TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-154-3p
miRNA Sequence: AAUCAUACACGGUUGACCUAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000809chr498297 7557 7042 6678 6417 6191 2018 1399 658 29063 1007 27568 1499 28728 7227
NM_000926chr1177319 6122 5894 2906 2215 2105 471 23647 3310 --19470
NM_001003652chr18108574 8386 8344 8277 7628 3368 2732 2645 2203 1383 12187 17792 --
NM_001003679chr192254 2166 1756 1530 1524 1462 1374 445 141 12229 1223 12049
NM_001013620chr1297918 7847 7453 6376 6127 5171 1396 1322 1237 17549 1674 --
NM_001025079chr383191 1315 1289 1211 1143 882 473 206 1579 2573 562 --
NM_001030055chr1484115 3917 3455 3290 3010 1121 784 715 21871 181 14152 --
NM_001039618chr1194614 4513 4089 4048 3869 3818 2028 1254 809 1744 21038 373 --
NM_001042599chr2137419 7396 7350 6800 6687 5798 5733 5129 2690 2045 1394 1269 505 ----12414
NM_001042603chr1284628 4316 4088 3981 3649 1874 1530 1513 --24586 2083 --
NM_001173chr1484115 3917 3455 3290 3010 1121 784 715 21871 181 14152 --
NM_001777chr383191 1315 1289 1211 1143 882 473 206 1579 2573 562 --
NM_001918chr198663 7374 3543 2455 2217 2046 746 240 226 29151 6097 21489 115 --
NM_002006chr485805 5547 4850 4122 3748 3691 1446 680 1482 --14325
NM_002214chr765270 1824 1783 1680 1657 601 25527 4587 15034 15122
NM_002310chr5116180 5599 4911 4412 4117 2367 2227 1676 1627 656 235 34622 835 699 26273 4584 --
NM_003439chr743344 1350 826 521 11013 11293 23282 978
NM_004726chrX74763 3848 3563 3524 1030 1023 480 --14424 15786
NM_004745chr886509 6415 2776 2321 1196 1012 889 593 12702 12095 1367
NM_005056chr12104872 4560 4332 4225 3893 2118 1774 1757 70 58 --14830 --
NM_005197chr14106183 5926 5434 5230 5188 5066 4636 4368 2296 2232 ----11804
NM_005235chr2137419 7396 7350 6800 6687 5798 5733 5129 2690 2045 1394 1269 505 ----12414
NM_005665chr184745 3241 3162 1701 983 775 227 54 13752 1556 14900
NM_005901chr18108574 8386 8344 8277 7628 3368 2732 2645 2203 1383 12187 17792 --
NM_006148chr1792916 2807 2799 1179 1109 1103 1097 636 114 ------
NM_006915chrX42562 2321 1989 1692 22118 260 1657 1957
NM_007038chr2186062 5530 4804 4397 3756 2215 1932 1333 24505 3823 1804 1947
NM_014155chr1176956 6768 5053 1450 828 281 50 32314 773 748 24744 1827 --
NM_014331chr4107699 7676 7261 6524 6358 6035 5587 5424 5117 2951 27494 2184 ----
NM_015455chr593006 2517 1328 1063 463 453 309 148 75 --13482 --
NM_015554chr1562021 1960 583 566 383 364 ----22171 1867
NM_015886chr895486 3982 1851 1651 1308 1105 429 405 371 15654 14017 --
NM_016132chr1553441 2990 2697 2359 419 --12952 2642 332
NM_017650chr7126011 5781 5267 5247 5213 4864 4795 4654 4171 2231 1329 321 14499 11620 11864
NM_018227chr452768 2732 455 312 214 ----23146 496
NM_018374chr755230 4124 3388 3331 1142 43643 1842 1341 468 24419 697 --
NM_018440chr875460 2885 2830 1423 1368 321 33 12551 28642 2360 --
NM_020390chr3104761 4461 3901 1763 1455 1433 622 600 543 282 24876 3375 ----
NM_021961chr1156901 5575 2698 2468 796 ----27308 7205
NM_024947chr3119339 6563 6439 5860 3421 3041 2147 1166 963 548 471 18900 28111 6492 23627 2689
NM_030816chr183240 2499 2402 2292 1423 1216 791 287 13307 --12385
NM_032435chr162101 2034 1808 1727 1609 158 1512 --11504
NM_032968chrX64177 4008 3866 2979 2792 1623 34096 3142 3001 12799 --
NM_032969chrX64177 4008 3866 2979 2792 1623 34096 3142 3001 12799 --
NM_032973chrY64169 4000 3858 2974 2787 1622 34088 3137 2996 12794 --
NM_033505chr286517 6303 5485 4083 2382 2100 1747 286 22610 801 16027 26085 112
NM_152624chr5127143 6713 5253 4807 2839 2061 2041 1991 1662 854 662 261 66748 5889 5728 4799 2143 1588 44923 2388 2222 2136 --
NM_173531chr1983554 2667 2378 1383 1222 1093 338 329 1257 11193 --
NM_173642chr1118260 7300 6020 5852 3343 3215 2163 957 531 226 83 15911 26936 433 --
NM_177968chr241778 1721 1654 790 1117 11742 21647 411
NM_178509chr1773949 3123 1589 1323 1240 770 118 21263 933 --13267
NM_182493chr16115320 5283 5115 5048 4666 1975 1477 1062 1012 423 219 14583 11781 15225
NM_194314chr1105209 4912 4113 4096 4012 3572 2189 1893 1146 215 12058 14898 --
NM_198793chr383187 1311 1285 1207 1139 878 469 202 1575 2569 558 --
NM_207303chr1053640 3564 2957 2646 418 21544 1371 --1833