TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1538
miRNA Sequence: CGGCCCGGGCUGCUGCUGUUCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51103 ------
NM_000020chr1222419 167 --1350 --
NM_000037chr822151 142 --11956 --
NM_000044chrX1158 ------
NM_000068chr195589 560 550 478 325 --3583 422 206 --
NM_000076chr11----169 --
NM_000088chr1711249 ------
NM_000110chr11785 ------
NM_000112chr544281 3404 1860 602 ----13992
NM_000210chr21573 ------
NM_000232chr4--21282 1091 ----
NM_000238chr7----2279 56 --
NM_000240chrX--188 ----
NM_000248chr342617 2591 1940 862 ------
NM_000264chr9------11013
NM_000266chrX1313 ------
NM_000296chr164735 313 290 25 ------
NM_000319chr12296 79 ------
NM_000326chr151359 --143 --
NM_000330chrX2646 51 ------
NM_000332chr632514 1748 473 --14543 --
NM_000333chr32352 119 --1143 --
NM_000335chr341952 1599 1555 120 ------
NM_000430chr1733419 1119 235 --12978 --
NM_000434chr6160 ------
NM_000445chr84912 798 407 221 --2352 284 --
NM_000449chr11193 ----1497
NM_000450chr1184 ------
NM_000462chr15------11723
NM_000476chr931373 556 426 ------
NM_000495chrX1416 ------
NM_000503chr811492 ------
NM_000555chrX32832 2280 530 ----1184
NM_000598chr721531 1248 ------
NM_000599chr233545 2860 623 --23818 2889 --
NM_000665chr72198 74 ------
NM_000675chr222701 263 ------
NM_000678chr205564 249 148 65 34 ------
NM_000679chr5196 --1197 --
NM_000681chr1021116 93 1251 ----
NM_000719chr1236558 532 22 1598 22096 271 --
NM_000720chr3----1456 --
NM_000722chr71115 ------
NM_000723chr171396 ----11118
NM_000725chr122291 194 --1855 --
NM_000801chr20------1685
NM_000827chr5139 --12463 --
NM_000831chr185982 5956 5920 4251 957 503 90 39 21523 125 15903 16078
NM_000832chr94736 633 565 220 --1115 --
NM_000841chr63291 180 171 163 ----
NM_000844chr31188 ------
NM_000875chr1565190 4926 1551 1528 900 237 ------
NM_000891chr1723545 1063 ------
NM_000899chr1211129 ------
NM_000918chr172738 21 --1619 --
NM_000935chr3--1131 ----
NM_000945chr21504 ------
NM_000964chr1741246 1148 210 109 --1178 --
NM_001001323chr1222600 636 ------
NM_001001433chr2052751 2702 2214 2087 46 1648 12615 12896
NM_001001481chr81157 ------
NM_001001521chr21250 ------
NM_001001522chr112282 151 1305 ----
NM_001001549chr722237 288 1845 ----
NM_001001550chr722237 288 1845 ----
NM_001001555chr722237 288 1845 ----
NM_001001557chr81644 143 ----
NM_001001560chr221625 --1212 --
NM_001001661chr71102 ------
NM_001001664chr2--21319 820 ----
NM_001001890chr2154160 3067 63 54 35 --3105 98 26 --
NM_001002032chr171591 189 ----
NM_001002860chr1451796 1090 915 830 609 ------
NM_001003676chr113777 353 46 1950 ----
NM_001003694chr3----1503 --
NM_001003800chr923735 2848 --11407 --
NM_001004065chr921006 342 23073 2811 ----
NM_001004127chr131906 ------
NM_001004317chr621558 733 ------
NM_001005271chr171116 2794 107 ----
NM_001005273chr171116 2794 107 ----
NM_001005375chrY--11439 ----
NM_001005408chr173396 43 35 ------
NM_001005417chr12188 105 1279 ----
NM_001005463chr10----11884 --
NM_001005505chr331213 650 254 ------
NM_001005920chr16----1944 1408
NM_001006115chr331017 586 375 --22362 968 12257
NM_001006605chr1--1849 ----
NM_001006605chr1--1849 ----
NM_001006610chr16--1415 ----
NM_001007075chr421105 110 ------
NM_001007098chr1----1351 --
NM_001007156chr15----2754 50 --
NM_001007257chr12216 208 ------
NM_001007271chr10------1294
NM_001007279chr223586 156 92 --197 --
NM_001007471chr91233 ----1160
NM_001007794chr1--1221 ----
NM_001008220chr533208 2475 410 --2752 733 --
NM_001008222chrX1242 ------
NM_001008407chr731714 589 494 ------
NM_001008541chr1022139 1608 ----146
NM_001008541chr1022139 1608 ----146
NM_001008701chr19102929 2567 2543 1899 1102 835 566 370 134 54 1104 11014 11005
NM_001008777chr171236 ------
NM_001009813chr191325 ------
NM_001009899chr335901 4522 1420 1777 ----
NM_001009944chr164735 313 290 25 ------
NM_001009993chr223200 2997 13516 14063 14171
NM_001009996chr31127 ------
NM_001010846chr114075 --126 --
NM_001010861chr1----12678 --
NM_001010867chr1106447 5962 5377 5230 4761 4621 2576 1044 437 248 26373 1133 2341 266 16135
NM_001010911chr103867 838 196 ------
NM_001010926chr1----199 --
NM_001011645chrX1158 ------
NM_001011658chrX1674 ------
NM_001011708chr222405 2279 ------
NM_001012267chr921654 613 ------
NM_001012300chr12297 25 1121 ----
NM_001012329chr121759 827 --2721 65 --
NM_001012415chr92572 112 ------
NM_001012426chr621343 1294 --1821 22702 132
NM_001012427chr621343 1294 --1821 22702 132
NM_001012614chr4134 --2149 118 --
NM_001012977chrX--11082 ----
NM_001013398chr721531 1248 ------
NM_001013415chr411041 ------
NM_001013438chr31720 ------
NM_001013439chr31566 ------
NM_001013661chr11345 --121 --
NM_001013693chr182469 2397 2388 1968 1139 1060 424 385 --41875 1183 832 311 --
NM_001013693chr182469 2397 2388 1968 1139 1060 424 385 --41875 1183 832 311 --
NM_001014794chr111176 ------
NM_001014795chr111176 ------
NM_001014797chr1012668 25222 1672 17528 --
NM_001015045chr4------1697
NM_001015053chr1741150 1105 1053 25 ----1287
NM_001017368chr17156 ----11908
NM_001017392chr1911352 11094 ----
NM_001017395chr31404 ------
NM_001017406chr12159 25 ------
NM_001017523chr12------1108
NM_001017928chr3193 ------
NM_001017995chr53618 578 170 --1181 --
NM_001018004chr151208 ------
NM_001018006chr151208 ------
NM_001018007chr151208 ------
NM_001018020chr151208 ------
NM_001018072chr12------1108
NM_001018108chr152817 139 ----1186
NM_001023567chr1522433 758 ------
NM_001024660chr321335 325 ------
NM_001024809chr1741246 1148 210 109 --1178 --
NM_001024858chr1462535 1082 975 633 116 49 1437 3174 129 121 22065 560
NM_001024937chr172268 91 --168 --
NM_001024947chr51397 133 ----
NM_001024948chr112419 ------
NM_001024959chr32643 156 --2772 233 --
NM_001024960chr32643 156 --2772 233 --
NM_001025077chr1014878 ------
NM_001025079chr313247 ------
NM_001025109chr1126 ------
NM_001025205chr31183 ----1144
NM_001025242chrX31304 952 477 1879 ----
NM_001025243chrX31304 952 477 1879 ----
NM_001025252chr813188 13056 ----
NM_001025253chr813188 13056 ----
NM_001025579chr1741134 919 65 38 --2240 166 --
NM_001025580chrX----129 --
NM_001025603chr11193 ----1497
NM_001025778chr191261 ------
NM_001029859chr1141729 1673 1581 318 ----11786
NM_001029989chr152845 711 ------
NM_001030007chr161422 13178 1299 --
NM_001031680chr142237 673 84 66 ------
NM_001031690chr73260 213 95 ------
NM_001031696chr19----2236 37 --
NM_001031740chr171721 1668 1415 1354 494 480 304 ------
NM_001032296chr1312285 ------
NM_001032380chr101117 ------
NM_001033026chr192584 502 --141 --
NM_001033057chr3--11912 ----
NM_001033117chr334170 1550 151 --23397 1450 --
NM_001033507chr121246 746 11652 ----
NM_001033551chr17153456 3421 3102 2985 2949 2933 2902 1486 1343 1008 682 486 236 62 35 21236 897 23388 422 --
NM_001033561chr17182 ------
NM_001033581chr1184 ------
NM_001033581chr1184 ------
NM_001033582chr1184 ------
NM_001033925chr1011595 ----11822
NM_001034025chr121296 ------
NM_001035235chr52390 198 --1101 1138
NM_001037317chr1----12678 --
NM_001037582chr41600 ------
NM_001038493chr22104 21 --1379 --
NM_001038640chr151825 ------
NM_001039141chr2211731 1105 ----
NM_001039479chr1442084 1762 635 50 1850 ----
NM_001039550chr22845 142 ------
NM_001039569chr243259 3145 2893 1271 ------
NM_001039574chr11721 --1983 --
NM_001039583chr222423 154 --1537 --
NM_001039584chr222423 154 --1537 --
NM_001039690chr1652025 951 939 703 531 --32150 729 615 --
NM_001039762chr1011636 ------
NM_001039916chr121120 ------
NM_001039917chr121120 ------
NM_001039918chr121120 ------
NM_001039919chr121120 ------
NM_001039920chr121120 ------
NM_001039960chr122582 30 --1496 --
NM_001040020chr71995 ------
NM_001040144chr1652025 951 939 703 531 --32150 729 615 --
NM_001040146chr1652025 951 939 703 531 --32150 729 615 --
NM_001040152chr754444 3510 3216 251 98 ----123
NM_001040167chr73175 160 29 --11055 1344
NM_001040284chr1625778 4851 ------
NM_001040424chr2142709 2040 1874 936 --1260 --
NM_001040619chr1----1375 --
NM_001040653chr31916 ------
NM_001040708chr8149 ------
NM_001042368chr93673 295 72 ------
NM_001042413chr91111 13996 ----
NM_001042479chrX41332 776 644 135 ------
NM_001042480chrX41332 776 644 135 ------
NM_001042595chr192420 182 1113 ----
NM_001042601chr31457 ------
NM_001042603chr1254077 3508 3450 3392 3334 ------
NM_001042632chr2051944 948 445 399 356 --2546 179 1327
NM_001042633chr2051944 948 445 399 356 --2546 179 1327
NM_001042663chr161440 1373 1349 1317 272 118 1543 1142 1913
NM_001042664chr161440 1373 1349 1317 272 118 1543 1142 1913
NM_001042665chr161440 1373 1349 1317 272 118 1543 1142 1913
NM_001042681chr122050 966 ------
NM_001042682chr122050 966 ------
NM_001042682chr122050 966 ------
NM_001043318chr1443172 964 253 38 --1490 --
NM_001043351chr142254 1554 1437 194 --11804 --
NM_001044385chr212791 13296 ----
NM_001077628chr1----126 --
NM_001080418chr1187 --5534 487 191 135 31 --
NM_001099678chr3--24735 1869 --13910
NM_001106chr387996 6161 3431 3084 3071 2145 1688 689 ----11679
NM_001122631chr111668 --164 --
NM_001122679chr51103 ------
NM_001123chr10----1740 --
NM_001128chr161422 13178 1299 --
NM_001144chr162501 96 ------
NM_001146chr81244 --11668 --
NM_001148chr41621 ------
NM_001174chrX--1236 2772 689 1703
NM_001191chr2021064 132 --11176 --
NM_001201chr413417 ------
NM_001203chr41159 ------
NM_001204chr235081 4827 429 12303 ----
NM_001206chr9----1453 --
NM_001220chr7160 ------
NM_001221chr4----195 --
NM_001222chr101789 --11645 --
NM_001259chr736351 6235 1580 12063 26293 380 --
NM_001260chr13--184 ----
NM_001265chr132707 255 ------
NM_001271chr151728 1188 ----
NM_001273chr121420 --1413 --
NM_001275chr142396 294 ------
NM_001277chr112867 804 --1857 --
NM_001292chr151164 --1962 --
NM_001315chr62708 672 11761 ----
NM_001328chr4134 --2149 118 --
NM_001331chr112695 26 ----12615
NM_001332chr521510 316 ------
NM_001364chr1123568 263 ------
NM_001365chr173547 233 192 --149 --
NM_001383chr17------1232
NM_001387chr522975 2638 ------
NM_001389chr212460 206 ------
NM_001396chr211778 ------
NM_001397chr152253 1698 949 524 249 1820 21073 272 1546
NM_001418chr111532 ------
NM_001418chr111532 ------
NM_001419chr1943039 616 605 564 1580 1532 --
NM_001420chr192242 36 ------
NM_001438chr112955 ------
NM_001454chr171916 --1355 2330 106
NM_001460chr1292 22 --1145 --
NM_001494chr10--1635 ----
NM_001495chr841194 881 858 357 ------
NM_001497chr932371 1712 74 --12308 --
NM_001500chr61102 ------
NM_001523chr19----298 63 --
NM_001552chr1711030 ------
NM_001567chr111701 --1471 --
NM_001569chrX31304 952 477 1879 ----
NM_001654chrX----1452 --
NM_001664chr31808 ------
NM_001682chr1222314 350 ------
NM_001702chr8--1100 --130
NM_001703chr11112 --1255 --
NM_001707chr7----1127 --
NM_001754chr2154160 3067 63 54 35 --3105 98 26 --
NM_001759chr1224615 3655 34873 4127 776 ----
NM_001760chr6--1265 ----
NM_001777chr313247 ------
NM_001810chr205720 520 331 239 69 --2741 162 --
NM_001823chr14154 ------
NM_001826chr11356 ------
NM_001829chr41134 --1900 --
NM_001834chr5----140 --
NM_001842chr91148 1217 1154 --
NM_001855chr91891 ------
NM_001946chr12172 ------
NM_001964chr51374 ------
NM_001977chr41526 ------
NM_002009chr15--11105 ----
NM_002015chr1322123 438 ------
NM_002023chr151374 1205 429 407 25 ------
NM_002025chrX37701 7657 3059 --26359 6177 --
NM_002031chr61174 ------
NM_002039chr41671 ------
NM_002061chr161955 1851 1707 1480 1362 1230 ------
NM_002069chr71231 ------
NM_002070chr31249 129 ----
NM_002072chr9--1963 ----
NM_002086chr1742013 1908 768 631 11580 --1119
NM_002105chr114878 266 226 120 ------
NM_002128chr13--12321 ----
NM_002160chr92162 103 ------
NM_002167chr11102 ------
NM_002168chr15154 ------
NM_002189chr10192 --1153 --
NM_002204chr171903 ------
NM_002214chr724774 1254 11879 ----
NM_002222chr31520 ------
NM_002247chr10--12275 1531 --
NM_002264chr3------14439
NM_002267chr1312128 ------
NM_002274chr171239 ------
NM_002290chr61983 ------
NM_002309chr2232977 1982 160 22206 448 22673 2628 --
NM_002310chr522327 74 ------
NM_002319chr72920 675 --3962 415 170 --
NM_002356chr611817 ------
NM_002359chr1764253 1311 539 505 415 25 --44240 569 346 160 13653
NM_002373chr1521111 140 ------
NM_002387chr51390 --2522 219 --
NM_002390chr1732019 1773 615 --11985 --
NM_002398chr21158 ------
NM_002406chr51260 --123 --
NM_002442chr121594 --21604 151 --
NM_002446chr19295 27 ------
NM_002473chr222529 507 --3897 555 248 --
NM_002499chr1521695 245 1256 ----
NM_002500chr2--1364 ----
NM_002501chr1963507 3026 2977 2968 924 210 --11027 13708
NM_002506chr1----148 --
NM_002507chr1731939 1702 124 21338 306 11308 --
NM_002519chr11----11325 --
NM_002522chr17--12408 22890 961 --
NM_002537chr15----1702 --
NM_002538chr51183 ------
NM_002539chr2--1288 ----
NM_002576chr111812 ------
NM_002581chr933947 1462 1037 ------
NM_002586chr641555 1501 658 381 1500 ----
NM_002599chr112247 88 --1146 1744
NM_002601chr21335 ------
NM_002609chr521676 1298 --180 --
NM_002628chr311083 ------
NM_002634chr175866 624 585 296 30 ----140
NM_002636chr6----1152 --
NM_002643chr2149 ------
NM_002653chr55831 722 322 157 24 ----1809
NM_002698chr1982866 2691 2635 2518 1042 845 125 92 ----1821
NM_002699chr131244 454 248 --2542 314 --
NM_002709chr223063 654 ------
NM_002714chr62789 371 --1803 --
NM_002716chr1132940 1221 279 ----11341
NM_002718chr332058 2013 1928 --2615 364 --
NM_002730chr1921309 1121 ------
NM_002737chr1775939 5423 4502 4078 2306 2083 1744 ------
NM_002744chr1184 ------
NM_002745chr2224219 4206 14431 ----
NM_002751chr222208 45 1810 1225 --
NM_002752chr5155 ------
NM_002779chr102533 33 182 3493 160 70 --
NM_002787chr71633 ------
NM_002840chr141384 1170 566 188 1414 ----
NM_002850chr1931206 421 60 ------
NM_002868chr1222144 686 --12218 --
NM_002899chr3--150 ----
NM_002912chr61695 ------
NM_002918chr191177 --2429 410 --
NM_002941chr3--11148 ----
NM_002942chr311055 ------
NM_002956chr12125 ------
NM_002957chr973712 3295 2951 2805 1195 885 327 1720 32786 1391 272 11203
NM_002964chr1127 ------
NM_002972chr221239 ------
NM_003013chr41119 ------
NM_003034chr121102 ------
NM_003045chr1323595 3277 --24267 188 1776
NM_003047chr131026 915 563 --21211 131 11314
NM_003069chrX1596 126 ----
NM_003070chr91216 ------
NM_003076chr1231257 316 49 ------
NM_003098chr20187 --2337 59 --
NM_003105chr111115 ------
NM_003108chr274594 2673 2625 2608 2521 2010 1899 --32759 2665 2564 --
NM_003110chr1721079 94 --159 --
NM_003118chr51297 12035 ----
NM_003128chr211862 --1995 --
NM_003131chr651760 562 357 167 93 11461 2857 550 --
NM_003137chr611414 --1472 --
NM_003150chr173852 597 159 ------
NM_003156chr1131265 370 129 ------
NM_003185chr201958 ------
NM_003186chr112282 151 1305 ----
NM_003189chr133204 2411 747 --1611 --
NM_003199chr1811593 ------
NM_003200chr1971820 1789 1720 1524 957 825 310 --21917 80 --
NM_003204chr171502 1141 1679 --
NM_003216chr2263295 3161 2876 1056 358 317 --32893 2353 836 --
NM_003221chr612957 --1638 --
NM_003236chr223031 145 1371 ----
NM_003250chr171375 ------
NM_003255chr1722239 944 --1922 --
NM_003292chr11658 ------
NM_003319chr21819 ------
NM_003325chr221155 ------
NM_003342chr1722084 136 ------
NM_003345chr161439 ------
NM_003369chr1142109 2057 540 212 2595 176 ----
NM_003370chr191775 --1535 --
NM_003385chr21286 ------
NM_003392chr324303 3263 --13011 --
NM_003400chr21271 ------
NM_003407chr191489 ------
NM_003430chr192141 23 ------
NM_003468chr213165 ------
NM_003470chr1621826 318 11593 ----
NM_003482chr1272201 2087 1876 652 643 298 179 --3476 450 360 --
NM_003483chr1222384 418 ----12113
NM_003498chr1651736 1103 216 171 126 ------
NM_003559chr1732531 1047 757 ------
NM_003575chr751292 1233 1048 250 73 --11093 1293
NM_003576chr1312285 ------
NM_003583chr12--13366 ----
NM_003586chr162650 248 --2139 41 --
NM_003597chr222164 751 ------
NM_003601chr4158 ------
NM_003607chr121088 835 --13945 --
NM_003615chr31113 ------
NM_003624chr1911167 --2511 121 --
NM_003629chr143123 3009 2948 2793 --12450 --
NM_003633chr542135 1825 494 366 ------
NM_003644chr1726049 48 12095 1962 2994 102
NM_003655chr172186 77 ------
NM_003660chr192690 53 ----1514
NM_003673chr17140 --146 --
NM_003684chr12928 273 ------
NM_003701chr13--1871 ----
NM_003713chr111138 ------
NM_003714chr521992 646 --21984 378 1360
NM_003737chr11178 ------
NM_003763chr2052751 2702 2214 2087 46 1648 12615 12896
NM_003779chr12412 161 ------
NM_003780chr12188 105 1279 ----
NM_003791chr161140 ------
NM_003829chr9----1100 --
NM_003861chr1422371 168 ------
NM_003885chr173862 533 162 ------
NM_003887chr211525 ------
NM_003888chr1521182 466 ------
NM_003893chr101183 --2454 189 --
NM_003916chrX11157 ------
NM_003930chr72961 694 ------
NM_003936chr251172 1159 1125 191 112 --11051 --
NM_003947chr3137 ----1176
NM_003958chr61491 ------
NM_003972chr1021003 521 ------
NM_003994chr1211129 ------
NM_004024chr1----1284 --
NM_004050chr1431847 794 502 ------
NM_004055chr112640 471 22023 835 21570 61 11487
NM_004068chr31183 ----1144
NM_004080chr7--147 ----
NM_004081chrY--11439 ----
NM_004093chr1311038 1455 ----
NM_004130chr31160 ------
NM_004157chr31897 ------
NM_004169chr171113 ------
NM_004171chr1119264 ------
NM_004185chr1197 ------
NM_004187chrX11033 ----1302
NM_004193chr10--178 --1384
NM_004200chr1153262 2419 2408 754 742 --32575 488 152 --
NM_004202chrY--1278 ----
NM_004225chr8--11219 ----
NM_004228chr19----166 --
NM_004240chr19------151
NM_004286chr2252665 1897 908 756 531 --32289 835 262 --
NM_004302chr12--22321 925 ----
NM_004308chr1161673 1627 360 251 236 43 --21607 226 --
NM_004309chr17----2870 440 1932
NM_004311chr1011185 ------
NM_004321chr242347 2262 858 734 --63359 3305 2986 2562 594 113 --
NM_004326chr11485 ------
NM_004341chr2145 ------
NM_004343chr19------1485
NM_004349chr81192 ------
NM_004350chr142237 673 84 66 ------
NM_004370chr611352 --1137 --
NM_004376chr1011270 ------
NM_004379chr231768 1514 414 ------
NM_004380chr1611926 --12150 --
NM_004393chr342252 1943 1920 348 2909 780 ----
NM_004395chr53786 606 320 ------
NM_004405chr24422 384 298 172 --2330 249 --
NM_004418chr2------177
NM_004420chr1162349 2042 1865 957 872 699 12153 ----
NM_004422chr17188 1449 124 --
NM_004423chr31826 --1803 --
NM_004428chr1--1153 ----
NM_004430chr82633 599 --1305 --
NM_004431chr11188 --2538 194 181
NM_004433chr12719 673 ------
NM_004436chr1----158 --
NM_004438chr21680 ------
NM_004441chr3--1995 ----
NM_004443chr3----1759 --
NM_004451chr112210 88 ------
NM_004472chr52187 165 ------
NM_004474chr12180 112 ----1819
NM_004485chr124369 903 12854 21338 1138 --
NM_004501chr113436 ------
NM_004515chr1165 ------
NM_004517chr111176 ------
NM_004549chr1111537 ------
NM_004560chr91415 ------
NM_004577chr7--1502 ----
NM_004586chrX21621 1485 --11283 --
NM_004593chr31802 ------
NM_004602chr2031475 311 99 --1177 --
NM_004603chr73326 149 74 137 ----
NM_004609chr203493 389 130 ------
NM_004630chr1131135 867 144 --1294 1151
NM_004634chr3----1503 --
NM_004647chr191274 ----1130
NM_004650chrX1541 ------
NM_004655chr171144 ------
NM_004656chr381199 1054 797 486 480 418 339 293 --1494 --
NM_004666chr6175 ------
NM_004673chr111537 ------
NM_004687chr1711968 ------
NM_004694chr17155 ------
NM_004703chr171750 ------
NM_004714chr19162 ------
NM_004725chr101525 ------
NM_004730chr5--1678 ----
NM_004737chr2221277 478 ------
NM_004758chr173812 194 79 --1299 --
NM_004762chr1731728 1717 631 --21759 567 --
NM_004772chr51248 ------
NM_004774chr171402 ------
NM_004791chr13------143
NM_004807chr232126 2047 163 22175 758 12185 1423
NM_004808chr1043161 2219 851 718 --12620 --
NM_004815chr1--13779 ----
NM_004821chr5190 ------
NM_004822chr1773981 1501 1113 1081 852 821 196 23607 559 31520 309 240 11315
NM_004831chr19147 ------
NM_004838chr192147 71 147 ----
NM_004841chr1------1231
NM_004850chr241764 1646 1231 177 ------
NM_004862chr1631383 352 29 ------
NM_004911chr71500 ------
NM_004922chr101151 ------
NM_004926chr141437 ------
NM_004948chr1811447 ------
NM_004952chr12216 90 --1921 --
NM_004953chr31393 --1171 --
NM_004959chr961348 1096 545 355 188 56 ------
NM_004961chrX1488 1232 11369 --
NM_004965chr211582 ------
NM_004968chr72569 289 1539 ----
NM_004973chr61555 ------
NM_004976chr11134796 4481 4030 3708 3447 3371 3317 3225 1681 792 545 452 130 --34286 3165 1632 24900 1799
NM_004978chr111384 --11646 --
NM_004985chr12--1957 ----
NM_004992chrX68024 6928 5390 2959 2826 833 --37587 6474 1599 16429
NM_004992chrX68024 6928 5390 2959 2826 833 --37587 6474 1599 16429
NM_004994chr20----1130 --
NM_004995chr142978 426 11351 ----
NM_004998chr151630 ------
NM_005022chr17--190 ----
NM_005027chr194774 412 392 275 --139 --
NM_005028chr10----12201 --
NM_005044chrX44291 3708 1253 930 ------
NM_005045chr7--1872 ----
NM_005056chr1254321 3752 3694 3636 3578 ------
NM_005063chr1023398 3093 11069 ----
NM_005077chr9--140 ----
NM_005078chr1551719 1670 1252 725 101 --1180 --
NM_005079chr813188 13056 ----
NM_005087chr31566 ------
NM_005099chr1129 1257 1292 --
NM_005116chr20----23819 1304 1711
NM_005118chr91980 1303 ----
NM_005121chr1713387 ------
NM_005137chr2272122 2079 1888 959 856 681 129 22157 323 1886 --
NM_005148chr17141 --1452 --
NM_005180chr10--1323 ----
NM_005184chr1921555 980 ------
NM_005194chr201436 --1403 --
NM_005202chr11914 --2729 288 --
NM_005219chr511242 ----11137
NM_005225chr2031055 789 495 ------
NM_005230chr12--161 ----
NM_005239chr2122028 1675 ------
NM_005252chr141149 ------
NM_005273chr7----121 1105
NM_005296chrX1343 ------
NM_005311chr722237 288 1845 ----
NM_005312chr932419 205 143 --1733 1989
NM_005337chr121333 ------
NM_005354chr19148 ------
NM_005359chr1826155 2171 15161 15241 --
NM_005368chr222427 40 1438 134 --
NM_005380chr131249 1126 444 1357 1399 --
NM_005384chr9124 ------
NM_005386chr202279 23 ------
NM_005399chr114097 ------
NM_005415chr22242 204 ------
NM_005417chr2071775 1389 1276 736 543 438 43 --31931 1926 1436 --
NM_005430chr12----1411 1639
NM_005433chr18--1546 ----
NM_005458chr92103 51 --11505 --
NM_005461chr201149 --11283 --
NM_005465chr1--11968 ----
NM_005474chr1741150 1105 1053 25 ----1287
NM_005475chr12--12934 ----
NM_005477chr1532516 1814 301 --11583 --
NM_005477chr1532516 1814 301 --11583 --
NM_005497chr1745264 4477 4361 157 --14923 --
NM_005499chr19149 ------
NM_005505chr122846 370 --144 --
NM_005523chr731609 310 282 ------
NM_005529chr13272 176 133 --1748 133
NM_005542chr71108 ------
NM_005550chr16----3245 33 21 1230
NM_005578chr323179 209 ------
NM_005596chr912130 16059 --16213
NM_005603chr182509 210 --1345 --
NM_005618chr61533 ------
NM_005627chr61329 ------
NM_005652chr162892 405 --1178 --
NM_005665chr124124 704 1864 ----
NM_005668chr534591 3516 1728 ------
NM_005692chr7177 ------
NM_005708chr131171 1390 ----
NM_005718chr32643 156 --2772 233 --
NM_005719chr12138 ------
NM_005730chr1243511 3412 1185 814 13351 1848 --
NM_005736chr1021203 375 21464 1258 1160 --
NM_005737chr2----1607 --
NM_005742chr2----1586 --
NM_005748chr1222753 2677 ------
NM_005780chr13--140 ----
NM_005852chr171116 2794 107 ----
NM_005877chr2221803 760 ------
NM_005881chr161310 --140 167
NM_005883chr1962227 2185 746 453 324 68 --42886 780 354 348 --
NM_005904chr181516 ------
NM_005909chr51757 --13965 --
NM_005920chr143099 2993 2764 680 13652 178 --
NM_005928chr153580 177 42 ------
NM_005933chr1132236 818 331 ------
NM_005934chr1962211 2039 855 339 278 238 --52280 2172 230 202 21 1208
NM_005943chr61260 11438 1606 --
NM_005955chr134642 594 386 14806 ----
NM_005962chr1022139 1608 ----146
NM_005962chr1022139 1608 ----146
NM_005964chr171326 ------
NM_005985chr203694 571 187 ------
NM_005990chr521058 37 --1411 --
NM_005994chr173877 854 224 --2174 43 --
NM_006004chr1140 ------
NM_006007chr913719 ------
NM_006011chr1542943 2627 1447 515 ------
NM_006026chr32455 307 --3419 329 139 --
NM_006030chr331213 650 254 ------
NM_006034chr1162332 2006 1565 1008 182 156 1713 --139
NM_006035chr14172 11068 11191 --
NM_006037chr264175 3578 1404 564 282 196 14116 13214 --
NM_006047chr2012449 13242 ----
NM_006048chr11324 ------
NM_006079chr6--1551 ----
NM_006090chr1--1221 ----
NM_006110chr16128 ------
NM_006133chr11102286 2265 2142 2082 992 720 562 539 252 79 1270 42321 1725 931 27 --
NM_006136chr7----11199 --
NM_006141chr1622731 261 ------
NM_006148chr1772674 2415 2355 293 244 175 58 --11148 --
NM_006172chr1----135 --
NM_006176chr11----1734 --
NM_006177chr14----1949 --
NM_006201chrX1471 ------
NM_006224chr1722311 2104 ------
NM_006237chr1321884 21 ----12284
NM_006251chr52585 422 ------
NM_006266chr93673 295 72 ------
NM_006268chr112878 285 ------
NM_006293chr152988 345 1235 ----
NM_006306chrX64024 1345 1208 469 301 292 --13690 11261
NM_006313chr121540 ------
NM_006328chr111132 ------
NM_006337chr12297 25 1121 ----
NM_006338chr11526 ----2130 72
NM_006361chr1731786 1728 1263 ------
NM_006369chr11367 ------
NM_006373chr172493 471 --2276 209 11217
NM_006380chr1713532 ------
NM_006383chr151528 ------
NM_006393chr1021598 165 ------
NM_006400chr121241 ------
NM_006421chr81250 ------
NM_006449chr2--21903 1764 ----
NM_006458chr11--181 ----
NM_006469chr1--11327 ----
NM_006482chr12--13366 ----
NM_006483chr19162 ------
NM_006484chr19162 ------
NM_006494chr191234 1607 ----
NM_006497chr171722 ------
NM_006540chr8----138 --
NM_006544chr1425454 4390 ------
NM_006558chr81159 ------
NM_006562chr10131 --1195 --
NM_006565chr16137 ----1940
NM_006618chr111259 11019 ----
NM_006621chr111702 ------
NM_006645chr11137 ----1107
NM_006650chr533208 2475 410 --2752 733 --
NM_006690chr2021504 231 --11467 11879
NM_006693chr74815 806 592 233 ------
NM_006696chr5172 ----1116
NM_006698chr20--11345 ----
NM_006721chr10----1740 --
NM_006722chr342617 2591 1940 862 ------
NM_006726chr42856 834 ------
NM_006734chr611097 ------
NM_006736chr241855 1152 691 561 --1305 --
NM_006741chr12----11004 --
NM_006759chr21250 ------
NM_006766chr812094 ----12608
NM_006769chr11212 ------
NM_006772chr61490 ------
NM_006775chr61780 ------
NM_006795chr1141366 1287 552 498 --31319 531 163 11226
NM_006806chr21--1108 ----
NM_006815chr12--1902 ----
NM_006826chr2--11241 ----
NM_006852chr1732621 1859 389 ------
NM_006854chr7----11948 --
NM_006868chr1813062 ------
NM_006893chr1151 ------
NM_006899chr201138 ------
NM_006901chr15----1158 --
NM_006906chr11277 29 --2268 84 --
NM_006917chr1143 ------
NM_006924chr1712776 ------
NM_006927chr1682228 2028 1457 444 386 357 178 40 1274 3775 641 151 --
NM_006931chr1211834 ----11954
NM_006936chr21--1192 123 --
NM_006940chr12--11496 ----
NM_006950chrX133 --149 --
NM_006991chr32397 278 --1145 --
NM_007001chr93192 109 43 ------
NM_007011chr1596328 6195 5927 5637 5385 4862 1697 1645 925 ------
NM_007023chr21783 ------
NM_007030chr584720 4699 4322 782 563 525 286 206 --24246 1288 --
NM_007032chr2211731 1105 ----
NM_007034chr1--1144 ----
NM_007038chr2125863 237 11737 ----
NM_007050chr2087728 7555 7201 6612 5372 2018 997 80 --22777 629 25497 2327
NM_007064chr321335 325 ------
NM_007097chr5----140 --
NM_007122chr1126 --1232 --
NM_007144chr17--1329 162 --
NM_007146chr1712232 12493 ----
NM_007170chr11136 ------
NM_007174chr121215 ------
NM_007185chr12353 296 --193 --
NM_007189chr731406 1358 569 123 ----
NM_007203chr921006 342 23073 2811 ----
NM_007223chr152328 261 1129 ----
NM_007225chr17295 78 --1918 --
NM_007236chr152979 610 ------
NM_007245chr162824 275 ------
NM_007249chr1316340 --1207 --
NM_007275chr31148 ------
NM_007322chr19----2511 121 --
NM_007327chr941051 948 880 274 --1430 --
NM_007353chr742888 2258 2012 680 ----12951
NM_007359chr1721210 1177 ------
NM_012074chr142762 24 --1741 --
NM_012082chr8195 ------
NM_012095chr1033253 3000 2965 ------
NM_012099chr191487 --2820 225 155
NM_012102chr122050 966 ------
NM_012154chr82797 628 ------
NM_012166chr911477 --1118 --
NM_012199chr124085 3154 ------
NM_012200chr112339 311 --158 --
NM_012249chr2--1505 ----
NM_012264chr2261636 630 500 436 226 184 --1662 --
NM_012264chr2261636 630 500 436 226 184 --1662 --
NM_012268chr19----2236 37 --
NM_012294chr743393 3364 3246 1562 23480 2545 ----
NM_012297chr411807 ------
NM_012298chr32211 23 ------
NM_012300chr521699 874 ------
NM_012302chr111005 ------
NM_012307chr181805 ------
NM_012308chr11185 --2335 293 1938
NM_012309chr1151465 1345 1062 557 405 23969 3193 23873 303 --
NM_012323chr2251475 1223 1135 465 139 ------
NM_012325chr20--1276 ----
NM_012326chr22794 97 ------
NM_012396chr1----1533 --
NM_012399chr2211696 ------
NM_012402chr1111394 ----1384
NM_012407chr222423 154 --1537 --
NM_012410chr16154 ------
NM_012425chr1032443 2325 2277 ------
NM_012446chr51168 ------
NM_012465chr10----12328 --
NM_012473chr22------1291
NM_012482chr12575 510 ------
NM_013235chr51824 ------
NM_013247chr21138 --1410 --
NM_013261chr42995 616 13130 13666 --
NM_013275chr164514 314 270 101 ------
NM_013279chr1142087 1728 1691 224 21956 764 12288 --
NM_013283chr51732 ------
NM_013305chr18182 ----1269
NM_013312chr19276 28 ------
NM_013334chr31177 ------
NM_013341chr222405 2279 ------
NM_013365chr221625 --1212 --
NM_013400chr721014 151 ------
NM_013411chr121976 73 ------
NM_013433chr1931956 1436 261 1297 21964 1305 1458
NM_013449chr12----2816 498 --
NM_013960chr81523 ------
NM_013995chrX21005 748 12358 ----
NM_014007chr92886 66 ------
NM_014023chr102925 226 ------
NM_014028chr612330 ------
NM_014030chr171772 ----160
NM_014079chr31341 --1211 1358
NM_014155chr1136779 1339 370 ------
NM_014159chr3170 ------
NM_014216chr1441448 651 613 404 --21344 663 157
NM_014240chr353929 3488 3350 1634 914 ------
NM_014246chr224735 405 327 86 --1295 1233
NM_014253chrX--1386 ----
NM_014271chrX1668 ------
NM_014299chr1951682 1456 1435 880 821 11738 21969 135 --
NM_014352chr1111356 11417 ----
NM_014360chr142637 246 --1772 --
NM_014374chr721014 151 ------
NM_014386chr51197 ------
NM_014396chr711613 ------
NM_014397chr931345 1269 419 ------
NM_014399chr71248 ------
NM_014400chr19192 ------
NM_014415chr31114 ------
NM_014423chr512174 ------
NM_014432chr61201 ------
NM_014445chr3--11515 ----
NM_014488chr11--150 ----
NM_014502chr11----129 --
NM_014554chr1222139 1453 ------
NM_014563chrX1674 ------
NM_014577chr223201 173 23 ------
NM_014591chr1021041 490 ------
NM_014613chr52987 636 --1675 --
NM_014614chr2--1448 ----
NM_014621chr2189 --170 --
NM_014636chr954128 3831 1506 815 78 --2266 54 --
NM_014646chr1852052 1024 883 443 378 1539 1215 --
NM_014661chr1083470 3329 656 341 128 98 71 59 12854 23315 3057 --
NM_014663chr11194 --1993 --
NM_014665chr883429 2240 1427 1375 505 494 221 136 --21065 356 13039
NM_014667chr311714 --12179 --
NM_014680chr171244 ------
NM_014690chr73260 213 95 ------
NM_014712chr161566 ------
NM_014726chr173935 529 343 ------
NM_014730chr1235197 4972 684 ----12060
NM_014730chr1235197 4972 684 ----12060
NM_014731chr203506 464 355 --11634 --
NM_014736chr152870 736 ------
NM_014737chr2041605 1526 1344 25 12893 ----
NM_014741chr1111344 --1347 --
NM_014743chr422289 1008 ------
NM_014747chr185696 5486 4656 4482 2018 1147 850 128 --34876 1365 1222 --
NM_014752chr11--1324 ----
NM_014755chr212606 ------
NM_014761chr161142 ------
NM_014762chr11836 --2683 282 --
NM_014770chr123302 58 39 ------
NM_014771chr161110 ----1853
NM_014772chr1833253 2227 436 --13395 --
NM_014776chr1222793 2173 ------
NM_014797chr642707 2574 1124 404 12416 ----
NM_014810chr11703 --148 --
NM_014826chr121088 835 --13945 --
NM_014828chr1441004 494 254 80 ------
NM_014836chr101117 ------
NM_014840chr1232755 1315 216 ------
NM_014850chr334170 1550 151 --23397 1450 --
NM_014851chr182532 2346 2279 1911 1852 822 444 24 --2780 635 --
NM_014859chr1731039 936 45 11087 ----
NM_014869chr34939 490 444 88 ------
NM_014872chr9--12122 ----
NM_014876chr2231955 1595 188 ------
NM_014883chr4------1697
NM_014888chr71995 ------
NM_014897chr1733268 2554 2504 ------
NM_014901chr51257 1672 11905 --
NM_014904chr1013774 1219 --13491
NM_014912chr10--1514 ----
NM_014921chr19102929 2567 2543 1899 1102 835 566 370 134 54 1104 11014 11005
NM_014924chr1432227 1242 865 --2329 315 1322
NM_014931chr19173 ------
NM_014952chr1541438 1281 703 160 --11743 1289
NM_014953chr1313932 ------
NM_014988chr4--12711 ----
NM_014991chr412075 ------
NM_015000chr1212466 ------
NM_015008chr31404 ------
NM_015020chr1621515 642 1176 ----
NM_015023chr12184 55 --21740 1608 --
NM_015032chr131550 ------
NM_015033chr91391 1233 32562 331 314 22517 184
NM_015035chr2096685 6207 5522 5404 5269 2176 1537 1201 113 14329 ----
NM_015039chr11208 ------
NM_015042chr1533235 3143 41 11171 23359 3170 --
NM_015045chr101312 ------
NM_015068chr723296 1084 ------
NM_015075chrX3497 397 103 --2882 314 --
NM_015079chr1593140 3053 2845 2284 2107 975 820 443 207 12322 13062 --
NM_015080chr113907 837 704 ------
NM_015082chr521997 938 ----126
NM_015090chr1105530 5414 5081 4737 4575 4221 4074 3980 644 200 11979 --46132 5324 1768 556
NM_015092chr1631770 1652 1516 --13533 --
NM_015100chr121709 1525 ------
NM_015101chr132760 1828 839 --12601 --
NM_015107chrX--1595 1848 --
NM_015124chr2252277 2228 2222 584 513 11001 1574 --
NM_015136chr3--1130 ----
NM_015155chr1023073 598 --12215 --
NM_015186chr91379 ------
NM_015187chr4------1256
NM_015199chr312218 ------
NM_015200chr411025 ------
NM_015205chr1333992 1031 351 --11123 1642
NM_015225chr9----1579 --
NM_015239chr9--1126 ----
NM_015245chr632714 1783 806 --42338 2020 999 149 --
NM_015250chr922037 237 ------
NM_015254chr872549 2497 2213 2047 1139 573 187 12204 22667 156 12161
NM_015267chr121743 1828 ----
NM_015270chr1232227 505 363 11959 ----
NM_015271chr422865 2765 ------
NM_015272chr16----11600 --
NM_015293chr61299 153 ----
NM_015299chr1443631 3599 2995 1541 ----1480
NM_015305chr1421686 668 --1408 11402
NM_015308chr111123 ------
NM_015310chr825979 3349 ------
NM_015315chr542715 1011 442 177 --1494 --
NM_015318chr1951701 1212 622 587 90 ------
NM_015326chr112138 --11937 1639
NM_015328chr722533 425 ------
NM_015347chr12------180
NM_015355chr1711600 ------
NM_015365chrX----129 --
NM_015374chr222415 389 ------
NM_015375chr164687 4372 1990 1872 947 829 ------
NM_015378chr132079 2028 940 --22856 2723 12344
NM_015393chr412525 23567 233 ----
NM_015401chr123332 270 215 ------
NM_015435chr81102 ------
NM_015443chr17--1361 ----
NM_015458chr844853 4160 3908 39 ------
NM_015461chr181260 ------
NM_015472chr3----150 --
NM_015472chr3----150 --
NM_015477chr15154 --1109 --
NM_015481chr122910 676 --163 --
NM_015483chr71710 ------
NM_015508chr31339 ------
NM_015520chr31208 12610 ----
NM_015526chr19------11345
NM_015545chr71313 --1301 --
NM_015557chr153526 3471 2793 2461 956 --22214 1037 2186 63
NM_015567chr131206 1997 ----
NM_015570chr71621 ------
NM_015575chr243368 2502 1366 850 ------
NM_015576chr3------1687
NM_015589chr14152 ------
NM_015609chr152943 2832 2166 959 781 12474 1764 --
NM_015638chr20------133
NM_015686chrX42271 1854 1717 1620 --1856 --
NM_015716chr172268 91 --168 --
NM_015726chr1154 ------
NM_015850chr821536 962 --169 --
NM_015866chr12216 208 ------
NM_015872chr111367 --31614 1180 558 --
NM_015898chr1941680 519 380 340 ------
NM_015902chr81794 ------
NM_015990chr421105 110 ------
NM_015995chr1553917 3663 1405 1386 547 --35179 1717 864 --
NM_015999chr11161 ------
NM_016022chr11754 --2418 76 --
NM_016032chrX1242 ------
NM_016037chr12871 306 ------
NM_016061chr221465 307 ------
NM_016083chr613303 ------
NM_016169chr102648 523 --21014 739 --
NM_016206chr347478 6847 2621 2481 ------
NM_016235chr1611036 1361 ----
NM_016240chr82624 529 1508 ----
NM_016250chr141698 183 ----
NM_016252chr21700 ------
NM_016272chr2222102 531 ----21847 585
NM_016275chr3----1709 --
NM_016284chr161942 ------
NM_016290chr5--150 ----
NM_016357chr12----122 --
NM_016373chr161208 --173 --
NM_016376chr1743667 2795 378 243 --1677 --
NM_016396chr1511947 ------
NM_016424chr17------11467
NM_016440chr191261 ------
NM_016463chr5173 ------
NM_016506chr11----170 --
NM_016507chr1722115 2077 ------
NM_016531chr41760 1200 ----
NM_016532chr171862 --1378 --
NM_016547chr1----4646 635 501 225 --
NM_016570chr12--1510 ----
NM_016596chr123332 270 215 ------
NM_016621chr1154144 4050 3047 2865 1197 11493 13246 1793
NM_016628chr101108 ------
NM_016830chr12168 ------
NM_016953chr254551 2334 2079 997 134 ------
NM_017415chr521659 1311 --13371 --
NM_017452chr2031475 311 99 --1177 --
NM_017453chr2031475 311 99 --1177 --
NM_017454chr2031475 311 99 --1177 --
NM_017456chr1731728 1717 631 --21759 567 --
NM_017457chr19----166 --
NM_017514chrX2672 182 --190 --
NM_017548chr321717 1514 ------
NM_017550chr192976 274 --5247 241 160 100 57 --
NM_017558chr161361 ------
NM_017559chr172256 103 ------
NM_017572chr19----122 --
NM_017575chr1741493 265 216 191 --1584 --
NM_017590chr2232516 2057 220 1642 ----
NM_017596chr143983 3803 3474 1520 11660 34208 1770 1077 --
NM_017602chrX3706 603 274 ------
NM_017617chr931148 1070 47 11184 11005 --
NM_017626chr1011706 --11353 --
NM_017637chr918622 ------
NM_017640chr61306 ------
NM_017643chr1712818 ------
NM_017651chr61481 --21566 620 --
NM_017666chrX11906 ------
NM_017709chr123917 388 ------
NM_017741chr442323 2205 1933 309 ------
NM_017742chr1811775 ------
NM_017749chr11------1368
NM_017752chrX2820 686 ------
NM_017762chr151919 12026 ----
NM_017763chr1721021 51 ------
NM_017772chr61216 ------
NM_017787chr1042837 2556 2477 1028 --1554 --
NM_017799chr14--11797 ----
NM_017805chr19145 ------
NM_017848chrX1693 --11691 --
NM_017849chr222090 445 22616 1024 22316 1190 --
NM_017856chrX41332 776 644 135 ------
NM_017893chr1021437 511 ----159
NM_017910chr2--1255 ----
NM_017919chr91202 ------
NM_017921chr1752310 1723 1579 872 134 --132 --
NM_017933chr211496 1349 ----
NM_017938chrX22089 348 ------
NM_017944chr11--1164 ----
NM_017994chr712527 --172 --
NM_018000chr23844 794 593 ------
NM_018028chr19268 39 ------
NM_018032chr162781 97 ----1935
NM_018067chr1123 1485 1106 --
NM_018077chr7159 ------
NM_018084chr2--131 ----
NM_018085chr186356 6238 6103 2484 1848 1595 1308 1172 --17452 137
NM_018086chr211380 ------
NM_018092chr16----1629 --
NM_018095chr11----170 --
NM_018114chr31127 ------
NM_018128chr1711135 ------
NM_018131chr102898 788 ------
NM_018156chr132079 2028 940 --22856 2723 12344
NM_018157chr1232358 2248 1109 --12520 --
NM_018184chr311583 ----1338
NM_018202chr13970 920 818 ------
NM_018240chr1----1199 1717
NM_018244chr2011248 1974 ----
NM_018246chr812760 --1726 --
NM_018254chr1--12010 ----
NM_018275chr7----173 --
NM_018299chr81157 ------
NM_018315chr411041 ------
NM_018320chr1121157 369 1114 11046 --
NM_018373chr1486103 5508 4679 4310 1539 1282 1015 808 ------
NM_018383chr221449 117 ------
NM_018403chr343004 2886 568 424 --13064 --
NM_018419chr20----121 --
NM_018440chr846396 6140 5248 2798 ------
NM_018449chr9143 ------
NM_018482chr8168 ------
NM_018486chrX1408 ------
NM_018489chr11104 ------
NM_018553chr1721362 617 --21832 212 --
NM_018584chr11197 ------
NM_018645chr23377 352 33 ------
NM_018667chr1682056 1865 1078 807 547 513 454 306 12439 52336 1983 1800 782 169 159
NM_018674chr22469 236 ------
NM_018719chr711278 ------
NM_018896chr17166 ------
NM_018898chr5--12222 ----
NM_018899chr5--12222 ----
NM_018900chr5--12222 ----
NM_018901chr5--12222 ----
NM_018902chr5--12222 ----
NM_018903chr5--12222 ----
NM_018904chr5--12222 ----
NM_018905chr5--12222 ----
NM_018906chr5--12222 ----
NM_018907chr5--12222 ----
NM_018908chr5--12222 ----
NM_018909chr5--12222 ----
NM_018910chr5--12222 ----
NM_018911chr5--12222 ----
NM_018947chr764963 4385 4268 4081 3969 3323 ------
NM_018951chr72450 286 --1133 --
NM_019044chr234477 559 483 ------
NM_019046chr101784 ------
NM_019058chr101334 ------
NM_019074chr153827 655 258 --1785 --
NM_019084chr10----1342 --
NM_019106chr2212163 13249 ----
NM_019114chr922413 62 ------
NM_019557chr11591 ----1787
NM_019596chr213725 562 428 ------
NM_019610chr1--11505 ----
NM_019613chr172334 93 ----187
NM_019843chr22150 ------
NM_019845chr2184 1329 ----
NM_019884chr191370 --196 --
NM_019885chr262551 2501 944 666 182 164 ------
NM_020064chr92256 36 ----1475
NM_020122chr275007 4951 4834 4704 3749 1195 600 ------
NM_020150chr101255 ------
NM_020160chr191325 ------
NM_020168chr1521058 52 ----1159
NM_020180chr18--165 11314 --
NM_020182chr2043161 2696 1386 776 --121 11087
NM_020184chr2152 1220 ----
NM_020199chr511141 ------
NM_020211chr15129 ------
NM_020246chr72293 146 ------
NM_020248chr121759 827 --2721 65 --
NM_020310chr174975 951 866 725 --21995 833 --
NM_020381chr611870 ------
NM_020416chr44951 826 363 152 --11079 --
NM_020420chrY--11439 ----
NM_020432chr71677 ------
NM_020440chr132821 2328 2169 ------
NM_020443chr135626 2384 314 16105 56951 6839 5494 2112 1631 --
NM_020463chr211279 ------
NM_020474chr18144 ------
NM_020478chr822151 142 --11956 --
NM_020526chr131721 1686 398 ------
NM_020530chr222244 149 1250 2312 85 --
NM_020631chr161440 1373 1349 1317 272 118 1543 1142 1913
NM_020640chr3----1207 --
NM_020672chr12481 48 1225 ----
NM_020699chr175027 4993 4546 4155 3723 1946 1867 --13728 13847
NM_020708chr20----21990 24 --
NM_020713chr2063049 2884 2080 939 891 413 13129 32848 2658 359 --
NM_020715chr142744 88 ------
NM_020728chr732866 2743 2608 ------
NM_020742chrX1326 ------
NM_020764chr1671329 1300 886 359 211 100 81 --4315 250 142 37 --
NM_020766chrX23679 3452 ------
NM_020772chr1717307 16339 ----
NM_020791chr171194 ------
NM_020795chr17----21849 200 --
NM_020796chr5----1172 --
NM_020804chr632410 2051 1881 --1702 --
NM_020807chr162644 50 ------
NM_020812chr19----2127 46 --
NM_020820chr2021103 616 --2204 25 --
NM_020831chr2221004 931 ------
NM_020845chr12112486 1797 936 721 712 328 185 175 134 96 77 ----12428
NM_020856chr191127 ------
NM_020899chr1722214 848 ------
NM_020940chr1011129 --12895 --
NM_020946chr931566 1524 512 ----21506 295
NM_020948chr11633 ------
NM_020952chr91233 ----1160
NM_020956chr1984313 3652 3602 3520 3062 1228 921 424 24154 26 34333 4327 293 --
NM_020962chr151370 ----11555
NM_020972chr4----2285 184 136
NM_020977chr41621 ------
NM_020983chr1232227 505 363 11959 ----
NM_020988chr1611249 --1448 --
NM_021003chr14----1804 --
NM_021019chr12----1206 --
NM_021025chr53153 74 51 ------
NM_021035chr204926 359 241 108 --11048 --
NM_021064chr611246 1396 --1364
NM_021081chr20------124
NM_021116chr7158889 7835 7812 7690 6818 6499 6381 6241 5866 3241 2966 2143 2054 1802 489 --18111 11686
NM_021132chr10134 ------
NM_021133chr11584 --174 --
NM_021140chrX1315 ------
NM_021155chr1952744 2574 2137 1874 661 12993 ----
NM_021159chr411644 ------
NM_021188chr141526 ------
NM_021192chr21323 ------
NM_021198chr22317 96 ----1917
NM_021215chr201397 ------
NM_021238chr121169 ------
NM_021242chrX1266 ------
NM_021249chr1411260 ------
NM_021252chr1021276 160 ------
NM_021255chr14------12823
NM_021569chr941051 948 880 274 --1430 --
NM_021614chr51103 ------
NM_021630chr8--2315 144 --137
NM_021635chr621970 1853 1253 ----
NM_021638chr453166 1873 1082 447 418 13346 24487 1987 --
NM_021648chr61559 --1193 --
NM_021728chr14147 ------
NM_021783chrX122 ------
NM_021806chrX299 64 1430 124 --
NM_021814chr61203 ------
NM_021831chr2----1284 --
NM_021907chr21225 ------
NM_021914chr14----1113 --
NM_021943chr62528 91 11793 ----
NM_021946chrX----21248 339 --
NM_021964chr312563 ------
NM_021971chr31177 ------
NM_021984chrX1488 1232 11369 --
NM_021987chrX1488 1232 11369 --
NM_021990chrX1488 1232 11369 --
NM_021991chr171183 --1320 --
NM_022006chr19161 ------
NM_022039chr10----1112 129
NM_022041chr161102 ------
NM_022042chr421115 285 --1249 --
NM_022048chr1532541 2061 474 ------
NM_022060chr1431247 916 346 --11260 --
NM_022119chr16178 --1258 --
NM_022152chr2280 33 --161 --
NM_022153chr1053329 2311 1331 1264 120 1846 21374 1029 1380
NM_022166chr162642 455 22075 23 1807 12419
NM_022169chr1141323 1301 420 167 --1451 --
NM_022170chr741656 1421 179 68 ------
NM_022307chr72569 289 1539 ----
NM_022340chr362801 2666 1029 777 332 28 --11215 --
NM_022343chr921263 849 ------
NM_022374chr2----178 --
NM_022455chr51215 ------
NM_022459chr1323993 501 11664 ----
NM_022473chr1561730 1412 1280 956 770 146 ------
NM_022497chr331052 382 294 1575 --11220
NM_022552chr211073 ------
NM_022574chr721697 26 1509 12037 --
NM_022648chr234194 4116 3976 21462 103 11336 --
NM_022652chr12172 ------
NM_022719chr22103543 3001 2950 2906 2896 1485 1321 964 577 406 12851 23696 552 1101
NM_022749chr821080 974 --1112 --
NM_022750chr72503 58 ------
NM_022758chr612624 12234 12253 --
NM_022768chr11136 ------
NM_022781chr922997 2926 ------
NM_022821chr11194 ----1426
NM_022822chr112739 72 1242 2664 176 --
NM_022843chr1311012 ------
NM_022898chr1414732 ------
NM_023009chr11462 ------
NM_023035chr191201 ----1154
NM_023067chr33914 357 280 --1111 --
NM_023075chr181709 ------
NM_023076chr1621207 31 ------
NM_023105chr821536 962 --169 --
NM_023106chr821536 962 --169 --
NM_023110chr821536 962 --169 --
NM_023111chr821536 962 --169 --
NM_024015chr172867 424 --198 --
NM_024016chr17149 --1121 --
NM_024019chr41196 ------
NM_024085chr23717 391 158 --2797 744 --
NM_024106chr191352 ------
NM_024107chr171294 --2793 75 --
NM_024119chr171129 ------
NM_024294chr612624 12234 12253 --
NM_024328chr141208 --160 --
NM_024348chr91257 ------
NM_024490chr152531 452 ------
NM_024493chr6192 ------
NM_024494chr1197 ------
NM_024511chr423299 407 ------
NM_024522chr12694 38 166 --11742
NM_024525chr1------1497
NM_024536chr24319 156 88 22 --1306 --
NM_024627chr222608 124 23942 3147 13733 --
NM_024631chr11--2164 128 ----
NM_024667chr1231557 1355 200 11431 31703 1118 592 31424 477 112
NM_024675chr16143 ------
NM_024704chr202131 54 1317 192 1138
NM_024722chr171389 ------
NM_024742chr1641449 1419 577 152 --21509 1208 --
NM_024761chr924029 434 11136 ----
NM_024787chr83699 389 139 ------
NM_024825chr191304 1286 ----
NM_024830chr562118 2072 1415 357 267 79 ------
NM_024859chrX5877 809 777 706 70 --1852 2783 279
NM_024871chr351135 567 490 98 80 ------
NM_024877chr1931057 337 178 --21109 283 --
NM_024884chr1451014 800 683 631 418 --14195 --
NM_024922chr1642039 1639 1293 310 11278 11399 11368
NM_024927chr17------146
NM_024946chr1611106 ------
NM_024954chr103540 479 200 ------
NM_024969chr22327 69 ------
NM_024971chr91233 ----1160
NM_025048chr6135 ------
NM_025054chr8------165
NM_025061chr192690 159 ------
NM_025146chr312253 ------
NM_025179chr144015 3836 1862 954 11047 11306 --
NM_025182chr92968 316 129 ----
NM_025222chr372578 2508 2390 2256 2054 649 100 1885 ----
NM_025248chr171627 12585 21261 735 --
NM_025251chr811126 1270 3944 368 332 --
NM_025264chr2124 ------
NM_030629chr163573 382 267 ------
NM_030634chr1--1113 ----
NM_030650chr214263 ----1670
NM_030661chr721126 647 21302 1119 ----
NM_030674chr1224100 2221 --14874 --
NM_030751chr101203 ------
NM_030751chr101203 ------
NM_030753chr17284 41 ------
NM_030762chr12------1708
NM_030766chr121279 1101 ----
NM_030802chr171213 ------
NM_030808chr1721048 833 --2154 80 --
NM_030913chr13531 521 487 --1515 --
NM_030918chr155226 4702 4393 1915 72 14382 11104 --
NM_030965chr1------1556
NM_030981chr1141100 773 476 125 ------
NM_031216chr1811643 ------
NM_031231chr202152 113 --1469 --
NM_031232chr202152 113 --1469 --
NM_031283chr21283 ------
NM_031300chr53299 244 22 ------
NM_031306chr12827 778 ------
NM_031309chr882251 2197 1790 1780 846 490 97 76 11693 31852 773 683 --
NM_031372chr411424 ------
NM_031411chr5--12222 ----
NM_031417chr1932523 2271 130 11879 ----
NM_031444chr223897 696 537 --156 --
NM_031445chr21422 ------
NM_031492chr11139 ------
NM_031844chr113436 ------
NM_031849chr5--12222 ----
NM_031857chr5--12222 ----
NM_031860chr5--12222 ----
NM_031890chr2242802 1076 1065 1016 --42386 2206 630 327 --
NM_031911chr432512 1960 1713 ------
NM_031992chr741656 1421 179 68 ------
NM_032017chr121564 1305 --41920 1892 1830 77 21787 103
NM_032051chr222261 219 1594 ----
NM_032052chr22----2242 214 --
NM_032105chr111324 ------
NM_032121chrX21083 868 ------
NM_032127chr11----141 --
NM_032169chr32547 264 ------
NM_032199chr102345 266 ------
NM_032205chr8135 ------
NM_032208chr243619 1302 1043 23 ------
NM_032272chr81398 --1319 --
NM_032281chr192242 36 ------
NM_032294chr1731553 405 274 ------
NM_032316chr362418 2130 942 826 631 354 160 --1126
NM_032325chr11156 --21469 362 --
NM_032364chr121199 ------
NM_032420chr52906 274 --1611 --
NM_032442chr173396 43 35 ------
NM_032447chr19122 --1163 --
NM_032491chr121267 ------
NM_032505chr3--1952 ----
NM_032514chr202107 35 --1173 --
NM_032538chr622835 838 12254 11979 --
NM_032560chr141373 ------
NM_032569chr162508 233 ------
NM_032595chr1741456 1437 1395 194 11467 2606 431 --
NM_032596chr91115 ------
NM_032632chr141138 ------
NM_032638chr33523 424 27 1586 ----
NM_032682chr321195 664 ------
NM_032701chr191530 ------
NM_032711chr1764253 1311 539 505 415 25 --44240 569 346 160 13653
NM_032725chr11129 ------
NM_032737chr1982591 2399 2063 1874 1717 616 580 161 1529 ----
NM_032781chr11277 29 --2268 84 --
NM_032786chr12----1497 --
NM_032789chr81126 ------
NM_032804chr103162 82 28 ------
NM_032808chr153686 38 30 --2888 619 --
NM_032827chr23959 830 37 ----11041
NM_032837chr1711977 ------
NM_032840chr122779 360 --21136 204 151
NM_032876chr142364 57 ------
NM_032918chr121114 ------
NM_033012chr13--1871 ----
NM_033018chrX1471 ------
NM_033056chr10126 ------
NM_033071chr61299 153 ----
NM_033102chr111025 --185 --
NM_033102chr111025 --185 --
NM_033129chr2031796 1616 1581 --21521 52 --
NM_033132chr13----1115 --
NM_033133chr1753250 2460 1374 598 484 --22324 974 1259
NM_033141chr1412219 ------
NM_033143chr423804 141 ------
NM_033147chr21225 ------
NM_033148chr21225 ------
NM_033181chr613303 ------
NM_033224chr767939 7814 7128 6136 5212 5091 15146 16686 --
NM_033225chr81356 ------
NM_033259chr34371 247 60 24 --131 --
NM_033260chr6161 2655 613 ----
NM_033274chr532936 2409 1141 23583 629 2688 440 --
NM_033278chr11--181 ----
NM_033290chrX22850 186 --12693 --
NM_033326chr1112502 ------
NM_033360chr12--11078 ----
NM_033375chr1721297 429 1193 --1203
NM_033380chrX1416 ------
NM_033381chrX1416 ------
NM_033386chr222358 51 ----2417 174
NM_033389chr171956 ------
NM_033420chr1941120 1038 484 134 --4387 217 183 87 --
NM_033421chr2031288 578 292 ------
NM_033426chr1432106 525 175 ------
NM_033429chr1521220 826 --131 --
NM_033512chr872671 1980 1077 906 613 392 35 --2971 688 --
NM_033542chr20137 ------
NM_033551chr542715 1011 442 177 --1494 --
NM_033631chr122670 1050 --2859 135 --
NM_033632chr411041 ------
NM_033644chr521699 874 ------
NM_033645chr521699 874 ------
NM_052854chr112506 174 --1586 --
NM_052855chr17------156
NM_052896chr122129 313 --11858 --
NM_052905chr211821 ------
NM_052906chr22114869 4856 3606 3539 3346 3325 3176 1931 1562 1182 488 --14681 --
NM_052934chr1190 ------
NM_052943chr11126 --134 --
NM_052978chr141175 ------
NM_052996chr16----11487 --
NM_053016chr947869 6846 6335 29 ------
NM_053024chr311405 ------
NM_053025chr31307 ----1373
NM_053026chr31307 ----1373
NM_053027chr31307 ----1373
NM_053028chr31307 ----1373
NM_053031chr31307 ----1373
NM_053032chr31307 ----1373
NM_053064chr14--12053 133 --
NM_054016chr13742 624 491 ------
NM_054016chr13742 624 491 ------
NM_054016chr13742 624 491 ------
NM_054035chr171620 --3779 609 204 --
NM_054111chr6132 ------
NM_057169chr1222793 2173 ------
NM_057170chr1222793 2173 ------
NM_057178chr17156 ----11908
NM_058164chr192131 21 ------
NM_058167chr161006 929 349 229 206 163 1794 11024 --
NM_078471chr1721196 53 ------
NM_080391chr11589 ------
NM_080415chr171606 178 ----
NM_080476chr20------159
NM_080546chr91565 ------
NM_080645chr611352 --1137 --
NM_080670chr51641 --1674 --
NM_080738chr121769 1689 ------
NM_080743chr652317 2051 1875 1788 1019 1463 ----
NM_080881chr53786 606 320 ------
NM_100264chr101108 ------
NM_100486chr101108 ------
NM_130436chr211778 ------
NM_130438chr2111355 ------
NM_130439chr1022139 1608 ----146
NM_130439chr1022139 1608 ----146
NM_130440chr141384 1170 566 188 1414 ----
NM_130459chr931627 1525 33 --11057 --
NM_130766chr171862 --1378 --
NM_130809chr5--1555 ----
NM_130838chr15------11723
NM_130839chr15------11723
NM_133170chr2087728 7555 7201 6612 5372 2018 997 80 --22777 629 25497 2327
NM_133171chr20146 1244 ----
NM_133369chr51977 --1362 2369 257
NM_133378chr21819 ------
NM_133432chr21819 ------
NM_133437chr21819 ------
NM_133452chr19--1750 31092 1050 839 11114
NM_133467chr11363 --3424 408 81 --
NM_133476chr121120 ------
NM_133499chrX1103 --1119 --
NM_133631chr3--11148 ----
NM_133639chr15----2317 69 --
NM_133642chr2221277 478 ------
NM_133650chr61299 153 ----
NM_134442chr231768 1514 414 ------
NM_138300chr141460 1209 1160 1108 ------
NM_138415chr2241332 664 549 147 --2586 284 --
NM_138444chr1321423 190 13034 ----
NM_138457chr621343 1294 --1821 22702 132
NM_138473chr12--134 ----
NM_138479chr12752 288 --21507 1299 --
NM_138492chr511378 ------
NM_138576chr1414732 ------
NM_138578chr2021064 132 --11176 --
NM_138638chr14----1113 --
NM_138732chr113907 837 704 ------
NM_138734chr113907 837 704 ------
NM_138927chr21193 ------
NM_138962chr17162 ------
NM_139012chr62708 672 11761 ----
NM_139014chr62788 752 11841 ----
NM_139015chr1221300 1262 ------
NM_139035chrX1596 126 ----
NM_139045chr91216 ------
NM_139068chr51186 ------
NM_139069chr51186 ------
NM_139070chr5155 ------
NM_139071chr1231257 316 49 ------
NM_139136chr121413 ------
NM_139159chr195914 844 499 329 90 1243 ----
NM_139276chr173852 597 159 ------
NM_139280chr1751245 1069 293 285 201 --11356 --
NM_144568chr141625 --1264 --
NM_144578chr1414961 ------
NM_144582chr242517 1602 780 361 --155 --
NM_144605chr16128 ------
NM_144635chr32346 181 ------
NM_144967chrX--1135 ----
NM_145071chr3174 --1282 --
NM_145074chr21138 --1410 --
NM_145185chr1941898 1602 807 511 11927 41717 491 291 166 --
NM_145233chr191291 ------
NM_145239chr162842 55 ------
NM_145296chr191600 --132 --
NM_145313chr103584 506 484 11221 31300 1277 1065 --
NM_145349chr1731842 1579 780 1657 2242 213 1456
NM_145351chr1742334 2071 1677 165 --2734 705 1948
NM_145714chr161289 ------
NM_145733chr22--11038 ----
NM_145861chr121769 1689 ------
NM_145891chr1611461 ------
NM_145892chr1611461 ------
NM_145893chr1611583 ------
NM_147150chr921006 342 23073 2811 ----
NM_147161chr11225 ------
NM_147164chr91148 1217 1154 --
NM_147168chr91115 ------
NM_147202chr952328 665 569 466 48 ------
NM_148414chr161372 ------
NM_148415chr161312 ------
NM_148416chr161289 ------
NM_148918chr171113 ------
NM_152230chr10--134 ----
NM_152233chr1411260 ------
NM_152253chr2274092 3756 3158 3147 3131 3110 1568 --1291 --
NM_152263chr184836 4779 4391 4146 1670 1216 1097 962 ------
NM_152277chr512039 ------
NM_152296chr191272 ------
NM_152388chr212791 13296 ----
NM_152409chr5198 ------
NM_152410chr6--1134 ----
NM_152424chrX14635 1116 11321 --
NM_152441chr121117 ------
NM_152462chr17--1290 ----
NM_152470chr1863324 3047 2856 2823 2603 328 --12656 --
NM_152523chr21287 ------
NM_152542chr42859 740 ------
NM_152546chr531292 1205 131 ------
NM_152553chr6--1178 ----
NM_152557chr731303 500 479 ------
NM_152586chr10159 ------
NM_152608chr121715 571 --1178 --
NM_152629chr91111 13996 ----
NM_152652chr162208 181 ------
NM_152678chr3--1282 ----
NM_152699chr323438 3416 1115 12348 --
NM_152713chr11------1161
NM_152722chr113668 596 80 --21152 206 --
NM_152724chr1032443 2325 2277 ------
NM_152742chr71457 --168 --
NM_152838chr2012449 13242 ----
NM_152857chr611003 ------
NM_152858chr611003 ------
NM_152860chr121145 ------
NM_152878chr2251475 1223 1135 465 139 ------
NM_152903chr132662 530 ----1762
NM_152924chr1596328 6195 5927 5637 5385 4862 1697 1645 925 ------
NM_152989chr12--11496 ----
NM_153029chr1653607 3237 1543 1187 765 ------
NM_153209chr17179 ------
NM_153260chr1531174 1055 591 ------
NM_153273chr331017 586 375 --22362 968 12257
NM_153334chr223495 104 79 --1588 --
NM_153350chr166509 490 444 215 195 46 ------
NM_153360chr2031217 1001 543 --1210 --
NM_153499chr1211988 --132 --
NM_153500chr1211988 --132 --
NM_153607chr512711 1479 ----
NM_153620chr741641 1557 1486 626 11166 ----
NM_153631chr721126 647 21302 1119 ----
NM_153632chr721126 647 21302 1119 ----
NM_153649chr142254 1554 1437 194 --11804 --
NM_153697chr24824 703 560 175 ------
NM_153715chr72450 286 --1133 --
NM_153748chr121413 ------
NM_153756chr11284 ------
NM_153759chr211073 ------
NM_153812chr152108 1447 584 563 52 1594 ----
NM_153827chr172268 91 --168 --
NM_170606chr721761 391 ------
NM_170663chr172268 91 --168 --
NM_170675chr15--1455 ----
NM_170676chr15--1455 ----
NM_170692chr1------1231
NM_170696chr1521182 466 ------
NM_170697chr1521182 466 ------
NM_170706chr11208 ------
NM_170774chr2041605 1526 1344 25 12893 ----
NM_170775chr51103 ------
NM_171998chrX--1208 ----
NM_172057chr7----2279 56 --
NM_172058chr811492 ------
NM_172059chr811492 ------
NM_172060chr811492 ------
NM_172070chr21813 ------
NM_172071chr122286 50 ------
NM_172078chr7160 ------
NM_172079chr7160 ------
NM_172080chr7160 ------
NM_172081chr7160 ------
NM_172082chr7160 ------
NM_172083chr7160 ------
NM_172084chr7160 ------
NM_172127chr4----1106 --
NM_172128chr4----162 --
NM_172169chr101789 --11645 --
NM_172170chr101789 --11645 --
NM_172171chr101789 --11645 --
NM_172173chr101789 --11645 --
NM_172200chr10192 --1153 --
NM_172206chr1731553 405 274 ------
NM_172226chr1211988 --132 --
NM_172337chr14147 ------
NM_172349chr51215 ------
NM_173054chr7--1872 ----
NM_173075chr411733 ------
NM_173156chr121616 759 ------
NM_173172chr2164 ------
NM_173191chr1021041 490 ------
NM_173192chr1021041 490 ------
NM_173193chr1021041 490 ------
NM_173194chr1021041 490 ------
NM_173195chr1021041 490 ------
NM_173475chr16----11647 --
NM_173476chr1682087 1983 1501 888 838 592 480 369 --51770 1556 1550 913 517 11927
NM_173502chr161136 ----1151
NM_173582chr1165350 5232 1591 1491 1373 1240 --15099 --
NM_173584chr111102 --175 --
NM_173587chr11129 --2204 179 --
NM_173595chr1255233 5149 4229 3720 1309 --23490 642 --
NM_173642chr147893 2822 2709 118 --37916 6539 641 --
NM_173667chr52781 223 ------
NM_173681chr731519 643 628 --1413 --
NM_173832chr843725 2442 871 25 --32785 2706 1386 1663
NM_173851chr823968 3432 --11593 --
NM_173872chr4166 --1832 --
NM_174856chr201138 ------
NM_174911chr822487 392 1639 2121 101 --
NM_174934chr1152826 2742 900 286 129 1796 1824 11131
NM_174937chr10142 ------
NM_175624chr1245485 4717 2958 2277 22824 2613 16549 --
NM_175625chr1245485 4717 2958 2277 22824 2613 16549 --
NM_175629chr211073 ------
NM_175630chr22329 256 ------
NM_175634chr81192 ------
NM_175635chr81192 ------
NM_175636chr81192 ------
NM_175854chr1321946 395 ------
NM_176795chr113388 378 271 ------
NM_176871chr8113342 3256 3206 3047 2910 2605 2518 805 797 484 46 ----12769
NM_177398chr121246 746 11652 ----
NM_177399chr121246 746 11652 ----
NM_177414chr111138 ------
NM_177441chr171294 --2793 75 --
NM_177539chr12612 53 --1898 --
NM_177549chr202983 422 ------
NM_177952chr14----1804 --
NM_177999chr923465 2678 --22721 2564 13055
NM_178010chr12--11496 ----
NM_178151chrX32832 2280 530 ----1184
NM_178152chrX32832 2280 530 ----1184
NM_178153chrX32832 2280 530 ----1184
NM_178167chr16----2311 62 --
NM_178423chr71127 ------
NM_178425chr71127 ------
NM_178500chr172756 652 --1761 132
NM_178554chr333579 2519 973 --22620 882 --
NM_178565chr811139 ------
NM_178585chr412075 ------
NM_178819chr8147 --1114 --
NM_178835chr41192 ------
NM_178863chr16----1446 --
NM_178864chr11----1640 --
NM_181332chrX1326 ------
NM_181458chr21992 ------
NM_181509chr202107 35 --1173 --
NM_181521chr1621581 163 --16367 --
NM_181528chr20163 ------
NM_181552chr7193 1317 3226 123 37 --
NM_181656chr17--143 ----
NM_181689chr202279 23 ------
NM_181701chr951560 875 642 513 108 --12071 --
NM_181784chr21168 ------
NM_181876chr44951 826 363 152 --11079 --
NM_181897chr332058 2013 1928 --2615 364 --
NM_182498chr191257 ------
NM_182509chr1411662 ------
NM_182527chr2241677 1550 551 196 --31593 503 97 1615
NM_182540chrX1167 ------
NM_182565chr172279 25 ----1173
NM_182594chr53439 321 183 ------
NM_182685chr1--1153 ----
NM_182700chr76573 501 482 409 279 57 --1211 --
NM_182744chr131249 1126 444 1357 1399 --
NM_182764chr20146 1244 ----
NM_182796chr51732 ------
NM_182830chr141698 ------
NM_182847chr22469 236 ------
NM_182895chr223495 104 79 --1588 --
NM_182917chr31393 --1171 --
NM_182943chr3--1131 ----
NM_182961chr61299 153 ----
NM_182970chr2043150 3132 431 149 --23183 1466 12642
NM_182975chr111169 ------
NM_183078chr61397 ------
NM_183360chr21225 ------
NM_183361chr21225 ------
NM_183419chr81102 ------
NM_194248chr23871 723 321 ------
NM_194259chr161439 ------
NM_194260chr161439 ------
NM_194261chr161439 ------
NM_194278chr1443172 964 253 38 --1490 --
NM_194313chr9152 1232 --11653
NM_194314chr135320 4177 715 ------
NM_194315chr161006 929 349 229 206 163 1794 11024 --
NM_194322chr23871 723 321 ------
NM_194328chr922997 2926 ------
NM_194329chr922997 2926 ------
NM_194330chr922997 2926 ------
NM_194332chr922997 2926 ------
NM_194452chr1121157 369 1114 11046 --
NM_194453chr1121157 369 1114 11046 --
NM_194457chr161006 929 349 229 206 163 1794 11024 --
NM_194458chr161006 929 349 229 206 163 1794 11024 --
NM_197939chr172896 181 1904 ----
NM_197941chr51517 ----12590
NM_198042chr81100 1419 --1141
NM_198056chr341952 1599 1555 120 ------
NM_198086chr142364 57 ------
NM_198158chr342617 2591 1940 862 ------
NM_198159chr342617 2591 1940 862 ------
NM_198177chr342617 2591 1940 862 ------
NM_198178chr342617 2591 1940 862 ------
NM_198225chr101117 ------
NM_198240chr12125 ------
NM_198241chr31393 --1171 --
NM_198242chr31393 --1171 --
NM_198244chr31393 --1171 --
NM_198291chr2071775 1389 1276 736 543 438 43 --31931 1926 1436 --
NM_198334chr111162 ------
NM_198335chr111162 ------
NM_198336chr7121 ------
NM_198376chr17166 ------
NM_198377chr17166 ------
NM_198378chr17166 ------
NM_198379chr17166 ------
NM_198380chr17166 ------
NM_198382chr17166 ------
NM_198383chr17166 ------
NM_198384chr17166 ------
NM_198385chr17166 ------
NM_198386chr17166 ------
NM_198387chr17166 ------
NM_198388chr17166 ------
NM_198390chr163573 382 267 ------
NM_198396chr17166 ------
NM_198560chr332997 2641 2394 --1739 --
NM_198595chr453166 1873 1082 447 418 13346 24487 1987 --
NM_198597chr101151 ------
NM_198679chr932419 205 143 --1733 1989
NM_198681chr161440 1373 1349 1317 272 118 1543 1142 1913
NM_198686chr1422608 786 1725 ----
NM_198793chr313243 ------
NM_198956chr76573 501 482 409 279 57 --1211 --
NM_198990chr73753 635 577 ------
NM_199039chr421105 110 ------
NM_199054chr1921726 91 --11896 --
NM_199129chr203465 315 116 --1122 --
NM_199141chr193759 278 68 ------
NM_199168chr103557 430 150 ------
NM_199169chr2043161 2696 1386 776 --121 11087
NM_199170chr2043161 2696 1386 776 --121 11087
NM_199171chr2043161 2696 1386 776 --121 11087
NM_199181chr20153 1113 ----
NM_199320chr41962 ------
NM_199320chr41962 ------
NM_199324chr41492 ------
NM_199368chr20------133
NM_199462chr164687 4372 1990 1872 947 829 ------
NM_199487chr2011248 1974 ----
NM_201378chr84912 798 407 221 --2352 284 --
NM_201379chr84912 798 407 221 --2352 284 --
NM_201380chr84912 798 407 221 --2352 284 --
NM_201381chr84912 798 407 221 --2352 284 --
NM_201382chr84912 798 407 221 --2352 284 --
NM_201383chr84912 798 407 221 --2352 284 --
NM_201384chr84912 798 407 221 --2352 284 --
NM_201412chr16------1169
NM_201432chr1726049 48 12095 1962 2994 102
NM_201433chr1726049 48 12095 1962 2994 102
NM_201520chr1751780 734 573 486 195 --11602 --
NM_201535chr141698 183 ----
NM_201536chr141698 183 ----
NM_201537chr141698 183 ----
NM_201538chr141698 183 ----
NM_201539chr141698 183 ----
NM_201540chr141698 183 ----
NM_201541chr141698 183 ----
NM_201568chr121616 759 ------
NM_201569chr121616 759 ------
NM_201575chr16154 ------
NM_201630chr11526 ----2130 72
NM_201634chr5----1112 11494
NM_201995chr111706 ------
NM_201998chr111771 ------
NM_203318chr1721196 53 ------
NM_203327chr20----23819 1304 1711
NM_203377chr222427 40 1438 134 --
NM_203378chr222427 40 1438 134 --
NM_203382chr521370 1082 ------
NM_203394chr12194 ------
NM_203422chr1131150 964 24 ------
NM_203434chr921232 337 ----199
NM_203504chr411807 ------
NM_203505chr411807 ------
NM_203506chr1742013 1908 768 631 11580 --1119
NM_205846chr511378 ------
NM_206594chr112955 ------
NM_206595chr112955 ------
NM_206853chr613394 ------
NM_206854chr614655 ------
NM_206855chr615620 ------
NM_206876chr223063 654 ------
NM_206907chr52585 422 ------
NM_206909chr825979 3349 ------
NM_206944chr91233 ----1160
NM_206945chr91233 ----1160
NM_206946chr91233 ----1160
NM_206947chr91233 ----1160
NM_207005chr1126 --1232 --
NM_207012chr1033253 3000 2965 ------
NM_207042chr1----158 --
NM_207045chr1----158 --
NM_207046chr1----158 --
NM_207123chr41671 ------
NM_207171chr121709 1525 ------
NM_207305chr9164 ------
NM_207362chr2------1190
NM_207371chr10----11164 --
NM_207380chr1573394 3324 2630 1113 1103 571 431 --1285 11131
NM_207406chr425125 320 15076 ----
NM_207412chr831189 1160 596 ------
NM_207429chr1112329 --1429 --
NM_207442chr141879 1111 1345 --
NM_207445chr151680 ----1216
NM_207518chr1921309 1121 ------
NM_207645chr11----1543 --
NM_212464chr151636 11964 1835 --
NM_212469chr112867 804 --1857 --
NM_213594chr121267 ------
NM_213606chr1032027 1775 337 ------
NM_213613chr421115 285 --1249 --