1873 1591 1175 806 352 ------
NM_001013624chr1761127 1024 848 294 183 52 --145 --
NM_001013635chr1261184 1171 1156 1124 1053 880 ------
NM_001013690chr1262400 2370 2181 1771 1621 358 --1336 --
NM_001013693chr142774 2138 257 206 ------
NM_001013693chr142774 2138 257 206 ------
NM_001014434chr13644 189 37 ------
NM_001014435chr165509 428 113 87 42 --1131 --
NM_001014797chr10157731 7444 7197 5586 3152 2767 2340 2258 2205 2176 1218 1146 983 502 485 --1665 23029 2499
NM_001014831chr192625 88 --1127 --
NM_001014832chr192625 88 --1127 --
NM_001014834chr192625 88 --1127 --
NM_001014835chr192625 88 --1127 --
NM_001014839chr13905 425 105 ------
NM_001014841chr13905 425 105 ------
NM_001015053chr17101595 1268 1234 1227 1118 558 423 416 271 128 --21531 275 --
NM_001015055chr21114 ------
NM_001015056chr21114 ------
NM_001015056chr21114 ------
NM_001015508chr83709 701 101 ------
NM_001015877chrX43003 813 658 521 ------
NM_001015880chr1041650 423 377 88 11134 11164 --
NM_001015882chr93946 798 111 1868 ----
NM_001015887chr341517 1404 620 513 ------
NM_001017395chr383141 3076 3026 2975 2779 2712 1289 240 ------
NM_001017415chr11188 ------
NM_001017416chr11188 ------
NM_001017424chr141857 527 269 47 ------
NM_001017425chr141857 527 269 47 ------
NM_001017440chr7187393 6699 6551 6515 6251 6055 6018 5781 5760 5470 3178 2820 2576 2251 1045 829 512 68 --1183 --
NM_001017916chr17101763 1711 1688 1569 1507 812 703 602 174 166 --1777 --
NM_001017917chr17101763 1711 1688 1569 1507 812 703 602 174 166 --1777 --
NM_001017926chr841818 1761 1409 1153 ------
NM_001017979chr41285 --1168 --
NM_001017995chr5114298 4205 4117 4098 3048 1876 1809 1275 475 273 38 14245 ----
NM_001017999chr131960 387 379 12293 ----
NM_001017999chr131960 387 379 12293 ----
NM_001018000chr131960 387 379 12293 ----
NM_001018000chr131960 387 379 12293 ----
NM_001018001chr131960 387 379 12293 ----
NM_001018009chr331131 358 349 ------
NM_001018025chrX3748 253 34 ------
NM_001018050chr22103399 2735 2695 2664 2614 2567 2135 333 176 154 ------
NM_001018052chr22103399 2735 2695 2664 2614 2567 2135 333 176 154 ------
NM_001018054chr111067 --1992 --
NM_001018056chr9195 ------
NM_001018064chr931782 102 40 ------
NM_001018065chr9135907 5631 5079 4335 3960 3874 3738 1103 895 863 733 573 132 1426 15301 1245
NM_001018066chr9135907 5631 5079 4335 3960 3874 3738 1103 895 863 733 573 132 1426 15301 1245
NM_001018067chr174888 3500 1938 1246 1027 580 164 13511 1679 --
NM_001018068chr174888 3500 1938 1246 1027 580 164 13511 1679 --
NM_001018069chr174888 3500 1938 1246 1027 580 164 13511 1679 --
NM_001018070chr11131 ----1215
NM_001018074chr543518 3456 1098 346 ------
NM_001018075chr543518 3456 1098 346 ------
NM_001018076chr543518 3456 1098 346 ------
NM_001018077chr543518 3456 1098 346 ------
NM_001018108chr15111901 1818 1583 1508 851 782 700 689 598 588 77 1278 ----
NM_001020658chr141488 450 439 132 ------
NM_001020658chr141488 450 439 132 ------
NM_001023560chr61144 1156 ----
NM_001023567chr1551905 1886 576 457 328 ------
NM_001024071chr143350 289 240 ------
NM_001024094chr543518 3456 1098 346 ------
NM_001024218chr141563 1852 ----
NM_001024226chr1127 ------
NM_001024227chr1127 ------
NM_001024228chr1127 ------
NM_001024401chr1662881 2813 2268 2062 1893 448 --1452 --
NM_001024455chrX72696 2446 2342 2141 1033 969 766 32198 2178 837 ----
NM_001024463chr156848 737 400 367 334 55 ------
NM_001024649chr5102479 2357 2223 2196 1883 915 895 542 42 35 ----11839
NM_001024660chr321522 1044 ------
NM_001024668chr123793 667 175 ------
NM_001024680chr231523 1467 1455 11186 ----
NM_001024807chr193344 219 46 ------
NM_001024808chr12132635 2018 1903 1815 916 891 821 589 538 319 222 163 85 --1739 12383
NM_001024809chr1741312 1229 1173 503 --2958 162 --
NM_001024847chr361991 1662 1627 1529 611 228 ------
NM_001024858chr14182761 2706 2693 2567 2555 2529 2421 2015 1992 1112 806 691 681 623 315 302 238 70 ------
NM_001024934chr61126 165 ----
NM_001024935chr61126 165 ----
NM_001024936chr61126 165 ----
NM_001024937chr175718 694 588 199 182 ------
NM_001024948chr122391 1272 13295 ----
NM_001025068chr34659 390 139 82 ------
NM_001025069chr34659 390 139 82 ------
NM_001025076chr10115926 5237 5216 5022 4979 4919 4802 4384 4338 4271 2213 --12217 --
NM_001025077chr10157284 6595 6574 6380 6337 6277 6160 5742 5696 5629 1386 1160 271 248 221 --1444 --
NM_001025079chr3113537 3206 3095 2711 2653 2555 2544 2526 1107 906 781 ----12660
NM_001025081chr1841180 1143 1032 477 ------
NM_001025090chr1841180 1143 1032 477 ------
NM_001025092chr1841180 1143 1032 477 ------
NM_001025101chr1841180 1143 1032 477 ------
NM_001025105chr521379 1021 ------
NM_001025107chr1112711 2435 2152 2047 1669 854 498 480 301 103 71 12492 ----
NM_001025107chr1112711 2435 2152 2047 1669 854 498 480 301 103 71 12492 ----
NM_001025108chr274010 1481 1220 1087 628 214 119 ------
NM_001025201chr21527 ------
NM_001025205chr3291 42 ------
NM_001025252chr822670 2270 ------
NM_001025253chr822670 2270 ------
NM_001025266chr3114835 4686 4514 4324 4312 3746 3360 1326 500 359 156 14888 13960 --
NM_001025366chr611708 ------
NM_001025366chr611708 ------
NM_001025367chr611708 ------
NM_001025367chr611708 ------
NM_001025368chr611708 ------
NM_001025368chr611708 ------
NM_001025369chr611724 ------
NM_001025369chr611724 ------
NM_001025370chr611708 ------
NM_001025370chr611708 ------
NM_001025579chr1761129 865 762 291 122 21 --2294 44 --
NM_001025580chrX84116 4026 3742 3604 3027 597 464 46 --1322 --
NM_001025596chr113207 126 118 ------
NM_001025603chr171268 1045 1014 955 943 116 78 ------
NM_001025780chr911560 11378 ----
NM_001029858chr682948 2845 2550 2118 856 840 619 538 ------
NM_001029863chr642644 2009 1157 1128 ------
NM_001029882chr12598 182 ------
NM_001029882chr12598 182 ------
NM_001029976chr83149 52 41 ------
NM_001029989chr152613 356 ------
NM_001029998chr431006 576 458 1526 ----
NM_001030006chr17102689 2624 2617 2415 2229 2155 771 620 613 261 --12237 --
NM_001030007chr16122982 2951 2834 2719 2469 1285 775 759 443 256 231 187 --13015 --
NM_001030055chr1414031 1988 ----
NM_001030272chr111423 ------
NM_001030273chr111423 ------
NM_001030287chr12874 382 ------
NM_001031677chr52388 64 ------
NM_001031679chr1253358 3300 2724 1246 358 ------
NM_001031689chr9150 ------
NM_001031690chr7102828 2786 2738 2460 2245 2099 2069 2061 1135 410 ------
NM_001031694chr14906 693 385 222 --1780 --
NM_001031694chr14906 693 385 222 --1780 --
NM_001031695chr22135075 4984 4925 4128 3904 3565 3299 1514 1285 1243 826 620 598 --25207 4382 --
NM_001031723chr41158 ------
NM_001031740chr141093 518 381 181 ------
NM_001031801chr221144 --1120 --
NM_001031804chr1694419 3660 2993 2909 2766 1227 636 594 578 ------
NM_001031812chr512024 1476 11431 --
NM_001032221chr961443 671 422 302 161 141 ------
NM_001032280chr631193 1176 603 --11493 --
NM_001032282chr811275 ------
NM_001032288chr2041139 999 577 379 ------
NM_001032289chrX4333 277 205 192 ------
NM_001032293chr171494 ------
NM_001032363chr151787 1594 1556 1533 53 --21879 495 --
NM_001032363chr151787 1594 1556 1533 53 --21879 495 --
NM_001032380chr1021307 130 ------
NM_001032393chrX3718 170 147 ------
NM_001033025chr181522 1242 1224 1215 1163 529 507 55 --1237 --
NM_001033026chr193432 160 87 ------
NM_001033044chr151775 1452 348 205 59 1631 ----
NM_001033045chr21119 11160 ----
NM_001033047chr43631 476 65 --1322 1193
NM_001033056chr151775 1452 348 205 59 1631 ----
NM_001033057chr311785 ------
NM_001033059chr622005 205 ------
NM_001033081chr15721 697 612 466 196 ------
NM_001033082chr15721 697 612 466 196 ------
NM_001033087chr2072694 2665 2084 2038 894 674 251 ------
NM_001033117chr3164788 4699 4482 4301 4042 3886 3550 3496 1612 1479 1459 1260 893 490 317 290 14525 13962 --
NM_001033506chr11125 ------
NM_001033507chr141973 1513 1504 1487 ------
NM_001033551chr1774055 3362 1087 979 400 328 255 --21057 501 --
NM_001033554chr171242 ------
NM_001033561chr174827 796 773 297 ------
NM_001033564chr631728 1410 358 ------
NM_001033566chr172667 354 ------
NM_001033568chr172667 354 ------
NM_001033602chr1362355 2300 2162 1827 653 138 --22514 36 --
NM_001033659chr1721456 1355 ------
NM_001033723chr882706 2477 2183 1995 1971 950 764 745 --11768 --
NM_001033756chr611642 ------
NM_001033756chr611642 ------
NM_001033910chr111758 ------
NM_001033925chr1031874 1747 1342 ------
NM_001033952chr113243 111 72 ------
NM_001033953chr11144 ------
NM_001034025chr122881 62 ------
NM_001034837chr52263 196 ------
NM_001034838chr52263 196 ------
NM_001034954chr1032652 1100 786 ------
NM_001034955chr1032652 1100 786 ------
NM_001034956chr1032652 1100 786 ------
NM_001034957chr1032652 1100 786 ------
NM_001035254chr9112507 2458 2395 1945 961 827 745 588 558 228 119 ------
NM_001035267chr121281 ------
NM_001035511chr192139 1885 1758 1481 1447 1436 713 345 214 --127 1664
NM_001035512chr1102246 1992 1865 1588 1554 1543 820 452 321 97 --1134 1771
NM_001035513chr1102246 1992 1865 1588 1554 1543 820 452 321 97 --1134 1771
NM_001035521chr24794 227 142 23 ------
NM_001037131chr24439 218 106 60 --1847 --
NM_001037132chr742138 2033 281 230 ------
NM_001037133chr742138 2033 281 230 ------
NM_001037164chr71198 ------
NM_001037165chr7168928 8107 7528 7298 6750 6558 6525 6409 6073 5534 3015 2307 1783 1380 270 252 ------
NM_001037174chr221823 1770 ------
NM_001037317chr132486 1717 713 ----1175
NM_001037331chr182360 198 1913 ----
NM_001037339chr131623 674 371 138 ----
NM_001037340chr131623 674 371 138 ----
NM_001037341chr131623 674 371 138 ----
NM_001037341chr131623 674 371 138 ----
NM_001037553chr21105159 4881 4773 4762 1906 1264 1080 752 383 314 1564 11704 --
NM_001037738chr51292 ------
NM_001037954chr1163269 2991 891 648 226 125 ----1806
NM_001038493chr241098 570 198 72 --21102 311 --
NM_001038707chr182242 2171 1712 1533 1432 781 450 374 ----189
NM_001038707chr182242 2171 1712 1533 1432 781 450 374 ----189
NM_001039199chr2074879 4020 3335 3201 3153 1855 848 --198 --
NM_001039348chr21913 --11035 --
NM_001039349chr21913 --11035 --
NM_001039350chr751452 1282 238 170 78 ------
NM_001039459chr73881 460 200 ------
NM_001039479chr1462245 1658 1588 470 447 228 --1392 --
NM_001039538chr243063 2793 2679 818 ------
NM_001039550chr22751 179 ------
NM_001039570chr22144115 4092 3908 3483 3127 1837 1824 602 401 191 136 100 92 79 --1122 --
NM_001039571chr22144115 4092 3908 3483 3127 1837 1824 602 401 191 136 100 92 79 --1122 --
NM_001039574chr13914 690 110 ------
NM_001039577chr173982 1815 1353 1339 1165 1147 777 12883 13870 --
NM_001039583chr223513 138 130 ------
NM_001039584chr223513 138 130 ------
NM_001039585chr143821 3476 3178 82 ------
NM_001039590chrX43323 2475 1162 399 ------
NM_001039591chrX43323 2475 1162 399 ------
NM_001039690chr1642221 2165 1897 210 --140 --
NM_001039762chr1052252 1954 1678 1558 644 --2194 123 --
NM_001039771chr143978 882 314 ------
NM_001039772chr11164 ------
NM_001039802chr121233 430 ------
NM_001039840chrX84588 4265 4150 4015 2341 1675 886 83 24953 1592 25686 128 --
NM_001039888chr16790 726 662 629 559 504 ------
NM_001039916chr122348 169 193 1116 --
NM_001039917chr122348 169 193 1116 --
NM_001039918chr122348 169 193 1116 --
NM_001039919chr122348 169 193 1116 --
NM_001039920chr122348 169 193 1116 --
NM_001039937chr1332912 2547 245 --11003 --
NM_001039960chr1261257 1057 648 397 250 116 ------
NM_001040002chr1771064 482 362 327 296 203 81 ------
NM_001040033chr12702 101 ------
NM_001040057chr72984 205 ------
NM_001040100chr341055 925 432 113 ------
NM_001040108chr1422109 1205 ------
NM_001040135chr74785 239 220 203 ------
NM_001040144chr1642221 2165 1897 210 --140 --
NM_001040146chr1642221 2165 1897 210 --140 --
NM_001040151chr11134389 4261 3995 3832 3768 3683 3229 3142 3025 2997 2892 854 823 --14581 --
NM_001040152chr775080 5055 5021 3132 1206 853 189 ----1698
NM_001040172chr571308 654 629 518 237 152 96 --1206 --
NM_001040173chr571308 654 629 518 237 152 96 --1206 --
NM_001040181chr33964 804 733 ------
NM_001040182chr33964 804 733 ------
NM_001040183chr33964 804 733 ------
NM_001040199chr33964 804 733 ------
NM_001040200chr33964 804 733 ------
NM_001040202chr431022 652 555 ------
NM_001040214chr642219 1745 345 206 ------
NM_001040272chr972344 1659 1450 455 446 285 136 ------
NM_001040273chr1052084 2066 2047 1772 358 ------
NM_001040284chr1641313 1062 745 28 ----14039
NM_001040402chr442458 1018 867 96 ------
NM_001040424chr2132086 931 474 ------
NM_001040429chr1332529 1374 42 ------
NM_001040439chr1641428 1308 541 100 ------
NM_001040441chr175119 3867 2054 1935 1621 1561 1278 ------
NM_001040455chr1151146 415 373 256 46 ------
NM_001040458chr54726 694 476 272 ----1358
NM_001040619chr141324 223 205 130 ------
NM_001040624chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040625chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040626chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040627chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040628chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040629chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040630chr8102449 2341 2323 2174 2081 1913 1878 1862 535 135 ------
NM_001040708chr811026 --1381 --
NM_001040709chr1102134 1632 897 831 819 549 476 189 76 44 ------
NM_001040712chr952525 809 618 392 60 1496 ----
NM_001042353chr206482 472 407 382 370 222 --1556 --
NM_001042361chr102457 85 ------
NM_001042364chr102457 85 ------
NM_001042365chr102457 85 ------
NM_001042370chr11229 ------
NM_001042387chr102457 85 ------
NM_001042388chr181108 ------
NM_001042393chr102457 85 ------
NM_001042396chr102457 85 ------
NM_001042397chr102457 85 ------
NM_001042404chr111936 --11591 --
NM_001042413chr983824 1135 1101 1089 610 569 556 192 11210 ----
NM_001042424chr4112692 2581 2414 1980 746 652 634 558 395 344 242 1482 1132 --
NM_001042425chr631193 1176 603 --11493 --
NM_001042472chr203557 53 42 --1234 --
NM_001042486chr2041527 1217 411 248 ------
NM_001042492chr1783457 3443 3189 2139 1123 894 71 46 --13461 1159
NM_001042494chr1553577 3491 1110 900 475 ------
NM_001042495chr1553577 3491 1110 900 475 ------
NM_001042496chr1553577 3491 1110 900 475 ------
NM_001042497chr1553577 3491 1110 900 475 ------
NM_001042498chrX4414 342 329 100 1723 ----
NM_001042506chrX6499 482 283 204 190 153 ------
NM_001042510chr852112 1346 451 225 39 ------
NM_001042511chr852112 1346 451 225 39 ------
NM_001042537chrX52026 1715 831 409 345 ----11571
NM_001042539chr164985 943 364 239 ------
NM_001042555chr1283553 3033 1279 1210 553 534 173 92 13380 ----
NM_001042599chr2127613 7588 6734 5510 5365 2808 2338 2162 1957 1525 1489 351 ------
NM_001042601chr353296 2323 2176 821 503 ------
NM_001042603chr12115336 5326 4698 3909 3897 1784 1544 1370 419 237 145 ------
NM_001042604chr354317 3833 1719 1382 33 ------
NM_001042610chr1641383 1282 1197 188 ------
NM_001042632chr2072215 1901 1713 1672 1615 252 118 12203 11665 --
NM_001042633chr2072215 1901 1713 1672 1615 252 118 12203 11665 --
NM_001042663chr121076 523 --1507 11357
NM_001042664chr121076 523 --1507 11357
NM_001042665chr121076 523 --1507 11357
NM_001042681chr152427 2398 2155 2041 875 22460 307 12085 --
NM_001042682chr152427 2398 2155 2041 875 22460 307 12085 --
NM_001042682chr152427 2398 2155 2041 875 22460 307 12085 --
NM_001042683chr621437 545 ------
NM_001042728chr125938 930 884 672 340 --1128 --
NM_001042749chrX1625 ------
NM_001042750chrX1625 ------
NM_001042751chrX1625 ------
NM_001043318chr1493771 3537 2943 1263 1063 968 887 815 695 11539 31378 1067 227 13217
NM_001043351chr151897 175 138 122 32 ----1787
NM_001044305chr661453 1391 1281 639 283 47 11533 ----
NM_001044385chr263649 3636 3065 916 779 609 23933 3710 ----
NM_001044722chr512024 1476 11431 --
NM_001044723chr512024 1476 11431 --
NM_001046chr52429 220 ------
NM_001048183chr143180 1136 626 51 12893 13737 23233 2577
NM_001049chr1462353 1560 769 299 288 271 ------
NM_001068chr3159 ------
NM_001069chr61137 ------
NM_001077628chr13483 463 50 ------
NM_001079874chr121869 130 ------
NM_001083620chr422025 1860 ------
NM_001083621chr184619 4493 3945 3371 3275 784 656 524 ------
NM_001087chr22153 130 ------
NM_001095chr12111840 1710 1684 1520 1493 1281 1270 707 263 120 74 ------
NM_001096chr173840 306 46 ------
NM_001099678chr355573 5240 4200 2128 1858 ------
NM_001100108chr1148329 7876 7852 7767 7472 6629 5850 2198 2151 1220 1207 1153 807 705 ------
NM_001106chr3178436 7570 7475 6273 3374 3039 2959 2662 2203 1838 1765 1014 729 521 496 479 462 18671 17228 --
NM_001111chr1112711 2435 2152 2047 1669 854 498 480 301 103 71 12492 ----
NM_001113490chrX53468 2479 2272 1174 770 ------
NM_001116chr1652602 2192 1963 1140 464 ------
NM_001117chr1852072 2024 739 675 653 ------
NM_001119chr451373 1358 1305 1260 80 --1982 --
NM_001121chr102565 297 ------
NM_001122631chr11----1555 --
NM_001122679chr5261 25 ------
NM_001126chr11936 ----132
NM_001127chr224874 843 750 75 --2358 79 --
NM_001128chr16122982 2951 2834 2719 2469 1285 775 759 443 256 231 187 --13015 --
NM_001130chr191204 ------
NM_001135chr152757 84 ------
NM_001140chr175237 228 208 193 97 ------
NM_001144chr1631041 241 197 ------
NM_001146chr851951 1938 1757 1673 1575 ------
NM_001147chr8193 ------
NM_001148chr441510 1500 503 127 11358 ----
NM_001159chr23264 232 39 ------
NM_001163chr941004 758 59 40 --144 --
NM_001167chrX64664 4562 2536 1958 1440 1206 --1773 --
NM_001173chr1414031 1988 ----
NM_001175chr122100 75 ------
NM_001178chr111423 ------
NM_001187chr212476 184 ------
NM_001191chr2061214 1125 1107 573 378 41 ------
NM_001198chr672304 2243 2225 2178 1901 1638 434 ------
NM_001204chr2137383 6951 6932 5367 5220 2204 1845 1760 1489 1298 1182 688 555 ------
NM_001205chr5--1415 ----
NM_001206chr952865 2782 1189 308 148 ------
NM_001219chr741390 897 147 25 ------
NM_001221chr41106 ------
NM_001222chr1021804 1612 ------
NM_001225chr11132 ------
NM_001237chr42800 356 ------
NM_001237chr42800 356 ------
NM_001256chr1732110 1173 744 ------
NM_001257chr164561 444 195 188 ------
NM_001259chr765988 5430 4473 1060 578 143 ------
NM_001265chr134702 330 319 72 ------
NM_001268chr132253 68 ------
NM_001273chr124587 384 69 46 ------
NM_001275chr142405 277 ------
NM_001280chr19----197 --
NM_001282chr17102689 2624 2617 2415 2229 2155 771 620 613 261 --12237 --
NM_001293chr112386 62 ------
NM_001300chr102448 350 --1132 --
NM_001304chr1762938 2503 2371 1461 1199 55 ------
NM_001310chr1222058 2020 --12445 --
NM_001315chr641937 385 265 106 --12142 --
NM_001319chr19132 1438 --1710
NM_001331chr11102629 1900 1871 1100 1069 942 670 624 499 84 ------
NM_001332chr54571 451 409 389 ------
NM_001343chr551212 695 594 539 149 ------
NM_001346chr362753 669 567 510 360 117 ------
NM_001352chr19136 ------
NM_001356chrX22495 754 ------
NM_001358chr4179 ------
NM_001364chr11164467 4370 4176 3867 3705 3339 3314 3297 3265 3233 3187 3170 3123 1089 921 295 --14531 --
NM_001365chr173501 258 162 --1239 --
NM_001382chr112117 108 --187 --
NM_001387chr562900 2580 2210 923 787 738 ----12445
NM_001390chr1892862 2673 1342 1214 1128 999 983 644 27 ------
NM_001392chr18165 ------
NM_001395chrX1194 ------
NM_001397chr182590 2257 1844 1825 1793 1037 502 113 ------
NM_001400chr12483 319 ------
NM_001406chr17151669 1646 1516 1475 1358 466 453 415 388 299 274 248 141 125 52 ------
NM_001407chr361658 1548 1442 564 421 381 ------
NM_001408chr171495 1308 1298 1094 1069 404 304 ------
NM_001417chr1251743 1728 1466 1217 522 ------
NM_001419chr19104433 3653 3145 3099 1860 1785 1454 1316 1090 922 13353 1934 --
NM_001420chr1922525 2494 --22149 1229 --
NM_001421chrX61677 1634 1579 1435 1287 694 --21343 1236 --
NM_001422chr1131295 210 91 11100 ----
NM_001423chr1231991 1568 755 ------
NM_001426chr23589 495 264 ------
NM_001429chr223906 416 111 ------
NM_001438chr173001 493 364 309 251 211 160 --13142 --
NM_001439chr181522 1242 1224 1215 1163 529 507 55 --1237 --
NM_001448chrX21544 1443 ------
NM_001449chrX51081 490 443 263 119 ------
NM_001461chr12388 213 ------
NM_001482chr152374 117 ------
NM_001495chr87981 936 912 905 801 156 142 ------
NM_001521chr24794 227 142 23 ------
NM_001523chr191113 --1252 --
NM_001527chr644745 4728 4277 1150 ------
NM_001543chr594827 4620 4218 1947 1919 1874 1838 1804 468 ------
NM_001546chr631248 1112 234 ------
NM_001555chrX3205 103 29 ------
NM_001584chr1131062 1021 495 ------
NM_001587chrX3448 271 153 --1511 --
NM_001604chr11--1642 ----
NM_001614chr17--2610 131 ----
NM_001614chr17--2610 131 ----
NM_001616chr262977 2963 2554 2536 1370 984 ------
NM_001621chr742535 1868 892 525 11109 ----
NM_001621chr742535 1868 892 525 11109 ----
NM_001634chr622005 205 ------
NM_001635chr72954 876 ------
NM_001642chr1141298 1234 843 406 ------
NM_001649chrX112499 2330 2144 2111 1850 962 903 724 421 334 110 ------
NM_001650chr1863849 2695 1522 615 352 35 --21622 1086 --
NM_001654chrX1415 ------
NM_001658chr1127 ------
NM_001659chr12142676 2668 2626 2506 2264 2206 2079 2045 912 743 735 672 160 80 12085 ----
NM_001660chr3----1203 --
NM_001662chr74254 105 93 75 ------
NM_001664chr33988 924 222 ------
NM_001665chr113485 431 154 ------
NM_001674chr12874 382 ------
NM_001678chr17121645 1627 1469 1411 1401 1324 661 584 558 448 203 148 1142 ----
NM_001682chr1212588 --12651 --
NM_001683chr352479 1929 1910 1875 1860 ------
NM_001686chr12----134 --
NM_001690chr352544 1695 315 211 37 12552 ----
NM_001694chr16153 ------
NM_001695chr863585 3375 3330 1538 280 33 ------
NM_001699chr1941724 1663 1642 160 ------
NM_001701chr941296 1280 557 56 11168 ----
NM_001702chr81557 ------
NM_001704chr61153 ------
NM_001706chr32231 39 ------
NM_001709chr112881 425 1230 ----
NM_001718chr631311 285 274 ------
NM_001731chr123920 749 69 ------
NM_001741chr113243 111 72 ------
NM_001742chr711526 --1321 --
NM_001743chr21137 ------
NM_001745chr541175 275 266 51 ------
NM_001746chr5102479 2357 2223 2196 1883 915 895 542 42 35 ----11839
NM_001753chr751509 1407 590 564 166 ------
NM_001754chr2154248 2860 2827 2797 1110 ------
NM_001755chr1621941 341 --11883 --
NM_001759chr12174938 4633 4509 4287 3979 3833 3420 3326 3211 1951 1853 1416 1261 1185 1042 1034 51 14788 11087 13742
NM_001761chr1611762 ------
NM_001773chr191408 1387 1323 1229 1181 1166 1092 83 61 ------
NM_001777chr3113537 3206 3095 2711 2653 2555 2544 2526 1107 906 781 ----12660
NM_001782chr9394 81 56 ------
NM_001788chr71398 ------
NM_001791chr121233 430 ------
NM_001798chr124786 732 242 42 11090 ----
NM_001800chr192193 77 ------
NM_001810chr204768 693 663 222 ------
NM_001821chr131715 1281 37 --13059 --
NM_001822chr21527 ------
NM_001825chr51134 ------
NM_001830chrX73156 2825 2456 1100 979 740 337 ------
NM_001833chr9161 ------
NM_001839chr12660 165 ------
NM_001842chr92194 118 ------
NM_001854chr11255 ------
NM_001859chr943538 2993 269 96 ------
NM_001862chr2178 ------
NM_001891chr4129 ------
NM_001892chr521379 1021 ------
NM_001895chr2061052 1003 451 423 382 296 ----158
NM_001915chr17101763 1711 1688 1569 1507 812 703 602 174 166 --1777 --
NM_001918chr1157694 7208 7014 6859 6586 6484 5966 5939 5671 5611 3717 3479 3130 2985 768 12764 16624 --
NM_001921chr461264 1092 1006 868 350 300 ------
NM_001927chr21130 ------
NM_001933chr1441152 1012 904 56 ------
NM_001935chr23924 861 359 ------
NM_001936chr751452 1282 238 170 78 ------
NM_001938chr11360 ------
NM_001945chr51109 ------
NM_001946chr121773 --121 --
NM_001949chr671203 1137 529 427 310 97 24 ------
NM_001954chr64618 524 279 175 ------
NM_001962chr52452 235 ------
NM_001965chr2289 77 1137 193 --
NM_001968chr42588 76 ------
NM_001969chr1441311 524 352 49 --11323 --
NM_001970chr173536 236 105 ------
NM_001973chr12364 273 ------
NM_001975chr124793 753 243 183 --1145 --
NM_001977chr451431 616 375 161 48 ------
NM_001978chr82868 107 ------
NM_001980chr121247 131 ----
NM_001981chr131746 1737 505 ------
NM_001982chr1251230 316 259 201 69 ------
NM_001987chr12143918 3495 3309 2955 1697 1634 1602 1500 1314 1113 501 356 276 136 --23922 1585 --
NM_001995chr461165 580 523 286 141 48 ------
NM_001999chr531334 1250 118 ------
NM_002006chr495499 5188 4959 4633 4154 1504 803 619 556 ----1816
NM_002010chr131187 ------
NM_002015chr1362392 2325 2191 2104 1178 141 ----13064
NM_002017chr1121412 172 ------
NM_002024chrX21787 1435 ------
NM_002025chrX128439 8042 7559 7547 7443 7377 3536 3390 2677 1199 1077 916 ------
NM_002026chr22874 156 ------
NM_002028chr142892 279 ----11315
NM_002031chr61212 ------
NM_002035chr1881458 1408 1072 920 799 638 433 130 --13800 --
NM_002040chr2111027 12874 ----
NM_002045chr32348 68 ------
NM_002048chr92223 195 ------
NM_002060chr13484 375 198 ------
NM_002065chr151775 1452 348 205 59 1631 ----
NM_002072chr92787 223 ------
NM_002074chr121516 1493 --11156 --
NM_002076chr12102844 2374 2181 1095 1027 875 785 305 222 160 ------
NM_002077chr9102150 2064 1917 1793 1635 1560 1548 1531 1490 510 --21838 1564 --
NM_002080chr162834 347 ------
NM_002081chr271762 1704 1233 1128 1104 391 380 ------
NM_002086chr17112066 2058 2043 2008 1883 1790 498 438 284 255 243 ------
NM_002092chr473792 3755 3251 3115 1267 880 422 ------
NM_002094chr16173 ------
NM_002107chr1158 ------
NM_002111chr4103511 3264 3198 3139 3045 1469 1020 877 552 540 --23683 881 --
NM_002114chr6166 --1459 --
NM_002128chr1322084 71 1787 ----
NM_002131chr661241 949 915 854 386 23 11008 ----
NM_002135chr123412 401 123 ------
NM_002136chr121479 ------
NM_002140chr91131 ------
NM_002141chr7270 49 ------
NM_002145chr171296 --142 --
NM_002146chr172438 141 ------
NM_002156chr2164 ------
NM_002158chr233695 2418 433 ------
NM_002160chr91172 ------
NM_002165chr201298 ------
NM_002167chr1----1354 --
NM_002181chr23511 495 119 ------
NM_002188chr52696 216 ------
NM_002198chr52292 28 --1145 --
NM_002199chr42918 165 ------
NM_002204chr1741372 1170 1000 214 --11347 --
NM_002205chr122224 116 ------
NM_002207chr33123 86 46 ------
NM_002210chr241406 978 311 159 ------
NM_002214chr773983 3559 2247 1571 1470 1042 647 --11410 --
NM_002221chr172868 2495 2187 1159 1094 64 39 --12357 12635
NM_002227chr13262 189 46 --1266 --
NM_002228chr131197 942 404 ------
NM_002230chr178984 892 825 744 323 105 61 44 ------
NM_002232chr121252 209 ------
NM_002240chr213251 52 25 ------
NM_002241chr192342 2266 2192 1018 933 737 120 42 27 ------
NM_002247chr1042345 2239 2105 801 ------
NM_002249chr11448 --1416 --
NM_002253chr41205 ------
NM_002254chr272120 2056 1743 578 407 171 160 ------
NM_002264chr3104572 3428 3334 1839 1593 1160 763 569 342 92 --11441 --
NM_002265chr171304 ------
NM_002267chr1342154 744 347 227 12232 ----
NM_002268chr331810 771 535 ------
NM_002270chr575461 3729 2177 1982 1641 1575 690 ------
NM_002271chr1341519 796 639 299 ----11939
NM_002274chr173311 276 252 ------
NM_002283chr122772 553 ------
NM_002285chr274010 1481 1220 1087 628 214 119 ------
NM_002293chr192413 2173 2161 1775 1735 496 378 216 102 --1970 --
NM_002298chr1371482 1448 663 560 548 507 478 1239 1285 --
NM_002310chr5115819 5481 5418 4611 2336 1881 1837 1045 971 505 454 ------
NM_002319chr72309 39 ------
NM_002333chr1941266 982 437 253 1894 ----
NM_002334chr11101604 1511 1322 687 406 340 286 106 60 38 ------
NM_002336chr12104966 4837 2034 1690 1499 1308 1046 935 880 746 ------
NM_002353chr12180 84 ------
NM_002355chr123568 146 27 ------
NM_002356chr642826 2609 1945 256 ------
NM_002359chr17123891 3073 2949 2824 2729 2682 1615 1120 117 105 96 84 ------
NM_002361chr192220 78 ------
NM_002373chr1561309 1225 504 481 332 45 ------
NM_002374chr243063 2793 2679 818 ------
NM_002375chr392066 1829 1606 1578 1514 538 341 214 79 ----12244
NM_002382chr144491 345 179 57 ------
NM_002383chr167808 766 365 348 302 187 62 ------
NM_002384chr181212 ------
NM_002385chr1841180 1143 1032 477 ------
NM_002387chr593591 3165 3131 1264 920 424 417 300 208 14479 ----
NM_002391chr111319 ------
NM_002397chr521940 275 ------
NM_002399chr1541333 1075 969 118 ------
NM_002401chr1721867 83 ------
NM_002404chr175863 375 238 112 29 --1867 --
NM_002406chr55858 745 393 370 354 --131 --
NM_002430chr22102195 2060 1791 1738 828 726 354 294 39 23 --1843 --
NM_002442chr1231723 1327 442 --1211 --
NM_002444chrX121664 1438 1379 1357 754 465 372 269 227 220 42 30 ------
NM_002451chr963557 3434 2836 2592 1200 273 12732 --13060
NM_002465chr123235 45 32 ------
NM_002473chr224446 276 182 116 ------
NM_002479chr13210 147 27 ------
NM_002480chr1241418 573 511 92 ------
NM_002486chr932288 758 272 ------
NM_002494chr4153 ------
NM_002499chr1542314 2046 694 447 ------
NM_002500chr22930 213 ------
NM_002501chr19134128 3926 3899 3197 1585 1545 1408 1335 1149 898 354 182 32 182 13008 --
NM_002505chr651510 568 392 353 69 11136 ----
NM_002507chr1741744 672 286 119 --11913 --
NM_002508chr161618 1580 1572 546 538 178 21985 1683 --1418
NM_002509chr202626 219 --1175 --
NM_002515chr1461668 1540 1374 1262 708 39 ------
NM_002516chr195229 106 61 46 36 ------
NM_002519chr1121303 1103 ------
NM_002522chr1792713 2536 2526 1236 978 879 843 205 76 ------
NM_002526chr61580 11123 ----
NM_002530chr15141 ------
NM_002537chr152792 142 --186 --
NM_002539chr21215 ------
NM_002544chr17137 ------
NM_002545chr11133913 2047 1756 1722 1705 1606 1493 1348 945 889 291 283 38 ------
NM_002546chr82171 28 ------
NM_002547chrX83184 3083 1657 744 358 338 194 113 ------
NM_002553chr71398 ------
NM_002556chr11101985 1968 1840 1625 1530 863 757 732 294 98 ------
NM_002569chr1531405 1279 986 --140 --
NM_002570chr153825 365 60 ------
NM_002572chr11275 38 ------
NM_002575chr181112 ------
NM_002576chr1171186 315 225 143 127 103 86 --192 --
NM_002577chr3103725 3122 2948 1526 1514 1492 901 504 444 413 ------
NM_002578chrX3398 387 329 ------
NM_002581chr965061 4728 4706 2153 961 459 ------
NM_002585chr11133 ------
NM_002586chr641573 1290 306 235 ------
NM_002588chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_002594chr2041640 1620 807 56 ------
NM_002595chr124719 413 216 121 ------
NM_002600chr131623 674 371 138 ----
NM_002601chr22327 72 --2331 320 --
NM_002603chr81145 ------
NM_002605chr152467 228 --177 --
NM_002607chr72246 131 ------
NM_002608chr2251398 621 336 188 74 --11133 --
NM_002612chr75676 656 215 119 89 ------
NM_002613chr16105380 3622 2118 2103 1943 1865 1414 1261 1156 462 ------
NM_002616chr173382 114 48 ------
NM_002622chr55687 631 216 82 23 ------
NM_002628chr31439 ------
NM_002633chr11473 ------
NM_002634chr173859 719 191 ------
NM_002635chr121176 ------
NM_002636chr64399 387 156 66 ------
NM_002645chr111984 ------
NM_002646chr172175 1740 1361 788 582 182 78 --182 --
NM_002648chr65974 511 427 236 219 ------
NM_002649chr75625 476 400 256 142 ------
NM_002651chr13865 647 319 --1323 --
NM_002653chr52847 139 ------
NM_002655chr884488 4469 4419 4406 4184 2017 1491 1236 ------
NM_002657chr20153654 3645 3394 2516 1544 1511 1338 1299 1146 979 777 529 515 311 286 --12468 --
NM_002687chr144496 405 284 74 ------
NM_002697chr1197 ------
NM_002698chr19222604 2593 2380 2342 2322 2303 2292 2284 2273 2265 2221 1968 1867 1198 1130 1066 1013 325 216 201 189 76 ------
NM_002699chr121372 495 ------
NM_002705chr162293 259 --267 22 --
NM_002710chr121181 ------
NM_002714chr64985 776 446 192 ------
NM_002715chr5------1828
NM_002717chr81464 --1653 --
NM_002718chr362320 1866 893 213 181 69 ------
NM_002719chr1461758 1558 614 580 469 222 11869 11494 --
NM_002721chr92356 41 ------
NM_002726chr61169 ------
NM_002730chr1971358 1265 1131 935 909 241 105 ------
NM_002731chr162620 678 665 257 237 80 ----1685
NM_002734chr1751525 915 655 238 31 ------
NM_002738chr1621076 383 ------
NM_002745chr2284459 4172 1693 1312 580 319 197 118 14074 ----
NM_002746chr162188 149 ------
NM_002747chr1841781 1501 745 509 ------
NM_002753chr4249 29 --1548 --
NM_002763chr11139 ------
NM_002773chr161100 ------
NM_002790chr1125 ------
NM_002791chr141111 ------
NM_002796chr1177 ------
NM_002806chr141333 ------
NM_002819chr1951487 1398 1107 1097 329 ------
NM_002821chr64557 307 248 156 ------
NM_002824chr124396 146 128 81 ------
NM_002827chr2051698 1483 1370 1192 730 ------
NM_002829chr92852 26 ----149
NM_002833chr1541201 626 363 316 ------
NM_002838chr1----1487 --
NM_002839chr952525 809 618 392 60 1496 ----
NM_002840chr181376 1217 595 519 369 325 296 61 ------
NM_002845chr18188 --1235 --
NM_002847chr741583 1504 1346 1090 --1546 --
NM_002849chr121932 --1170 --
NM_002855chr11153455 3200 3121 3064 2677 2558 1477 813 654 570 454 303 199 190 36 ------
NM_002859chr12111612 1442 1351 1320 1254 1245 666 540 411 332 202 ------
NM_002865chr8164 ------
NM_002866chr192495 28 ------
NM_002868chr1292409 2255 2170 1751 1680 728 415 329 313 ------
NM_002869chr1131764 1706 453 --1384 --
NM_002874chr932355 2098 2055 ------
NM_002886chr394824 4668 4599 4150 3364 2053 1575 1438 1348 ------
NM_002888chr3144 ------
NM_002890chr5174 ------
NM_002892chr1441432 1103 234 156 ------
NM_002895chr202905 637 --1838 1856
NM_002896chr113301 160 94 ------
NM_002906chr1132045 441 154 ------
NM_002911chr191323 --1416 --
NM_002912chr61202 1361 ----
NM_002918chr193780 303 144 ------
NM_002924chr16589 518 483 233 207 160 ------
NM_002930chr18122 ------
NM_002931chr61310 ------
NM_002938chr451994 1475 1305 1285 215 ------
NM_002941chr31129 ------
NM_002942chr33476 273 178 ------
NM_002945chr173722 646 59 ------
NM_002953chr14767 507 187 166 --1190 --
NM_002955chr651831 1698 583 329 70 ------
NM_002965chr11179 ------
NM_002966chr1124 ------
NM_002968chr16----171 --
NM_002970chrX2269 58 ------
NM_002971chr34742 365 179 74 ------
NM_002973chr12139 ------
NM_002975chr193231 168 70 1189 1172 --
NM_002977chr221270 790 1110 ----
NM_003001chr1102246 1992 1865 1588 1554 1543 820 452 321 97 --1134 1771
NM_003010chr1752376 1817 1685 705 172 ------
NM_003011chr93625 585 380 ------
NM_003012chr842994 2970 2568 612 ------
NM_003016chr1721854 1575 ------
NM_003017chr611376 ------
NM_003028chr942637 2631 2389 773 12980 13781 1238
NM_003030chr341773 761 112 75 1561 ----
NM_003034chr1288110 6462 5445 2577 2085 1032 726 634 ------
NM_003043chr394139 3999 3755 3282 3244 3053 1376 1181 420 ------
NM_003045chr13103659 3415 3281 609 554 364 336 278 260 253 14200 11373 --
NM_003047chr191345 1324 1241 505 324 305 273 159 43 ------
NM_003051chr141949 1700 1546 159 ------
NM_003060chr531201 1034 190 --1879 --
NM_003068chr81279 ------
NM_003070chr93741 43 22 ------
NM_003072chr191356 ------
NM_003074chr35857 730 145 107 72 ------
NM_003075chr121125 ------
NM_003076chr1291690 1678 1334 1035 618 609 396 186 169 ------
NM_003077chr175587 574 224 158 62 ------
NM_003081chr2051156 1146 437 51 23 --1272 1238
NM_003085chr5186 ------
NM_003091chr202192 54 --1243 --
NM_003098chr202496 479 ----1344
NM_003100chr51455 ------
NM_003107chr641619 1057 662 151 ------
NM_003108chr2146502 6301 6071 5643 5027 4786 2581 2152 1873 1854 1763 1135 1060 53 25686 1370 17030 26313 867
NM_003112chr732362 1045 216 ------
NM_003113chr22881 68 ------
NM_003128chr251134 881 273 100 29 ------
NM_003131chr692113 1961 1430 792 676 652 507 371 251 --1408 --
NM_003137chr632000 94 69 11436 ----
NM_003139chr114804 676 609 136 ------
NM_003140chrY146 ------
NM_003144chr631838 845 324 ------
NM_003145chr13103 45 23 --1194 --
NM_003146chr11280 35 ------
NM_003150chr1762044 1937 1923 1850 1598 320 --1918 --
NM_003152chr1751173 1099 303 137 22 ------
NM_003153chr124382 215 185 37 ------
NM_003155chr872529 2418 2300 2118 2074 259 227 --1909 --
NM_003156chr1141218 375 157 60 ------
NM_003161chr1741158 636 250 237 ------
NM_003164chr111438 ------
NM_003170chr17181 ------
NM_003173chrX31379 1226 389 --11199 --
NM_003178chr341872 1594 404 155 ------
NM_003179chrX71463 1446 1357 1198 415 393 375 ------
NM_003180chr194329 322 310 99 ------
NM_003183chr22596 169 ------
NM_003185chr2041347 827 492 138 ------
NM_003186chr111159 --2323 45 --
NM_003189chr122835 254 ----1833
NM_003199chr1844642 1382 893 88 ------
NM_003200chr1921608 1573 --12024 --
NM_003203chr2184 12316 ----
NM_003204chr1741737 1455 1335 120 --1607 --
NM_003214chr631199 462 45 --1499 --
NM_003216chr22122972 2258 2042 1332 1296 776 768 637 531 508 414 200 --22912 2338 --
NM_003217chr1261298 527 389 248 133 35 ------
NM_003220chr631193 1176 603 --11493 --
NM_003221chr6153940 3621 3519 3461 3345 3095 2953 2861 2846 2775 2651 1646 1213 987 526 --12779 --
NM_003222chr202283 60 ------
NM_003223chr161761 ------
NM_003224chr202859 149 1134 ----
NM_003236chr283324 3239 3043 2868 2396 1225 1019 748 ------
NM_003239chr142722 232 --162 --
NM_003242chr361991 1662 1627 1529 611 228 ------
NM_003243chr121194 254 ------
NM_003244chr181342 ------
NM_003247chr64704 638 85 76 ------
NM_003250chr173324 149 49 ------
NM_003253chr211473 ------
NM_003255chr1732366 248 148 ------
NM_003263chr4128 ------
NM_003269chr631114 997 356 ------
NM_003274chr2132767 2406 70 --1337 --
NM_003275chr921482 377 --1472 --
NM_003286chr2011109 ------
NM_003290chr19295 59 ------
NM_003292chr12530 178 ------
NM_003298chr3156013 5818 5090 4918 4826 4793 3946 2310 1408 1367 869 798 778 378 129 12205 ----
NM_003299chr122180 103 ------
NM_003304chr331248 1205 373 ------
NM_003314chr51451 ------
NM_003319chr2------1981
NM_003336chrX3767 163 131 ------
NM_003340chr421194 331 ------
NM_003342chr1773124 2808 2691 2541 2313 964 857 ------
NM_003345chr162415 195 ------
NM_003348chr1251579 1395 402 54 33 ------
NM_003349chr2041139 999 577 379 ------
NM_003352chr21219 ------
NM_003359chr41938 ------
NM_003368chr11188 ------
NM_003369chr1182574 1949 690 664 582 528 502 118 ------
NM_003371chr921319 76 --1635 --
NM_003373chr1051949 612 388 371 142 ------
NM_003376chr611708 ------
NM_003376chr611708 ------
NM_003379chr621098 215 1228 11081 --
NM_003383chr9195 ------
NM_003385chr21271 ----1352
NM_003387chr292804 1879 1861 1854 1812 946 929 401 72 ------
NM_003390chr113918 890 736 192 ----
NM_003392chr373611 3390 3314 1310 1048 1021 628 ------
NM_003400chr21669 ------
NM_003403chr14177 ----125
NM_003404chr2041756 1389 1363 593 ------
NM_003405chr222686 64 --1535 --
NM_003406chr851888 1811 1746 1736 1652 ------
NM_003410chrX21028 328 ------
NM_003411chrY2367 313 ------
NM_003412chr332673 1063 919 12845 ----
NM_003413chrX51900 789 455 288 255 ------
NM_003418chr3266 25 1315 ----
NM_003427chr64560 514 285 216 ------
NM_003439chr71596 12828 ----
NM_003442chr111574 ------
NM_003453chr13193 ------
NM_003457chr171494 ------
NM_003458chr3153846 3819 3783 3731 3451 3304 3240 3196 2967 1317 1301 1288 1015 950 721 --33535 2556 833 --
NM_003468chr273017 2954 1397 1126 996 496 173 ------
NM_003469chr23160 65 34 ------
NM_003470chr1671728 1534 1162 542 531 500 156 ------
NM_003473chr101151 ------
NM_003482chr12102673 2488 1996 1779 925 774 574 539 198 50 ------
NM_003483chr1242193 1183 1050 700 ------
NM_003487chr173199 87 76 ------
NM_003489chr2121117 746 ------
NM_003502chr162534 219 ------
NM_003508chr71302 --141 --
NM_003525chr6143 ------
NM_003532chr6138 ------
NM_003549chr3127 ------
NM_003557chr151299 1190 396 170 142 ------
NM_003559chr17133833 3544 3434 2987 2752 2734 2503 2413 1482 1290 1007 642 598 --12507 --
NM_003563chr1721027 534 ------
NM_003564chr14561 427 232 107 ------
NM_003566chr123858 490 165 13187 ----
NM_003574chr1855017 3715 1773 474 438 ------
NM_003575chr741464 1368 1033 247 ----1271
NM_003581chr23668 103 76 ------
NM_003583chr1291340 1237 1203 806 796 774 671 545 397 ----12875
NM_003587chr6136 ------
NM_003590chr242724 2708 228 96 --143 --
NM_003595chr221439 ------
NM_003602chr73444 438 285 ------
NM_003603chr421628 450 ------
NM_003607chr1104330 4191 4084 3465 1423 1374 940 394 69 53 ------
NM_003612chr151427 --191 --
NM_003613chr152573 24 ------
NM_003617chr1114816 4552 4544 4523 4453 4287 4095 1779 1479 672 43 ------
NM_003620chr172925 806 --1775 --
NM_003627chr111420 ------
NM_003628chr22748 673 ------
NM_003629chr142524 2488 1108 436 --12185 --
NM_003631chr103645 139 25 ------
NM_003632chr174760 677 212 88 ------
NM_003633chr532615 1023 259 ------
NM_003634chr2251018 869 292 33 24 ------
NM_003644chr17226361 6337 5944 5794 5671 5203 4898 4720 4500 4347 4175 4000 2469 2459 2143 1252 1199 751 713 497 352 294 --14351 --
NM_003651chr121572 ------
NM_003654chr111107 ------
NM_003655chr172584 485 ------
NM_003657chr203841 67 54 ------
NM_003659chr21316 ------
NM_003660chr191637 ------
NM_003663chr332128 448 340 ------
NM_003670chr371052 999 945 925 380 221 38 ------
NM_003677chr1251979 1500 861 287 281 --1881 --
NM_003679chr183260 3159 3143 3133 3090 2944 2118 271 22536 1122 ----
NM_003701chr131704 ------
NM_003704chr42439 203 ------
NM_003705chr22692 118 --1731 --
NM_003714chr562769 2459 2275 1096 251 31 ------
NM_003716chr321031 719 ------
NM_003722chr382272 2097 479 269 103 94 83 21 11992 --12293
NM_003728chr42651 250 ------
NM_003735chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_003736chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_003737chr111362 ------
NM_003740chr621725 40 --1674 --
NM_003743chr242214 1761 579 517 ------
NM_003749chr1332422 2016 549 ----1837
NM_003758chr1521276 1126 ----1376
NM_003758chr1521276 1126 ----1376
NM_003760chr1299 69 ------
NM_003762chr11168 1962 11227 --
NM_003768chr171826 1790 1573 732 316 300 195 ------
NM_003774chr1273311 3291 2690 2357 738 716 250 ------
NM_003779chr14445 337 309 72 --1341 --
NM_003787chr181618 1139 ----
NM_003790chr1----1222 --
NM_003794chr32719 23 ------
NM_003795chr61488 ------
NM_003800chr652208 1826 1585 920 182 ------
NM_003816chr81398 ------
NM_003822chr163145 2537 2195 1974 493 423 ------
NM_003850chr132503 243 ------
NM_003858chr142702 561 ------
NM_003860chr113338 312 65 ------
NM_003861chr1492898 2873 2853 2332 2115 2106 2028 860 240 ------
NM_003870chr1592048 2006 1993 1984 1773 1626 149 76 57 ----12011
NM_003872chr252710 2223 2173 1193 879 ----12667
NM_003873chr102721 310 ------
NM_003877chr122363 177 1858 ----
NM_003884chr331688 293 148 ------
NM_003885chr1731934 1905 1693 ------
NM_003887chr222302 348 1448 11943 --
NM_003888chr1561252 1151 421 381 342 277 --1398 --
NM_003893chr102461 414 ------
NM_003895chr2121579 184 ------
NM_003899chr1382482 2457 2266 2105 1693 1044 987 598 ------
NM_003908chr203452 444 141 --11097 --
NM_003913chr694171 4033 3926 3742 3207 2903 2693 1637 494 ------
NM_003919chr7174 ------
NM_003921chr11337 ------
NM_003922chr15129 ------
NM_003924chr451406 1378 1210 661 201 ------
NM_003930chr742317 2003 1714 159 --196 --
NM_003931chr61126 165 ----
NM_003932chr2241934 1802 614 98 11808 ----
NM_003934chr911168 ------
NM_003938chr194986 394 199 78 1300 1230 --
NM_003939chr10183644 3559 3462 3428 3318 3197 3143 2676 1521 1498 1392 1195 1053 887 737 650 634 280 ----11010
NM_003941chr712008 12033 ----
NM_003947chr33239 206 101 ------
NM_003948chr432676 2521 842 --1975 --
NM_003954chr1741218 1164 1154 278 ------
NM_003955chr1771488 606 535 288 279 225 56 ------
NM_003966chr5156949 6422 5321 5229 5182 2681 2563 2547 2334 1947 1858 1348 889 406 42 --1776 --
NM_003971chr17140 ------
NM_003975chr12325 105 ------
NM_003980chr631016 589 251 ------
NM_003983chr16164398 4326 4298 4192 4144 4048 3991 3197 3179 1617 1358 1218 1147 1041 551 455 ------
NM_003987chr10111990 1891 1702 1637 1627 1594 1541 908 838 750 740 11962 12225 --
NM_003988chr10102067 1968 1779 1714 1704 1671 1618 915 827 817 12039 12302 --
NM_003989chr10111926 1827 1638 1573 1563 1530 1477 844 774 686 676 11898 12161 --
NM_003990chr10111926 1827 1638 1573 1563 1530 1477 844 774 686 676 11898 12161 --
NM_003992chr15----1271 --
NM_003994chr1253506 3146 3093 1686 607 ------
NM_004006chrX21924 592 ------
NM_004007chrX21924 592 ------
NM_004009chrX21924 592 ------
NM_004010chrX21924 592 ------
NM_004011chrX21924 592 ------
NM_004012chrX21924 592 ------
NM_004013chrX21924 592 ------
NM_004014chrX21924 592 ------
NM_004015chrX21924 592 ------
NM_004017chrX21924 592 ------
NM_004019chrX4331 96 70 51 ------
NM_004020chrX21924 592 ------
NM_004028chr1863849 2695 1522 615 352 35 --21622 1086 --
NM_004036chr22266 122 ------
NM_004050chr14102333 2313 2286 2025 1810 869 763 608 595 535 ------
NM_004055chr1172213 1445 795 554 209 193 109 ----11795
NM_004061chr51526 ------
NM_004063chr82921 659 1653 ----
NM_004068chr3291 42 ------
NM_004074chr11----1162 --
NM_004077chr1251234 1100 1078 997 373 --11051 --
NM_004082chr22229 110 ------
NM_004086chr142642 149 ------
NM_004087chr361593 1349 1327 574 156 68 ------
NM_004093chr1362378 1310 951 597 268 129 --1133 1273
NM_004096chr1081674 1340 791 777 651 454 187 139 ------
NM_004098chr102974 225 ------
NM_004100chr642570 2538 379 361 ------
NM_004105chr21913 --11035 --
NM_004111chr112232 25 ------
NM_004113chr321965 1588 ------
NM_004115chr131138 ------
NM_004117chr66871 829 629 612 412 46 --1643 --
NM_004124chr1473495 2779 2729 2462 2311 632 353 ------
NM_004130chr31459 ------
NM_004161chr231445 462 251 ------
NM_004162chr311039 ------
NM_004170chr911293 --1753 --
NM_004171chr11169332 9224 9034 8505 8243 7923 6861 6320 6300 6212 3525 3174 2466 1704 1180 1168 19201 11695 --
NM_004185chr1280 64 ------
NM_004193chr104403 391 194 88 151 ----
NM_004202chrY1173 ------
NM_004205chr112478 23 ------
NM_004210chr1071351 580 572 392 264 112 87 --138 --
NM_004225chr821289 299 --11329 --
NM_004228chr191121 ------
NM_004231chr72265 206 ------
NM_004232chr181278 ----11320
NM_004235chr91750 ------
NM_004252chr173693 222 66 1511 ----
NM_004263chr251722 1638 1518 1483 408 ------
NM_004272chr531754 120 51 ------
NM_004274chr1443048 1026 329 142 ------
NM_004277chr61178 ------
NM_004290chr531033 878 105 ------
NM_004293chr953017 3000 2437 1124 879 ------
NM_004296chr1473951 3428 2744 1409 1089 1026 238 --1830 --
NM_004302chr1272863 2791 2571 2457 2287 860 482 ------
NM_004305chr2145 ------
NM_004308chr11101895 1743 1480 1463 1446 608 261 203 54 30 ------
NM_004311chr10112854 2755 2733 2486 2327 2254 2050 1190 897 340 224 --22955 2763 --
NM_004316chr121901 --1435 --
NM_004321chr282951 2555 1111 1027 729 701 605 56 12706 11238 --
NM_004326chr161150 1037 953 783 355 29 ------
NM_004329chr1021031 554 ------
NM_004338chr1885912 4720 2662 2514 2310 1755 1116 552 22749 1150 --14620
NM_004342chr742107 1958 1702 1635 ------
NM_004349chr82287 58 ------
NM_004364chr1951183 488 378 214 164 ------
NM_004370chr641829 813 677 520 --11959 --
NM_004371chr16619 224 190 144 99 67 ------
NM_004379chr24653 618 263 197 ----1360
NM_004380chr1612211 ------
NM_004384chr512024 1476 11431 --
NM_004385chr51663 ------
NM_004389chr21588 ------
NM_004391chr391884 1806 1633 1585 1506 1433 1418 229 145 ------
NM_004392chr1321646 347 ------
NM_004393chr331828 1544 256 ------
NM_004395chr53693 271 229 ------
NM_004397chr1163754 940 598 410 399 72 ------
NM_004405chr23916 320 79 --1407 --
NM_004411chr71752 ------
NM_004414chr2131592 633 84 ------
NM_004416chr1251086 926 685 661 58 ------
NM_004417chr52129 25 ----154
NM_004418chr23559 188 116 ------
NM_004420chr1172131 2021 1873 1590 839 457 424 1184 11811 --
NM_004422chr172342 159 ------
NM_004423chr392453 2442 2241 2140 1697 1010 784 219 55 ------
NM_004427chr17458 443 411 287 255 152 40 ------
NM_004429chrX51169 1029 944 557 58 ------
NM_004430chr8122768 2607 2193 2186 1755 1068 1044 976 960 951 795 620 ------
NM_004431chr12332 114 ------
NM_004432chr91743 ------
NM_004433chr16626 548 313 272 255 197 ------
NM_004434chr1431386 697 307 ------
NM_004436chr11519 1579 ----
NM_004437chr193471 3269 2663 2418 2408 2297 1047 362 36 ------
NM_004438chr252529 901 793 544 92 ------
NM_004440chr61281 ------
NM_004441chr371275 1207 450 428 417 389 100 --11292 --
NM_004443chr32189 145 ------
NM_004444chr73638 593 571 ------
NM_004446chr1366 32 24 ------
NM_004447chr122732 453 ------
NM_004450chr141252 ------
NM_004451chr112560 160 ------
NM_004454chr351727 1547 663 508 274 ------
NM_004455chr171093 814 342 311 288 245 174 ------
NM_004456chr72171 26 ------
NM_004457chr241267 187 118 98 ------
NM_004458chrX1469 ----12284
NM_004459chr171344 ------
NM_004468chr13542 111 57 1403 ----
NM_004472chr54141 87 56 50 ------
NM_004474chr12956 38 ------
NM_004475chr1741127 353 180 24 --11016 --
NM_004480chr141178 ------
NM_004481chr182455 1817 1731 1691 818 510 255 205 12625 ----
NM_004484chrX1117 154 ----
NM_004485chr1123211 2891 2826 2769 2757 2697 2680 1064 1051 442 153 27 --13754 --
NM_004493chrX131 ------
NM_004494chr171182 968 814 490 342 240 118 ------
NM_004496chr142415 283 ------
NM_004497chr19----1582 --
NM_004500chr1431292 630 128 11385 ----
NM_004501chr163510 3301 1624 1082 976 846 ----13896
NM_004503chr123338 233 204 1825 1211 --
NM_004504chr242828 2006 1922 514 ------
NM_004505chr1742029 1388 421 357 --152 --
NM_004514chr1782848 2806 2796 2681 2626 2320 1197 151 ------
NM_004516chr19150 --1995 --
NM_004519chr82246 160 --127 --
NM_004520chr52537 261 ------
NM_004525chr221259 573 ------
NM_004527chr1771064 482 362 327 296 203 81 ------
NM_004529chr921414 232 ------
NM_004535chr2021722 1582 ------
NM_004566chr1092459 2251 2219 2138 1804 967 853 754 548 ------
NM_004573chr154663 218 142 48 ------
NM_004574chr17133 ------
NM_004575chr43582 56 36 ------
NM_004580chr152111 53 11684 ----
NM_004583chr174489 259 249 34 ------
NM_004586chrX95373 4616 4514 4454 2176 1950 869 832 153 --1161 --
NM_004588chr11143811 3399 3243 3095 2946 2841 2800 2643 1629 1083 835 458 181 40 12517 23467 652 --
NM_004598chr5102923 2786 2678 2398 2120 940 867 421 263 97 ------
NM_004600chr11229 --11377 --
NM_004602chr202563 372 ------
NM_004603chr75939 915 341 305 138 ------
NM_004606chrX1269 --121 --
NM_004612chr9127 1445 ----
NM_004615chrX1786 --1625 --
NM_004619chr111758 ------
NM_004626chr112551 543 ------
NM_004630chr1151105 1046 1035 943 260 ----1904
NM_004631chr111067 --1992 --
NM_004637chr341284 1155 1114 79 --1243 1455
NM_004639chr6124 ------
NM_004645chr172832 277 ------
NM_004654chrY1994 ------
NM_004655chr172993 876 ------
NM_004656chr34956 937 428 248 ------
NM_004660chrY1232 11568 ----
NM_004663chr1531245 410 243 ------
NM_004667chr151223 1110 ----
NM_004670chr1041650 423 377 88 11134 11164 --
NM_004673chr111589 ------
NM_004684chr4140 ------
NM_004686chr85638 569 436 347 311 ------
NM_004687chr1762001 1737 810 514 391 78 --21345 133 --
NM_004697chr931057 867 56 ------
NM_004709chrX71547 1148 565 551 232 220 106 ------
NM_004714chr191332 --1336 186
NM_004716chr115809 801 782 714 33 ------
NM_004719chr1242532 2452 2030 601 ------
NM_004723chr13856 137 118 1355 ----
NM_004725chr101477 ------
NM_004726chrX85166 4700 4490 4092 1736 1226 567 276 ------
NM_004730chr521927 1792 --22006 1519 --
NM_004734chr13273 30 12719 ----
NM_004736chr11128 158 ----
NM_004739chr111668 ------
NM_004742chr351566 1320 456 301 263 11761 ----
NM_004744chr443839 2931 328 189 ------
NM_004745chr8156919 6852 6600 5522 5174 5016 4906 4869 4429 4292 2198 1557 1153 109 88 12246 1575 11886
NM_004746chr18261 46 ------
NM_004753chr11278 ------
NM_004757chr41111 ------
NM_004762chr1761859 1481 1236 518 231 51 ------
NM_004772chr561410 1401 1352 1272 1160 507 --1586 --
NM_004774chr1762858 2850 2824 2487 1120 339 22887 431 ----
NM_004779chr54888 530 242 224 ----1513
NM_004781chr1142 ------
NM_004781chr1142 ------
NM_004783chr162482 133 ------
NM_004784chr4198 ------
NM_004792chr2171 ------
NM_004796chr1422006 333 ------
NM_004798chr20123533 2578 2408 1263 928 847 801 690 626 344 337 307 ----13508
NM_004800chr13146 ------
NM_004811chr113372 226 24 ------
NM_004822chr17103735 3714 3232 2879 2862 1447 1388 1252 585 281 ------
NM_004824chr631145 1015 384 ------
NM_004831chr193762 719 167 ------
NM_004834chr272986 2891 326 308 159 149 67 11248 12689 --
NM_004836chr21100 ------
NM_004839chr154451 179 170 150 ------
NM_004841chr15879 802 742 716 322 ------
NM_004844chr331131 358 349 ------
NM_004855chr151215 ------
NM_004856chr151392 154 ----
NM_004857chr1484255 3594 3454 3391 1920 1311 1224 908 ------
NM_004859chr17163 ------
NM_004860chr173371 230 28 ------
NM_004863chr1474621 3925 3510 3267 1840 1120 417 --1910 --
NM_004866chr534755 3531 154 ------
NM_004869chr181159 ------
NM_004871chr1794237 3754 3738 3585 2723 1650 957 844 351 ------
NM_004872chr12298 52 ------
NM_004887chr511004 ------
NM_004898chr462744 2610 2274 2136 1949 626 ------
NM_004904chr7125867 5687 4784 4761 4731 2099 1631 1576 611 575 565 101 ----11721
NM_004921chr131884 733 243 21624 941 ----
NM_004922chr1031006 791 257 ------
NM_004924chr194900 344 158 74 ------
NM_004926chr1451747 557 546 413 68 ------
NM_004930chr13589 275 176 ------
NM_004932chr521587 90 11335 ----
NM_004938chr93448 261 129 ------
NM_004947chr362000 1819 847 551 425 280 12600 ----
NM_004956chr733125 3075 877 ------
NM_004961chrX41299 522 243 198 ------
NM_004962chr10----149 --
NM_004968chr72633 455 --1645 --
NM_004973chr631333 1161 1069 ------
NM_004975chr20----1221 --
NM_004976chr1164863 4448 4337 3633 1845 1400 --23885 3604 --
NM_004979chrX81055 1008 794 388 309 188 50 33 --1254 --
NM_004981chr221154 ------
NM_004985chr1253388 1798 1784 552 176 ----12798
NM_004992chrX257979 7911 7658 7161 7050 6804 6782 6171 5699 5380 3081 3048 2618 2566 2368 2293 1800 1507 1305 1284 1274 1218 955 265 60 17525 ----
NM_004992chrX257979 7911 7658 7161 7050 6804 6782 6171 5699 5380 3081 3048 2618 2566 2368 2293 1800 1507 1305 1284 1274 1218 955 265 60 17525 ----
NM_004993chr1411368 ------
NM_004995chr1461078 618 595 371 149 126 --21346 120 --
NM_004998chr153941 211 105 ------
NM_005010chr742138 2033 281 230 ------
NM_005022chr17154 ------
NM_005028chr1032251 2036 825 12326 21563 117 --
NM_005030chr162272 34 ------
NM_005032chrX2258 183 ------
NM_005045chr73849 730 129 ------
NM_005055chr11127 --131 --
NM_005056chr12125580 5570 4942 4153 4141 2028 1788 1614 663 481 389 191 ------
NM_005065chr1455117 3686 1856 1645 635 --1734 --
NM_005068chr611460 ------
NM_005070chr2193 --1236 --
NM_005074chr62244 42 ------
NM_005078chr1541474 1169 1145 222 ------
NM_005079chr822670 2270 ------
NM_005080chr221739 ------
NM_005087chr31116 ------
NM_005088chrX2811 626 --172 --
NM_005095chr142048 875 806 664 ------
NM_005096chrX81113 1012 447 439 416 284 143 117 ------
NM_005097chr10178 ------
NM_005099chr12516 132 ------
NM_005105chr141804 1534 744 30 --1807 --
NM_005110chr55669 626 529 280 248 --2735 642 --
NM_005114chr41528 --1517 --
NM_005116chr20164230 3858 3844 2847 1570 1486 1001 984 969 684 671 444 407 305 189 55 14318 1210 --
NM_005117chr11124 ------
NM_005119chr131306 1081 431 ------
NM_005121chr1763476 3258 2995 1507 437 82 ------
NM_005124chr61132 ------
NM_005128chr211513 ------
NM_005134chr181108 ------
NM_005135chr1553577 3491 1110 900 475 ------
NM_005140chrX1754 ------
NM_005146chr115720 222 215 69 58 ------
NM_005153chr162748 713 ------
NM_005156chr954740 4705 3645 1929 621 ------
NM_005157chr971583 1330 603 415 403 385 201 1226 11888 --
NM_005159chr1532135 1905 588 --1781 --
NM_005160chr22116649 6424 5865 5742 5641 4915 4639 2633 1628 549 103 21356 26 14907 --
NM_005166chr193344 219 46 ------
NM_005168chr21402 ------
NM_005180chr1021218 543 ----1367
NM_005181chr8480 68 61 23 ------
NM_005182chr165509 428 113 87 42 --1131 --
NM_005184chr19131409 1156 1145 1121 1096 349 330 310 231 212 176 69 48 --151 --
NM_005186chr115606 574 566 145 106 --143 --
NM_005187chr1681653 1495 1321 1308 412 372 343 258 --11291 --
NM_005188chr11257930 7870 7262 6787 6715 6649 5930 5741 5723 5713 5661 5472 5275 5252 3143 3129 3078 3011 2969 2259 1918 1382 1363 628 401 --11738 --
NM_005190chr611160 ------
NM_005197chr1466096 5505 4945 4531 306 168 1618 14982 --
NM_005201chr31275 ------
NM_005202chr1111959 1798 1786 1615 1597 1585 885 703 480 421 34 --11442 --
NM_005203chr101162 ------
NM_005207chr222295 54 ------
NM_005219chr591626 1565 1281 1121 488 464 287 91 29 --11377 --
NM_005220chr1761451 1289 1252 959 448 133 ------
NM_005227chr11474 ------
NM_005229chrX4878 200 169 130 ------
NM_005235chr2127613 7588 6734 5510 5365 2808 2338 2162 1957 1525 1489 351 ------
NM_005238chr1183040 2962 2869 2660 2546 2479 892 251 ------
NM_005241chr31457 1187 ----
NM_005252chr141197 ------
NM_005256chr11152 ------
NM_005259chr21992 ----1302
NM_005271chr1051062 1005 262 34 22 ------
NM_005274chr1138 ------
NM_005276chr1231521 586 111 --11184 --
NM_005276chr1231521 586 111 --11184 --
NM_005277chr421284 99 1642 ----
NM_005281chr13753 656 300 --1675 --
NM_005296chrX1216 ------
NM_005311chr742569 1908 1060 406 ----1855
NM_005312chr962478 2133 1017 1005 904 179 11846 1974 --
NM_005313chr1521007 37 ------
NM_005316chr112982 952 ------
NM_005324chr1741898 1745 1457 239 ------
NM_005329chr1642242 2068 883 275 ------
NM_005334chrX81655 1281 586 570 488 246 127 31 --11132 --
NM_005336chr282152 1878 1796 842 475 403 170 112 1373 12156 --
NM_005339chr464067 3841 1518 1165 573 39 ------
NM_005342chrX72850 2516 2144 2044 861 705 268 --2447 24 --
NM_005349chr43566 546 485 ------
NM_005359chr18106357 6027 5961 5235 4369 4350 4303 1951 1683 184 ------
NM_005374chr17132428 2362 2187 2106 2093 1918 1781 1555 674 613 425 389 116 1882 12096 --
NM_005375chr6166 1392 ----
NM_005380chr151301 1173 1062 858 259 ------
NM_005381chr2----1126 --
NM_005382chr81162 ------
NM_005385chr31897 ------
NM_005387chr111203 ------
NM_005392chr941363 1183 489 113 ------
NM_005398chr1041457 1434 951 530 11447 ----
NM_005399chr1133582 2924 2793 2766 2725 1446 1325 1209 1084 704 592 560 368 1963 13269 --
NM_005400chr262803 2107 479 291 163 95 --1102 --
NM_005402chr741746 1544 1372 333 ------
NM_005406chr1831311 330 142 ------
NM_005407chr1481505 1285 1249 1142 408 306 299 207 ------
NM_005410chr52750 617 ------
NM_005412chr122489 45 ------
NM_005413chr26361 94 73 49 38 29 ------
NM_005418chr113694 578 94 ------
NM_005430chr127949 847 810 668 381 167 150 1999 1924 139
NM_005433chr1822193 1122 ------
NM_005435chr73570 162 110 ------
NM_005436chr1084086 3795 2887 2523 1635 656 416 77 ------
NM_005437chr1051042 419 306 223 117 ------
NM_005438chr112115 50 ------
NM_005439chr124508 467 387 73 ------
NM_005455chr111437 ------
NM_005458chr952418 2232 1668 798 463 ------
NM_005460chr52464 73 ------
NM_005461chr201285 ------
NM_005465chr111636 ------
NM_005474chr17101595 1268 1234 1227 1118 558 423 416 271 128 --21531 275 --
NM_005475chr1282992 2606 2031 1300 1131 1075 742 207 --11204 --
NM_005476chr931444 148 28 ------
NM_005479chr1071382 1207 1013 617 359 303 261 ------
NM_005488chr224660 228 121 75 ------
NM_005501chr1741185 983 813 27 --11160 --
NM_005502chr952342 2249 2236 2179 2142 ------
NM_005505chr125687 381 334 278 78 ------
NM_005507chr112440 173 ------
NM_005513chr351466 1226 205 120 23 ------
NM_005515chr73621 215 57 ------
NM_005520chr51770 ------
NM_005522chr721282 347 1394 140 --
NM_005523chr731492 602 551 ------
NM_005530chr1591469 1294 1196 1187 1169 994 453 388 315 ------
NM_005537chr131847 ------
NM_005544chr22120 56 ------
NM_005562chr121458 520 --1185 --
NM_005563chr11618 ------
NM_005573chr53602 253 71 ------
NM_005574chr11164 ------
NM_005578chr3134805 4795 4779 4763 4370 3872 3741 3414 1735 993 888 511 486 ------
NM_005581chr193135 103 96 ------
NM_005584chr132109 39 ------
NM_005587chr151277 --1206 --
NM_005596chr914107 --11106 --
NM_005603chr1811535 --1142 --
NM_005604chr642173 774 708 54 ------
NM_005609chr112269 187 --1258 --
NM_005610chr1146 2834 797 ----
NM_005611chr1641283 919 156 26 ------
NM_005613chr152131 1842 1599 1481 305 ------
NM_005614chr72885 673 ----170
NM_005626chr11151 ------
NM_005627chr61178 ------
NM_005634chrX3625 454 238 ------
NM_005637chr181836 ------
NM_005639chr1221495 211 ------
NM_005644chr12351 76 ------
NM_005652chr1651167 1109 921 799 433 ------
NM_005653chr12134 ------
NM_005655chr811275 ------
NM_005660chrX142 ------
NM_005665chr113658 13719 ----
NM_005667chr21344 ------
NM_005669chr512288 ------
NM_005686chr151450 1425 1135 286 29 ------
NM_005688chr31484 1102 ----
NM_005698chr11104 ------
NM_005700chr111358 ------
NM_005708chr131377 ------
NM_005724chr152200 184 ------
NM_005725chr12875 670 ------
NM_005730chr12133404 3289 2950 2723 2583 2512 1179 1152 684 506 424 344 324 ------
NM_005731chr2189 ------
NM_005736chr1031539 988 268 ------
NM_005737chr232896 2372 1795 --1527 --
NM_005738chr71198 ------
NM_005748chr1223440 3361 ------
NM_005749chr17------170
NM_005754chr52270 171 ------
NM_005756chrX51031 982 560 533 104 ------
NM_005759chr274699 4403 3637 3396 1893 533 359 --13481 --
NM_005765chrX1574 ------
NM_005768chr12169 ------
NM_005776chr141131 ------
NM_005778chr31481 ------
NM_005779chr583421 3260 2605 2417 1388 848 770 433 ------
NM_005780chr131714 ------
NM_005782chr17146 ------
NM_005783chr21419 1111 ----
NM_005786chr182954 891 ------
NM_005789chr1782166 1915 1894 1574 595 466 435 196 ------
NM_005796chr16368 44 34 ------
NM_005801chr174319 149 63 40 ------
NM_005807chr12221 209 ------
NM_005808chr373389 2999 2819 2708 2622 1345 993 ----1803
NM_005811chr12195 ------
NM_005813chr21994 11644 ----
NM_005814chr151241 1122 1092 940 70 ----1952
NM_005822chr651843 1644 684 121 35 ----12200
NM_005826chr11173 ------
NM_005828chr17134151 3753 3737 3667 1968 1927 1506 736 578 338 260 238 204 ------
NM_005832chr331033 975 256 ------
NM_005834chrX1236 --133 --
NM_005835chr62206 43 ------
NM_005840chrX186526 6271 5896 4840 2447 2154 1947 1712 1575 597 586 575 500 493 480 462 201 35 26253 5546 --12599
NM_005841chr46929 916 862 751 158 113 ------
NM_005850chr1154 --2221 82 --
NM_005851chr113314 292 61 ------
NM_005852chr1761125 1091 1044 858 275 149 ------
NM_005859chr51185 ------
NM_005863chr103572 493 69 ------
NM_005864chr144679 281 160 27 ------
NM_005884chr192625 88 --1127 --
NM_005885chr5158 1228 ----
NM_005888chr121176 ------
NM_005896chr22809 651 ------
NM_005898chr1132763 863 252 ------
NM_005901chr1868332 7162 3455 2223 454 48 25722 609 --11095
NM_005904chr1841041 593 151 73 --1145 --
NM_005909chr564257 4088 3905 3328 2703 691 ------
NM_005910chr17154010 3887 3780 3281 3244 3220 3203 3028 3000 1423 1250 864 822 692 284 --2634 107 --
NM_005911chr23944 367 80 ------
NM_005920chr1173705 3590 3318 3055 2904 2721 2434 2418 2372 1501 1473 1175 1162 1138 1037 195 82 13828 43485 1234 1198 1142 --
NM_005922chr61141 ------
NM_005923chr62524 205 123 ----
NM_005927chr531003 297 175 ------
NM_005933chr1192834 2763 2707 2518 2421 2354 2245 2133 713 ------
NM_005934chr1992129 1971 1833 938 925 503 147 121 72 --11705 --
NM_005937chr17124008 3650 3601 3528 3036 2626 2575 1107 826 677 614 507 ------
NM_005941chr853592 3322 2945 839 256 ------
NM_005943chr681411 1397 1320 1242 1141 1123 191 160 ------
NM_005955chr1124939 4930 4680 4563 3990 3393 1533 1491 907 814 752 418 ------
NM_005962chr1032273 1772 94 11801 ----
NM_005962chr1032273 1772 94 11801 ----
NM_005964chr1731045 1031 432 11291 ----
NM_005967chr123636 114 104 ------
NM_005982chr141194 ------
NM_005996chr1231358 623 549 ------
NM_006015chr171245 1047 914 363 207 161 126 ------
NM_006016chr611834 ------
NM_006020chr1461306 1232 1166 1089 484 278 ------
NM_006022chr133889 420 399 ------
NM_006030chr331799 1632 1223 --148 --
NM_006033chr1832278 1736 105 --1163 --
NM_006035chr141314 ------
NM_006036chr24820 706 232 129 ------
NM_006038chr2031457 1402 1371 ------
NM_006047chr2052744 2515 1273 919 540 ------
NM_006048chr11495 ------
NM_006051chr56231 222 214 123 102 67 ----193
NM_006064chrX2308 111 ------
NM_006079chr62286 46 ------
NM_006091chr1571715 1672 1396 562 551 492 64 ------
NM_006094chr821558 684 167 ----
NM_006095chr463958 3184 3005 1675 1656 914 ----11582
NM_006096chr851274 410 269 238 55 11089 ----
NM_006106chr1143198 2683 559 152 ------
NM_006113chr121869 130 ------
NM_006129chr81531 ------
NM_006135chr121041 492 ------
NM_006136chr721174 469 ------
NM_006142chr13472 174 88 ------
NM_006147chr13496 477 26 ------
NM_006148chr17112443 2265 2209 2070 935 925 765 556 342 183 128 ------
NM_006157chr111378 ------
NM_006158chr831655 1583 171 ------
NM_006160chr1781576 1233 339 327 314 255 232 209 ------
NM_006161chr51269 ------
NM_006166chr1222592 2553 ------
NM_006180chr931782 102 40 ------
NM_006183chr122446 105 ------
NM_006185chr112243 88 --1182 --
NM_006190chr22903 58 ------
NM_006191chr122716 84 ------
NM_006195chr931399 1262 516 ------
NM_006198chr211230 1249 ----
NM_006201chrX41098 856 849 221 ------
NM_006203chr555396 2120 1970 1616 929 25121 1668 ----
NM_006216chr2160 --1653 --
NM_006223chrX1529 --1127 --
NM_006224chr1792323 2140 1965 1912 1632 1617 863 444 224 ------
NM_006226chr21439 1359 ----
NM_006237chr1342148 737 143 67 --22117 131 --
NM_006238chr671971 337 292 285 230 196 181 ------
NM_006241chr342176 1586 912 829 ------
NM_006242chr2021595 427 1441 ----
NM_006244chr115589 483 458 412 59 ------
NM_006245chr66861 834 380 333 276 174 ------
NM_006246chr1431071 470 209 ------
NM_006247chr191324 ------
NM_006251chr543195 2419 1035 427 13352 ----
NM_006252chr166428 6255 6175 2639 2460 1478 --1347 --
NM_006254chr32159 124 ------
NM_006256chr142774 1810 464 179 ------
NM_006265chr82967 484 ------
NM_006267chr22752 518 ------
NM_006268chr1151028 735 353 86 49 ------
NM_006275chr2042485 2180 83 61 ------
NM_006279chr12933 300 1204 ----
NM_006282chr2084716 4656 4639 4286 2953 1651 1344 316 23791 1412 --13579
NM_006283chr8144607 4029 4014 3859 3568 3013 1496 1285 893 758 603 361 347 46 13967 ----
NM_006288chr1151092 1031 950 380 61 --1478 --
NM_006289chr91349 ------
NM_006292chr11249 33 ------
NM_006301chr121507 ------
NM_006306chrX74552 4417 4400 1466 971 909 266 ----11520
NM_006307chrX129 182 ----
NM_006309chr3----134 --
NM_006310chr172971 946 11280 ----
NM_006313chr12--1499 ----
NM_006315chr464219 3370 1427 1395 1349 1185 --34378 1408 1033 --
NM_006317chr57784 606 359 117 103 90 47 ------
NM_006320chr41391 ------
NM_006321chr341646 1631 877 164 ------
NM_006327chr102265 85 ------
NM_006330chr831027 573 153 ------
NM_006335chr11329 --1319 --
NM_006341chr11205 ------
NM_006345chr421386 72 ------
NM_006353chr641403 1245 1211 135 ------
NM_006357chr2146 ------
NM_006358chr223451 414 50 ------
NM_006359chrX52026 1715 831 409 345 ----11571
NM_006361chr1771693 1643 1592 1386 744 568 150 --1579 --
NM_006367chr13819 110 82 ------
NM_006369chr11315 ------
NM_006374chr22227 163 ------
NM_006378chr921032 1025 ------
NM_006379chr711778 ------
NM_006380chr1733149 2753 2744 ------
NM_006386chr2272268 2231 2083 1674 637 545 75 --179 --
NM_006389chr11101291 1061 878 854 559 518 502 409 379 214 ------
NM_006390chr1231497 1489 665 ------
NM_006391chr11152 ------
NM_006405chr14172 ------
NM_006408chr71979 ------
NM_006409chr71229 ------
NM_006411chr66348 333 123 92 43 22 ------
NM_006416chr62532 24 ------
NM_006420chr2083343 3246 3125 2769 2702 2587 2354 1033 2897 764 --1348
NM_006422chr12128 ------
NM_006430chr24484 202 96 77 ------
NM_006434chr1032652 1100 786 ------
NM_006439chr41509 ------
NM_006440chr22----151 --
NM_006449chr252174 1953 1575 1525 1480 ------
NM_006451chr511105 ------
NM_006454chr472674 1942 1212 1034 927 868 67 --121 --
NM_006459chr1031649 633 78 ------
NM_006460chr171301 1541 --11534
NM_006463chr21601 ------
NM_006464chr294479 1781 1742 1663 1627 1551 591 293 168 2419 86 ----
NM_006465chr15102351 1939 1784 1698 1424 868 813 482 420 270 12319 ----
NM_006469chr131132 331 292 ------
NM_006471chr182220 32 ------
NM_006472chr1154 ----1283
NM_006480chr51361 1482 ----
NM_006482chr1291340 1237 1203 806 796 774 671 545 397 ----12875
NM_006483chr191332 --1336 186
NM_006484chr191332 --1336 186
NM_006488chr24620 226 212 60 ----1280
NM_006489chr1461668 1540 1374 1262 708 39 ------
NM_006496chr11489 ------
NM_006497chr175794 756 568 522 280 --1760 --
NM_006510chr651019 853 670 410 350 ------
NM_006516chr161513 1474 1432 641 531 122 ------
NM_006517chrX82072 1499 1468 611 599 579 218 38 --1137 --
NM_006519chr6130 ------
NM_006526chr201718 1756 --11485
NM_006527chr42242 36 ------
NM_006532chr1951774 1465 820 587 240 --2591 431 --
NM_006539chr162219 87 ------
NM_006540chr81187 ------
NM_006544chr1422134 433 ------
NM_006546chr17186518 6276 5957 5948 5538 5453 5319 5214 5122 5036 4664 4381 4350 4219 2151 2142 1554 1419 --14865 --
NM_006547chr712075 ----11419
NM_006548chr311708 ------
NM_006557chr921768 603 ------
NM_006558chr81494 ------
NM_006559chr131147 136 120 ------
NM_006560chr113207 126 118 ------
NM_006561chr10115926 5237 5216 5022 4979 4919 4802 4384 4338 4271 2213 --12217 --
NM_006562chr102113 94 ------
NM_006565chr16132 ------
NM_006566chr183468 440 392 ------
NM_006574chr3166 ------
NM_006578chr1571637 1624 1546 1387 1263 1227 420 1391 ----
NM_006593chr28752 666 651 582 314 251 89 63 --193 --
NM_006595chr1121493 434 ------
NM_006599chr16137575 7494 7413 7389 7064 6983 6835 5650 2574 2561 1520 1392 1152 12244 17144 --
NM_006601chr123980 316 46 ------
NM_006603chrX1625 ------
NM_006609chr222157 57 12338 ----
NM_006614chr342676 2287 2257 1308 ------
NM_006618chr121382 1155 ------
NM_006621chr172016 1698 1665 601 334 210 89 --11641 --
NM_006622chr52486 33 1221 ----
NM_006624chr101170 --11605 --
NM_006626chr942603 957 791 254 11703 --11795
NM_006628chr1554236 3855 1810 1739 48 ------
NM_006640chr1721830 1782 ------
NM_006650chr573315 1034 706 545 303 140 122 --1561 --
NM_006651chr451475 1298 961 557 203 ------
NM_006654chr1283553 3033 1279 1210 553 534 173 92 13380 ----
NM_006662chr162324 124 ------
NM_006670chr65476 234 216 160 143 ------
NM_006690chr2042012 1970 1654 52 --1595 --
NM_006694chr12289 270 ------
NM_006698chr2061142 565 447 425 414 388 --1375 --
NM_006699chr162619 2300 2140 1971 850 398 ------
NM_006700chr122782 577 ------
NM_006706chr51621 ------
NM_006709chr62104 56 ------
NM_006717chr943201 3128 2442 1163 ------
NM_006722chr342394 2142 1954 357 ------
NM_006724chr61141 ------
NM_006726chr421133 66 ------
NM_006729chrX115337 4877 4851 4812 4336 3741 1865 1342 1164 660 169 ------
NM_006732chr1951836 1799 818 178 124 1664 ----
NM_006734chr621229 1111 ------
NM_006735chr73361 118 43 ------
NM_006736chr251761 1189 741 526 509 ------
NM_006738chr1564062 3669 2902 1832 565 106 14560 ----
NM_006750chr16117304 7082 3174 3099 1746 1724 988 817 516 370 93 37459 5624 536 ----
NM_006756chr811292 ------
NM_006761chr175743 735 722 699 44 ------
NM_006766chr872625 1649 627 603 536 446 163 --12631 --
NM_006772chr681640 1615 1450 1285 1204 674 557 25 --11191 --
NM_006774chr72179 149 ------
NM_006775chr641999 1209 411 29 ------
NM_006777chrX22836 910 ------
NM_006778chr621264 25 ------
NM_006788chr187739 712 567 560 149 126 112 --1475 --
NM_006791chr151166 ------
NM_006793chr102302 27 ------
NM_006795chr1181504 1451 1407 1249 1119 565 467 112 --11576 --
NM_006801chr191573 --127 --
NM_006802chr12383 286 ------
NM_006805chr51160 ------
NM_006809chr203787 696 120 1625 1728 --
NM_006814chr2072251 2137 2012 831 512 261 240 1311 ----
NM_006823chr82866 533 --11075 --
NM_006826chr211248 1164 1421 --
NM_006827chr1453199 2262 446 346 21 --12252 --
NM_006846chr5190 ------
NM_006851chr1242805 2406 700 647 1940 ----
NM_006852chr1752563 2363 2225 1996 693 ------
NM_006854chr731957 1555 680 --11563 1389
NM_006856chr1261077 1041 1034 885 873 368 ------
NM_006861chr1271703 1502 736 544 219 151 69 ----1166
NM_006874chr411213 ------
NM_006875chrX4876 798 261 214 ------
NM_006884chr341773 761 112 75 1561 ----
NM_006885chr1684213 3511 3113 2758 1514 1364 1103 970 --11368 --
NM_006887chr23461 197 184 ------
NM_006888chr1463131 3068 3030 1355 1309 261 ------
NM_006889chr33444 310 293 ------
NM_006898chr21578 ------
NM_006906chr113396 167 100 ------
NM_006908chr7--11515 11003 --
NM_006913chr62435 336 ------
NM_006914chr931449 1431 584 ------
NM_006920chr231956 124 80 ------
NM_006922chr22661 321 ------
NM_006924chr1763762 3528 2806 1442 1379 237 --11732 --
NM_006936chr212122 34 --1976 --
NM_006937chr171398 ------
NM_006940chr1251596 1584 638 563 552 ------
NM_006947chr471678 1281 1202 1180 680 152 100 ------
NM_006950chrX5804 774 168 133 43 --1882 --
NM_006958chr83149 52 41 ------
NM_006965chr1831168 1148 267 ------
NM_006981chr952920 2788 2427 656 32 ------
NM_006987chr1761274 1227 1053 173 79 64 ------
NM_006990chr182492 1874 1779 1621 797 613 183 162 --12158 --
NM_006999chr52399 144 11700 ----
NM_007005chr9130 ------
NM_007010chr1731296 1213 743 ------
NM_007011chr15206471 5882 5868 5492 5069 5032 4992 4875 4627 4580 2668 2656 2148 1985 1571 1559 1433 1397 162 37 16795 ----
NM_007013chr821009 412 ------
NM_007017chr52192 58 ------
NM_007026chr17178 ------
NM_007030chr585074 4638 4493 3518 3471 3248 1735 161 --1854 --
NM_007039chr1441987 1829 1667 1579 11682 ----
NM_007042chr332495 1804 287 12089 ----
NM_007043chr1231603 412 35 ------
NM_007050chr20187777 6864 6617 5992 5733 5628 5302 5132 2319 1527 1504 1425 1158 752 744 481 418 381 --22009 756 --
NM_007054chr553517 3027 1042 229 85 ------
NM_007064chr321522 1044 ------
NM_007067chr1771571 1557 1294 1118 1055 427 308 ------
NM_007073chr673813 3774 3653 3417 3268 1130 353 ------
NM_007078chr1032494 750 494 ------
NM_007084chr1321239 414 ------
NM_007096chr9161 ------
NM_007106chr1362726 2654 2402 2372 919 387 ------
NM_007114chr313003 1251 ----
NM_007124chr611769 --1102 --
NM_007125chrY141 ----1411
NM_007129chr132375 365 ------
NM_007144chr1771273 1128 1086 362 97 79 46 ------
NM_007145chr1931149 952 308 ------
NM_007146chr1732187 1099 376 ------
NM_007147chr1931074 982 70 ------
NM_007158chr131010 146 82 ------
NM_007159chr3187 ------
NM_007162chr63464 378 124 ------
NM_007166chr112596 110 11039 ----
NM_007174chr1251781 1712 926 594 26 --1184 --
NM_007175chr872446 2301 2218 827 738 91 72 --1618 --
NM_007185chr13431 220 51 ------
NM_007189chr741379 583 359 204 --1565 --
NM_007191chr121155 ------
NM_007192chr1441115 910 274 35 ------
NM_007195chr1853148 2570 1496 918 73 12490 12595 --
NM_007200chr1564062 3669 2902 1832 565 106 14560 ----
NM_007202chr172647 604 ------
NM_007203chr943477 3350 1382 556 ------
NM_007217chr3130 ------
NM_007222chr841818 1761 1409 1153 ------
NM_007224chr123636 505 106 --1138 --
NM_007236chr1582133 834 657 629 505 98 61 21 12466 ----
NM_007238chr2094755 4326 4289 4085 3928 3880 3785 3415 74 --1367 --
NM_007245chr162363 140 ------
NM_007246chr42913 86 ------
NM_007249chr1398983 8016 7516 7460 7270 6959 6213 1354 848 18616 47708 2796 1292 1270 --
NM_007269chr11437 ------
NM_007271chr631170 638 61 ------
NM_007276chr72695 261 ------
NM_007278chr17173 ------
NM_007285chr162458 87 ------
NM_007313chr971583 1330 603 415 403 385 201 1226 11888 --
NM_007320chr193288 249 237 ------
NM_007327chr94917 889 760 21 --1923 --
NM_007345chr182261 249 22171 1681 1897 --
NM_007350chr1254086 3940 3417 3032 1618 33106 963 485 ----
NM_007358chr11729 ------
NM_007365chr172086 2042 1659 842 800 674 30 1815 ----
NM_007368chr1321319 1307 --1245 --
NM_007371chr91220 --1641 --
NM_007373chr101681 ------
NM_007375chr132362 1130 430 ------
NM_012064chr1251141 1030 764 458 213 1341 ----
NM_012069chrX72702 2563 2549 894 815 402 133 ------
NM_012074chr144823 814 767 118 ------
NM_012081chr532516 2275 289 ------
NM_012092chr25696 549 452 428 48 ------
NM_012095chr1073480 2192 2182 1329 1211 1046 482 ------
NM_012096chr343336 2449 2336 1114 13135 ----
NM_012097chr221823 1770 ------
NM_012098chr931554 1232 84 ------
NM_012102chr152427 2398 2155 2041 875 22460 307 12085 --
NM_012104chr1173768 3466 2832 2482 2452 1083 1034 ----11408
NM_012104chr1173768 3466 2832 2482 2452 1083 1034 ----11408
NM_012115chr6162 --1406 --
NM_012120chr642876 2485 2009 951 12057 ----
NM_012137chr1112650 2378 2205 2165 2052 1911 1094 653 587 496 437 182 ----
NM_012141chr1332912 2547 245 --11003 --
NM_012156chr20113347 2836 2824 2634 2329 1271 805 724 657 462 202 ------
NM_012158chr1311607 11674 ----
NM_012160chr61196 ------
NM_012161chr421178 1032 ------
NM_012164chr9156923 6895 6694 6676 6260 6214 6000 5692 4828 1654 1547 1194 1145 808 448 26466 6194 ----
NM_012175chr112801 223 ------
NM_012180chr42490 168 ------
NM_012192chr1152437 2312 811 130 124 --1702 --
NM_012193chr11124899 4696 4630 4452 4420 3574 3332 1816 1531 708 684 674 --34798 1627 1287 --
NM_012199chr1144078 4054 3636 2929 1870 1481 1440 1084 1077 1069 939 669 636 600 11804 13255 13103
NM_012210chr91966 1343 ----
NM_012214chr2145470 5449 4606 4075 4054 2518 2418 2373 2167 2004 1993 883 858 530 15096 16160 --
NM_012215chr1051675 1665 1334 729 377 ------
NM_012232chr17142049 2040 1914 1906 1886 1805 1681 1675 1452 1443 379 50 38 31 ------
NM_012234chr341506 1431 1183 1067 ------
NM_012242chr102287 29 ------
NM_012244chr1471665 1657 1647 1290 576 316 30 --11199 --
NM_012250chr11261 50 ------
NM_012252chr763719 2120 1870 1518 730 397 ------
NM_012257chr73870 773 393 ------
NM_012262chr1124396 4291 3904 3735 3710 3368 2061 1939 1683 1286 666 387 ------
NM_012281chr722151 631 ------
NM_012282chrX3772 201 36 ------
NM_012286chrX1172 ------
NM_012287chr353792 3628 3449 1317 343 ------
NM_012288chr6185441 5385 4930 4666 4643 4539 4089 3931 3880 3637 3573 3491 2228 2040 2026 1827 173 81 --1538 --
NM_012290chr221680 154 ------
NM_012296chr11143375 3195 3092 2846 2595 1528 1471 1227 846 421 291 192 99 85 13102 ----
NM_012297chr431678 805 770 ------
NM_012300chr552084 1658 480 189 150 ------
NM_012301chr72588 316 1494 11555 --
NM_012302chr121085 1012 ------
NM_012306chr12173331 3307 3122 3063 3010 2936 2496 2405 2294 2270 2261 1261 1112 839 547 373 266 --23115 714 --
NM_012307chr182684 82 ------
NM_012308chr1181923 969 714 581 457 349 191 139 --1797 172
NM_012316chr1135408 3685 1964 1922 1710 1683 1656 1315 1283 1101 998 747 603 12121 ----
NM_012325chr202159 127 ------
NM_012329chr1721057 609 ------
NM_012333chr131479 614 336 ------
NM_012340chr201177 ------
NM_012382chr523342 642 12887 ----
NM_012384chr2052373 2277 2185 557 218 --12205 --
NM_012395chr762810 2373 2330 2227 2128 1378 --12384 --
NM_012399chr2231803 1364 500 --11522 --
NM_012402chr114418 366 298 114 --1369 --
NM_012405chr143783 2955 529 120 13119 --13361
NM_012407chr223513 138 130 ------
NM_012410chr163203 100 46 ------
NM_012412chr72828 25 ------
NM_012414chr11179 ------
NM_012419chr62607 104 ------
NM_012423chr193452 46 25 ------
NM_012432chr1143 ------
NM_012433chr21276 ------
NM_012446chr51645 ------
NM_012448chr1792553 2166 2159 2084 1570 1023 731 445 85 --12170 --
NM_012461chr143660 478 191 ------
NM_012463chr1221610 148 21259 1201 ----
NM_012465chr1042985 2798 2335 355 --2644 305 1887
NM_012471chrX21388 53 21801 320 ----
NM_012473chr222673 242 ------
NM_012479chr762706 2207 1973 1768 942 792 ------
NM_013227chr152757 84 ------
NM_013230chrY2588 484 1285 ----
NM_013231chr1443863 3212 1446 691 ------
NM_013233chr23970 398 87 ------
NM_013242chr16144 ------
NM_013243chr1521477 232 ------
NM_013245chr165648 576 251 225 215 ----1464
NM_013246chr112701 161 --121 --
NM_013252chr762667 2213 1983 738 478 110 ------
NM_013259chr32290 91 --1227 --
NM_013261chr433014 2922 2775 ------
NM_013269chr1264259 4180 3964 3459 1256 471 ------
NM_013275chr161194 ------
NM_013281chr2031376 385 264 ------
NM_013293chr72100 38 ------
NM_013316chr72798 85 --1911 --
NM_013333chr192359 145 --1317 --
NM_013336chr351577 665 652 475 302 ------
NM_013341chr2102806 2793 2762 2744 2025 1191 1168 1162 1077 346 ------
NM_013357chr8187 ------
NM_013363chr31136 ------
NM_013364chrX51995 1966 1435 1422 147 11644 ----
NM_013365chr224719 707 157 125 ------
NM_013368chr194466 116 42 30 ------
NM_013372chr1583179 2808 2280 935 495 466 392 361 ------
NM_013374chr31802 ------
NM_013381chr1232112 271 213 ------
NM_013390chr921389 250 ------
NM_013400chr731061 760 752 ------
NM_013411chr172481 2458 1987 1849 1750 1736 1092 ------
NM_013423chrX2323 109 ------
NM_013427chrX2323 109 ------
NM_013433chr1941944 1935 1876 1867 --11776 --
NM_013434chr221740 451 --1801 --
NM_013434chr221740 451 --1801 --
NM_013443chr931110 892 788 ------
NM_013444chrX6999 991 779 343 216 188 ------
NM_013446chr721349 147 21257 449 ----
NM_013448chr141639 ------
NM_013449chr12142301 2262 2112 865 841 829 748 641 633 626 337 323 195 186 --1541 --
NM_013450chr23866 461 351 ------
NM_013943chr133165 716 71 12765 ----
NM_013958chr81145 ------
NM_013959chr81145 ------
NM_013960chr81255 --1194 1611
NM_013961chr81145 ------
NM_013962chr81145 ------
NM_013979chr5--1415 ----
NM_013989chr14115032 4629 4536 4013 3978 3649 3366 3189 1271 1075 208 1462 14204 13317
NM_013993chr64618 524 279 175 ------
NM_013994chr64618 524 279 175 ------
NM_013999chr1771101 519 399 364 333 240 118 ------
NM_014000chr1051949 612 388 371 142 ------
NM_014005chr552497 2458 2432 826 637 12934 ----
NM_014007chr92836 174 ------
NM_014010chr93554 507 443 ------
NM_014011chr21572 ------
NM_014015chr163626 620 25 ------
NM_014016chr31347 ------
NM_014021chr143351 3039 1112 281 ------
NM_014030chr173869 830 420 ------
NM_014034chr641131 979 968 259 ------
NM_014038chr71291 ------
NM_014043chr31251 ------
NM_014048chr1614925 11882 ----
NM_014057chr931496 1113 502 ------
NM_014079chr34716 332 168 84 ------
NM_014109chr81452 ------
NM_014112chr854908 4815 2093 1223 529 1773 ----
NM_014141chr745053 3902 3499 430 14249 ----
NM_014145chr202595 579 ------
NM_014153chr161120 ------
NM_014155chr1175976 5659 5377 1492 987 115 82 ------
NM_014166chr131821 ------
NM_014178chr142243 26 --1571 --
NM_014181chr221912 828 ------
NM_014184chr11111 ------
NM_014188chr12311 287 ------
NM_014189chr451373 1358 1305 1260 80 --1982 --
NM_014190chr451725 1710 1657 1612 432 --11334 --
NM_014203chr192263 133 ------
NM_014217chr141857 527 269 47 ------
NM_014223chr12726 78 ------
NM_014231chr12102043 1955 1927 1711 1701 1368 738 234 132 117 11762 11715 --
NM_014232chr17101632 1253 1212 1030 651 412 405 383 346 61 ------
NM_014232chr17101632 1253 1212 1030 651 412 405 383 346 61 ------
NM_014233chr1721359 221 11399 ----
NM_014234chr61170 ------
NM_014238chr1721371 38 ------
NM_014240chr364086 3579 1598 635 413 223 ----14198
NM_014243chr42171 56 ------
NM_014251chr71811 ----1317
NM_014253chrX1553 --1557 --
NM_014268chr18----11164 --
NM_014271chrX2700 588 176 ----
NM_014275chr52873 792 --2933 820 --
NM_014279chr92817 247 ------
NM_014283chr11322 1997 ----
NM_014284chr13905 425 105 ------
NM_014289chrX41243 1215 1066 120 ------
NM_014299chr1992076 2041 1760 861 737 652 593 577 122 ------
NM_014309chr22135065 4974 4915 4118 3894 3555 3289 1504 1275 1233 816 610 588 --25197 4372 --
NM_014323chr222392 143 ------
NM_014333chr1141021 849 579 358 ------
NM_014335chr152999 285 ------
NM_014342chr1131382 1320 1264 ------
NM_014344chr112839 700 ------
NM_014345chr63946 937 162 ------
NM_014365chr12250 24 ------
NM_014368chr981916 1901 1613 850 401 352 290 212 ------
NM_014374chr731061 760 752 ------
NM_014381chr1422109 1205 ------
NM_014393chr842311 947 786 217 --1302 --
NM_014396chr751816 911 901 686 192 --126 --
NM_014397chr931424 329 62 ----167
NM_014405chr1782267 2258 2139 2130 1941 1488 525 338 ------
NM_014408chr12560 534 ------
NM_014409chr13835 420 106 ------
NM_014415chr311163 ------
NM_014423chr574687 3466 2106 2035 1185 1163 1136 --24530 118 --
NM_014426chr202542 208 ------
NM_014445chr311696 --12161 --
NM_014450chr93401 335 206 ------
NM_014452chr62213 180 ------
NM_014456chr102319 224 ------
NM_014458chr171269 1180 1103 880 471 255 32 ------
NM_014462chr81219 ------
NM_014470chr123639 593 39 ------
NM_014488chr111622 ------
NM_014491chr7----1772 --
NM_014494chr1662072 1893 1846 1667 797 314 ------
NM_014496chrX1252 ------
NM_014504chr732174 378 277 ------
NM_014507chr222915 855 11027 ----
NM_014515chr1221077 1049 1118 ----
NM_014516chr191196 ------
NM_014517chr341799 1234 779 165 ------
NM_014521chr241742 1644 157 45 --1607 --
NM_014554chr1222017 552 ------
NM_014562chr21100 ------
NM_014563chrX32105 690 201 ------
NM_014570chr224306 248 225 39 ------
NM_014572chr1321673 141 11504 ----
NM_014573chr1721562 1243 ------
NM_014574chr141322 ------
NM_014584chr1411411 ------
NM_014587chr1641525 1188 1065 266 --1541 --
NM_014588chr20146 ------
NM_014591chr1051322 1090 1071 428 75 --1846 --
NM_014592chr52263 196 ------
NM_014603chr1731689 1124 499 ----1416
NM_014604chr172636 156 ------
NM_014606chr4111259 1114 1031 506 465 401 394 384 376 268 37 ------
NM_014607chr231956 444 199 ------
NM_014612chr911344 ------
NM_014613chr5102676 2309 2040 1907 950 943 889 641 434 296 1495 22699 2268 --
NM_014614chr21164 ------
NM_014616chr341060 625 385 39 ------
NM_014620chr122193 124 ------
NM_014630chr15123854 3674 2473 1041 927 899 849 542 531 419 384 343 --12429 --
NM_014632chr11278 62 ------
NM_014634chr22103514 3207 2753 2661 2592 640 449 49 41 32 ------
NM_014636chr9133495 3438 3113 1729 1442 1362 1352 1239 1018 872 836 649 524 --1878 14061
NM_014640chr21114 ------
NM_014644chr11127 ------
NM_014646chr1882203 2034 647 487 287 243 139 69 ------
NM_014647chr1611571 ------
NM_014653chr1242144 1733 662 459 ------
NM_014659chr156848 737 400 367 334 55 ------
NM_014661chr1082383 1552 1537 1272 1253 1205 824 502 11041 ----
NM_014663chr12972 143 ------
NM_014665chr893691 3516 3292 2863 2350 1161 703 697 363 ------
NM_014667chr332350 1677 748 --11681 --
NM_014674chr383843 3666 3504 3256 3182 3164 329 156 11076 ----
NM_014676chr141488 450 439 132 ------
NM_014677chr831031 1013 499 ------
NM_014678chr222171 47 ------
NM_014680chr172380 129 ------
NM_014686chr1961850 851 658 423 416 137 12212 ----
NM_014690chr7102828 2786 2738 2460 2245 2099 2069 2061 1135 410 ------
NM_014701chr1563239 2679 2217 1212 840 374 ------
NM_014702chr653022 1401 1099 525 91 12395 13275 12287
NM_014705chr72257 106 11906 ----
NM_014707chr722287 480 ------
NM_014711chr1621959 159 ------
NM_014713chr2181 ------
NM_014720chr102734 374 ------
NM_014723chr20103204 2946 2794 2660 2637 713 475 426 298 73 ------
NM_014726chr1741223 1008 493 185 ------
NM_014729chr811692 ------
NM_014730chr12184912 4761 4222 4061 3950 3647 3428 3419 1711 1487 1308 1062 893 812 759 243 236 204 --14827 14066
NM_014730chr12184912 4761 4222 4061 3950 3647 3428 3419 1711 1487 1308 1062 893 812 759 243 236 204 --14827 14066
NM_014731chr2061442 1351 1224 280 143 82 ------
NM_014733chr52799 587 ------
NM_014735chrX41509 1449 575 323 ------
NM_014741chr1172090 1477 747 526 493 322 124 --1774 --
NM_014742chr2061253 1118 586 572 399 36 ------
NM_014743chr483058 2614 2010 1177 383 143 100 59 --11117 --
NM_014746chr263045 2814 1617 890 822 395 1718 21702 339 --
NM_014747chr1215507 5416 5286 5122 4887 4863 4116 4003 3989 3981 3967 3770 3734 3684 3650 1468 1326 805 719 588 80 --35128 4320 1784 12108
NM_014751chr841681 861 778 383 ------
NM_014752chr1111342 1406 --1211
NM_014755chr263440 3247 3212 1531 1331 211 --1497 --
NM_014756chr112387 172 ------
NM_014757chr582365 1908 1801 1795 1622 946 749 713 ------
NM_014761chr1641030 283 158 149 --173 --
NM_014764chr123514 401 55 ------
NM_014765chr121863 1061 --1616 --
NM_014767chr1082729 2650 2620 2411 2249 1285 1165 488 1248 32863 2253 301 22716 2660
NM_014772chr1873436 3311 2462 2213 925 607 273 13014 1351 12233
NM_014776chr12142963 2865 2725 2623 2451 2231 2129 1986 1242 1060 949 577 75 23 ------
NM_014779chr33815 156 49 ------
NM_014784chr15810 754 387 94 38 ------
NM_014795chr21471 ------
NM_014798chr1751780 1508 734 653 586 ------
NM_014800chr73881 460 200 ------
NM_014803chr1041040 395 360 256 ----1531
NM_014807chr113658 610 326 ------
NM_014810chr162819 2649 2635 2607 1418 1286 --13458 --
NM_014812chr111936 --11591 --
NM_014819chr51947 --1778 --
NM_014820chr331901 1369 50 ------
NM_014822chr4150 ------
NM_014824chr1161884 1529 1330 596 500 153 11765 ----
NM_014826chr1104330 4191 4084 3465 1423 1374 940 394 69 53 ------
NM_014827chr131474 253 159 ----1319
NM_014828chr1432166 1582 856 ------
NM_014830chr1283751 3416 3406 2875 2832 2674 2653 736 12434 ----
NM_014832chr13135 ------
NM_014835chr2062082 2025 1870 1668 845 198 22094 57 12321 --
NM_014836chr1021307 130 ------
NM_014838chr2232796 700 166 ------
NM_014839chr172273 2013 1829 1787 880 602 531 1961 ----
NM_014840chr1242742 2297 832 180 --2818 421 --
NM_014841chr631176 400 127 ------
NM_014847chr13375 208 46 ------
NM_014849chr171105 912 893 885 278 193 55 ------
NM_014850chr3164788 4699 4482 4301 4042 3886 3550 3496 1612 1479 1459 1260 893 490 317 290 14525 13962 --
NM_014853chr1751500 1396 1379 1150 1022 ------
NM_014868chr124616 580 229 25 ------
NM_014870chr184619 4493 3945 3371 3275 784 656 524 ------
NM_014872chr932131 1928 225 --11748 --
NM_014873chr143763 1608 1186 679 1809 ----
NM_014877chr17127411 7193 5917 5619 5585 5403 4963 2553 2503 2445 2363 906 ------
NM_014887chr132717 640 ------
NM_014892chr61552 ------
NM_014893chrY3749 427 161 ------
NM_014897chr1753153 2258 2082 337 99 13103 12313 --
NM_014901chr541999 748 347 287 --11408 1500
NM_014902chr2041527 1217 411 248 ------
NM_014903chr1242394 431 376 325 ------
NM_014904chr1053673 3302 3156 327 117 13787 ----
NM_014906chr1723608 1002 23387 3096 12877 13140
NM_014909chr1463229 3163 3088 2967 2771 373 ------
NM_014912chr1012884 1109 ----
NM_014914chr24439 218 106 60 --1847 --
NM_014918chr1531305 529 130 ------
NM_014920chr643484 2541 2530 27 ------
NM_014921chr19152976 2935 2896 2739 2495 2477 2025 1895 1194 1061 880 869 612 504 434 --12968 --
NM_014923chr1332276 694 474 ------
NM_014924chr1433115 359 48 ------
NM_014925chr123248 234 173 ------
NM_014932chr341332 710 678 65 ------
NM_014933chr41382 ------
NM_014934chr1313230 ------
NM_014939chr1831281 1191 1054 ------
NM_014944chr151074 1067 960 521 194 ------
NM_014945chr571862 1282 617 607 599 328 169 ------
NM_014949chr1139 ------
NM_014950chr1411776 ------
NM_014952chr1572027 1799 1623 831 585 550 276 ------
NM_014961chr461764 1607 824 732 460 370 1354 ----
NM_014969chr15822 454 411 323 254 1840 ----
NM_014974chr1051549 1252 709 311 150 ------
NM_014978chr101289 --2731 246 --
NM_014982chr1473753 3592 1413 1141 894 324 152 21362 526 ----
NM_014988chr471762 1135 981 858 313 123 93 ------
NM_014989chr611361 ------
NM_014990chr141150 ----1109
NM_014991chr442375 2248 2147 104 ------
NM_014994chr1552336 1962 836 761 200 --1147 --
NM_014996chr32271 76 ------
NM_014997chr772581 2337 1938 1856 249 208 53 11100 --1257
NM_015000chr1223090 2263 ------
NM_015001chr14924 905 270 166 ------
NM_015002chr1272246 1703 1663 795 673 376 166 ------
NM_015008chr383141 3076 3026 2975 2779 2712 1289 240 ------
NM_015013chr12216 63 ------
NM_015020chr1693701 3677 3351 3294 1472 1387 1131 789 354 ------
NM_015023chr191673 1552 1521 1466 1452 1423 1271 1213 612 ------
NM_015024chr831375 1336 268 ------
NM_015025chr222031 1757 --1889 --
NM_015026chr1284620 4584 4565 4499 4478 1484 1072 122 ------
NM_015032chr1332588 897 515 ------
NM_015035chr20155879 5844 5111 4848 4604 4083 4053 2527 2047 1963 1627 1215 552 226 139 12574 ----
NM_015037chr101264 ------
NM_015039chr183701 3571 2970 1523 1498 397 258 196 13432 189 --
NM_015042chr15154296 4262 4252 3853 3642 3635 3473 2878 2805 1344 1117 1082 911 607 195 --1841 --
NM_015044chr1662625 2492 2283 803 773 507 --22755 2572 --
NM_015045chr101150 184 ----
NM_015046chr9--1222 12352 --
NM_015051chr952886 1341 1122 857 785 ----12984
NM_015052chr741212 491 195 92 ------
NM_015053chr162238 1937 1674 313 49 26 ------
NM_015059chr15153843 3775 3289 3261 2854 2628 2593 867 825 737 659 511 417 338 212 --1598 12612
NM_015064chr1273256 2700 1444 1050 1038 910 894 ------
NM_015068chr743932 3907 3873 58 ------
NM_015071chr595255 4964 4321 2312 2291 2087 1600 995 621 ------
NM_015072chr142480 395 ------
NM_015075chrX72245 2073 2047 1571 356 180 90 --22249 1624 --
NM_015076chr664004 3422 2960 957 239 164 --13283 --
NM_015079chr15103180 3080 2962 2433 2266 1235 789 711 236 118 --11082 --
NM_015080chr113373 175 117 ------
NM_015086chr1281458 1391 1380 1063 971 97 88 43 1128 1245 --
NM_015090chr1145743 5435 5134 4846 4260 2353 2098 1153 963 757 750 654 583 354 --25094 705 --
NM_015092chr1694471 4321 3543 3475 2896 2845 995 656 469 ------
NM_015094chr2244375 3476 1122 608 ----1490
NM_015097chr322293 1864 1898 ----
NM_015099chr174459 291 142 135 --1173 --
NM_015100chr151714 793 737 613 607 ------
NM_015107chrX62372 1523 576 208 162 47 ------
NM_015113chr1731998 668 278 ----2586 110
NM_015115chr442458 1018 867 96 ------
NM_015116chr1391660 1542 1462 1308 1244 587 294 256 197 ------
NM_015125chr194451 216 136 81 ------
NM_015132chr721755 153 1498 ----
NM_015133chr1641428 1308 541 100 ------
NM_015138chr1592599 1009 937 810 494 477 389 167 60 ------
NM_015141chr331053 841 226 --1615 --
NM_015147chr272641 1156 855 735 227 150 80 ------
NM_015150chr33931 325 288 --1130 --
NM_015153chr61627 ------
NM_015155chr1042766 2303 2232 668 ----13231
NM_015156chr1493631 3516 3429 3154 2994 857 632 321 175 --1355 --
NM_015161chr1631342 581 499 --11127 --
NM_015162chr15276 57 ------
NM_015163chr1421875 182 ------
NM_015171chr163352 146 109 --1102 --
NM_015173chr441587 1208 218 105 11369 ----
NM_015176chr121418 164 ------
NM_015178chr871082 818 726 711 328 135 65 1396 ----
NM_015185chrX82632 2386 2372 2322 2210 2203 559 552 12243 12330 --
NM_015191chr1152730 2572 839 826 168 ------
NM_015197chr1493127 3111 2920 2194 2138 1179 853 596 352 ------
NM_015199chr352907 2312 2289 1975 1068 ------
NM_015200chr442434 1989 1782 1768 --12134 --
NM_015202chr1651707 1530 1173 611 507 ------
NM_015206chr1561220 1072 906 619 504 433 1834 ----
NM_015208chr1832505 1256 843 ------
NM_015209chr131960 387 379 12293 ----
NM_015215chr12335 308 ------
NM_015216chr531290 1078 63 ------
NM_015225chr941934 842 563 554 ----12718
NM_015226chr16103455 3138 3010 1370 883 873 434 344 328 198 23288 172 ----
NM_015227chr21143302 3255 2689 2507 2141 888 707 512 472 412 294 224 132 87 --12942 --
NM_015229chr173865 340 105 ------
NM_015233chr1362355 2300 2162 1827 653 138 --22514 36 --
NM_015234chr631021 271 92 ------
NM_015250chr941593 1495 1437 386 --1308 --
NM_015252chr24606 596 160 153 1230 ----
NM_015263chr152985 399 ------
NM_015268chr3155 ------
NM_015270chr1232246 1870 930 ----11686
NM_015271chr454113 2922 1253 859 206 ----1866
NM_015272chr1651681 516 245 190 33 ------
NM_015282chr282541 2487 1229 1020 930 845 653 410 11110 --12042
NM_015285chr1862365 1822 1609 646 155 73 --12227 --
NM_015288chr593664 3201 3002 2832 2805 2751 1317 991 175 --13870 --
NM_015291chr1113027 2578 2486 2362 1074 967 289 275 213 116 30 ------
NM_015292chr122282 272 ------
NM_015293chr61129 ------
NM_015294chr1711083 ------
NM_015296chr132404 113 ------
NM_015299chr1493792 3729 3680 3366 3293 3270 1388 370 221 ------
NM_015305chr1471894 1822 1331 607 207 189 28 --1126 --
NM_015310chr897959 7881 6227 3233 3002 2738 2489 1516 274 ----11198
NM_015313chr11123658 3633 3432 3327 3188 3122 1471 1440 708 684 602 232 ------
NM_015314chr71434 ------
NM_015315chr582781 2242 2168 1333 1182 996 963 207 1754 ----
NM_015317chr262707 2463 2380 2128 2087 1116 ------
NM_015320chr251016 386 376 355 90 ------
NM_015326chr192707 2689 2584 2482 1989 1158 1015 856 784 --12375 --
NM_015327chr161257 1123 966 506 486 375 ----1934
NM_015328chr7102696 2323 1221 1189 780 671 616 598 317 92 ------
NM_015332chr783425 2947 2917 2895 2832 1002 325 53 13340 53355 2776 2388 1038 505 --
NM_015335chr1241001 195 137 39 ----1187
NM_015336chr1222652 2447 ------
NM_015338chr2041847 1449 1264 752 ------
NM_015339chr202192 78 1731 ----
NM_015344chr82679 131 ------
NM_015346chr1471734 1610 603 464 338 99 80 11571 ----
NM_015349chr622130 222 ------
NM_015355chr171521 11518 ----
NM_015359chr892748 2707 2583 820 740 526 309 231 223 11838 ----
NM_015361chr2----1753 --
NM_015365chrX84116 4026 3742 3604 3027 597 464 46 --1322 --
NM_015381chr2272079 1560 1446 1403 811 745 417 ------
NM_015382chr141288 ------
NM_015385chr1032652 1100 786 ------
NM_015393chr452886 2378 1226 148 139 --12889 --
NM_015396chr31190 --141 --
NM_015397chr971864 1563 1512 1402 1278 362 54 11657 ----
NM_015401chr123781 292 52 ------
NM_015404chr92495 485 --182 --
NM_015416chr123793 667 175 ------
NM_015426chr31582 --1586 --
NM_015429chr321024 386 ------
NM_015435chr811025 ------
NM_015443chr1721029 215 ------
NM_015444chr32657 106 ------
NM_015455chr563392 3335 2788 1530 405 325 --11167 --
NM_015457chr111352 1236 1802 --
NM_015458chr885265 3828 3341 1862 1821 1682 1515 498 --161 --
NM_015460chr331871 1585 581 --11544 --
NM_015464chr74829 379 330 257 ------
NM_015465chr51486 ------
NM_015466chr32190 78 ------
NM_015470chr23287 122 62 --1116 --
NM_015472chr31126 ------
NM_015472chr31126 ------
NM_015475chr23744 406 216 ------
NM_015481chr1231084 108 81 ------
NM_015488chr2101634 1572 1515 1374 1181 684 523 348 295 75 ------
NM_015493chr1972145 2103 1692 1492 597 77 61 --12046 --
NM_015497chr151243 1121 ----
NM_015503chr161585 ----1575
NM_015509chr1271540 1412 1366 559 442 134 92 ------
NM_015511chr2051136 982 949 753 313 11178 ----
NM_015526chr1921477 1028 ------
NM_015530chr22342 290 --1729 --
NM_015534chr12138 33 ------
NM_015542chr101250 ------
NM_015550chr773299 2727 2714 2246 772 642 151 22674 792 ----
NM_015553chr6154720 4630 4467 3852 3730 3606 3405 1862 1807 804 510 299 174 49 23 ----14654
NM_015564chr532869 740 550 ------
NM_015565chr211119 ------
NM_015567chr135537 512 379 364 222 ------
NM_015568chr20124157 3725 3316 3206 2822 2746 1729 1656 1131 784 602 309 ------
NM_015569chr174668 4327 3873 3685 618 543 482 ----12954
NM_015570chr731308 734 239 ------
NM_015571chr621992 356 ------
NM_015575chr232257 676 625 ------
NM_015576chr31620 12067 ----
NM_015578chr1941373 723 461 43 ------
NM_015605chr102457 85 ------
NM_015609chr122457 188 ------
NM_015627chr181881 1622 1531 1382 693 651 521 379 --11647 --
NM_015634chr101401 ------
NM_015635chr91877 1623 ----
NM_015640chr174888 3500 1938 1246 1027 580 164 13511 1679 --
NM_015645chr112313 296 ------
NM_015649chr192382 289 ----1294
NM_015652chr103628 225 182 ------
NM_015660chr71219 ------
NM_015680chr25606 591 580 548 98 ------
NM_015686chrX42382 2087 1919 78 ------
NM_015689chr7127 ------
NM_015691chrX21109 195 1369 ----
NM_015694chr72143 131 1254 ----
NM_015716chr175718 694 588 199 182 ------
NM_015719chr193738 201 148 ------
NM_015726chr171868 1689 1172 1139 745 643 566 ------
NM_015831chr74332 168 105 39 ------
NM_015834chr212913 130 ------
NM_015840chr1112711 2435 2152 2047 1669 854 498 480 301 103 71 12492 ----
NM_015841chr1112711 2435 2152 2047 1669 854 498 480 301 103 71 12492 ----
NM_015844chr181212 ------
NM_015846chr181212 ------
NM_015847chr181212 ------
NM_015850chr852411 2358 2267 1960 184 ------
NM_015853chr112191 48 ------
NM_015864chr6147 ------
NM_015872chr191707 1451 1418 1409 1335 1257 1169 448 131 --11108 --
NM_015874chr43566 546 485 ------
NM_015878chr822209 1848 ------
NM_015886chr875192 5169 5159 4060 3932 939 117 ------
NM_015891chr642046 826 578 377 --11623 --
NM_015906chr184507 4481 4199 4033 3661 1471 1156 746 --14324 23666 124
NM_015912chr842096 1939 942 531 ------
NM_015955chr21131 ------
NM_015957chr113353 303 146 ------
NM_015960chr10189 ------
NM_015974chr13128 ------
NM_015980chr541472 1465 1327 197 ------
NM_015982chr171299 1143 ----
NM_015984chr11385 ------
NM_015987chr12150 ------
NM_015995chr15145241 5130 4765 3698 1498 1440 1348 1275 1266 1253 1144 985 814 494 --11279 --
NM_015999chr12299 229 ------
NM_016002chr1151 ------
NM_016018chr832811 2675 465 ------
NM_016019chr72882 386 1163 ----
NM_016021chr672386 2325 2287 2072 451 213 127 ------
NM_016022chr16875 855 744 702 442 101 --3777 713 105 1734
NM_016032chrX61334 1183 1168 1001 890 298 ------
NM_016039chr14123 ------
NM_016040chr162637 2023 1847 972 735 86 ------
NM_016041chr171312 ------
NM_016057chr1241122 373 33 24 ------
NM_016059chr62182 27 ----1776
NM_016061chr241449 1105 556 38 ------
NM_016063chr62767 568 ------
NM_016072chr1211879 ------
NM_016073chr154988 420 149 101 ------
NM_016075chr1332596 835 448 12787 ----
NM_016076chr1103017 2969 2850 2443 2260 1954 1244 1197 829 585 --1833 --
NM_016083chr643741 3671 2794 1279 --179 --
NM_016096chr852112 1346 451 225 39 ------
NM_016099chr861119 1025 378 366 358 79 ------
NM_016107chr511049 ------
NM_016120chrX21222 323 ------
NM_016131chr24793 761 742 48 --1746 --
NM_016132chr1521250 876 --13352 --
NM_016147chr116872 856 320 231 84 23 1384 ----
NM_016152chr331059 256 161 ------
NM_016156chr1182269 2250 2215 2034 2025 1742 1586 75 ------
NM_016162chr122215 128 --1319 --
NM_016169chr10123261 3097 2810 2790 2645 2557 2328 1289 1177 1002 473 453 ------
NM_016173chr3134555 4525 4213 3844 3750 3375 3253 3236 2949 2905 2757 1151 1128 --11634 --
NM_016185chr172697 40 1170 ----
NM_016194chr1571637 1624 1546 1387 1263 1227 420 1391 ----
NM_016201chr3122280 2169 1919 1440 836 771 721 586 501 493 230 44 ------
NM_016211chr41382 ------
NM_016221chr521982 292 ----12327
NM_016223chr112109 57 ------
NM_016224chr642110 2079 1988 477 ------
NM_016226chr122352 131 ------
NM_016227chr11322 1997 ----
NM_016230chr61436 ------
NM_016231chr171572 ------
NM_016248chr1373999 3465 1299 1283 1272 1244 390 ------
NM_016255chr633214 3158 917 ------
NM_016257chr173063 3003 2681 2330 1021 436 142 ------
NM_016258chr11795 ------
NM_016260chr287587 6588 5973 5074 1975 1455 1171 82 ----24672 1120
NM_016269chr43764 732 66 ------
NM_016272chr22111954 1907 1869 1824 1792 1737 678 493 362 354 109 --1528 --
NM_016277chr641609 1525 234 204 ------
NM_016279chr5175 ------
NM_016281chr125908 893 881 231 185 ------
NM_016284chr16188 ------
NM_016287chr151800 1611 600 198 106 ------
NM_016293chr12252 22 ------
NM_016303chrX1383 ------
NM_016319chr123706 556 155 ------
NM_016322chr962934 2802 2358 2035 579 252 ------
NM_016338chr53863 854 190 1985 ----
NM_016351chr7195 ------
NM_016353chr851888 938 740 501 270 ------
NM_016374chr121629 189 ------
NM_016374chr121629 189 ------
NM_016396chr15--12386 12887 --
NM_016406chr11359 ------
NM_016410chr91182 ------
NM_016422chr1122196 530 ------
NM_016424chr172723 152 ------
NM_016436chr2051941 930 548 538 236 12589 ----
NM_016441chr21187 ------
NM_016453chr33673 269 249 ------
NM_016454chr152330 74 ------
NM_016456chr13680 130 80 --1600 --
NM_016484chrX3602 554 443 ------
NM_016485chr621827 782 ------
NM_016492chr171127 ------
NM_016499chr113527 470 209 ------
NM_016505chr12701 518 ------
NM_016506chr11135 ------
NM_016507chr174979 683 554 140 ------
NM_016513chr643484 2541 2530 27 ------
NM_016522chr1121675 1574 ------
NM_016525chr91221 ----1785
NM_016530chr1553428 1608 933 247 53 ------
NM_016531chr493628 3232 1116 754 587 518 394 338 189 ------
NM_016544chr2163557 3424 2865 2844 2835 1493 1442 1259 1252 1220 1165 1132 1121 1103 1034 602 ----11447
NM_016545chr14883 339 297 279 ------
NM_016569chr1231358 623 549 ------
NM_016571chr6123 ------
NM_016574chr116919 760 322 286 154 108 1314 1710 --
NM_016577chr3124367 4277 4072 3989 3325 1595 1352 1280 972 700 437 395 --34215 3304 37 --
NM_016587chr72695 261 ------
NM_016588chr61733 ------
NM_016592chr20----127 --
NM_016596chr123781 292 52 ------
NM_016603chr51570 148 ----
NM_016604chr54984 339 145 24 ------
NM_016605chr592537 1919 1883 1874 1862 1744 911 488 395 --21683 142 --
NM_016607chrX21482 658 ------
NM_016620chr111455 ------
NM_016621chr11164292 4233 4116 3837 3825 3767 3459 3128 1641 1561 1540 1533 1182 767 715 655 ----11503
NM_016623chr82126 118 ------
NM_016628chr102637 626 ------
NM_016641chr1621490 1474 ------
NM_016653chr221046 855 ------
NM_016656chrX2308 111 ------
NM_016824chr102565 297 ------
NM_016830chr123405 73 63 1124 177 --
NM_016834chr17154010 3887 3780 3281 3244 3220 3203 3028 3000 1423 1250 864 822 692 284 --2634 107 --
NM_016835chr17154010 3887 3780 3281 3244 3220 3203 3028 3000 1423 1250 864 822 692 284 --2634 107 --
NM_016841chr17154010 3887 3780 3281 3244 3220 3203 3028 3000 1423 1250 864 822 692 284 --2634 107 --
NM_016929chr6114546 3973 3390 1451 1365 979 383 370 337 187 76 14451 13730 --
NM_016931chr111347 ------
NM_016936chr1661938 1820 1795 1762 1550 408 --2576 140 --
NM_017409chr124141 86 53 34 ------
NM_017410chr1281106 1067 954 871 792 785 489 288 --1292 --
NM_017412chr821402 430 ------
NM_017413chrX92464 1774 966 646 357 285 139 72 52 ------
NM_017415chr5114524 3506 3133 1809 1204 1063 818 797 676 442 128 34423 696 617 13516 --
NM_017420chr1443015 2461 927 708 --12712 --
NM_017426chr41183 ------
NM_017439chr7162 ------
NM_017450chr1731157 1067 72 ------
NM_017452chr202563 372 ------
NM_017453chr202563 372 ------
NM_017454chr202563 372 ------
NM_017456chr1761859 1481 1236 518 231 51 ------
NM_017457chr191121 ------
NM_017481chr11133 ------
NM_017488chr271557 1487 601 391 378 369 295 ------
NM_017519chr641285 1276 449 115 ------
NM_017522chr111067 --1992 --
NM_017530chr162103 26 ------
NM_017553chr15----1345 --
NM_017575chr1771590 1525 1185 640 595 166 126 --1342 --
NM_017580chr1032360 897 545 ------
NM_017582chr14642 325 282 22 ------
NM_017596chr1144422 4219 3753 3557 3479 1791 1563 1491 1396 1364 984 707 113 26 --14156 --
NM_017599chr1231916 758 376 --11356 --
NM_017602chrX3937 129 95 ------
NM_017622chr174451 271 121 64 ------
NM_017629chr121763 1259 ------
NM_017632chr41141 ------
NM_017633chr643044 1430 603 208 ------
NM_017636chr192307 264 1103 ----
NM_017637chr9108749 8209 8186 7401 6669 6284 5746 3768 2270 1507 1163 18252 --
NM_017640chr64575 233 114 95 ------
NM_017643chr1722536 492 ------
NM_017644chr344841 772 137 86 11105 ----
NM_017645chr973014 2320 2215 2101 2014 977 188 ------
NM_017649chr1081157 1130 993 898 844 497 469 303 ------
NM_017650chr795897 5072 4746 4464 929 857 259 70 54 ------
NM_017658chr1421571 358 11542 ----
NM_017666chrX52051 1968 1762 813 397 ------
NM_017668chr166792 679 104 93 80 47 2149 73 2256 51 --
NM_017670chr11----1830 --
NM_017672chr1531159 865 443 ------
NM_017694chr231440 379 44 ------
NM_017709chr1104207 3389 2969 2878 1312 1185 1096 868 453 71 --11630 --
NM_017714chr204967 933 281 258 ------
NM_017715chr73527 184 42 ------
NM_017719chr322081 644 ------
NM_017721chr191340 ------
NM_017730chr32530 197 1225 ----
NM_017734chr1166 ------
NM_017739chr13524 513 207 ------
NM_017740chr1631832 1213 1179 ------
NM_017742chr1831865 1371 440 11972 ----
NM_017744chr152209 1778 989 742 310 ------
NM_017745chrX2114 46 ------
NM_017753chr931017 950 383 ------
NM_017754chr684975 4666 4474 1463 1163 949 885 297 --1392 --
NM_017757chr1841134 1034 984 884 ------
NM_017758chr1791397 1086 962 545 497 388 212 141 57 ------
NM_017762chr1531676 790 50 11652 ----
NM_017766chr13486 362 84 --1508 --
NM_017772chr661793 1637 1603 1339 440 433 ------
NM_017778chr821003 536 --2995 551 --
NM_017779chr172727 2608 2583 2503 2279 1806 779 ------
NM_017784chr331152 904 319 ------
NM_017786chr8----1110 --
NM_017789chr22776 217 ------
NM_017798chr2021238 1188 ------
NM_017799chr1411828 ------
NM_017801chr321038 1027 ------
NM_017810chr162618 32 ------
NM_017811chr952714 2639 1168 630 162 ------
NM_017813chr855410 5349 5170 4913 3628 ------
NM_017831chr1864524 4500 3315 1637 1628 1399 1195 ----
NM_017848chrX74399 1767 1477 1244 503 493 280 --21818 1771 --
NM_017849chr2123172 2752 2030 1038 877 537 323 285 117 76 55 21 --2980 473 --
NM_017851chr1521025 242 ------
NM_017890chr841687 1439 1423 548 11757 ----
NM_017893chr1071447 1028 537 222 173 114 28 ------
NM_017902chr10195643 5389 4515 4413 4401 4061 4000 3978 2227 2158 2061 2002 1981 1827 1573 1544 1314 823 226 --13782 --
NM_017907chr11126 ------
NM_017915chr122392 299 ------
NM_017919chr964843 4309 2077 1820 613 582 --14186 --
NM_017923chr43738 324 102 ------
NM_017938chrX2557 550 ------
NM_017953chr12362 213 ------
NM_017955chr1431166 858 315 ------
NM_017964chr221002 185 --140 --
NM_017982chr141233 1193 535 35 ------
NM_017983chr172305 157 ------
NM_017987chr105853 836 545 484 86 ------
NM_017988chr123732 218 205 ------
NM_017994chr752831 1974 888 830 50 ------
NM_017998chr93894 335 61 ------
NM_018008chr31259 1160 ----
NM_018010chr341612 1571 1460 278 ------
NM_018027chr1062802 2771 2006 1280 867 35 2652 593 ----
NM_018028chr1981215 1203 911 510 316 281 272 72 ------
NM_018032chr162385 46 ------
NM_018043chr1131351 1047 358 ------
NM_018045chr192710 2630 2342 2333 2291 1969 859 450 75 ------
NM_018048chr1242055 1692 1449 808 ------
NM_018061chr12129 95 ------
NM_018062chr22405 158 --1409 --
NM_018067chr14424 359 227 42 ------
NM_018077chr7164 ------
NM_018078chr41410 182 ----
NM_018084chr233279 2326 992 1193 ----
NM_018085chr177173 5933 5584 574 552 88 29 ------
NM_018086chr231364 1320 512 1331 ----
NM_018092chr16----1311 --
NM_018095chr11135 ------
NM_018107chr1481035 977 889 759 749 371 313 63 --2981 28 --
NM_018111chr19183 ------
NM_018114chr32560 199 ------
NM_018115chr42761 50 ------
NM_018116chr11465 1583 ----
NM_018117chr102647 534 ------
NM_018120chr821407 462 ------
NM_018121chr1052715 2211 2006 518 301 ------
NM_018133chr321461 680 ------
NM_018150chr12654 611 ------
NM_018155chr373161 3044 2976 732 723 694 237 --13220 --
NM_018159chrX31379 1268 146 ------
NM_018176chr441454 1174 621 535 ------
NM_018178chr142034 1649 152 23 ------
NM_018181chr1851719 1388 751 690 633 2516 160 ----
NM_018182chr1772121 1925 1826 1723 1685 543 310 ------
NM_018184chr331998 1599 62 ------
NM_018200chr1592274 2267 1944 1819 1771 795 722 562 457 --21831 1590 --
NM_018201chr9142041 1837 1809 1675 1622 758 726 700 664 654 624 528 350 162 12495 11568 12210
NM_018202chr12305 231 ------
NM_018206chr16126 ------
NM_018211chr132153 1867 1835 1276 ----
NM_018214chr62325 37 --187 --
NM_018216chr1124 ------
NM_018227chr422513 1242 ------
NM_018231chr168959 950 935 750 650 274 252 125 ------
NM_018234chr271883 1612 847 806 751 663 529 ------
NM_018237chr10------1207
NM_018240chr15839 702 235 214 115 --198 --
NM_018241chr41749 ------
NM_018243chr4123803 3447 3371 1567 1453 1325 1184 1112 1100 611 355 115 1718 ----
NM_018244chr2051148 959 843 477 152 ------
NM_018246chr852750 2343 1773 597 590 1459 ----
NM_018247chr632147 2002 670 ------
NM_018254chr162306 1992 710 400 346 214 1820 ----
NM_018263chr262374 2269 1930 1801 1029 1021 ----11771
NM_018287chr102912 361 ------
NM_018293chr353001 2859 2673 2340 2192 ------
NM_018299chr863087 2698 2628 2615 723 329 --12430 --
NM_018302chr432418 2136 680 ------
NM_018307chr172667 354 ------
NM_018312chr1171908 1866 1701 1668 1659 1611 452 ------
NM_018315chr431425 1063 312 ------
NM_018327chr204644 437 210 93 --155 --
NM_018334chr71350 ------
NM_018351chr1284174 4153 4113 4075 3839 1095 724 21 ----13279
NM_018357chr151325 1368 ----
NM_018362chr1123499 55 --22759 124 --
NM_018364chr173598 2938 2820 937 706 673 266 ------
NM_018367chr1142336 1019 843 211 ------
NM_018368chr61256 ------
NM_018375chr1451369 756 743 641 80 11837 11191 11264
NM_018388chrX21274 70 11358 ----
NM_018394chr32199 99 1213 ----
NM_018400chr11134389 4261 3995 3832 3768 3683 3229 3142 3025 2997 2892 854 823 --14581 --
NM_018403chr373233 2635 2552 1572 1229 530 203 1915 ----
NM_018409chr442985 2926 2196 2181 12400 ----
NM_018412chr7150 ------
NM_018416chr1272515 2501 2031 2000 992 569 191 ------
NM_018419chr202321 37 ------
NM_018426chr62410 101 ------
NM_018429chr532354 1128 275 ------
NM_018433chr22218 48 ------
NM_018440chr8118456 8204 7916 7154 7109 5994 5535 1830 1168 657 398 --18325 --
NM_018448chr1211249 ------
NM_018452chr6_random31479 1382 1352 ------
NM_018462chr34615 313 92 81 ------
NM_018469chr172359 351 ------
NM_018471chr22393 160 ------
NM_018482chr821733 233 ------
NM_018489chr131799 534 218 12358 ----
NM_018509chr1771628 1517 1450 1226 692 387 141 --11319 --
NM_018534chr21544 --2165 81 --
NM_018553chr1751350 1282 1252 1166 367 ------
NM_018557chr221354 456 ------
NM_018566chr183786 3600 3279 1951 1252 994 252 150 34717 906 692 ----
NM_018571chr2----147 --
NM_018584chr12423 202 ------
NM_018639chr1241203 1019 1001 418 ------
NM_018640chr1222265 2234 ------
NM_018644chr117735 721 581 537 518 113 24 ------
NM_018649chr102222 157 ------
NM_018650chr132233 2035 578 ------
NM_018653chr173356 266 83 ------
NM_018660chr883010 2445 2352 2263 1080 869 782 395 1791 42846 2285 2267 531 --
NM_018667chr1682147 1746 961 934 787 717 600 329 ------
NM_018683chr2081633 1453 420 414 328 302 251 170 ------
NM_018684chrX61286 1105 1060 993 540 231 --1407 --
NM_018685chr711028 ------
NM_018710chr811002 ------
NM_018712chr112419 286 ------
NM_018713chr12976 188 ------
NM_018717chr442095 944 912 81 --1916 --
NM_018718chr761517 440 233 154 131 38 --11968 --
NM_018719chr721131 1121 --11125 11270
NM_018834chr51790 ------
NM_018841chr193985 3123 3085 3070 2455 1306 1042 676 30 11298 31259 980 23 161
NM_018890chr7--11515 11003 --
NM_018896chr172119 57 ------
NM_018898chr532375 263 81 ------
NM_018899chr532375 263 81 ------
NM_018900chr532375 263 81 ------
NM_018901chr532375 263 81 ------
NM_018902chr532375 263 81 ------
NM_018903chr532375 263 81 ------
NM_018904chr532375 263 81 ------
NM_018905chr532375 263 81 ------
NM_018906chr532375 263 81 ------
NM_018907chr532375 263 81 ------
NM_018908chr532375 263 81 ------
NM_018909chr532375 263 81 ------
NM_018910chr532375 263 81 ------
NM_018911chr532375 263 81 ------
NM_018912chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018913chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018914chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018915chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018916chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018917chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018918chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018919chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018920chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018921chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018922chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018923chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018924chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018925chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018926chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018927chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018928chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018929chr5121717 1681 1666 1394 1299 644 539 485 384 360 314 57 21771 1588 21685 1376 --
NM_018944chr213525 229 40 ------
NM_018945chr683488 3288 2663 1176 663 159 136 31 --13122 --
NM_018951chr72335 106 ------
NM_018953chr123603 149 75 ------
NM_018957chr221304 ------
NM_018963chr2121451 145 ------
NM_018970chr72639 44 --12093 --
NM_018976chr1232106 776 117 ------
NM_018977chrX2432 251 ------
NM_018991chr73636 583 165 ------
NM_018994chr11501 ------
NM_018999chr1094530 3547 3175 1296 879 771 699 340 242 --14742 --
NM_019001chr354317 3833 1719 1382 33 ------
NM_019004chr752168 2087 1674 690 472 ------
NM_019008chr2293802 3295 2965 2843 2665 1291 1186 387 185 --11295 13733
NM_019027chr442064 784 698 639 ------
NM_019035chr41788 ------
NM_019042chr721239 1128 ------
NM_019063chr242334 1753 1484 765 --12068 --
NM_019071chr71276 ------
NM_019072chr553565 3282 2677 215 85 11432 ----
NM_019080chr1321519 570 ------
NM_019087chr54644 282 257 112 ------
NM_019091chr2125 ------
NM_019096chr65981 761 418 403 311 ------
NM_019098chr82714 295 ------
NM_019102chr72457 113 ------
NM_019102chr72457 113 ------
NM_019106chr22153199 2990 2683 2498 2394 2247 2235 1267 1246 760 386 293 287 261 80 ------
NM_019107chr192394 31 ------
NM_019114chr962262 2227 1658 988 955 59 --2969 594 --
NM_019116chr16133622 3326 3159 3057 2547 2448 2303 1497 1366 1268 1059 936 563 --13336 --
NM_019117chrX32314 1396 824 --13183 --
NM_019555chr31347 ------
NM_019557chr14775 691 290 63 ------
NM_019592chr95819 328 148 123 72 ----181
NM_019593chr2093080 2865 2827 2329 2129 2090 1991 803 99 --12745 --
NM_019597chrX3718 170 147 ------
NM_019606chr71163 --1362 --
NM_019610chr122119 589 ------
NM_019845chr21312 ------
NM_019849chr191191 ------
NM_019854chr123712 302 189 ------
NM_019884chr191495 ------
NM_019885chr272956 2489 2347 1041 821 420 409 ------
NM_019891chr111064 11005 ----
NM_019895chr33964 804 733 ------
NM_019903chr102565 297 ------
NM_020039chr12111840 1710 1684 1520 1493 1281 1270 707 263 120 74 ------
NM_020062chr202877 37 ------
NM_020116chr431705 1393 1193 ------
NM_020122chr295490 5151 5113 5063 4971 4508 4385 1586 1411 --15525 13911
NM_020123chr102456 300 ------
NM_020130chr831244 259 109 --11192 --
NM_020132chr21105159 4881 4773 4762 1906 1264 1080 752 383 314 1564 11704 --
NM_020134chr241165 427 310 205 --1937 --
NM_020137chrX127 ------
NM_020139chr441959 433 188 88 ------
NM_020141chr162360 2252 1699 333 294 232 12412 ----
NM_020142chr123504 168 66 ------
NM_020144chr721627 125 ------
NM_020148chr1841100 518 343 78 1306 ----
NM_020150chr1062161 1858 680 170 63 36 ------
NM_020151chr261488 1292 1152 1133 326 312 11422 ----
NM_020166chr3139 ------
NM_020177chr542376 2166 528 385 ------
NM_020178chr173843 93 86 ------
NM_020180chr1831342 1185 972 ------
NM_020182chr20113437 3003 2781 2758 2357 2295 1425 1406 1236 1007 664 ------
NM_020184chr262030 1981 1950 1542 540 463 ------
NM_020188chr161271 ------
NM_020204chr13644 189 37 ------
NM_020205chr163483 3426 2318 732 648 212 ------
NM_020211chr1531017 499 342 ------
NM_020228chr112927 186 ------
NM_020229chr111355 --1157 --
NM_020239chr182242 2171 1712 1533 1432 781 450 374 ----189
NM_020245chr6125061 4821 4343 1397 1390 1380 1232 1091 1083 747 385 54 ------
NM_020309chr195829 428 404 270 89 ------
NM_020310chr1772498 2476 2414 2184 431 411 334 ------
NM_020336chr20103767 3554 3194 2931 2830 2700 2686 2589 1015 623 ------
NM_020337chr482851 2454 2263 970 935 671 375 173 13060 ----
NM_020341chr20----1771 --
NM_020342chr232631 1692 63 ------
NM_020348chr1082243 2188 1768 1697 1013 392 327 131 --12397 --
NM_020354chr104272 170 153 59 ------
NM_020360chr173514 90 72 ------
NM_020374chr1231566 818 235 ------
NM_020379chr11146 ------
NM_020382chr1241398 1259 608 354 1558 ----
NM_020384chrX61698 1684 1670 1651 479 228 ----11525
NM_020390chr334608 4261 901 ------
NM_020416chr452507 912 879 601 422 ----1932
NM_020429chr732931 196 135 ------
NM_020432chr711733 ------
NM_020440chr163141 2514 1090 992 630 191 ------
NM_020441chr11131 ----1215
NM_020443chr1266976 6614 6361 6300 5647 5639 5518 5464 5341 5328 5144 4262 4229 2772 2704 2406 2042 1979 1480 1257 918 485 433 243 78 63 ------
NM_020445chr74785 239 220 203 ------
NM_020449chrX1116 ------
NM_020452chr151695 1504 770 349 98 ----1479
NM_020456chr1331949 1633 890 ------
NM_020457chr164425 234 162 75 ------
NM_020463chr21262 --1340 --
NM_020465chr1641706 1373 189 52 ------
NM_020474chr183684 150 104 ------
NM_020475chr872128 1664 1596 859 769 547 74 ------
NM_020476chr872128 1664 1596 859 769 547 74 ------
NM_020477chr872128 1664 1596 859 769 547 74 ------
NM_020478chr872191 1727 1659 922 832 610 137 ------
NM_020480chr872128 1664 1596 859 769 547 74 ------
NM_020526chr141652 1271 238 112 ------
NM_020530chr224926 826 394 167 ------
NM_020630chr102720 31 ------
NM_020631chr121076 523 --1507 11357
NM_020638chr1281641 1316 442 322 307 201 126 53 1569 ----
NM_020640chr32774 327 ------
NM_020644chr111938 ------
NM_020647chr811888 ------
NM_020651chr231561 1249 1239 ------
NM_020665chrX122 ------
NM_020672chr14462 434 395 70 ------
NM_020679chr172429 22 ------
NM_020689chr2081748 1165 549 524 340 217 169 32 --1185 --
NM_020693chr112374 190 ------
NM_020695chr193747 596 63 ------
NM_020699chr1145013 4964 4908 4499 4126 4035 3771 3392 3372 1889 1537 1125 231 51 132 ----
NM_020703chr11106 ------
NM_020708chr208944 894 785 398 385 358 230 203 1658 3750 589 480 --
NM_020713chr2093085 2420 2377 2106 818 639 344 258 114 ------
NM_020714chr1994443 4342 3743 3307 2963 2941 1804 1625 1254 --11466 --
NM_020717chrX114567 4147 3765 1731 1621 1601 1565 1544 1277 673 244 11632 14570 --
NM_020718chr1686638 6223 5165 4900 4879 2440 1504 947 ----12613
NM_020728chr743146 819 197 27 ------
NM_020732chr641285 1276 449 115 ------
NM_020742chrX52648 1800 1674 810 447 ------
NM_020750chr641284 296 46 25 ------
NM_020752chr1062930 2539 2509 2120 2083 1977 ------
NM_020755chr61106 ------
NM_020764chr1661279 1068 1034 1027 1012 897 ------
NM_020766chrX34237 1457 1066 --24184 3751 --
NM_020768chr542340 917 850 363 ----12797
NM_020769chrX2932 168 ------
NM_020772chr1798201 7454 6723 5395 5336 2857 2575 959 490 22661 2056 ----
NM_020774chr18105882 4593 4321 2294 1889 1558 1452 1296 1286 999 ------
NM_020775chr12170 29 ------
NM_020776chr18112999 2867 2477 1903 955 937 727 646 324 96 40 ------
NM_020778chr15134727 4412 1792 1783 1694 1542 853 842 640 607 506 469 203 1562 13043 1282
NM_020783chr181233 ------
NM_020791chr1741136 1104 554 81 ------
NM_020792chr382132 2008 1954 1908 740 576 402 92 11945 1744 --
NM_020794chr121049 281 ------
NM_020795chr17121944 1809 1743 1337 1317 811 431 421 251 186 142 24 --11357 --
NM_020796chr562000 769 742 654 223 138 12477 ----
NM_020801chr542633 2573 584 51 ------
NM_020802chr1142713 2661 1049 330 ------
NM_020805chr1831501 268 222 ------
NM_020806chr141563 1852 ----
NM_020807chr1671508 1468 1379 1310 709 336 78 ------
NM_020810chr1463374 3099 2745 737 713 355 ------
NM_020820chr2041142 430 146 79 --11580 --
NM_020826chr1183585 2392 2322 2254 1003 880 76 59 1667 ----
NM_020830chr233316 620 342 ------
NM_020839chr331542 298 43 ------
NM_020841chr1211118 11258 ----
NM_020843chr151108 ------
NM_020845chr1292286 2062 2007 1878 1715 832 791 734 172 --1972 --
NM_020850chr1693113 2934 2792 2450 2047 1185 889 828 116 ------
NM_020853chr12102621 2522 2471 2366 1040 963 937 908 527 100 --22478 2330 --
NM_020854chr18290 59 ------
NM_020856chr1931553 1401 476 ------
NM_020858chr1522134 758 1903 ----
NM_020859chr473828 3433 3260 2583 1397 1042 360 ------
NM_020861chr63366 116 108 ------
NM_020866chr132840 96 ------
NM_020870chr422196 480 11441 ----
NM_020871chrX12037 ------
NM_020872chr31618 ------
NM_020896chr1121026 1014 ------
NM_020897chr151288 1192 1023 989 922 ------
NM_020899chr1772033 1699 1691 618 585 264 217 ------
NM_020918chr1043091 2922 144 49 ------
NM_020921chr1453406 3017 2715 2609 604 ------
NM_020922chrX41786 1162 402 79 ------
NM_020925chr12972 360 ------
NM_020927chr1692272 1895 1659 1552 953 710 582 395 68 ------
NM_020935chr264584 4361 3712 3471 553 67 1483 --13225
NM_020940chr1012488 11903 --1955
NM_020946chr951707 1433 506 393 140 --2424 252 --
NM_020948chr173435 3363 3032 2722 2712 329 251 193 ----
NM_020952chr91566 181 ----
NM_020959chr19121 ------
NM_020962chr15122439 1728 1719 1641 927 832 759 740 712 643 635 527 ------
NM_020964chr1894155 3895 3871 3094 2922 1558 1345 1181 434 ----13264
NM_020967chr2031249 145 48 1957 ----
NM_020971chr194678 671 604 150 ------
NM_020975chr1041374 1307 1264 254 21832 1817 ----
NM_020977chr441510 1500 503 127 11358 ----
NM_020983chr1232246 1870 930 ----11686
NM_020988chr1621318 1101 ------
NM_020993chr12132635 2018 1903 1815 916 891 821 589 538 319 222 163 85 --1739 12383
NM_021003chr141297 ------
NM_021032chr321965 1588 ------
NM_021033chr1332912 358 213 1626 1984 --
NM_021038chr323403 119 ------
NM_021069chr421628 450 ------
NM_021072chr522060 1816 ------
NM_021079chr172484 425 12500 22246 907 --
NM_021083chrX73595 2899 1431 1366 947 812 130 --23666 117 13212
NM_021090chr22104217 3238 1494 1243 1073 915 748 656 436 206 ------
NM_021097chr253044 2940 2057 1039 846 ------
NM_021104chr121281 ------
NM_021116chr7188860 8765 8518 7628 7448 7306 7286 6903 6634 6001 5843 3236 2375 2339 2071 1595 1452 1442 38656 2565 985 ----
NM_021120chrX63141 3096 2200 66 59 52 ------
NM_021133chr181399 1233 1123 1103 1081 609 498 52 ------
NM_021135chr693197 2694 2552 988 848 617 568 180 42 --22082 572 --
NM_021136chr143306 159 62 --1292 --
NM_021137chr1721976 558 --11996 1626
NM_021140chrX21008 363 ------
NM_021143chr191496 ------
NM_021144chr91434 ------
NM_021145chr73369 162 61 1765 ----
NM_021155chr19183009 2513 2447 2401 2378 2318 2253 2234 2104 1975 1921 1167 1052 946 251 179 93 37 12848 ----
NM_021156chr201107 ------
NM_021159chr441433 1325 1232 565 ------
NM_021160chr61186 ------
NM_021165chr14839 707 642 626 --1607 --
NM_021174chr81663 ------
NM_021183chrX22262 492 1338 ----
NM_021188chr141133 ------
NM_021189chr141036 977 949 235 --1833 --
NM_021191chr1232542 2082 171 11991 ----
NM_021192chr25388 289 103 84 48 --1392 --
NM_021198chr261464 1273 495 420 224 53 --11074 --
NM_021202chr2053073 1991 1943 267 57 --167 --
NM_021205chr162793 2458 2442 1133 995 76 --1901 --
NM_021215chr2072307 2193 746 557 387 292 149 --12197 --
NM_021224chr91358 ------
NM_021229chr124984 506 433 151 --1988 --
NM_021239chr1421221 193 ------
NM_021240chr91470 ------
NM_021245chr101174 ------
NM_021249chr1421363 130 11639 ----
NM_021253chr651381 1345 201 83 58 ------
NM_021255chr1423927 3662 12991 ----
NM_021259chr164832 743 135 39 --1180 --
NM_021260chr14101348 1120 1087 487 480 442 395 357 112 79 ------
NM_021267chr1941316 311 100 67 ------
NM_021569chr94917 889 760 21 --1923 --
NM_021614chr51224 ------
NM_021625chr12126 ------
NM_021627chr31950 ------
NM_021629chr355057 3891 3573 3501 1829 ------
NM_021638chr495044 4113 3999 3550 3193 1795 1044 862 805 23987 3368 21513 899 --
NM_021643chr231909 1298 1184 ------
NM_021647chr494032 3985 3848 3427 1759 1503 1379 1373 433 --151 --
NM_021648chr682723 2300 1100 982 336 187 99 48 12196 11790 --
NM_021649chr571834 1738 1587 1199 697 410 281 11489 ----
NM_021705chr651510 568 392 353 69 11136 ----
NM_021723chr7195 ------
NM_021724chr173199 66 59 ------
NM_021729chr112309 275 ------
NM_021808chr122264 193 --1485 --
NM_021809chr2052178 2056 274 184 117 ------
NM_021813chr6125637 5406 5376 4111 3800 1705 1546 1538 1084 822 561 160 ----1167
NM_021814chr611319 ------
NM_021905chr642066 1435 646 474 --21979 1558 --
NM_021907chr21100 ------
NM_021908chr76668 256 223 212 113 40 --1302 1831
NM_021911chr595078 3810 2104 2080 1848 1771 362 193 38 ------
NM_021912chr1553842 3396 2721 2649 559 13108 ----
NM_021913chr1941724 1663 1642 160 ------
NM_021914chr1422001 876 ------
NM_021935chr32423 109 ------
NM_021940chr661453 1391 1281 639 283 47 11533 ----
NM_021943chr631895 1624 439 ------
NM_021946chrX61378 1062 1047 548 33 21 --31084 313 61 --
NM_021949chrX82918 2478 2354 1025 576 496 252 240 ------
NM_021950chr1172216 2110 2048 1964 1938 284 145 ------
NM_021954chr1353171 3104 2981 2863 2487 ------
NM_021956chr61233 ------
NM_021959chr67702 638 216 198 88 78 65 ------
NM_021960chr142613 1780 487 310 ------
NM_021961chr11136992 6467 6373 6301 6106 6045 5670 5364 2770 2612 1961 1587 277 --25371 2490 16629
NM_021964chr346623 4250 4057 705 ------
NM_021965chr941194 1136 1098 188 ------
NM_021966chr142113 29 1861 ----
NM_021970chr41622 ------
NM_021973chr4----1110 --
NM_021976chr661043 1030 908 806 332 26 --1215 --
NM_021977chr652859 2500 1543 758 614 13293 22479 52 --
NM_021980chr102541 53 ------
NM_021984chrX41299 522 243 198 ------
NM_021987chrX41299 522 243 198 ------
NM_021988chr2041139 999 577 379 ------
NM_021990chrX41299 522 243 198 ------
NM_021991chr174687 595 528 26 ------
NM_022036chr173356 266 83 ------
NM_022048chr15266364 6345 6123 6002 5964 5040 4951 4777 4197 4133 4060 2351 2249 1783 1731 1689 1585 1572 1441 1008 526 491 328 271 233 89 ----16406
NM_022049chr14668 494 67 50 11874 ----
NM_022060chr1481379 1295 877 864 422 374 341 85 --1262 --
NM_022062chr1161927 1886 1557 1445 1327 470 ------
NM_022066chr174745 304 123 82 ------
NM_022067chr146933 870 662 607 70 37 ------
NM_022068chr182657 113 ------
NM_022075chr15973 688 674 657 236 --1135 --
NM_022095chr20182 ------
NM_022107chr62402 28 ------
NM_022114chr1134153 3876 3868 3845 3729 3229 3153 1896 1866 1460 1199 979 106 --23131 3081 --
NM_022117chrX3452 423 64 ------
NM_022123chr141112 ------
NM_022130chr53305 184 27 ------
NM_022138chr62937 281 ------
NM_022140chr521973 1547 ------
NM_022143chr711101 ------
NM_022144chrX1132 ------
NM_022166chr16185113 5070 5058 5045 4926 4738 4729 4253 2160 1768 1439 1270 812 718 594 493 270 239 26084 898 45526 2411 1318 700 --
NM_022169chr11101453 1189 1081 985 521 317 296 242 130 118 ------
NM_022170chr751498 1477 428 298 113 --1271 --
NM_022307chr72633 455 --1645 --
NM_022337chr114657 540 471 177 ------
NM_022369chr153409 82 65 ------
NM_022373chr73920 814 134 ------
NM_022442chr2041139 999 577 379 ------
NM_022458chr762722 2444 2106 918 421 104 12098 ----
NM_022459chr1366317 4166 2474 612 529 86 ------
NM_022462chr19173673 3396 3074 3007 2953 2700 2579 1480 1399 1382 871 850 718 529 239 114 28 --12865 --
NM_022463chr1751477 495 153 60 45 ------
NM_022465chr12212944 2893 2821 2714 2499 2170 2071 1950 1876 1224 1042 988 979 621 540 527 403 340 228 157 144 --1850 21955 782
NM_022473chr1564071 3972 1677 951 233 77 ------
NM_022477chr202666 637 ------
NM_022484chr731249 978 918 ------
NM_022491chr12103512 3037 2996 1384 1314 793 537 520 316 73 ------
NM_022494chr102355 110 ------
NM_022497chr362499 1413 853 843 474 377 ------
NM_022552chr22988 261 --11219 --
NM_022566chr151395 ------
NM_022572chr2101634 1572 1515 1374 1181 684 523 348 295 75 ------
NM_022574chr742185 1840 1830 1368 ------
NM_022644chr172186 109 ------
NM_022648chr2104557 4350 3863 3697 3393 3347 2864 1738 823 661 --21829 348 --
NM_022650chr5174 ------
NM_022652chr121773 --121 --
NM_022716chr132942 452 195 11243 ----
NM_022719chr2293878 3743 3475 3292 2380 2362 1478 653 483 --23747 83 --
NM_022726chr631120 1083 334 --11198 --
NM_022728chr71581 ------
NM_022733chr131088 989 33 ------
NM_022735chr131714 706 200 1158 ----
NM_022737chr1961289 1264 916 899 839 145 165 ----
NM_022745chr132834 2055 67 ----12935
NM_022750chr71497 ------
NM_022751chr181101 ------
NM_022753chr162764 2283 1980 880 768 604 11864 1895 --
NM_022754chr521858 572 ------
NM_022755chr962643 2326 2062 1010 890 871 ------
NM_022756chr1152 11369 ----
NM_022758chr6103098 2856 2588 2368 2275 2178 1059 1025 615 75 --12388 --
NM_022763chr322962 2718 ------
NM_022771chr121216 ------
NM_022776chr3139 ------
NM_022778chr141421 1115 523 319 ----1942
NM_022780chr22553 341 ------
NM_022781chr972667 2304 1260 1125 794 739 38 ------
NM_022821chr13392 342 177 ------
NM_022822chr113574 227 140 --2791 566 --
NM_022831chr111571 --1196 --
NM_022836chr151603 1399 451 444 172 ------
NM_022840chr1841466 1099 1060 42 ------
NM_022841chr1532307 993 962 1440 ----
NM_022845chr1621895 295 --11837 --
NM_022893chr212110 ------
NM_022894chr241322 533 347 208 ------
NM_022898chr1493857 3618 3541 3526 3168 2968 1445 1050 834 13256 34432 3861 3003 --
NM_022910chr1641706 1373 189 52 ------
NM_022912chr262939 2285 978 837 105 43 ------
NM_022918chr1131427 646 197 ------
NM_022970chr1031095 1034 309 1994 ----
NM_022977chrX1469 ----12284
NM_023000chr1441432 1103 234 156 ------
NM_023001chr1441432 1103 234 156 ------
NM_023008chr192668 34 ------
NM_023009chr16708 275 190 146 125 53 ------
NM_023015chr14320 194 145 46 1711 ----
NM_023019chr22229 110 ------
NM_023033chr123491 469 456 --1477 --
NM_023037chr131993 1938 177 --
NM_023068chr2051037 312 267 260 247 ----1317
NM_023071chr123159 151 27 1198 ----
NM_023074chr1941222 885 858 244 1901 ----
NM_023076chr162233 52 ------
NM_023079chr1761633 1590 1162 671 500 323 11643 21742 187 --
NM_023105chr852411 2358 2267 1960 184 ------
NM_023106chr852411 2358 2267 1960 184 ------
NM_023110chr852411 2358 2267 1960 184 ------
NM_023111chr852411 2358 2267 1960 184 ------
NM_023112chr1452663 1988 1066 933 72 ------
NM_023923chr143180 1136 626 51 12893 13737 23233 2577
NM_023929chr842119 673 660 567 1590 ----
NM_023932chr6239 31 ------
NM_024003chrX2712 587 ------
NM_024007chr552818 2711 2061 863 786 --12516 --
NM_024015chr1731077 804 404 --1327 --
NM_024016chr175784 594 584 218 210 --1339 --
NM_024017chr1791506 1468 1448 1211 353 185 157 122 36 ----11232
NM_024019chr45419 336 146 89 70 ------
NM_024038chr194269 255 227 219 ------
NM_024040chr101112 ------
NM_024043chr1641383 1282 1197 188 ------
NM_024045chr101201 ------
NM_024046chr371235 1198 872 323 279 235 67 --1866 --
NM_024050chr191436 1167 143 --
NM_024052chr1782647 2445 2343 1955 1058 314 209 200 ------
NM_024061chr73395 221 69 1493 ----
NM_024076chr1952347 2181 1934 479 201 --1265 --
NM_024082chrX1475 --1107 --
NM_024094chr81123 ------
NM_024095chr1221310 1055 --166 --
NM_024107chr175537 330 162 123 39 ------
NM_024117chr941084 910 335 92 11074 ----
NM_024122chrX1236 ------
NM_024294chr6103098 2856 2588 2368 2275 2178 1059 1025 615 75 --12388 --
NM_024295chr861871 1837 1526 264 44 27 ------
NM_024315chr7134 ------
NM_024328chr144679 177 138 104 1156 ----
NM_024345chr9115000 4244 2062 1849 1532 1226 1216 1061 304 222 30 --14284 26064 3832
NM_024408chr183472 3049 2738 2688 1498 576 437 270 1900 1444 --
NM_024411chr2061535 1390 1115 1091 323 147 ------
NM_024416chr931496 1113 502 ------
NM_024423chr1824155 1453 ------
NM_024424chr11179 --1784 --
NM_024425chr11179 --1784 --
NM_024426chr11179 --1784 --
NM_024430chr1841796 1292 1223 371 ------
NM_024494chr1280 64 ------
NM_024496chr14241 22 ------
NM_024511chr453033 1189 815 741 291 ------
NM_024512chr321137 1066 1760 ----
NM_024524chr342218 2044 359 144 ------
NM_024539chrX2801 218 ------
NM_024540chr1122 ------
NM_024546chr13174 ------
NM_024551chr1242451 1716 1014 361 --12004 --
NM_024551chr1242451 1716 1014 361 --12004 --
NM_024563chr531873 1354 678 ------
NM_024567chr82656 63 ------
NM_024574chr41364 ------
NM_024586chr12488 253 ------
NM_024594chr541637 1627 1270 246 ------
NM_024602chr13871 695 688 ------
NM_024607chr893979 3145 3065 3033 2866 1261 665 331 140 --13247 11326
NM_024612chr171263 --11053 --
NM_024613chr84623 190 181 172 ------
NM_024615chr5140 ------
NM_024616chr351447 1441 1036 546 138 ------
NM_024624chr21118 ------
NM_024626chr131560 1136 588 ------
NM_024631chr113101 44 38 ------
NM_024641chr642640 2103 813 550 ------
NM_024645chr821553 349 ------
NM_024646chr143222 887 437 206 ------
NM_024657chrX2172 23 ------
NM_024665chr353894 3844 3660 3366 3228 14270 --11064
NM_024676chr15339 327 215 188 56 --1321 --
NM_024686chr1155 ------
NM_024698chr1121006 240 ------
NM_024701chr1051596 283 149 115 76 ------
NM_024704chr203407 267 101 --142 --
NM_024713chr1521469 1092 ------
NM_024721chr831700 744 88 1578 ----
NM_024726chr22535 330 ------
NM_024738chr1251817 1532 1350 678 196 1500 21665 143 --
NM_024744chr262354 825 599 448 311 191 ------
NM_024749chr121439 43 ----12157
NM_024757chr941037 397 333 323 ------
NM_024761chr9134432 4268 4026 4013 3992 3872 2124 1290 1084 792 785 408 42 ------
NM_024769chr112946 56 --159 --
NM_024770chr276632 4860 4798 2391 561 397 139 1259 25688 5660 --
NM_024779chr1271279 1099 1058 219 193 123 91 ------
NM_024785chr251336 617 558 502 315 --11163 --
NM_024811chr114675 520 104 52 ------
NM_024828chr911375 ------
NM_024830chr551962 1532 718 336 89 --11982 --
NM_024835chr17158 ------
NM_024850chr52345 86 ------
NM_024857chr17--196 ----
NM_024875chr1071714 1625 545 284 270 155 60 21543 304 ----
NM_024887chr141439 690 521 86 ------
NM_024889chr10171245 1209 1194 1172 1158 1143 1128 727 712 698 683 668 654 627 613 598 96 ------
NM_024909chr6121580 1568 1532 1411 1404 1390 1134 623 490 444 430 306 ------
NM_024920chr41158 --11190 --
NM_024939chr1631409 1033 39 ------
NM_024944chr2131299 1252 1205 ------
NM_024946chr1681589 1482 1393 630 237 188 94 29 1521 ----
NM_024947chr3149639 9137 8966 8687 7910 6738 6291 3260 2840 2326 2088 1141 631 362 ------
NM_024949chr484894 4790 4318 4298 4125 3852 1467 373 ------
NM_024953chr121106 1417 ----
NM_024954chr101680 ------
NM_024971chr91566 181 ----
NM_024989chr2107295 7280 6861 6533 6179 3119 1551 1535 1397 696 26868 1420 ----
NM_024991chr1032652 1100 786 ------
NM_025027chr191108 ------
NM_025054chr823546 1192 11064 ----
NM_025080chr1151065 984 967 780 55 1695 ----
NM_025083chr1561913 1826 1819 1488 623 442 ------
NM_025130chr102138 52 ------
NM_025133chr22998 855 ------
NM_025134chr1611929 ----1374
NM_025140chr125557 452 146 135 126 ------
NM_025146chr33581 534 67 --1110 --
NM_025151chr842155 1953 775 539 ------
NM_025160chr142838 793 758 343 ----14121
NM_025164chr1181712 1567 1522 1483 1459 1399 492 129 ------
NM_025179chr1184722 4418 4384 4207 3692 3549 3009 1986 1873 1815 1757 1443 1434 1417 1320 561 479 145 1569 ----
NM_025182chr93831 746 413 --1763 --
NM_025191chr121067 848 ------
NM_025194chr1941162 1110 807 800 ------
NM_025195chr861238 1203 646 605 468 140 ------
NM_025227chr205309 268 231 212 200 ------
NM_025235chr1021583 75 ------
NM_025248chr1793266 3186 2071 606 586 319 313 144 65 2458 269 ----
NM_025251chr86962 850 471 431 412 394 --1322 --
NM_025256chr62104 56 ------
NM_025261chr6_qbl_hap22142 27 ------
NM_030576chr1742139 910 173 159 ----11671
NM_030594chr153855 403 275 ------
NM_030621chr1441349 1107 409 236 ------
NM_030625chr102942 721 12094 ----
NM_030627chr583213 3169 1277 886 197 80 71 49 ------
NM_030629chr1621437 1268 --1762 --
NM_030634chr172244 1819 940 601 577 334 183 1494 ----
NM_030637chr142682 227 ------
NM_030647chr7115522 5076 4968 4700 4255 3859 1638 1376 1020 846 753 26319 4459 ----
NM_030648chr4105199 4930 4803 4796 4268 3571 1103 917 737 139 ----1922
NM_030660chr1411368 ------
NM_030661chr761623 1395 1293 283 240 122 ----1251
NM_030664chr103958 873 147 ------
NM_030665chr171979 1129 ----
NM_030670chr1221902 1769 ------
NM_030671chr1221902 1769 ------
NM_030674chr1285282 4641 4292 3612 2136 1590 1292 872 --14034 --
NM_030751chr1031867 1851 62 ------
NM_030751chr1031867 1851 62 ------
NM_030761chr142564 1858 953 808 ------
NM_030762chr121561 ------
NM_030763chrX1839 ------
NM_030766chr1221019 994 --1312 --
NM_030774chr1131263 1067 23 ----11466
NM_030786chr121399 84 ------
NM_030797chr21222 ------
NM_030799chr522168 283 ------
NM_030802chr172651 198 ------
NM_030806chr1208569 8546 8080 8071 7182 3495 3455 3270 2063 1643 1459 1248 841 783 776 724 480 430 380 257 ------
NM_030808chr1741043 779 205 36 --1208 --
NM_030816chr152733 2282 831 784 667 ------
NM_030820chr621003 178 ------
NM_030881chr2272268 2231 2083 1674 637 545 75 --179 --
NM_030884chr392066 1829 1606 1578 1514 538 341 214 79 ----12244
NM_030885chr361438 509 499 492 188 145 ------
NM_030912chr108817 591 315 307 299 106 93 37 ------
NM_030913chr12217 69 1184 ----
NM_030914chr92920 781 --1320 --
NM_030918chr1165383 5076 4972 4275 4101 4086 3982 3447 3435 1807 1692 1402 865 557 161 132 --24796 1126 --
NM_030920chr132072 2060 1403 ------
NM_030923chr21222 ------
NM_030927chr1031612 1453 1140 ------
NM_030934chr121826 530 --11286 --
NM_030935chr73338 155 67 ------
NM_030937chr11946 ------
NM_030939chr621140 1069 ------
NM_030958chr81199 ------
NM_030962chr1131183 1059 374 179 ----
NM_030964chr5113481 3263 2545 1503 1155 693 635 500 390 356 49 ------
NM_030981chr116897 808 351 302 138 39 ------
NM_031157chr121479 ------
NM_031216chr1831676 1509 74 ------
NM_031231chr202518 100 ------
NM_031232chr202518 100 ------
NM_031262chr9174 ------
NM_031263chr91131 ------
NM_031268chr16105380 3622 2118 2103 1943 1865 1414 1261 1156 462 ------
NM_031272chr17269 62 ------
NM_031282chr12123 78 ------
NM_031283chr26680 670 648 603 336 297 --1339 --
NM_031309chr881874 1754 1558 873 745 339 104 63 ------
NM_031314chr1431292 630 128 11385 ----
NM_031371chr121629 189 ------
NM_031371chr121629 189 ------
NM_031407chrX4511 207 199 168 ------
NM_031411chr532375 263 81 ------
NM_031412chr124828 768 375 189 --1996 --
NM_031417chr1971953 1750 870 778 597 302 200 ------
NM_031424chr206482 472 407 382 370 222 --1556 --
NM_031426chr9122596 2362 2284 2208 2195 2103 1909 928 557 461 223 213 ------
NM_031433chr116580 493 466 183 110 26 ------