TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-154-5p
miRNA Sequence: UAGGUUAUCCGUGUUGCCUUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr5163 ------
NM_000046chr562929 2759 2042 711 366 273 --11978 --
NM_000051chr1153078 2670 2565 68 55 12554 2788 738 --
NM_000052chrX62419 1331 1233 1214 670 31 --11391 --
NM_000067chr8------1656
NM_000081chr131691 1412 1303 --21245 202 --
NM_000084chrX96693 4332 4269 2528 2081 1973 1553 1074 629 2359 293 36558 365 158 --
NM_000090chr22899 67 --1356 --
NM_000091chr262775 2371 1943 929 814 193 32738 2707 2659 21160 808 12500
NM_000092chr234511 4475 3587 1491 13808 --
NM_000104chr273023 2914 2890 2739 2472 2253 365 12214 23117 2308 32429 1198 561
NM_000108chr721222 513 ------
NM_000109chrX22423 2290 11783 1332 --
NM_000125chr683197 3168 1695 1640 1402 649 317 33 11511 ----
NM_000129chr651398 1385 1293 1058 206 21477 1341 ----
NM_000170chr93511 451 129 ------
NM_000176chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_000189chr242353 1497 548 230 12049 ----
NM_000202chrX103865 3765 3422 3411 3196 3129 2739 2509 761 331 11402 21104 602 --
NM_000210chr232250 568 420 1348 1132 --
NM_000214chr2021380 650 21212 644 ----
NM_000217chr1274728 4673 4233 896 824 355 305 13971 11078 --
NM_000232chr483211 3181 2515 665 646 594 199 89 ----12044
NM_000237chr82554 70 11615 --1344
NM_000248chr363043 2364 1912 676 618 132 12260 13062 166
NM_000252chrX11225 --1122 11462
NM_000259chr1585251 5223 5013 4812 4404 2299 2073 1037 15505 1363 --
NM_000264chr943078 697 498 142 1716 22974 893 --
NM_000267chr1753207 1118 484 468 197 12483 --23280 2646
NM_000277chr122269 237 --2644 157 --
NM_000284chrX22000 1750 ----1510
NM_000301chr62222 79 ------
NM_000307chrX1332 ------
NM_000314chr1052557 2534 2192 1190 612 ------
NM_000321chr132651 323 21348 1328 174 --
NM_000328chrX------167
NM_000332chr686597 5946 5396 2490 2425 1650 1362 125 --46099 5582 4984 1553 --
NM_000346chr1751643 1299 1271 692 51 11835 --1204
NM_000368chr974556 3057 3009 391 345 192 27 --1471 14545
NM_000387chr31593 1616 --1178
NM_000393chr261957 509 462 257 244 44 11885 ----
NM_000408chr283420 3084 2658 2534 1186 1090 1055 270 --23277 2881 --
NM_000441chr751550 896 713 566 391 22222 1774 ----
NM_000450chr121437 73 11482 1680 21786 489
NM_000461chr394289 3852 3736 3567 3460 3178 1796 1594 1292 13442 1537 --
NM_000489chrX23041 2267 --13368 21290 671
NM_000493chr6--1741 2721 455 --
NM_000533chrX31821 1516 1288 ------
NM_000538chr1361677 1588 1347 388 331 174 --1572 191
NM_000555chrX137434 7347 7053 6940 5980 5698 4903 2919 2846 1444 1292 1122 225 27500 2965 46189 5466 2367 275 --
NM_000596chr72464 398 --2214 136 --
NM_000600chr7--1339 ----
NM_000618chr12106024 5794 5521 5068 4612 4579 1517 1437 1240 800 --35831 507 472 12138
NM_000618chr12106024 5794 5521 5068 4612 4579 1517 1437 1240 800 --35831 507 472 12138
NM_000633chr1864093 3550 3530 2086 1749 1706 --24603 4501 --
NM_000673chr42330 154 --1582 --
NM_000686chrX21531 103 1557 ----
NM_000693chr1541540 1181 686 88 --11469 --
NM_000724chr1051818 1734 1512 1402 51 11838 11380 --
NM_000793chr1484863 4714 3748 3185 1734 1118 643 193 23247 1484 13729 13417
NM_000794chr51720 ------
NM_000801chr201771 --1779 --
NM_000810chr151168 ------
NM_000813chr585371 5056 3993 2233 1504 942 803 351 --44392 4307 3942 2029 14437
NM_000814chr1574244 4064 3533 3136 1305 1270 464 11452 23910 2815 --
NM_000816chr52448 81 ----1558
NM_000824chr43929 911 261 149 ----
NM_000828chrX11985 --2724 132 --
NM_000829chr1142232 2059 747 417 --21910 903 --
NM_000831chr175647 3865 1106 1006 695 550 237 --14587 --
NM_000838chr62974 288 --22767 1809 --
NM_000842chr111543 ------
NM_000845chr71377 ------
NM_000868chrX--1214 ----
NM_000879chr51111 2276 249 ----
NM_000882chr3--1366 1336 1310
NM_000891chr172929 635 --1807 --
NM_000899chr1253924 3860 3173 1735 1088 22713 1444 ----
NM_000901chr462316 1811 1792 1665 1015 280 ------
NM_000926chr11138399 7939 7466 6667 5994 5758 3684 3022 2586 1919 1771 1621 311 12971 46888 2311 701 489 17638
NM_000935chr311064 ------
NM_000945chr251798 1731 1698 621 185 ------
NM_000949chr51811 ------
NM_000950chrX63506 3487 1134 495 420 343 --1605 --
NM_000983chr11158 ------
NM_001001323chr1252843 2031 939 795 532 --11126 --
NM_001001330chr1021206 1143 ------
NM_001001342chr1011277 1500 2597 216 --
NM_001001344chrX11986 22575 1021 12345 --
NM_001001395chr1292744 2499 2409 2389 2009 1964 1951 626 458 --2988 735 --
NM_001001419chr585190 4558 4056 3951 3872 3819 839 696 --1881 11863
NM_001001420chr585190 4558 4056 3951 3872 3819 839 696 --1881 11863
NM_001001433chr2031264 1234 537 1554 1912 --
NM_001001481chr853128 2383 2105 892 84 1102 23414 2191 --
NM_001001484chr1021961 1639 41937 1905 305 217 32415 2308 1898 --
NM_001001556chr1521566 80 ----1249
NM_001001664chr293874 3385 2720 2634 1570 933 858 795 332 23918 751 12553 --
NM_001001668chr1954272 3846 945 165 110 --12598 13725
NM_001001890chr2142656 1106 649 388 --23566 3327 --
NM_001001974chr103858 830 524 --1353 1882
NM_001001995chrX21316 1238 11765 ----
NM_001002026chr352465 1934 519 294 156 --2807 262 --
NM_001002233chr862068 2048 1851 658 179 85 ------
NM_001002257chr273508 3394 2785 2701 1109 1021 179 --1236 --
NM_001002295chr10------1288
NM_001002814chr873901 3168 2999 2419 658 179 85 --12924 --
NM_001002860chr1454466 3270 3255 100 59 11150 24123 3857 --
NM_001002909chr1752211 2139 1965 568 309 ------
NM_001003652chr18208261 8185 7937 7552 7204 7059 6706 6618 6472 6183 5534 5374 3198 3170 1533 1119 765 612 596 438 35756 5524 1034 12954 1915
NM_001003674chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_001003675chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_001003679chr152234 2076 1514 721 581 --1639 1800
NM_001003681chr2221726 297 1498 11968 --
NM_001003712chr1274051 3999 3096 2724 1438 1133 960 33991 3977 403 24033 3401 --
NM_001003760chr663645 3263 1243 1210 958 65 --1647 1174
NM_001004019chr31322 1108 194 --
NM_001004051chrX1119 194 ----
NM_001004065chr953131 2984 2905 2556 984 23694 1487 ----
NM_001004317chr6103233 3093 3079 2851 1278 1258 857 701 651 94 23952 1303 23429 1143 --
NM_001004329chr121420 ------
NM_001004342chr155210 4845 4515 1279 82 24613 4421 ----
NM_001005375chrY1317 --21707 208 --
NM_001005404chr1733332 3077 684 --22870 1206 1473
NM_001005407chr16--1765 1702 --
NM_001005463chr1041833 1682 636 584 1614 12009 --
NM_001005473chr5155593 5174 5134 4832 4768 4744 4086 2624 1820 1761 1648 1541 834 592 255 ----14276
NM_001005502chr12105134 5042 4802 4600 3221 1908 1827 1035 853 253 --12026 --
NM_001005527chr32540 202 1931 --11244
NM_001005732chr212644 637 ------
NM_001005733chr212601 594 ------
NM_001005849chr17----1471 --
NM_001006600chr552380 2230 1578 727 340 11949 ----
NM_001006605chr1----1818 --
NM_001006605chr1----1818 --
NM_001006612chrX----2323 97 --
NM_001006613chrX----2323 97 --
NM_001006614chrX----2323 97 --
NM_001006623chr272595 2376 2102 2066 964 867 203 --11576 --
NM_001006657chr262388 1254 570 466 411 24 ----1687
NM_001006945chr12594 572 ------
NM_001007023chr1484863 4714 3748 3185 1734 1118 643 193 23247 1484 13729 13417
NM_001007067chr82681 192 1951 1991 --
NM_001007068chr82681 192 1951 1991 --
NM_001007069chr82681 192 1951 1991 --
NM_001007070chr82681 192 1951 1991 --
NM_001007097chr995016 4320 3905 3654 2006 1602 1264 832 395 1458 1869 --
NM_001007102chr62409 78 --1527 --
NM_001007246chr21----1297 130
NM_001007466chr695151 4538 3781 3655 3506 3478 1244 1077 249 --12069 12082
NM_001007794chr12629 102 --1117 --
NM_001008239chr1893443 3326 3103 2881 2750 2536 2344 681 281 33109 2850 650 ----
NM_001008393chr442469 1977 395 254 --31808 1101 90 --
NM_001008405chr73468 414 223 31327 1205 438 2276 107 21241 143
NM_001008408chr7106287 5823 5387 5264 4691 4559 4482 4402 529 23 ------
NM_001008540chr21404 --2334 40 --
NM_001008541chr103910 665 459 ----11541
NM_001008541chr103910 665 459 ----11541
NM_001008660chr113485 474 288 1297 ----
NM_001008707chr1441613 472 292 255 11441 1350 --
NM_001008708chr23402 202 23 ------
NM_001008723chr10------1379
NM_001008738chr521016 993 --12924 12287
NM_001008925chr433158 2398 689 12463 12711 --
NM_001009185chr52516 499 ------
NM_001009552chr81397 2444 90 ----
NM_001009554chr473737 1879 1776 1741 1608 1244 1022 --14471 --
NM_001009554chr473737 1879 1776 1741 1608 1244 1022 --14471 --
NM_001009894chr1261513 1259 1166 258 187 38 --11612 1374
NM_001009899chr3105684 5649 5541 5211 4923 4893 4206 1557 420 113 1957 --1353
NM_001009909chr1193652 3512 3474 3207 2827 2608 861 721 121 1135 1183 --
NM_001009958chr7----1566 --
NM_001009959chr272197 1768 1746 1702 932 563 152 32244 1895 1821 1179 --
NM_001010853chr683019 2964 2589 2361 736 295 89 57 ------
NM_001010861chr142358 1753 399 262 --11046 12605
NM_001010888chrX64640 4487 3870 3432 1093 811 23022 1509 11023 --
NM_001010891chr586803 5309 4200 2728 2300 572 520 48 1384 16336 --
NM_001010971chr11734 ------
NM_001010984chr152420 2056 1977 1872 212 ----11860
NM_001010986chrX52286 1811 463 242 155 1588 12046 11797
NM_001011513chr444094 2910 2841 317 13423 13158 13715
NM_001011663chr1011108 ----1115
NM_001011666chr7105773 4727 2345 2038 1842 1479 1259 868 827 288 ----35252 2063 1128
NM_001011708chr252155 1990 1073 790 288 12594 12627 --
NM_001012398chr162922 753 ------
NM_001012418chr663992 3189 3105 1349 1128 806 --1107 --
NM_001012420chr1562672 2510 2102 436 105 67 ----22284 810
NM_001012423chr1562672 2510 2102 436 105 67 ----22284 810
NM_001012751chr1071853 1742 1703 1226 257 250 213 --11624 --
NM_001012761chr522029 1691 1889 11786 --
NM_001012989chrX1486 ------
NM_001013399chr621157 437 ------
NM_001013406chr741611 1401 338 247 --21097 654 --
NM_001013415chr43596 367 193 1607 --11594
NM_001013437chr18--1104 ----
NM_001013620chr12158087 7800 7778 7403 6601 5368 3206 3053 2661 2238 1968 1911 1227 775 704 37529 7182 1362 26790 5217 --
NM_001013635chr1221194 851 --1386 --
NM_001013699chr12--1452 ----
NM_001013746chr732290 502 174 12211 11920 --
NM_001013843chr152757 183 ------
NM_001014797chr1068173 8090 6505 2332 2224 1079 22438 1980 48207 3019 1678 365 --
NM_001015508chr8----1738 --
NM_001015877chrX42506 2427 98 50 --11193 --
NM_001015882chr92718 55 ----1205
NM_001017371chr22442 120 ------
NM_001017395chr353330 2859 2604 595 434 --12720 --
NM_001017440chr7117290 5953 5570 3050 2661 2526 2505 2069 1406 782 287 18095 28217 1026 --
NM_001017523chr1211787 --31302 714 463 --
NM_001017977chr11267 ----1135
NM_001017992chr551498 1487 317 168 147 --21525 1470 --
NM_001018009chr34842 274 135 72 ------
NM_001018065chr965845 4989 4193 3662 2407 1307 ----1147
NM_001018066chr965845 4989 4193 3662 2407 1307 ----1147
NM_001018067chr1125299 5025 4941 4402 4338 3773 3336 2127 2104 1592 1004 707 23616 535 24447 2009 --
NM_001018068chr1125299 5025 4941 4402 4338 3773 3336 2127 2104 1592 1004 707 23616 535 24447 2009 --
NM_001018069chr1125299 5025 4941 4402 4338 3773 3336 2127 2104 1592 1004 707 23616 535 24447 2009 --
NM_001018072chr1211787 --31302 714 463 --
NM_001018074chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_001018075chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_001018076chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_001018077chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_001018091chr1542210 2200 419 36 11161 2872 119 12727
NM_001018100chr15--1705 --1823
NM_001020825chr521297 300 --21219 1002 --
NM_001023567chr1522484 67 1813 32454 1610 611 --
NM_001024094chr5113822 3235 2825 2523 1573 1192 1051 915 864 692 279 --33744 3527 1025 --
NM_001024647chr1286804 6491 5915 4752 2392 2024 958 39 11806 ----
NM_001024649chr552311 2091 351 264 153 ------
NM_001024660chr3------1439
NM_001024668chr122681 607 ----1925
NM_001024934chr62657 117 1650 1134 --
NM_001024935chr62657 117 1650 1134 --
NM_001024936chr62657 117 1650 1134 --
NM_001024948chr132295 720 532 --12848 1575
NM_001025076chr1093851 2322 2300 2004 1238 213 193 176 147 --15223 11397
NM_001025077chr10105209 4606 2596 1571 1551 1534 1505 1376 1089 492 1924 16581 22755 1304
NM_001025079chr353401 3391 713 362 335 12591 23937 1669 --
NM_001025108chr254024 2638 1662 1427 247 --33534 3296 2676 --
NM_001025266chr354913 4675 4582 1806 1234 --33942 3406 651 --
NM_001025580chrX74105 4048 3842 3519 2961 2752 1040 --11482 11411
NM_001025595chr41353 --1203 --
NM_001025616chr431728 1419 544 --21900 1381 --
NM_001029858chr693169 3117 3104 3024 2760 2580 850 656 586 --12792 --
NM_001029863chr663038 2792 2093 1966 850 695 12336 42685 2141 631 340 --
NM_001029875chr532194 2172 655 22509 2149 12157 --
NM_001030006chr1762679 2204 1756 553 194 134 --1659 1934
NM_001030007chr1662793 2640 2555 884 581 154 --33457 1279 928 --
NM_001030055chr1494705 4215 3966 3886 3762 1719 1520 797 457 34537 4469 804 1903 --
NM_001030272chr111166 ------
NM_001030273chr111166 ------
NM_001031696chr19----1303 --
NM_001031732chr483583 2930 2424 1189 654 599 352 135 21392 920 ----
NM_001031804chr1643515 3500 1261 931 13193 21498 300 --
NM_001031812chr54761 394 363 191 11720 1378 --
NM_001032279chr111425 ------
NM_001032282chr8132 --1880 --
NM_001032999chr2074794 4584 4378 3491 1882 1600 1590 ----15296
NM_001033002chr17------192
NM_001033045chr273906 3875 3829 1660 1218 958 72 33419 2915 1578 22873 1773 1688
NM_001033117chr384920 4400 4064 3968 3308 3265 3138 634 23116 1051 ----
NM_001033503chr5----2472 74 --
NM_001033557chr2186 --21470 1323 11379
NM_001033566chr173980 690 158 ----1874
NM_001033568chr173980 690 158 ----1874
NM_001033578chr841998 1742 755 92 31713 1701 260 1563 --
NM_001034841chr1675148 4841 4796 4627 4489 4102 1917 14769 13867 --
NM_001034850chr531351 1275 1085 1376 ----
NM_001035chr111214 ----1208
NM_001037165chr7118949 8496 8350 8079 7209 6487 5902 3264 2721 1879 679 --27714 751 --
NM_001037317chr142358 1753 399 262 --11046 12605
NM_001037331chr182352 155 1607 ----
NM_001037332chr532306 2073 1845 --12352 12046
NM_001037333chr532306 2073 1845 --12352 12046
NM_001037334chr1861863 1623 775 678 657 65 --22425 2378 --
NM_001037339chr141741 1498 1394 708 --1354 --
NM_001037340chr141741 1498 1394 708 --1354 --
NM_001037341chr141741 1498 1394 708 --1354 --
NM_001037341chr141741 1498 1394 708 --1354 --
NM_001037872chr2----1740 --
NM_001037954chr1193464 2600 2310 2275 2254 1268 735 535 492 22918 1325 22569 1175 --
NM_001039199chr2053293 2014 1734 955 252 11781 ----
NM_001039535chr1871899 1725 1696 1590 716 94 87 1423 ----
NM_001039538chr263126 3059 2728 2262 1003 181 1409 23172 111 --
NM_001039580chr4135027 4397 4219 3761 3710 3566 3485 1544 1395 1331 980 627 211 11221 11107 --
NM_001039590chrX53970 2753 1320 529 169 13296 --13308
NM_001039591chrX53970 2753 1320 529 169 13296 --13308
NM_001039618chr1165940 5786 5175 4825 4443 167 --14582 --
NM_001039690chr1642021 1781 573 550 2791 743 ----
NM_001039693chr22971 892 21069 567 33929 1252 616 --
NM_001039709chr2074794 4584 4378 3491 1882 1600 1590 ----15296
NM_001039762chr1051627 1496 868 793 355 --1541 --
NM_001039840chrX34833 1723 951 --55899 5312 4629 2023 838 15665
NM_001039937chr1384178 4000 3484 3040 2870 948 550 161 --32647 1431 683 13247
NM_001040142chr232397 763 538 ----12297
NM_001040143chr232397 763 538 ----12297
NM_001040144chr1642021 1781 573 550 2791 743 ----
NM_001040146chr1642021 1781 573 550 2791 743 ----
NM_001040151chr1154211 3518 3237 1235 1226 14147 23618 1301 --
NM_001040152chr775062 4908 4749 4626 3681 1992 289 ------
NM_001040153chr132663 332 ----1946
NM_001040157chr452599 2548 2207 912 157 11780 12324 --
NM_001040181chr341114 916 861 437 1221 11135 --
NM_001040182chr341114 916 861 437 1221 11135 --
NM_001040183chr341114 916 861 437 1221 11135 --
NM_001040199chr341114 916 861 437 1221 11135 --
NM_001040200chr341114 916 861 437 1221 11135 --
NM_001040202chr452161 784 491 465 169 --1998 --
NM_001040284chr1685570 5254 4446 4426 1968 1695 1143 865 34656 4439 4107 15941 1627
NM_001040402chr453166 1174 904 763 463 13062 32314 2286 510 --
NM_001040409chr22843 762 1236 ----
NM_001040429chr1373461 3388 3374 2634 965 882 77 --23261 1288 --
NM_001040432chr31127 ----1337
NM_001040441chr144088 937 804 411 --23615 131 --
NM_001040450chr1552053 2010 759 510 305 --1990 21983 685
NM_001040453chr1552053 2010 759 510 305 --1990 21983 685
NM_001040624chr841850 1725 1694 970 11961 --12695
NM_001040625chr841850 1725 1694 970 11961 --12695
NM_001040626chr841850 1725 1694 970 11961 --12695
NM_001040627chr841850 1725 1694 970 11961 --12695
NM_001040628chr841850 1725 1694 970 11961 --12695
NM_001040629chr841850 1725 1694 970 11961 --12695
NM_001040630chr841850 1725 1694 970 11961 --12695
NM_001040665chr7114996 4896 4101 3380 3036 1571 1490 853 841 279 253 --13342 13505
NM_001040666chr72698 598 ------
NM_001040712chr972806 2575 2542 817 614 532 98 22294 1145 13431 1192
NM_001042361chr103568 532 446 --31464 453 253 --
NM_001042364chr103568 532 446 --31464 453 253 --
NM_001042365chr103568 532 446 --31464 453 253 --
NM_001042387chr103568 532 446 --31464 453 253 --
NM_001042393chr103568 532 446 --31464 453 253 --
NM_001042396chr103568 532 446 --31464 453 253 --
NM_001042397chr103568 532 446 --31464 453 253 --
NM_001042404chr141740 1395 347 191 1329 1577 --
NM_001042406chr61145 11088 1271 1803
NM_001042424chr452364 2334 1995 340 197 12176 1802 --
NM_001042453chrX21718 1546 --1202 --
NM_001042473chr1041998 1981 660 212 --52163 1699 1597 549 46 --
NM_001042492chr1753207 1118 484 468 197 12483 --23280 2646
NM_001042506chrX31229 573 252 --2997 243 --
NM_001042510chr851860 748 665 354 284 --1627 --
NM_001042511chr851860 748 665 354 284 --1627 --
NM_001042550chr951738 812 134 68 29 11893 11694 --
NM_001042555chr1254705 4081 1674 1615 1541 13216 14218 --
NM_001042599chr2167538 7037 6700 6271 6030 5878 5853 5449 4746 2877 2867 2305 2138 1558 615 160 25909 2290 16342 13050
NM_001042603chr1284685 4507 4466 4429 4251 3815 841 564 14593 ----
NM_001042669chr431728 1419 544 --21900 1381 --
NM_001042749chrX31877 1805 673 11334 1385 --
NM_001042750chrX31877 1805 673 11334 1385 --
NM_001042751chrX31877 1805 673 11334 1385 --
NM_001044385chr273917 3713 1603 527 410 286 30 12774 21328 619 2572 327
NM_001044722chr54761 394 363 191 11720 1378 --
NM_001044723chr54761 394 363 191 11720 1378 --
NM_001046chr572980 2139 1896 597 586 325 288 --12064 12043
NM_001096chr17--1648 ----
NM_001099678chr374257 4231 2551 2489 1399 805 659 66043 6000 4632 2414 1778 670 32163 750 328 12537
NM_001100108chr187094 6841 6798 5167 3143 2674 2272 498 11720 13192 --
NM_001104548chr12168 121 ------
NM_001105518chr1------1875
NM_001106chr3129000 8298 3768 3469 3254 2715 1984 1917 1886 1810 864 737 38934 8709 6796 28684 1253 --
NM_001117chr1852485 2470 2308 2234 1646 ------
NM_001121chr1061695 1596 1434 1311 579 375 --11720 --
NM_001122631chr112472 257 ------
NM_001124chr112490 196 ----1700
NM_001128chr1662793 2640 2555 884 581 154 --33457 1279 928 --
NM_001143chrY--198 ----
NM_001149chr1011229 ----31399 994 970
NM_001153chr2155 ------
NM_001160chr1282054 1985 1879 1764 1749 933 799 189 --11954 --
NM_001166chr113183 177 25 --1143 --
NM_001167chrX136603 6565 5707 4971 4936 4705 4617 2282 2082 1793 1006 397 260 --36717 4906 157 --
NM_001173chr1494705 4215 3966 3886 3762 1719 1520 797 457 34537 4469 804 1903 --
NM_001177chr1232284 943 550 --1462 --
NM_001178chr111166 ------
NM_001186chr2172423 2257 1238 1182 275 263 75 --12045 --
NM_001198chr662046 2008 1668 1556 357 83 --2655 306 1691
NM_001203chr41234 ------
NM_001204chr2116910 6627 5866 5752 5609 2732 2390 2232 775 335 251 12017 56807 6772 1485 1095 1035 11195
NM_001206chr942180 1028 557 427 33056 2613 184 1881 --
NM_001219chr722061 1799 --21715 1652 --
NM_001237chr41287 170 --1450
NM_001237chr41287 170 --1450
NM_001241chr291980 1900 1881 1699 1524 877 869 727 188 1696 21872 663 --
NM_001241chr291980 1900 1881 1699 1524 877 869 727 188 1696 21872 663 --
NM_001256chr1752698 918 831 425 270 --21938 936 --
NM_001259chr7125751 5191 5111 4849 4705 4638 4613 1688 1163 772 362 305 --1816 --
NM_001282chr1762679 2204 1756 553 194 134 --1659 1934
NM_001284chr51100 ------
NM_001294chr19--1438 ----
NM_001304chr1772924 2793 1403 987 911 696 670 --12931 --
NM_001310chr124787 602 482 179 --13025 --
NM_001315chr62550 539 --11642 --
NM_001321chr12----165 151
NM_001329chr1021304 434 11487 11506 11560
NM_001331chr1132475 1950 1018 ------
NM_001332chr52185 130 ------
NM_001351chr321489 661 11394 11680 --
NM_001356chrX42260 935 503 321 160 32025 1555 839 --
NM_001357chr1----1262 --
NM_001364chr1164409 3492 3227 1625 603 434 --21133 1103 --
NM_001380chr1021021 967 ----1978
NM_001390chr1883438 2528 2286 1374 1182 715 584 223 1299 22825 2423 --
NM_001396chr212251 147 11907 21923 828 --
NM_001408chr111590 ------
NM_001412chrX32323 1186 499 22548 1418 ----
NM_001419chr19104490 4336 4233 4062 3849 3190 1538 1484 1096 312 1398 --11518
NM_001422chr1131321 387 105 ----11356
NM_001430chr231985 1968 702 ------
NM_001432chr4103187 3111 3105 3082 3063 3020 2745 1506 1028 716 23743 3031 ----
NM_001438chr143408 3389 884 500 11105 12537 --
NM_001455chr694873 4531 4083 3751 1726 1342 1263 1089 433 14926 21945 1143 14635
NM_001457chr32458 336 ----11464
NM_001482chr153711 359 282 --1178 --
NM_001498chr641203 1141 558 508 ------
NM_001527chr673932 3813 3251 3127 1731 1589 462 --24610 3914 --
NM_001546chr631451 1364 244 21340 404 ----
NM_001609chr1084299 3695 2946 2754 1022 922 682 351 1185 ----
NM_001616chr252528 1336 1149 574 424 12614 --21362 1308
NM_001621chr732668 1104 453 --22169 512 --
NM_001621chr732668 1104 453 --22169 512 --
NM_001649chrX52248 2060 1817 556 225 --1145 --
NM_001650chr1863915 3821 2889 1500 938 593 24000 1408 23698 1105 --
NM_001656chr582015 1984 1703 1556 610 423 361 46 ------
NM_001663chr1462654 2509 2274 2226 811 586 1567 12539 1782
NM_001664chr34340 309 272 58 --1871 --
NM_001682chr1252557 1048 653 509 246 --1840 --
NM_001695chr863271 2842 2781 1110 645 401 1557 ----
NM_001701chr951079 604 590 457 420 11620 ----
NM_001704chr63243 180 150 --1480 --
NM_001718chr61262 --1365 11076
NM_001730chr132636 478 11101 11355 --
NM_001730chr132636 478 11101 11355 --
NM_001743chr2--171 ----
NM_001744chr51150 --1432 --
NM_001746chr552311 2091 351 264 153 ------
NM_001753chr721617 511 1606 1553 --
NM_001754chr2142656 1106 649 388 --23566 3327 --
NM_001755chr1641737 1558 778 142 --133 12173
NM_001769chr12--1389 ----
NM_001777chr353401 3391 713 362 335 12591 23937 1669 --
NM_001781chr123806 319 238 --1676 --
NM_001786chr10------1144
NM_001792chr18186 ------
NM_001806chr1952884 2374 2356 1100 170 21919 424 ----
NM_001823chr14--144 ----
NM_001830chrX73863 3776 3485 2611 2575 1193 883 1364 12496 --
NM_001842chr91559 ------
NM_001858chr674457 3691 3517 3344 3172 3140 642 --1936 1507
NM_001859chr963124 2921 1538 1519 422 189 --12796 --
NM_001874chr12105134 5042 4802 4600 3221 1908 1827 1035 853 253 --12026 --
NM_001895chr201213 ----1894
NM_001903chr54913 715 644 247 ------
NM_001904chr351029 826 799 779 223 ------
NM_001920chr12--1683 130 --
NM_001935chr23919 848 323 ------
NM_001938chr111470 --1299 11175
NM_001939chrX43800 2712 620 230 ----22757 1335
NM_001941chr1863919 3727 3716 3108 1091 735 ------
NM_001951chr81468 ----168
NM_001957chr432258 1591 36 11492 --1524
NM_001966chr32614 120 1582 ----
NM_001977chr451349 697 521 438 371 11609 --11573
NM_001981chr162234 1900 1636 1564 379 201 11673 1599 11861
NM_001985chr19--156 ----
NM_001992chr522059 1543 --32237 391 53 12041
NM_001998chr31322 1108 194 --
NM_001999chr531409 1365 103 --1231 11139
NM_002009chr1542053 1990 880 453 22643 1764 12580 2820 518
NM_002015chr1352993 2946 2889 990 590 ----11097
NM_002017chr1151207 1156 917 327 162 ----1441
NM_002024chrX32081 2058 1925 --11652 --
NM_002025chrX148225 7997 7972 7351 7225 7142 5855 3000 2971 1600 1557 1280 1175 959 --38034 7204 3119 --
NM_002044chr1521566 80 ----1249
NM_002051chr10------1288
NM_002063chrX11115 21080 494 1242 --
NM_002076chr1263158 2949 2824 2209 711 489 1408 12274 --
NM_002077chr962031 1668 1544 1325 298 165 11448 ----
NM_002092chr463479 3370 1974 1284 1105 378 1707 14043 --
NM_002114chr62475 108 ------
NM_002126chr1754016 1029 954 732 573 ----1507
NM_002128chr1382439 1971 816 702 660 211 203 177 ------
NM_002130chr531595 1069 352 --21708 665 --
NM_002133chr221574 ------
NM_002137chr71753 ----1675
NM_002139chrX2254 70 ------
NM_002156chr21131 --175 --
NM_002158chr283757 3673 3659 2905 2885 2447 917 817 --23850 1405 --
NM_002161chr91169 ------
NM_002203chr594099 3829 3489 2682 1623 1151 661 250 119 21376 885 ----
NM_002210chr283575 3519 3394 3196 2709 732 673 490 --11220 --
NM_002214chr7125582 5564 4948 4889 4694 4007 3898 3613 2228 1734 1390 548 25488 4391 21818 424 1255
NM_002223chr1273126 3062 1318 471 191 162 28 --21174 706 13808
NM_002230chr171398 ------
NM_002247chr1082159 2063 2051 2029 1988 1564 245 77 ----12307
NM_002252chr21327 ------
NM_002264chr3124600 3695 3198 2005 1945 1748 1610 1152 1097 1060 212 89 --33475 1205 1170 --
NM_002268chr321774 1376 ----1645
NM_002270chr585338 4332 4236 3449 1959 1878 1157 1010 15037 13465 --
NM_002285chr254024 2638 1662 1427 247 --33534 3296 2676 --
NM_002290chr621250 177 1441 21070 375 1452
NM_002293chr162797 2691 2387 1801 1764 832 12057 ----
NM_002296chr13579 262 167 21434 188 ----
NM_002310chr566337 5790 5216 4306 2032 680 12133 --16485
NM_002312chr135944 818 356 175 152 ------
NM_002317chr52159 71 ------
NM_002336chr1274834 4762 3325 1612 1559 1496 523 13175 1451 --
NM_002356chr682895 2841 2744 2454 2333 1967 1134 25 --32217 1927 760 --
NM_002374chr263126 3059 2728 2262 1003 181 1409 23172 111 --
NM_002381chr22849 334 ------
NM_002395chr62972 333 --1476 --
NM_002397chr562230 2167 1759 1376 896 254 ------
NM_002408chr142291 145 ------
NM_002430chr2252437 2096 1987 1631 321 --22236 345 --
NM_002467chr81447 --1293 --
NM_002481chr1118007 7739 7583 6317 5057 2909 2813 1442 987 764 601 --26893 4955 11793
NM_002482chr1----186 --
NM_002486chr942193 2169 764 207 --22151 374 --
NM_002489chr73342 171 134 ------
NM_002524chr12907 187 --1161 --
NM_002576chr112899 322 --1492 --
NM_002577chr353164 1030 732 596 234 --2720 108 --
NM_002581chr974876 4176 2136 1938 1491 1226 876 24117 1852 24884 1897 15282
NM_002582chr162675 297 2189 88 ----
NM_002590chr13----1469 --
NM_002595chr1221391 329 11564 --11266
NM_002600chr141741 1498 1394 708 --1354 --
NM_002645chr1183127 3017 2953 2552 2393 1180 626 188 --1384 --
NM_002655chr844454 470 425 57 34315 3962 1568 11514 1916
NM_002656chr641039 728 707 248 --3989 421 336 --
NM_002657chr2042433 965 633 258 11236 33768 3458 369 13516
NM_002661chr16197 1205 ----
NM_002662chr341643 1560 207 79 1599 --11598
NM_002663chr171521 ------
NM_002667chr62813 219 ----11170
NM_002687chr1451276 1179 1110 995 843 1861 ----
NM_002703chr491825 1525 1457 1347 657 418 252 243 173 --2498 445 --
NM_002706chr2177 148 3753 606 128 1662
NM_002709chr242627 1190 875 538 2737 121 12994 --
NM_002710chr1231112 863 335 11023 152 --
NM_002715chr541230 927 846 336 --2988 811 --
NM_002716chr1153130 3045 2466 1389 1335 ----22726 445
NM_002718chr352410 804 744 645 607 2537 170 12487 --
NM_002730chr191166 --11262 --
NM_002731chr153160 2627 1267 1073 555 23033 2424 ----
NM_002734chr1721885 615 12062 1911 11700
NM_002737chr17116626 6315 6161 5543 5289 4906 4466 1750 1301 800 681 25373 1014 16619 --
NM_002745chr2284413 4047 3757 3144 2983 969 498 232 ------
NM_002747chr1861893 1867 1196 366 183 171 ------
NM_002753chr41342 ------
NM_002816chr17------1242
NM_002834chr1243273 1393 788 575 --23547 2922 13633
NM_002838chr1--1395 2994 471 --
NM_002839chr972806 2575 2542 817 614 532 98 22294 1145 13431 1192
NM_002851chr73693 669 116 ------
NM_002869chr1152114 1855 1530 1373 439 11879 1244 --
NM_002874chr941703 1594 280 50 ----11544
NM_002892chr14------11466
NM_002893chrX----1323 --
NM_002894chr18--1197 ----
NM_002906chr1131852 1773 462 2622 396 --12244
NM_002912chr63866 814 80 ------
NM_002922chr1--1521 ----
NM_002938chr421657 1394 ------
NM_002941chr341626 1064 1018 447 --1437 --
NM_002942chr331234 417 402 ------
NM_002956chr1231003 912 330 ------
NM_002959chr164397 4275 3848 1551 721 238 24472 664 --13378
NM_002968chr162333 230 1345 1199 --
NM_002977chr263320 2526 2104 1222 809 748 12584 32862 1040 711 23462 860
NM_002998chr831370 541 356 ----22009 1413
NM_003013chr41713 ------
NM_003016chr1751993 1936 1571 1489 37 11323 ----
NM_003034chr12127486 7251 7007 6672 6583 5874 5681 5523 5403 5383 3242 1227 --27708 1205 --
NM_003045chr1321128 144 11853 ----
NM_003051chr171932 1783 422 389 321 244 39 21385 76 1170 --
NM_003071chr32836 684 --11992 --
NM_003106chr3------1758
NM_003107chr642080 1914 1644 750 --12618 --
NM_003108chr276105 5396 4958 4806 2204 1131 847 --15957 25326 1439
NM_003111chr22442 120 ------
NM_003112chr733035 1142 569 22966 1166 1259 --
NM_003113chr24658 596 202 173 1787 ----
NM_003131chr621698 771 ------
NM_003150chr1752392 964 461 128 103 --1566 --
NM_003155chr852296 2034 1034 926 874 22506 840 1810 --
NM_003161chr1762785 2733 2243 1384 1077 731 --13315 --
NM_003162chr231075 1056 947 1772 ----
NM_003178chr3----22046 221 --
NM_003185chr20--1360 2885 392 --
NM_003199chr1895621 5529 5180 4954 4550 1708 1129 827 741 --12211 --
NM_003211chr1251787 1518 1080 607 292 ------
NM_003221chr634187 3367 3342 1356 13719 1159
NM_003222chr202962 202 1984 11108 --
NM_003234chr382141 2122 1821 1754 838 620 506 198 --1173 --
NM_003257chr1541091 994 466 285 152 ----
NM_003262chr3104851 4826 4365 4017 3982 3904 3743 1724 1225 858 13784 23951 349 15161
NM_003270chrX21021 969 ------
NM_003272chr1------1271
NM_003281chr195221 5114 4952 3434 2184 1433 1425 643 630 14525 14434 --
NM_003286chr2041046 946 854 764 --1398 --
NM_003291chr132575 311 ------
NM_003292chr142162 1697 868 556 --1767 2647 356
NM_003298chr3145914 5758 5639 5623 5186 5078 4955 4756 4434 3867 2439 1475 1217 1109 --15273 --
NM_003314chr5187 ------
NM_003317chr141666 1799 ----
NM_003336chrX51108 1095 773 349 107 --11158 --
NM_003337chr531223 638 22 --2580 418 --
NM_003338chr1031434 718 669 ----11638
NM_003340chr441016 490 306 195 --125 --
NM_003341chr3--1155 ----
NM_003342chr1742077 920 235 24 ----12333
NM_003370chr191621 ------
NM_003385chr2--1398 ----
NM_003390chr113783 322 187 ------
NM_003404chr2072035 640 569 536 380 365 348 --1817 --
NM_003405chr221614 ------
NM_003406chr821493 785 11314 11425 --
NM_003409chr1821256 940 --31127 917 431 --
NM_003410chrX1353 32334 2259 344 ----
NM_003412chr362893 2706 2412 2065 979 815 --33124 2744 1246 --
NM_003413chrX41678 1513 1280 723 --1588 --
NM_003423chr1922358 1716 21807 1723 21657 994 --
NM_003439chr772727 2678 1416 1017 226 215 181 1534 ----
NM_003442chr112332 171 ------
NM_003453chr131256 --1149 --
NM_003463chr643387 3249 2072 254 21311 1074 ----
NM_003467chr21404 --2334 40 --
NM_003468chr2124255 4204 3631 3399 3250 3045 1658 1573 1475 1271 550 274 ------
NM_003474chr1012339 ----12326
NM_003478chr1162584 2526 2091 1024 969 577 23188 596 22893 2416 --
NM_003483chr1232802 2701 584 1302 2554 169 --
NM_003488chr172927 642 1998 ----
NM_003489chr2163427 2879 2837 2376 1369 918 1258 22213 1292 --
NM_003507chr241628 1541 125 99 --1501 --
NM_003559chr1792867 2826 1541 1261 1003 565 389 297 215 --11109 --
NM_003574chr1874060 3951 3682 1794 1146 808 343 25285 4353 24840 4249 --
NM_003590chr243911 3265 585 578 12963 11045 --
NM_003591chr10------1380
NM_003597chr232293 1566 155 --1255 --
NM_003601chr4229 21 ------
NM_003615chr343472 2971 909 587 11559 1700 13274
NM_003617chr175000 4637 3970 3193 1301 1108 53 173 23096 3077 1728
NM_003622chr1242472 1028 763 333 1554 --12569
NM_003663chr322844 2259 33170 417 377 11089 --
NM_003686chr11271 ------
NM_003725chr12--1291 --1346
NM_003743chr221914 1645 ------
NM_003759chr4124326 4065 3917 1556 1181 850 653 629 563 383 221 144 --14169 --
NM_003762chr161206 1145 1130 551 428 224 11172 190 --
NM_003763chr2031264 1234 537 1554 1912 --
NM_003768chr121775 109 11189 --11762
NM_003794chr32735 409 1134 ----
NM_003800chr632228 1943 955 ----12168
NM_003816chr81489 --21344 1174 1418
NM_003819chr12220 33 ------
NM_003822chr182954 2870 2693 2399 1202 482 375 159 11029 ----
NM_003828chrX1563 ------
NM_003831chr1851398 732 659 447 136 ------
NM_003850chr133538 259 46 ------
NM_003861chr1462285 2239 2102 1835 227 39 ------
NM_003872chr242894 2874 2289 637 22064 1891 197 --
NM_003873chr1062450 2020 537 269 231 108 12516 ----
NM_003878chr8----164 --
NM_003884chr321308 691 1219 11376 --
NM_003887chr262231 1796 429 372 273 74 --1604 --
NM_003895chr2172129 1969 1719 1613 1575 1404 553 --1675 --
NM_003913chr644299 771 641 171 ------
NM_003927chr1811048 ------
NM_003931chr62657 117 1650 1134 --
NM_003939chr1073314 3259 2953 2865 2778 2584 1508 --33016 566 414 --
NM_003941chr742339 1943 163 142 1975 ----
NM_003943chr411095 11082 ----
NM_003947chr331005 553 452 1476 ----
NM_003958chr663242 3138 2702 1417 1126 664 23375 2916 11486 --
NM_003971chr173520 210 134 ------
NM_003994chr1253924 3860 3173 1735 1088 22713 1444 ----
NM_004006chrX22423 2290 11783 1332 --
NM_004007chrX22423 2290 11783 1332 --
NM_004009chrX22423 2290 11783 1332 --
NM_004010chrX22423 2290 11783 1332 --
NM_004011chrX22423 2290 11783 1332 --
NM_004012chrX22423 2290 11783 1332 --
NM_004013chrX22423 2290 11783 1332 --
NM_004014chrX22423 2290 11783 1332 --
NM_004015chrX22423 2290 11783 1332 --
NM_004016chrX22337 2204 11697 1246 --
NM_004017chrX22423 2290 11783 1332 --
NM_004018chrX22337 2204 11697 1246 --
NM_004020chrX22423 2290 11783 1332 --
NM_004021chrX22337 2204 11697 1246 --
NM_004022chrX22337 2204 11697 1246 --
NM_004023chrX22337 2204 11697 1246 --
NM_004028chr1863915 3821 2889 1500 938 593 24000 1408 23698 1105 --
NM_004035chr1795144 4534 3434 2072 1905 1500 1446 1281 25 11206 14115 --
NM_004060chr541204 1177 971 294 --11080 --
NM_004064chr1221079 882 21139 1111 ----
NM_004075chr123485 425 150 ------
NM_004081chrY1317 --21707 208 --
NM_004085chrX1206 1663 ----
NM_004087chr31305 21785 661 ----
NM_004090chr1733297 2939 2357 1232 22525 361 --
NM_004103chr81834 ------
NM_004109chr1172021 1750 726 574 555 377 139 --22412 298 --
NM_004124chr1463170 2197 1240 672 483 40 --23400 2693 1273
NM_004128chr131211 ------
NM_004133chr822400 1018 11695 11898 --
NM_004136chr153811 534 31 --1329 21309 822
NM_004145chr191315 ------
NM_004156chr81397 2444 90 ----
NM_004161chr221084 189 ------
NM_004170chr941323 1208 425 285 1502 ----
NM_004171chr11209647 9585 9023 8222 7791 7124 7104 6979 6753 6248 5984 2917 2723 2535 2169 945 750 664 204 121 27050 6159 59614 7768 3684 2891 1678 --
NM_004202chrY179 1655 --1495
NM_004229chrX82196 2179 1918 1823 1411 710 603 442 11622 ----
NM_004232chr1853408 2479 502 252 102 12360 33425 2940 547 --
NM_004236chr151192 --2396 386 --
NM_004274chr1453009 2192 2056 863 403 --12750 1605
NM_004277chr631620 1510 431 ------
NM_004281chr102532 120 ------
NM_004282chr63691 93 72 ------
NM_004288chr22926 127 --1372 11006
NM_004290chr531007 70 46 --1976 --
NM_004293chr943013 2948 799 554 --11288 11265
NM_004329chr1061437 1367 1198 968 938 92 ------
NM_004331chr84380 184 94 35 --22672 861 11798
NM_004338chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_004342chr772087 1611 681 661 476 270 165 --11437 1895
NM_004370chr63357 211 176 ------
NM_004373chr12------1187
NM_004380chr1612197 --1466 --
NM_004384chr54761 394 363 191 11720 1378 --
NM_004397chr1143837 3478 2923 1639 11413 23444 991 --
NM_004430chr8156 12376 12288 --
NM_004432chr942088 1620 1545 322 ------
NM_004434chr1441613 472 292 255 11441 1350 --
NM_004438chr22645 631 --22876 2226 13231
NM_004440chr631969 1912 277 ------
NM_004457chr241666 1175 1168 341 --11091 --
NM_004458chrX32408 712 40 2268 173 ----
NM_004464chr431164 406 329 21331 1246 33529 3324 2844 --
NM_004482chr22796 193 1109 ----
NM_004492chr15----1199 --
NM_004499chr5183 ------
NM_004500chr1441762 1723 1279 789 12016 1308 --
NM_004501chr182929 1546 1474 1113 981 866 545 80 --13999 --
NM_004504chr242954 842 335 189 ----1422
NM_004521chr101375 --2117 86 --
NM_004529chr941197 527 399 264 --1273 --
NM_004586chrX85442 5393 5328 3926 3848 1227 881 526 45365 1453 1156 739 14474 13681
NM_004621chr1131287 1205 263 --1119 --
NM_004626chr11----1231 --
NM_004654chrY2504 225 ------
NM_004660chrY1319 2782 61 11501 --
NM_004687chr1761819 1553 1511 1311 375 357 11611 ----
NM_004689chr14--2382 175 ----
NM_004703chr1742517 2169 1608 25 22335 2193 ----
NM_004705chr11------1132
NM_004726chrX125789 5667 5615 5432 2057 1006 994 695 387 362 127 33 --22220 137 1313
NM_004730chr542110 1653 1556 330 1779 22128 772 --
NM_004734chr1322973 2785 13243 1630 --
NM_004736chr162062 1560 824 777 660 555 ------
NM_004738chr2021823 72 1717 ----
NM_004745chr8106866 6732 6553 5156 5091 4506 4249 2593 2126 1536 22444 836 12804 16611
NM_004748chr1554105 3454 628 586 307 --23705 3412 --
NM_004751chr15--1429 ----
NM_004760chr742497 2168 1832 100 --1129 --
NM_004774chr1722479 887 --23150 2530 --
NM_004788chr1131874 1023 514 ----12293
NM_004796chr1451975 577 428 388 122 ----12106
NM_004798chr20103529 3058 2818 2372 736 353 280 272 173 149 12991 ----
NM_004804chr272739 2371 962 356 288 106 95 12746 ----
NM_004808chr1073327 3201 2809 2511 2063 1367 122 21314 207 ----
NM_004815chr174861 4405 4373 3468 3267 1513 1454 14348 ----
NM_004824chr62192 178 ------
NM_004827chr451939 727 690 229 214 1263 ----
NM_004834chr253367 3065 2888 2744 1041 12128 33041 1129 595 --
NM_004836chr23946 721 262 ----2164 48
NM_004844chr34842 274 135 72 ------
NM_004849chr621461 563 --1459 --
NM_004857chr1494341 3903 3883 3863 3369 3135 1708 1455 659 --1339 11292
NM_004859chr1753035 1235 1149 459 104 1597 12507 --
NM_004863chr14125194 4353 3976 3961 3463 1768 1676 1289 597 547 535 302 ----13904
NM_004874chr82469 37 --1357 --
NM_004898chr472854 2300 2149 1820 1106 345 217 11890 2307 69 --
NM_004902chr201342 --1718 --
NM_004904chr7105773 4727 2345 2038 1842 1479 1259 868 827 288 ----35252 2063 1128
NM_004912chr741611 1401 338 247 --21097 654 --
NM_004926chr1451367 1289 706 246 171 21171 383 ----
NM_004938chr92336 144 11203 1993 --
NM_004947chr312337 ----11649
NM_004956chr773818 3198 2904 1337 1158 646 611 23233 202 ----
NM_004965chr21----3681 628 509 --
NM_004969chr101553 --1414 --
NM_004972chr9--1478 --1726
NM_004985chr1264438 4415 3978 3861 3553 2876 24381 1708 23719 882 --
NM_004987chr22428 163 --1302 --
NM_004992chrX168385 7814 7310 6874 6682 6669 6333 5932 5829 5593 5272 3283 2541 1993 1692 525 18522 ----
NM_004992chrX168385 7814 7310 6874 6682 6669 6333 5932 5829 5593 5272 3283 2541 1993 1692 525 18522 ----
NM_004999chr651266 1041 415 377 86 13708 --11587
NM_005023chr551185 476 159 72 42 --2574 373 --
NM_005056chr1284929 4751 4710 4673 4495 4059 1085 808 14837 ----
NM_005057chr121203 327 ------
NM_005063chr1063853 3671 2721 2576 2488 376 33464 1489 348 ----
NM_005065chr1484879 4803 4331 3814 3803 2025 1435 520 14712 14701 --
NM_005068chr621481 494 11249 --1108
NM_005077chr9179 ------
NM_005093chr2074794 4584 4378 3491 1882 1600 1590 ----15296
NM_005104chr61568 1708 ----
NM_005109chr32656 650 12208 12434 --
NM_005113chr143417 332 125 ------
NM_005121chr1753354 2431 490 252 162 23035 872 ----
NM_005126chr362086 1852 1705 1695 1506 255 ------
NM_005133chr111425 ------
NM_005151chr1861863 1623 775 678 657 65 --22425 2378 --
NM_005153chr162629 183 ------
NM_005154chr151525 ------
NM_005156chr9155346 4382 4333 4094 3900 3791 3392 1890 976 834 739 644 445 432 107 11096 31003 272 228 --
NM_005159chr1582255 2236 1439 1418 754 568 500 327 --11409 --
NM_005168chr261777 1652 1336 457 398 156 ----1354
NM_005188chr11127956 7530 7112 6805 6138 5556 5546 5531 2609 1731 889 419 26973 5418 --23118 272
NM_005190chr621157 437 ------
NM_005194chr20------1502
NM_005197chr1485837 5609 5069 4721 2334 1580 1225 1136 14323 12328 14711
NM_005207chr2233624 3323 2817 13632 ----
NM_005235chr2167538 7037 6700 6271 6030 5878 5853 5449 4746 2877 2867 2305 2138 1558 615 160 25909 2290 16342 13050
NM_005238chr1173539 3011 3002 2822 2754 2493 1277 ------
NM_005254chr1511074 ------
NM_005257chr181525 ------
NM_005259chr211376 --125 --
NM_005261chr84913 806 209 133 ----166
NM_005271chr1041225 391 76 45 ------
NM_005312chr942683 2638 2553 308 12306 ----
NM_005313chr152871 499 1419 21248 127 --
NM_005328chr82769 199 ------
NM_005339chr464139 3763 3318 1457 1263 968 1552 33515 1526 1505 12871
NM_005358chr131647 --21367 120 --
NM_005359chr18135893 5314 5212 4417 4102 2306 2244 1967 646 541 499 362 28 25968 4862 171 11831
NM_005369chrX1444 1622 ----
NM_005376chr1----1980 --
NM_005388chr941409 1391 1353 608 --21297 164 --
NM_005392chr9------11703
NM_005399chr1134265 3857 3308 3230 2981 2920 2758 1690 1530 1471 1095 752 315 --1588 --
NM_005402chr7--1554 ----
NM_005429chr4----1143 --
NM_005436chr1073858 3270 3236 3175 1426 1356 734 22767 726 --11306
NM_005439chr121192 --166 --
NM_005440chr1783352 3320 2658 2313 1198 430 286 81 --22619 380 --
NM_005443chr41130 ----1511
NM_005475chr1242821 1139 1116 485 23248 2970 ----
NM_005479chr10--11492 ----
NM_005487chr2221726 297 1498 11968 --
NM_005493chr62767 203 1170 1713 --
NM_005497chr1725051 1929 11994 --1762
NM_005502chr922074 1267 2991 200 13226 --
NM_005504chr1276001 4640 4058 2599 2502 2390 2045 25116 213 65503 5085 4630 1679 1213 198 --
NM_005506chr441863 683 358 46 22739 909 ----
NM_005509chr551834 1683 1611 409 248 21322 1173 21587 708 --
NM_005570chr1831091 417 116 1805 ----
NM_005573chr53704 228 43 1538 ----
NM_005578chr385131 4655 4240 3850 3284 1142 282 118 --14701 --
NM_005591chr1182677 2511 2315 1043 1028 332 172 106 --1522 --
NM_005596chr974044 2199 1781 1343 689 626 352 --15044 --
NM_005599chr11961 --31513 1342 411 --
NM_005603chr1811781 --21513 125 --
NM_005610chr13870 676 233 --1765 --
NM_005611chr1611206 --21146 915 --
NM_005613chr131910 723 611 1110 ----
NM_005625chr82681 192 1951 1991 --
NM_005629chrX21067 868 ------
NM_005648chr8168 ------
NM_005655chr8132 --1880 --
NM_005665chr164546 4105 3198 1233 968 724 33029 1657 1630 14904 21937 1412
NM_005715chr62512 304 32847 1104 313 22614 2373 1321
NM_005721chr241007 974 826 448 --149 --
NM_005731chr2164 --2347 147 --
NM_005734chr11----2518 181 --
NM_005746chr742021 595 361 298 ----11744
NM_005748chr1243042 3004 1100 971 1863 --12239
NM_005759chr284311 3587 3503 1831 1249 414 270 235 14796 24125 1328 --
NM_005779chr5113249 3178 3160 3054 2976 2231 1465 1314 227 89 39 11259 13306 1295
NM_005813chr262633 2530 1842 628 242 64 31787 1005 232 22300 2291 --
NM_005826chr1----1527 1467
NM_005832chr321370 193 --2575 224 --
NM_005840chrX127548 7145 6770 6175 5456 2345 2337 2298 1931 1092 929 144 11179 27542 996 14637
NM_005843chr261732 1713 1698 1285 534 295 ------
NM_005859chr521525 1375 11164 ----
NM_005862chr341005 948 381 213 ------
NM_005871chr1061080 868 758 333 180 164 1304 ----
NM_005895chr1284107 3500 3086 1215 776 530 487 204 ------
NM_005898chr1162930 2502 2085 1280 925 397 --1301 --
NM_005899chr1781574 1518 1358 1287 394 274 96 24 ------
NM_005901chr18208261 8185 7937 7552 7204 7059 6706 6618 6472 6183 5534 5374 3198 3170 1533 1119 765 612 596 438 35756 5524 1034 12954 1915
NM_005902chr1574514 4456 4053 3716 3411 3376 786 12934 14467 11518
NM_005903chr585190 4558 4056 3951 3872 3819 839 696 --1881 11863
NM_005909chr584151 3319 2853 2689 2672 2622 1568 857 12944 23655 3163 --
NM_005911chr23959 940 502 --1407 --
NM_005923chr62573 226 2561 267 1438 --
NM_005930chr146908 774 620 354 264 203 ------
NM_005935chr421890 506 14493 24818 1521 11330
NM_005941chr873667 3052 2834 1614 1011 125 49 --34134 4083 856 11304
NM_005962chr103910 665 459 ----11541
NM_005962chr103910 665 459 ----11541
NM_005966chr231973 118 81 21884 722 11492 --
NM_005977chr133805 783 414 1707 1237 --
NM_005987chr1----1305 --
NM_005999chr12247 84 ----1305
NM_006002chr13195 ------
NM_006007chr984061 3875 3567 3372 1623 1431 1155 968 14002 43210 2830 663 361 13392
NM_006016chr632074 1551 747 --1289 --
NM_006024chr72205 195 --1620 --
NM_006036chr242297 1816 1624 914 1204 31854 458 90 --
NM_006037chr233116 2972 1878 14617 --14507
NM_006038chr2021484 247 11955 ----
NM_006054chr11--1412 --1562
NM_006064chrX5401 345 272 161 137 1154 ----
NM_006079chr64345 327 256 209 ------
NM_006080chr742509 2357 167 54 --22374 2347 11857
NM_006090chr12629 102 --1117 --
NM_006095chr463583 3534 3275 1742 1216 360 --23341 251 --
NM_006100chr32609 133 1171 ----
NM_006106chr1132607 800 187 --42920 2794 2655 589 --
NM_006135chr151203 1124 974 533 130 --21090 948 --
NM_006139chr232136 428 77 --21917 1828 12057
NM_006141chr1641864 210 40 32 22670 627 12599 --
NM_006154chr1541900 1050 383 48 12674 12667 --
NM_006166chr1231926 1720 1602 12630 --1481
NM_006178chr17--11530 ----
NM_006203chr5135613 5546 5368 4728 4499 3474 1997 1207 1183 686 548 166 130 ------
NM_006206chr452860 2735 2064 1802 366 1650 11035 --
NM_006207chr82275 192 ------
NM_006212chr1105439 5375 4006 1946 1560 1407 1218 1174 138 98 25089 4924 ----
NM_006237chr1342231 1684 1547 185 --1531 --
NM_006246chr1431027 229 30 --1480 --
NM_006251chr553263 3084 2671 432 98 --1479 --
NM_006252chr1106578 6528 5917 5437 5282 4886 2914 2766 1833 600 --35549 2717 1109 26619 1655
NM_006256chr132453 2419 2360 --1922 --
NM_006265chr821142 617 --21537 590 --
NM_006267chr251513 559 430 263 168 ------
NM_006275chr2052145 1543 1007 915 246 --1215 --
NM_006282chr2064524 4073 4014 3568 3263 1874 --34065 2984 1356 --
NM_006306chrX125023 4724 4330 4052 3865 2115 1305 1204 1029 890 871 285 ----24644 4269
NM_006310chr17------1342
NM_006313chr1241635 1063 144 114 ----1411
NM_006315chr423648 1264 --23406 126 --
NM_006323chr4----154 139
NM_006348chr71281 ----1790
NM_006352chr131455 403 121 ----22022 1618
NM_006364chr14------1254
NM_006379chr732038 614 589 2652 226 1783 11458
NM_006380chr17104351 3926 3720 3640 3295 3064 3004 1293 1220 992 14403 24275 2896 --
NM_006393chr1054447 4356 3720 1506 52 22943 1030 2697 159 13841
NM_006409chr7--1268 ----
NM_006416chr62554 529 ------
NM_006420chr2021133 757 13289 --13151
NM_006451chr52982 673 ----1183
NM_006457chr444094 2910 2841 317 13423 13158 13715
NM_006459chr1041965 1738 1322 1268 ------
NM_006464chr274094 3058 2938 1077 661 337 152 14551 11300 11443
NM_006469chr141374 1240 513 415 11058 1537 --
NM_006475chr133585 269 192 --150 --
NM_006496chr172015 2008 1751 1704 1274 723 255 --1390 12000
NM_006504chr102971 309 22766 1141 ----
NM_006520chrX21345 545 135 --11103
NM_006521chrX11425 ------
NM_006526chr2021588 189 ----21664 1628
NM_006538chr294156 4032 3883 3749 3516 2849 1558 555 428 1458 1376 --
NM_006544chr1485321 5261 4941 4462 4241 2412 2343 2292 21424 1340 25493 448 --
NM_006561chr1093851 2322 2300 2004 1238 213 193 176 147 --15223 11397
NM_006565chr161813 ------
NM_006572chr1793168 2660 1255 855 529 457 446 268 120 --22803 2716 --
NM_006575chr144988 513 483 319 ------
NM_006590chr21382 1289 ----
NM_006595chr1121696 1348 --11600 1202
NM_006599chr16117958 7523 7490 7177 7139 6453 5921 1286 924 701 446 46901 6072 962 952 48199 6468 2204 1559 --
NM_006603chrX31877 1805 673 11334 1385 --
NM_006614chr342854 2727 2557 1470 --22771 2372 --
NM_006620chr6114513 4420 4134 4098 3814 3427 1427 1384 1036 160 49 2434 401 1827 --
NM_006624chr1061679 1584 1458 675 437 296 --1615 --
NM_006625chr131019 998 904 --11202 --
NM_006625chr131019 998 904 --11202 --
NM_006625chr131019 998 904 --11202 --
NM_006626chr961807 1753 1696 588 467 131 12064 11824 --
NM_006628chr1554401 3925 3662 1300 253 24301 584 22968 368 12983
NM_006636chr22843 762 1236 ----
NM_006654chr1254705 4081 1674 1615 1541 13216 14218 --
NM_006667chrX1159 ------
NM_006670chr61485 --2575 560 --
NM_006675chr123587 506 95 ------
NM_006699chr152690 1966 1734 731 588 ----11035
NM_006700chr121777 ------
NM_006718chr641039 728 707 248 --3989 421 336 --
NM_006722chr363043 2364 1912 676 618 132 12260 13062 166
NM_006729chrX85305 5292 4175 4023 3737 1291 264 187 --11339 24914 2085
NM_006731chr9155849 5815 5646 4640 4302 4234 3570 2191 2024 1765 1636 741 547 412 53 11580 1908 --
NM_006738chr1554308 4132 3693 3148 1504 21871 1598 13363 --
NM_006750chr16118095 7684 6244 5619 2896 2758 903 398 338 142 128 28055 4930 16086 --
NM_006756chr81304 1135 11485 --
NM_006761chr171780 ------
NM_006766chr842517 2261 1703 889 --12252 --
NM_006773chr221597 1123 1392 131 11525
NM_006775chr653117 2884 2714 2064 1914 --144 --
NM_006777chrX42601 561 508 314 12785 ----
NM_006805chr531648 1328 1273 21667 1635 21604 419 --
NM_006814chr2042244 919 813 784 1803 31847 1678 138 --
NM_006826chr21299 --1389 --
NM_006827chr1462712 2296 2135 887 587 464 12830 ----
NM_006832chr1431044 997 49 2343 173 ----
NM_006851chr1251961 1075 931 603 318 22841 234 --11970
NM_006857chr22648 77 1155 ----
NM_006908chr7--1952 ----
NM_006915chrX32341 1938 587 --1796 --
NM_006922chr242473 2273 342 153 1778 21676 967 --
NM_006924chr17104350 3878 3610 3501 3417 2875 1326 1124 783 532 ----1959
NM_006931chr1252029 1948 821 517 462 ------
NM_006937chr17----1471 --
NM_006939chr141911 ----1794
NM_006981chr962952 2741 2233 2209 1876 333 --12390 12551
NM_007005chr91144 --11593 --
NM_007007chr1264304 4171 3412 3406 583 166 --14298 --
NM_007011chr1574310 2178 1744 1247 809 104 93 --22346 2106 11353
NM_007034chr11342 ----1847
NM_007038chr2185941 5586 4103 4028 1999 345 194 33 14774 35427 3997 1370 35534 4314 1924
NM_007039chr141192 --1480 --
NM_007064chr3------1439
NM_007078chr1042993 2921 2833 2451 ------
NM_007107chr342172 1655 361 309 1606 1277 --
NM_007118chr5286 54 --1276 --
NM_007124chr6101989 1878 1593 1431 699 653 519 427 355 195 1810 ----
NM_007129chr132911 298 ----1182
NM_007145chr192109 74 11420 ----
NM_007146chr1762707 2651 644 619 409 57 1184 12026 --
NM_007156chrX136 1204 ----
NM_007157chrX--2486 204 11010 --
NM_007159chr321633 381 --11769 --
NM_007166chr113485 474 288 1297 ----
NM_007170chr11847 2617 587 1880 --
NM_007172chr222999 582 --13275 1114
NM_007175chr8153384 3273 3169 2895 2612 2576 2563 2332 1398 1371 1321 1048 502 255 248 ------
NM_007187chr13--11015 ----
NM_007200chr1554308 4132 3693 3148 1504 21871 1598 13363 --
NM_007203chr953131 2984 2905 2556 984 23694 1487 ----
NM_007207chr1----1172 --
NM_007208chr32320 67 ------
NM_007212chr152142 1743 1676 1560 874 ----143
NM_007217chr31324 ------
NM_007245chr164970 859 850 319 --1812 --
NM_007246chr451066 1040 1024 789 251 ------
NM_007249chr13126937 6605 6313 6274 5867 3656 2913 2743 1798 1254 1143 169 --33308 1898 1039 --
NM_007271chr631862 1569 1363 --31652 572 277 --
NM_007282chr32951 250 ----199
NM_007292chr1795144 4534 3434 2072 1905 1500 1446 1281 25 11206 14115 --
NM_007325chrX11985 --2724 132 --
NM_007372chr171750 ------
NM_007373chr1031209 235 148 1443 ----
NM_007374chr14----1368 --
NM_007375chr142566 1037 890 532 ------
NM_012062chr121617 1266 2336 324 1802
NM_012069chrX62458 2049 1986 324 313 270 ----1422
NM_012081chr553768 3564 3473 3011 2634 11054 11493 --
NM_012084chrX5470 380 76 45 30 ------
NM_012089chr121472 200 --1491 --
NM_012095chr1053417 2925 2217 2201 1309 1929 1314 --
NM_012098chr931247 617 21 11028 --11063
NM_012104chr1153536 3396 2757 2710 1142 ------
NM_012104chr1153536 3396 2757 2710 1142 ------
NM_012120chr692947 2842 2753 2656 1038 827 658 400 364 12783 12204 --
NM_012141chr1384178 4000 3484 3040 2870 948 550 161 --32647 1431 683 13247
NM_012153chr114590 518 315 46 12088 22020 580 --
NM_012207chr102849 417 ------
NM_012214chr295327 5172 3911 2104 1719 898 771 657 201 24390 846 44880 4855 3937 2049 --
NM_012223chr231050 516 171 ------
NM_012224chr42784 322 --1989 --
NM_012234chr393300 3205 2724 2302 1475 1375 936 781 472 --23189 761 --
NM_012238chr1061211 1144 541 262 199 162 1402 ----
NM_012243chr13750 355 60 ------
NM_012249chr232438 1282 645 22884 578 ----
NM_012250chr1161218 1090 459 354 118 92 ------
NM_012257chr72755 408 --1810 --
NM_012262chr185180 4524 4389 3671 1501 1266 1083 440 14802 33329 1156 232 --
NM_012268chr19----1303 --
NM_012281chr742042 871 715 192 --11517 --
NM_012287chr374383 4245 4127 2796 2766 1485 1461 23586 500 ----
NM_012294chr794030 3789 3675 2701 1122 1081 732 347 114 --13000 --
NM_012300chr542506 2298 2235 797 ------
NM_012301chr722174 1755 --21998 1528 --
NM_012309chr1134565 4336 3611 --11852 --
NM_012316chr184004 3631 1697 1599 1545 1010 533 138 15295 ----
NM_012329chr1731613 1252 99 --11372 --
NM_012333chr131633 1412 527 --4599 499 172 72 --
NM_012334chr574699 4604 1215 1045 883 423 304 --11231 --
NM_012347chr682778 2528 2446 2399 2374 2259 828 600 12240 ----
NM_012405chr162874 2590 676 473 335 22 --11069 --
NM_012419chr6------1457
NM_012448chr173516 478 133 ----12330
NM_012464chr482706 2225 2023 2000 1946 1903 1135 594 1958 ----
NM_012479chr732541 2506 1698 32281 456 283 1104 --
NM_013229chr1282054 1985 1879 1764 1749 933 799 189 --11954 --
NM_013257chr841998 1742 755 92 31713 1701 260 1563 --
NM_013262chr621045 313 --31189 954 517 --
NM_013263chr16--154 ----
NM_013282chr19--191 ----
NM_013309chr1562165 2110 986 896 656 289 --1415 --
NM_013316chr71906 1359 21002 332 --
NM_013322chr741672 1175 664 548 --11185 --
NM_013341chr252155 1990 1073 790 288 12594 12627 --
NM_013372chr1572304 2291 2211 1107 831 527 449 --23382 1338 --
NM_013374chr332003 1115 435 1962 1856 --
NM_013381chr1252389 2134 2128 1893 546 --12412 --
NM_013396chr213220 119 101 ------
NM_013417chr91169 ------
NM_013423chrX41119 942 523 364 ----1303
NM_013427chrX41119 942 523 364 ----1303
NM_013436chr21636 ------
NM_013437chr82134 65 1409 ----
NM_013448chr141645 --2740 475 --
NM_013937chr661097 1020 472 447 162 82 --11153 --
NM_013989chr1484863 4714 3748 3185 1734 1118 643 193 23247 1484 13729 13417
NM_013995chrX72119 1956 1898 878 682 669 514 1484 1990 --
NM_014011chr242572 1817 971 555 1702 1406 --
NM_014021chr153323 2271 2150 706 372 ----198
NM_014028chr642984 2865 2592 1144 12858 13335 --
NM_014048chr1684612 4603 3810 3672 2091 1806 939 929 --34100 2126 143 --
NM_014055chr122350 56 ------
NM_014112chr883858 3475 1258 1232 988 891 872 282 35238 1437 558 14654 13731
NM_014154chr32651 157 11278 ----
NM_014155chr11157386 7373 7163 6993 6708 6357 5308 4996 2526 2213 1412 939 613 263 234 16253 ----
NM_014157chr1653184 3045 2462 525 273 22589 1497 --140
NM_014160chr321407 130 21062 192 11016 --
NM_014181chr232449 2274 1909 12243 11090 11041
NM_014220chr31814 ------
NM_014241chr10138 --1124 --
NM_014250chr2221726 297 1498 11968 --
NM_014263chr1031266 945 344 1421 31231 1121 480 --
NM_014264chr41233 1124 140 1578
NM_014268chr1841368 1174 948 453 ------
NM_014283chr111242 1963 2439 410 11217
NM_014289chrX21410 410 21343 1195 --1182
NM_014294chr821140 930 11356 ----
NM_014296chr331626 1538 507 11229 ----
NM_014314chr961552 465 453 244 76 41 1355 11243 --
NM_014319chr1261946 1911 1699 1633 454 318 11267 11291 1672
NM_014325chr1211916 ----1827
NM_014331chr4117789 7081 6823 6079 5727 5279 5057 2900 2091 1505 178 --27108 5991 21966 836
NM_014333chr1132304 2105 1894 --12057 --
NM_014342chr1141209 502 111 102 ----1174
NM_014363chr132927 276 ------
NM_014368chr921713 1358 ------
NM_014372chr1----2603 367 --
NM_014376chr532306 2073 1845 --12352 12046
NM_014395chr422001 1719 --21904 780 --
NM_014423chr5114969 4618 4523 4373 3937 3734 1947 1244 530 285 148 11988 14557 --
NM_014445chr372156 2082 1508 666 596 370 46 ------
NM_014447chr41353 --1203 --
NM_014452chr63953 410 209 1357 ----
NM_014454chr61980 ------
NM_014458chr1155 --21411 1265 --
NM_014491chr741040 898 54 46 --1952 --
NM_014495chr12270 41 --2163 70 --
NM_014521chr231835 1480 652 --21629 1255 --
NM_014572chr1331243 1216 315 ------
NM_014574chr1421159 613 1537 ----
NM_014577chr222768 737 179 1730 --
NM_014587chr1611547 ------
NM_014600chr221385 1261 1569 --11574
NM_014606chr431575 425 391 ------
NM_014607chr272138 1897 488 441 385 183 28 12076 --11700
NM_014613chr532869 2573 542 11162 1520 --
NM_014615chr1663392 3333 3299 2943 2884 285 13365 ----
NM_014616chr353294 2359 1320 843 519 22440 1135 23261 1108 --
NM_014636chr974211 3897 3159 1172 608 596 356 --13969 11383
NM_014670chr261531 1490 1470 1334 552 498 ------
NM_014671chr711067 ----1211
NM_014673chr8--166 1285 --
NM_014674chr323894 715 ------
NM_014677chr821181 273 ------
NM_014689chr22517 57 ------
NM_014699chr16--1334 ----
NM_014701chr1583301 2143 1079 1014 988 804 798 638 --22351 2245 --
NM_014705chr742161 1793 1461 299 ----195
NM_014707chr721663 1402 11414 12149 --
NM_014711chr1621531 497 11406 1443 --
NM_014717chr191257 ----1854
NM_014720chr1041623 1617 1430 371 ------
NM_014721chr6107376 6918 6792 6417 5563 1923 1736 1393 521 111 16044 ----
NM_014730chr12105130 4932 4347 3441 1954 1808 1413 1049 841 790 ------
NM_014730chr12105130 4932 4347 3441 1954 1808 1413 1049 841 790 ------
NM_014733chr541649 866 564 364 --12292 1502
NM_014735chrX52045 1800 670 635 22 1558 ----
NM_014739chr694152 4042 3874 3691 3221 3089 2845 1626 1088 ------
NM_014746chr264097 3340 3025 2901 2869 656 13817 ----
NM_014751chr872087 1522 1503 657 631 281 234 --21913 182 --
NM_014752chr1131780 1412 364 ----11553
NM_014755chr254034 3802 3488 180 54 14221 34118 1132 418 --
NM_014764chr1231252 397 85 ------
NM_014765chr142416 929 822 488 1679 ----
NM_014774chr132863 2095 130 23106 2412 ----
NM_014797chr692430 1208 1197 1149 1110 1034 656 545 241 12509 1957 --
NM_014802chr122920 165 ------
NM_014810chr133617 2595 601 23372 1428 23521 3125 --
NM_014812chr141740 1395 347 191 1329 1577 --
NM_014819chr562455 1523 920 755 286 141 12234 1476 --
NM_014822chr4----4690 490 117 46 --
NM_014824chr1131898 1577 1471 11362 ----
NM_014828chr1452441 2386 2370 2117 189 --22110 796 1713
NM_014832chr1321673 503 ------
NM_014839chr131976 717 130 1889 ----
NM_014841chr6----2378 124 --
NM_014848chr1562853 2395 1927 859 333 233 --1714 --
NM_014850chr384920 4400 4064 3968 3308 3265 3138 634 23116 1051 ----
NM_014860chr22442 378 1340 ----
NM_014872chr962259 2225 1854 1833 418 130 11565 ----
NM_014873chr184798 4662 3801 3561 3262 3055 1906 1429 14505 43314 1264 770 190 13533
NM_014877chr17137567 7313 7114 6132 5878 3045 2464 1499 1334 1201 892 824 599 17628 16899 27451 2768
NM_014897chr1742912 2690 1126 696 --1730 --
NM_014899chr573157 3013 2375 2262 1097 650 406 12270 23118 2193 12608
NM_014904chr10124011 3889 3623 3564 3006 2896 2778 1334 1006 816 282 173 --23934 2511 --
NM_014906chr1743857 3718 2543 2508 21633 780 1708 --
NM_014912chr1073466 3136 2829 2360 2302 1279 532 12387 --22927 1084
NM_014920chr663659 3611 3532 3321 2603 1406 --13583 --
NM_014923chr1331995 1801 1688 --31710 1642 345 --
NM_014932chr311933 --11729 --
NM_014934chr1353781 3244 3168 2870 1041 --43674 3145 1011 578 --
NM_014939chr1831421 82 35 --1540 --
NM_014942chr662634 1831 961 914 259 243 --12473 1794
NM_014943chr821223 1071 --11276 --
NM_014946chr252597 2191 814 759 290 ------
NM_014947chr122730 537 ----1162
NM_014950chr1431426 675 381 --21238 54 --
NM_014961chr441949 1365 575 492 22144 692 ----
NM_014974chr101705 ------
NM_014982chr1411211 --34606 3579 1248 23305 2075
NM_014988chr442737 2548 1990 812 --22371 2219 --
NM_014991chr473012 2336 2315 1123 947 890 681 ------
NM_014994chr15----12294 --
NM_014999chr1221036 462 ----1664
NM_015000chr1273124 1012 865 443 387 220 25 --1713 --
NM_015008chr353330 2859 2604 595 434 --12720 --
NM_015009chr31541 --1324 --
NM_015020chr1663552 2647 1303 1032 529 335 22695 2683 12432 --
NM_015024chr8------11201
NM_015025chr232422 1982 1770 167 12354 12465
NM_015026chr1283799 3358 2952 1825 1797 1494 990 463 21291 1225 ----
NM_015032chr1342913 1816 561 401 22633 823 12773 --
NM_015035chr2076490 5218 4650 2113 930 664 600 31282 861 835 2778 434 --
NM_015039chr164078 3630 3321 3030 1279 894 --24222 3100 --
NM_015040chr283374 3258 2293 2229 1231 1095 957 669 12689 12153 --
NM_015051chr943362 923 308 180 1557 12558 --
NM_015062chr101205 ------
NM_015068chr7103914 3760 3601 3478 2533 1521 1483 1458 1274 844 ------
NM_015071chr546339 954 710 238 16042 14621 14855
NM_015076chr684466 3919 1049 1015 1003 768 485 278 ------
NM_015087chr133930 389 128 21989 582 ----
NM_015092chr1643657 3489 3174 1045 1691 --12882
NM_015093chr631609 1404 212 --1721 --
NM_015097chr341936 1700 301 183 --22155 1884 --
NM_015115chr453166 1174 904 763 463 13062 32314 2286 510 --
NM_015130chr441368 1214 963 303 ----1296
NM_015138chr1562425 1804 860 789 434 79 11840 ----
NM_015141chr3102710 2603 2373 932 902 603 557 518 464 102 ------
NM_015144chr1663835 2687 1563 585 475 95 --1867 --
NM_015156chr1443921 3372 2682 2532 13022 1538 11228
NM_015161chr1631155 1144 1122 ------
NM_015163chr141394 1295 ----
NM_015170chr852125 1552 832 327 314 ------
NM_015192chr2052646 2129 1961 1092 809 1113 12201 --
NM_015199chr362205 2046 1183 1048 449 301 12804 12903 --
NM_015205chr1325168 4634 13254 21687 1458 --
NM_015206chr1583894 3789 3444 3003 2986 2965 2718 2399 --11233 13116
NM_015208chr1853743 3163 2748 746 331 --11116 1519
NM_015215chr162839 2462 2239 876 864 590 22650 2324 22787 2487 --
NM_015216chr511263 11322 --11193
NM_015225chr983016 2899 2536 2402 2279 2231 889 560 --13159 --
NM_015239chr91120 ------
NM_015245chr652745 2682 2655 2607 2540 --22084 415 --
NM_015254chr853187 1087 966 394 147 1378 ----
NM_015256chr52516 499 ------
NM_015263chr1551125 994 421 293 126 ------
NM_015271chr443841 3591 3330 452 1422 ----
NM_015272chr1641980 812 511 199 ----197
NM_015275chr1251600 1452 652 622 546 1314 ----
NM_015278chr643051 2917 1373 646 23008 2105 --13244
NM_015291chr132943 1332 866 21196 162 1859 13415
NM_015299chr1453957 3419 2753 558 218 --13800 --
NM_015310chr8177721 7700 6930 6605 6203 6042 5703 5083 3221 3158 2605 1942 1568 1429 1296 1203 769 13325 --11999
NM_015313chr1164816 4693 4230 3743 1194 192 --14364 --
NM_015317chr222781 787 ------
NM_015328chr733117 2828 1217 11970 22184 1999 --
NM_015335chr1242535 2204 1819 84 --1445 --
NM_015336chr1252570 2237 2208 1872 646 ----11049
NM_015347chr1242441 1179 517 237 --12168 --
NM_015350chr14520 502 433 79 1533 ----
NM_015355chr172801 758 ------
NM_015359chr872882 2683 1951 1855 1178 816 191 22921 1988 22135 380 --
NM_015361chr23726 350 260 ------
NM_015365chrX74105 4048 3842 3519 2961 2752 1040 --11482 11411
NM_015382chr143793 744 535 ------
NM_015387chr231976 727 456 --12014 --
NM_015397chr931614 1488 36 ------
NM_015409chr1272778 2638 2606 2196 2176 1947 580 22289 1975 ----
NM_015416chr122681 607 ----1925
NM_015419chrX1408 --1936 --
NM_015429chr3--1430 ----
NM_015435chr821211 312 1955 2998 988 --
NM_015436chr442977 2217 1271 508 12282 12530 --
NM_015449chr1----1629 1507
NM_015455chr553742 3419 1482 859 446 12876 --12583
NM_015457chr1131050 869 793 --1765 --
NM_015458chr8155150 4849 4330 3488 3401 3325 1926 1343 1310 1269 1003 842 513 365 92 --14261 21069 266
NM_015472chr31492 1175 135 --
NM_015472chr31492 1175 135 --
NM_015477chr154851 778 335 134 --2240 24 --
NM_015508chr331492 577 180 --11470 --
NM_015523chr111100 ------
NM_015525chr62872 198 --2343 327 1263
NM_015535chr273883 2845 1584 1568 1104 376 151 --12937 13632
NM_015550chr763315 2519 2436 1209 966 949 ------
NM_015553chr6114818 4749 4337 4246 3845 3465 1976 1906 1896 1529 152 ------
NM_015564chr562951 2924 2522 2446 2240 1306 141 ----
NM_015565chr2151769 1433 651 172 149 ------
NM_015569chr174375 1235 1042 945 200 117 64 11479 11874 --
NM_015571chr652440 2410 1039 828 636 ------
NM_015578chr1942017 1815 1366 591 ------
NM_015601chr101364 --1639 --
NM_015602chr13649 404 298 1350 11339 --
NM_015605chr103568 532 446 --31464 453 253 --
NM_015640chr1125299 5025 4941 4402 4338 3773 3336 2127 2104 1592 1004 707 23616 535 24447 2009 --
NM_015693chr4--1238 ----
NM_015695chr631763 1355 698 ----11541
NM_015696chr11498 --1448 --
NM_015723chr73675 234 92 ------
NM_015878chr862168 2096 1967 1733 668 528 21372 520 ----
NM_015879chr18148342 7466 6704 3453 3227 2939 2762 2592 2322 1584 1050 909 623 359 15776 164 --
NM_015885chr111819 ------
NM_015886chr8115547 5022 4986 4974 4758 4139 3781 1358 329 207 107 25236 4383 ----
NM_015888chr172233 1330 1227 1141 644 395 367 22805 331 11316 --
NM_015891chr631695 560 491 --31854 1391 86 11573
NM_015906chr134619 3657 692 1827 ----
NM_015946chr5--1656 2714 195 --
NM_015948chr6159 ------
NM_015954chr122604 232 ------
NM_015975chrX61696 1678 1383 1167 727 530 ------
NM_015986chr171530 1104 21380 555 --
NM_015999chr11570 --156 --
NM_016009chr174791 4629 4260 3860 1977 1339 388 23215 1387 ----
NM_016018chr811836 12107 1935 --
NM_016038chr7------1555
NM_016040chr172211 2102 1915 860 569 266 251 --12051 --
NM_016060chr173797 452 241 ----11128
NM_016072chr121642 --42255 1987 1945 954 1133
NM_016075chr1342611 2153 275 253 ------
NM_016076chr152883 2838 2611 875 371 --12355 12194
NM_016083chr683751 1312 1225 905 802 647 336 97 13905 1587 --
NM_016096chr851860 748 665 354 284 --1627 --
NM_016103chr5----2472 74 --
NM_016107chr5----1854 --
NM_016131chr232108 1877 881 --22208 1701 1420
NM_016132chr1553100 2314 1225 866 172 --1940 --
NM_016142chr1141316 1247 89 24 --11039 --
NM_016205chr42959 91 11112 ----
NM_016206chr398878 8205 8169 7614 6141 3495 3355 2173 1381 --48955 8859 7341 798 --
NM_016217chr6103342 3060 2603 2553 1345 975 938 526 366 181 22252 658 1772 --
NM_016220chr732290 502 174 12211 11920 --
NM_016224chr641868 1564 763 473 11373 12224 --
NM_016227chr111242 1963 2439 410 11217
NM_016230chr62207 158 ----1470
NM_016231chr1721457 176 ------
NM_016248chr1343161 740 419 184 11425 ----
NM_016260chr2166474 6059 5849 5731 5550 5129 4834 4607 2944 1745 1703 1311 1207 1078 521 425 16301 25769 4725 --
NM_016271chr1831503 467 84 --11772 1402
NM_016275chr331893 875 308 ----12014
NM_016277chr611408 11399 21460 1207 --
NM_016282chr921700 1596 1295 ----
NM_016287chr151989 1350 511 484 222 11936 ----
NM_016303chrX----2323 97 --
NM_016308chr15519 199 97 88 65 --12065 1679
NM_016315chr221792 1242 --1380 --
NM_016316chr2----1740 --
NM_016322chr963232 1001 549 471 416 32 22694 2064 --21218 772
NM_016340chr521067 937 ----1442
NM_016351chr71546 ------
NM_016357chr122287 123 --1201 --
NM_016376chr1763520 3200 3115 3061 2894 1437 ------
NM_016396chr1563022 2919 2705 1097 495 306 --1478 12179
NM_016422chr1152643 2545 2397 1105 885 --22972 573 --
NM_016427chr182404 105 ------
NM_016441chr251883 1655 1631 497 196 ----11871
NM_016447chr71215 --1229 --
NM_016448chr151589 1530 1205 168 99 --21499 488 --
NM_016472chr1421472 1445 1518 ----
NM_016485chr652073 1389 552 418 403 --11632 --
NM_016499chr111540 ------
NM_016505chr12594 110 --194 --
NM_016513chr663659 3611 3532 3321 2603 1406 --13583 --
NM_016530chr1584026 3930 3172 1432 1390 1044 975 309 1678 1709 12788
NM_016531chr464240 3591 2599 1579 1244 312 --13396 --
NM_016542chrX21718 1546 --1202 --
NM_016544chr273882 3198 2956 2493 2429 447 67 12807 1179 --
NM_016545chr12916 216 ------
NM_016548chr921164 629 --1325 --
NM_016557chr32941 851 ------
NM_016559chr35968 523 478 124 28 --11108 --
NM_016577chr354463 3169 2986 1607 1536 ----11372
NM_016586chr142474 152 154 ----
NM_016599chr431555 1358 200 ----11080
NM_016607chrX------1408
NM_016613chr462729 2272 2126 2067 1917 1109 11865 22750 2415 --
NM_016622chr21595 --32140 628 589 12063
NM_016625chr3176 ------
NM_016626chr1841798 1407 513 293 11692 ----
NM_016628chr101318 --1675 1726
NM_016639chr161553 ------
NM_016654chr1511074 ------
NM_016656chrX5401 345 272 161 137 1154 ----
NM_016824chr1061695 1596 1434 1311 579 375 --11720 --
NM_017423chr411696 --21834 408 21563 26
NM_017440chr123418 245 175 ------
NM_017447chr2154210 3658 3495 1254 748 13745 1663 --
NM_017495chr2021422 459 1188 ----
NM_017548chr34681 529 519 123 --22047 745 --
NM_017554chr322157 1855 --1197 --
NM_017594chr931224 913 805 1373 1821 --
NM_017599chr1261787 1555 1438 1351 403 145 --11572 --
NM_017610chr1531881 1858 402 21821 1299 --21518 1349
NM_017612chr121524 --3607 224 36 --
NM_017628chr495099 4784 3845 3503 1847 1552 1246 773 134 --33882 1989 1365 --
NM_017634chr821620 281 ----41953 1727 1609 720
NM_017637chr9169344 8417 8205 7928 6751 6715 6574 5778 2968 2865 2418 2001 1045 854 584 537 ------
NM_017643chr17102918 2528 2450 2391 1909 1250 1134 880 299 59 12136 13084 --
NM_017644chr394461 4175 4062 3215 1508 1067 980 803 735 --34987 3430 3262 14408
NM_017650chr785587 4613 4391 2084 800 461 195 146 1268 34908 4743 2283 --
NM_017655chr131504 1289 1155 --11222 1210
NM_017658chr14103939 3469 3180 3152 2845 1726 958 369 198 108 11424 23868 3860 14223
NM_017673chr1------1875
NM_017693chr1321401 1368 11508 2235 128 --
NM_017694chr251697 1628 1540 499 201 --1827 --
NM_017709chr1124228 3972 3622 3385 3374 3232 2916 2825 1375 1175 1150 715 12736 34166 697 449 1241
NM_017737chr11148 1709 21557 612 --
NM_017752chrX3727 673 551 ------
NM_017754chr654618 3743 3136 933 714 43933 1783 1277 1243 44883 4424 1722 463 --
NM_017762chr1572364 2276 1916 979 765 574 233 171 194 --
NM_017768chr14632 296 239 153 ------
NM_017769chr14103030 2310 2202 1205 927 647 568 152 71 51 1113 ----
NM_017770chr642424 2404 453 162 2425 35 12325 12495
NM_017778chr821414 1094 1258 --11057
NM_017789chr2--1812 ----
NM_017799chr1421825 320 ------
NM_017813chr865543 2237 1474 1101 792 49 33868 3849 1081 25344 402 14051
NM_017824chr1062668 2346 2216 2158 2072 499 12561 ----
NM_017848chrX84126 4117 3385 3180 3070 3031 1320 1187 --11784 --
NM_017851chr15153 ------
NM_017864chr82258 21 ------
NM_017902chr1085709 5623 5604 5500 5243 4256 3559 2126 11065 1630 --
NM_017905chr131544 ------
NM_017910chr2------1120
NM_017919chr9105482 5441 4628 4083 3570 1656 1540 1242 353 291 14316 2861 817 --
NM_017935chr41541 ----1604
NM_017938chrX41579 1528 887 870 --11868 --
NM_017944chr11112938 2889 2773 2261 1068 683 538 349 332 266 101 ----12310
NM_017958chr273065 2834 2605 2075 1885 411 38 --12476 11145
NM_017987chr1042024 681 659 72 12193 --11551
NM_017988chr121591 --1295 --
NM_017994chr761954 1841 1828 733 494 46 --11154 --
NM_017998chr921119 960 --1395 --
NM_018000chr251977 1950 1733 473 151 --1312 --
NM_018028chr1931334 1070 144 --21310 1042 --
NM_018030chr183407 321 127 133 --11096
NM_018045chr173020 2850 1943 1258 434 337 111 1805 ----
NM_018084chr273085 2263 2024 1230 1019 864 676 --12203 --
NM_018085chr1157919 7847 7753 6260 5613 5226 5089 3139 2659 1537 1341 1255 897 620 538 15299 23258 1042 --
NM_018086chr22571 427 11178 ----
NM_018092chr1641662 1613 600 216 1129 --11286
NM_018103chr13279 252 244 ------
NM_018105chr831188 227 58 --2905 440 --
NM_018117chr102668 30 2778 300 ----
NM_018121chr1071214 809 526 395 359 284 215 ------
NM_018133chr34320 289 182 80 --12006 --
NM_018137chr12248 43 --21287 131 11379
NM_018157chr1273032 2784 2656 2608 2385 2078 987 ------
NM_018181chr1811436 --1219 11828
NM_018195chr1161772 785 752 465 454 312 11588 ----
NM_018211chr142141 664 70 22 1235 ----
NM_018227chr453021 2757 314 279 267 32699 2571 663 22913 2811 --
NM_018243chr493827 3119 3041 3024 2538 1306 1059 391 192 13858 12894 14042
NM_018254chr152436 483 210 88 30 --1805 --
NM_018263chr242561 2307 1703 446 22287 1052 1983 --
NM_018286chr171670 ----1371
NM_018287chr1051310 888 530 519 200 ------
NM_018293chr362175 2125 2052 2041 979 452 1543 ----
NM_018299chr853128 2383 2105 892 84 1102 23414 2191 --
NM_018302chr4102386 2371 2356 2341 2059 1703 652 646 532 502 1923 ----
NM_018307chr173980 690 158 ----1874
NM_018312chr1131597 562 253 1516 1369 --
NM_018313chr312146 2991 813 ----
NM_018315chr43596 367 193 1607 --11594
NM_018342chr411705 --11680 1322
NM_018351chr1231893 974 716 13942 23867 3565 --
NM_018360chrX----147 --
NM_018362chr1173935 3398 2538 953 554 426 331 13763 13640 --
NM_018364chr184005 3425 2887 1562 1151 702 67 31 12768 ----
NM_018372chr12594 572 ------
NM_018373chr14116386 6099 6082 5644 5052 4584 954 864 768 717 96 14548 ----
NM_018374chr765207 5063 4479 4148 3630 3375 11434 33197 605 431 --
NM_018383chr241982 1950 1710 532 --1829 --
NM_018386chr131134 1264 ----
NM_018387chr92511 505 ------
NM_018400chr1154211 3518 3237 1235 1226 14147 23618 1301 --
NM_018424chr92730 440 --11576 1643
NM_018429chr542375 1167 570 155 12399 1719 --
NM_018440chr8138583 8201 8182 7311 7279 7099 6825 3234 3137 2418 1349 880 28 27752 1030 26623 1816 --
NM_018442chr11267 ----1135
NM_018444chr832143 591 524 22180 484 21453 295 --
NM_018452chr6_random43667 3284 2465 1282 --1240 --
NM_018456chr3199 ------
NM_018469chr1721396 1141 ----11152
NM_018490chr1131837 442 396 --11729 --
NM_018566chr185036 4178 3272 1088 427 320 272 79 1123 --11782
NM_018569chr441001 630 82 36 21460 1240 ----
NM_018584chr12831 461 ------
NM_018602chr15--1168 ----
NM_018638chr1265344 3974 3728 2131 1364 437 22204 273 44876 3906 1636 697 1633
NM_018640chr1292744 2499 2409 2389 2009 1964 1951 626 458 --2988 735 --
NM_018667chr1632606 2576 282 ----1921
NM_018683chr2031241 662 216 ----21738 295
NM_018691chr54931 365 254 21 --11008 --
NM_018695chr552380 2230 1578 727 340 11949 ----
NM_018698chrX71972 1822 1812 1386 1361 1314 493 --11904 11417
NM_018700chr541335 1116 237 63 ------
NM_018710chr84520 486 464 114 1471 ----
NM_018834chr54935 889 847 63 ------
NM_018841chr183383 3345 3096 2969 2908 1323 104 91 --12557 --
NM_018844chr75710 656 465 96 60 31569 1447 680 2518 349 21483 385
NM_018847chr921984 1795 ------
NM_018890chr7--1952 ----
NM_018938chr561147 1120 1014 490 434 240 1391 1745 --
NM_018945chr663481 3350 1484 1340 969 527 23341 1154 ----
NM_018970chr7132983 2679 2620 2493 2399 2210 2006 1212 871 158 69 40 25 --12268 13072
NM_018975chr16--1553 1812 --
NM_018976chr1252778 876 414 322 283 12347 --12371
NM_018979chr1231672 794 654 179 ----
NM_018981chr231181 987 489 1505 ----
NM_018999chr1084710 3829 3469 3279 1605 734 500 439 ------
NM_019000chr531351 1275 1085 1376 ----
NM_019004chr741859 780 367 172 22282 314 --1481
NM_019022chr1843166 1129 914 581 13134 22503 473 1787
NM_019035chr41184 --1451 --
NM_019036chr61145 11088 1271 1803
NM_019050chr441583 1525 546 97 --32184 491 37 --
NM_019072chr5114146 3936 3887 3046 2891 1720 1036 898 847 704 406 --13221 13136
NM_019080chr1341235 1110 582 372 --11515 1594
NM_019083chr141579 1469 1235 1075 ------
NM_019084chr103976 325 21 12052 32189 1685 571 --
NM_019091chr221040 397 --1207 --
NM_019114chr972239 1895 1767 1569 582 565 300 ------
NM_019117chrX72708 2699 2485 1197 774 261 104 12184 --12567
NM_019594chr931582 1558 263 ----1390
NM_019895chr341114 916 861 437 1221 11135 --
NM_019903chr1061695 1596 1434 1311 579 375 --11720 --
NM_020116chr42531 81 --21450 681 --
NM_020122chr2105133 4627 4567 4549 1543 1347 877 596 408 158 21873 1359 ----
NM_020150chr102865 382 11434 21814 595 --
NM_020159chr431333 233 76 --21220 102 --
NM_020177chr522336 959 --11194 12317
NM_020193chr1111275 --1945 --
NM_020198chr1731405 364 220 11577 ----
NM_020205chr141303 1170 1164 856 13436 1278 --
NM_020243chr22194 ------
NM_020245chr695057 4444 3687 3561 3412 3384 1150 983 155 --11975 11988
NM_020337chr472918 2058 1016 1007 931 346 182 --12669 --
NM_020340chr641807 565 533 245 --22097 1395 --
NM_020347chr31545 12298 1665 --
NM_020348chr1021835 411 --32407 2231 941 --
NM_020357chr311363 21611 1506 ----
NM_020390chr3104904 4431 3369 3177 1865 1712 1464 1148 796 591 13943 34869 3099 86 --
NM_020403chr1321573 1166 --2121 28 --
NM_020420chrY1317 --21707 208 --
NM_020432chr731628 387 27 12000 11456 --
NM_020435chr11740 ------
NM_020440chr162653 2300 1095 741 262 114 --21177 586 --
NM_020466chr663593 3113 3083 1925 1673 803 21861 1664 33788 3161 1774 13124
NM_020640chr31596 --21660 622 --
NM_020651chr23679 404 324 ------
NM_020653chr17------1152
NM_020654chr321227 1194 --197 --
NM_020673chr20137517 6528 6396 6194 5762 5264 2934 2509 2336 1764 1192 638 243 23070 570 12094 --
NM_020699chr154849 4394 3887 3386 997 1979 ----
NM_020711chr272197 1768 1746 1702 932 563 152 32244 1895 1821 1179 --
NM_020718chr16115845 5805 5471 4529 4233 4186 4045 1800 1719 1683 788 --24567 1547 --
NM_020727chr2153201 2663 1546 303 172 --12938 --
NM_020728chr772448 2418 1174 1036 722 669 458 32492 781 495 22666 368 11981
NM_020734chr1253404 3299 2171 1345 596 12392 32675 2664 381 --
NM_020739chr1554105 3454 628 586 307 --23705 3412 --
NM_020748chr1731994 1550 1544 1814 21977 1697 --
NM_020752chr1082824 2639 2453 2116 719 438 389 265 1457 22927 580 --
NM_020762chr126846 661 393 349 199 104 --181 --
NM_020772chr17128313 5566 5354 3443 2703 2258 2103 874 733 380 248 25 12466 --35884 3329 1819
NM_020774chr1856176 4779 4092 1304 651 15837 --24069 1174
NM_020779chr262388 1254 570 466 411 24 ----1687
NM_020783chr182254 157 --1711 --
NM_020792chr382664 2123 1857 1843 422 373 137 40 1185 32656 2503 304 1157
NM_020805chr183476 284 185 1245 ----
NM_020815chr41416 1115 ----
NM_020819chr62961 800 ------
NM_020824chr101569 1590 ----
NM_020830chr233052 1049 998 1378 23128 584 --
NM_020839chr3--11080 ----
NM_020841chr1274051 3999 3096 2724 1438 1133 960 33991 3977 403 24033 3401 --
NM_020844chr8107637 6769 6171 5650 3043 2849 2579 1825 1278 416 35362 3030 2527 32806 756 359 26213 1748
NM_020850chr16----1792 --
NM_020853chr1222569 692 12288 22084 1102 11740
NM_020859chr453545 2480 1204 1047 56 11501 44064 4002 3562 2802 --
NM_020860chr42902 193 ----1433
NM_020861chr631196 971 886 ------
NM_020871chrX32282 1629 314 1199 21682 253 --
NM_020872chr331557 193 108 --11489 --
NM_020895chr19--1211 ----
NM_020921chr1483673 2888 1416 1291 1190 979 573 237 190 11315 --
NM_020925chr111201 ------
NM_020935chr274677 4358 3282 3095 2906 1299 507 ------
NM_020940chr1072881 2483 2474 1926 921 670 564 12447 1443 --
NM_020948chr183537 3339 3266 3179 1332 754 675 126 --22346 1377 --
NM_020949chr31186 151 ----
NM_020964chr18124682 4220 3600 1761 1339 1256 1101 1048 950 804 73 53 --24539 4464 --
NM_020973chr41231 ----1532
NM_020975chr1051960 1565 1333 176 150 --1466 11843
NM_020987chr1011229 ----31399 994 970
NM_021007chr232397 763 538 ----12297
NM_021033chr1383484 2571 2457 1090 1025 830 503 331 21391 103 1782 12263
NM_021061chr884371 3164 3124 3103 1664 994 964 131 --24528 1052 23955 3707
NM_021072chr572490 2444 2088 1655 986 896 613 2294 98 1720 --
NM_021083chrX63435 2323 1011 561 374 230 21376 853 12792 --
NM_021090chr22104766 4662 4569 4267 3899 3818 1931 1345 1098 724 ------
NM_021098chr16--1765 1702 --
NM_021109chrX179 ------
NM_021109chrX179 ------
NM_021116chr798857 8838 8590 6709 6177 5777 3642 1998 1465 15550 --17919
NM_021136chr141649 --1117 1537
NM_021156chr2051112 1003 728 722 715 ------
NM_021159chr431508 552 216 --1656 21721 1475
NM_021165chr11846 ----165
NM_021167chr712541 --12221 --
NM_021176chr211573 ----11708
NM_021183chrX52567 2425 2144 1675 749 12397 --1818
NM_021191chr1262028 1826 1011 905 862 431 --42329 897 295 82 --
NM_021204chr41148 184 ----
NM_021222chr131429 1179 197 ------
NM_021229chr1211101 1144 ----
NM_021238chr1242078 682 315 299 21693 1295 ----
NM_021240chr91162 ----1154
NM_021249chr1461623 1493 538 360 285 277 11661 ----
NM_021255chr1483633 3047 2808 1406 697 621 316 280 11520 2689 597 23768 3708
NM_021572chr621167 477 --1395 --
NM_021614chr51242 ------
NM_021622chr103858 830 524 --1353 1882
NM_021627chr311120 --11159 11091
NM_021629chr363883 1740 1707 1468 352 240 54462 4037 3798 1486 1438 23707 630 --
NM_021633chr111162 31356 1001 293 --21299 363
NM_021644chr102849 417 ------
NM_021645chr1351605 746 688 237 147 --11788 --
NM_021647chr473737 1879 1776 1741 1608 1244 1022 --14471 --
NM_021722chr72505 227 ------
NM_021723chr71546 ------
NM_021809chr2021842 1609 --12471 --
NM_021813chr695483 5464 4973 4872 4488 4046 2077 915 905 --25081 1055 --
NM_021814chr631305 1122 650 ------
NM_021818chr1451475 1321 952 317 124 ------
NM_021911chr585371 5056 3993 2233 1504 942 803 351 --44392 4307 3942 2029 14437
NM_021912chr1574244 4064 3533 3136 1305 1270 464 11452 23910 2815 --
NM_021914chr1422074 936 ------
NM_021960chr152776 2252 917 419 87 1594 12038 --
NM_021961chr11156292 5838 5118 4956 2667 2474 2377 2164 1869 1666 1424 1183 1174 684 455 37055 6016 1738 37312 6767 613 15261
NM_021964chr3136064 5064 4816 4772 4263 4150 2587 1755 1085 1030 1005 150 142 15759 --24485 2410
NM_021999chr134820 604 341 48 --1583 --
NM_022041chr1642418 2358 1647 624 --22642 966 --
NM_022048chr1576286 6243 6019 4031 3957 2345 1205 22325 1047 14025 --
NM_022051chr1159 --1706 --
NM_022079chr101364 --1639 --
NM_022087chr71567 ------
NM_022091chr662420 1864 1797 638 201 71 --12238 --
NM_022114chr144747 1407 450 438 --11418 --
NM_022143chr731452 254 184 ------
NM_022351chr843384 1128 876 794 31280 568 93 1154 --
NM_022373chr71659 --3822 735 87 --
NM_022444chr751806 1589 1559 156 81 1513 21871 285 --
NM_022456chr1286804 6491 5915 4752 2392 2024 958 39 11806 ----
NM_022458chr743054 1060 792 186 --12882 1145
NM_022459chr13136186 6145 6066 5741 5590 5358 4668 4374 4326 2471 2039 1098 1067 11870 22112 867 11671
NM_022462chr1962343 1378 1111 1011 778 211 --33095 2400 771 --
NM_022473chr1564424 4113 4105 3844 3477 3088 --24386 3181 --
NM_022474chr1452735 2721 2473 2324 1865 1684 22528 850 --
NM_022476chr162922 753 ------
NM_022484chr7157 --11276 11219
NM_022491chr1232390 891 854 32942 2776 93 ----
NM_022739chr171837 1340 ----
NM_022756chr131337 569 58 --1580 1968
NM_022763chr3122881 2655 2604 2192 2182 1976 1227 1215 808 784 719 656 2820 585 1602 --
NM_022778chr121436 232 ------
NM_022781chr943185 2085 2054 76 --1560 --
NM_022802chr1021304 434 11487 11506 11560
NM_022824chr551707 1447 1408 1310 245 ------
NM_022845chr1641691 1512 732 96 ----12127
NM_022894chr241795 1190 282 163 --1130 --
NM_022918chr1191996 1618 1612 1542 1346 851 758 652 204 ----1287
NM_022977chrX32408 712 40 2268 173 ----
NM_023000chr14------11466
NM_023001chr14------11466
NM_023009chr1----1645 --
NM_023016chr272526 2409 909 829 742 202 154 --12782 --
NM_023037chr131798 11078 ----
NM_023074chr1971337 1296 1134 1006 531 477 456 --21376 30 --
NM_023914chr331592 1364 22 ------
NM_023929chr852467 2198 1736 799 780 12552 --1553
NM_024007chr543020 2269 121 61 1593 ----
NM_024052chr1721190 284 ------
NM_024061chr7----1566 --
NM_024086chr1753298 1312 1239 1084 39 --23170 2582 --
NM_024094chr81572 1722 169 --
NM_024332chrX21378 671 --31442 408 269 --
NM_024345chr9105450 5192 5082 4577 4515 3967 1467 1357 1294 145 ------
NM_024423chr1874133 3941 3930 3322 1305 949 83 ------
NM_024511chr483115 3003 2986 2674 2317 1266 685 544 ------
NM_024512chr363381 2788 2520 1403 1098 297 --21372 753 --
NM_024513chr373828 3016 2908 1482 1202 958 750 11440 --11016
NM_024524chr373069 2631 2429 2421 1290 604 456 --13188 --
NM_024529chr11191 11040 1797 --
NM_024532chr2----1178 --
NM_024539chrX2173 165 1903 ----
NM_024586chr1----1565 --
NM_024612chr171866 ------
NM_024613chr821497 644 1127 11175 --
NM_024639chr642849 2777 2759 1052 11929 12725 --
NM_024665chr3104425 4103 3119 1720 1571 1305 1108 938 227 47 ------
NM_024721chr81551 --22449 725 --
NM_024740chr1184032 3818 3465 3157 1478 1375 858 58 1634 13242 --
NM_024755chr152757 183 ------
NM_024761chr9145374 4815 4061 3987 1992 1719 1449 1172 1028 1014 849 771 316 174 25099 1589 13601 --
NM_024779chr1221196 137 --21239 450 --
NM_024817chr1555443 2371 1746 696 477 ----25054 3693
NM_024884chr1484203 3992 3783 3324 1151 201 118 33 --24004 1245 21706 1266
NM_024920chr41532 11106 11478 1148
NM_024930chr562745 2282 2255 2092 1886 777 --1545 --
NM_024947chr3119457 8347 8279 7528 6920 6329 3727 2271 1799 108 73 13273 39222 8464 2451 16342
NM_024948chr101642 ------
NM_024949chr443707 1651 1347 946 --24786 233 14573
NM_024989chr2198179 7442 7133 7097 6814 6741 6486 6469 5811 5107 3056 2630 2405 2064 1532 873 608 494 451 25701 1680 58189 6523 6260 5598 4945 --
NM_025040chr1962073 1984 1929 1546 1527 440 --3710 506 471 --
NM_025054chr863175 3146 1416 756 400 73 ----12577
NM_025073chr174424 4246 4161 1790 1390 759 106 14438 23847 547 --
NM_025080chr1111088 ----170
NM_025106chr111407 11929 ----
NM_025114chr12143 ------
NM_025125chr1011608 ------
NM_025126chr121747 ------
NM_025133chr221100 337 ----147
NM_025134chr1662387 1860 1602 830 799 751 --12156 195
NM_025146chr362145 1955 1677 864 725 182 1795 --12662
NM_025147chr2--1413 ----
NM_025151chr862068 2048 1851 658 179 85 ------
NM_025160chr174299 3223 3141 3132 783 529 176 34034 3649 36 13812 --
NM_025191chr173491 3022 2720 2486 2465 1194 180 1493 1373 --
NM_025208chr1162244 2069 1986 1913 313 103 11643 1638 --
NM_025235chr1032177 1551 271 ------
NM_025248chr1753115 3100 2629 2469 213 1904 ----
NM_030621chr1423864 697 1800 13201 --
NM_030623chr231697 1282 1099 1418 --11226
NM_030625chr1042239 991 646 264 11652 ----
NM_030627chr543386 1662 1472 396 2810 116 12760 1144
NM_030647chr7115811 5669 5273 5145 4540 4526 4337 1791 1316 739 177 25336 4297 25434 5302 --
NM_030648chr465098 4247 3523 2036 481 194 ------
NM_030650chr243878 1501 1101 314 --1840 13678
NM_030664chr1021961 1639 41937 1905 305 217 32415 2308 1898 --
NM_030674chr1255859 4281 2058 887 519 21926 741 1134 --
NM_030751chr1051765 1180 755 647 85 ------
NM_030751chr1051765 1180 755 647 85 ------
NM_030759chr101675 --1553 --
NM_030780chr841241 1090 658 374 --11285 --
NM_030791chr1431518 1413 1184 1109 ----
NM_030806chr177960 7223 6128 6094 5779 2600 1994 1866 67714 7275 3551 3445 3429 1319 --
NM_030821chr43720 308 60 1830 2773 640 --
NM_030918chr185202 4753 3743 3547 964 892 819 748 --11325 15088
NM_030920chr12526 108 --11926 --
NM_030939chr61452 --1442 --
NM_030962chr1141566 643 477 161 --21198 994 --
NM_030963chr61224 1527 ----
NM_031216chr182101 23 11909 12011 --
NM_031243chr71753 ----1675
NM_031266chr5183 ------
NM_031291chr4137 ------
NM_031296chr462233 2048 2036 1011 295 83 11806 12555 --
NM_031305chr431728 1419 544 --21900 1381 --
NM_031314chr1441762 1723 1279 789 12016 1308 --
NM_031362chr262701 2297 1869 855 740 119 32664 2633 2585 21086 734 12426
NM_031365chr272837 2433 2005 1801 991 876 255 32800 2769 2721 1870 12562
NM_031366chr272837 2433 2005 1801 991 876 255 32800 2769 2721 1870 12562
NM_031418chr1132566 2546 894 ------
NM_031423chr1----1193 --
NM_031427chr1485753 5459 5378 4926 4267 4056 2093 1112 45142 3797 155 29 35871 4068 3987 --
NM_031442chrX41081 928 159 128 22912 73 ----
NM_031461chr862171 2028 1660 569 490 391 --2871 466 --
NM_031468chr7117290 5953 5570 3050 2661 2526 2505 2069 1406 782 287 18095 28217 1026 --
NM_031483chr2073193 2928 2594 1418 1283 1173 1003 33272 906 733 ----
NM_031844chr182929 1546 1474 1113 981 866 545 80 --13999 --
NM_031845chr263126 3059 2728 2262 1003 181 1409 23172 111 --
NM_031847chr263126 3059 2728 2262 1003 181 1409 23172 111 --
NM_031858chr1781574 1518 1358 1287 394 274 96 24 ------
NM_031862chr1781574 1518 1358 1287 394 274 96 24 ------
NM_031889chr42369 244 11907 11484 --
NM_031935chr1----21074 757 --
NM_031942chr261243 985 967 423 339 134 --11266 --
NM_032018chr14665 301 222 117 ----1105
NM_032027chr11259 ----1318
NM_032041chr841850 1725 1694 970 11961 --12695
NM_032121chrX112803 2501 2314 2241 2201 2077 1988 1105 424 337 218 --12053 --
NM_032142chr182195 53 ------
NM_032144chr241711 1387 635 288 11735 194 --
NM_032145chr621690 577 ----11929
NM_032154chr1011108 ----1115
NM_032160chr1863838 3499 3245 2865 1618 1451 21353 344 ----
NM_032189chr1324970 4436 --21489 1260 --
NM_032199chr1083714 3626 3197 3181 1388 1370 1273 104 --13550 --
NM_032217chr421267 21 1149 2548 264 --
NM_032221chr2041891 1673 1474 542 ------
NM_032226chr91668 --161 1844
NM_032228chr11103247 2987 2596 2510 2374 1381 1040 652 498 307 ----12283
NM_032294chr1731837 704 592 --1146 --
NM_032295chr761026 944 542 201 166 114 ------
NM_032315chr1--1215 1202 --
NM_032352chr1431355 1019 226 ----187
NM_032373chr1085875 5066 4709 1733 1371 832 774 682 15166 24536 3590 --
NM_032408chr731093 514 247 --1260 --
NM_032410chr851277 1197 1021 432 413 --1471 --
NM_032438chr62409 78 --1527 --
NM_032446chr552967 2783 1334 984 487 13842 13189 --
NM_032457chr432378 819 167 13586 13454 11566
NM_032458chrX52836 2757 428 380 189 ------
NM_032466chr821591 1095 ------
NM_032468chr821591 1095 ------
NM_032472chr2----126 --
NM_032491chr121849 1880 ----
NM_032499chr1511154 11290 1276 1486
NM_032505chr362511 2434 2096 1736 749 426 31018 733 452 ----
NM_032520chr162223 158 ------
NM_032521chr2063118 2517 2150 2022 1092 335 ------
NM_032557chr41674 --1861 --
NM_032560chr141872 ----1755
NM_032622chr431339 1151 1049 11296 11166 --
NM_032632chr1431491 559 126 --21902 623 --
NM_032663chr1262075 2011 1880 1680 750 585 --11931 --
NM_032784chr6--1793 ----
NM_032793chr1------1305
NM_032800chr142707 2053 796 626 12684 12081 --
NM_032801chr1162544 2383 2271 984 260 213 ----1838
NM_032804chr103594 443 78 1427 12340 --
NM_032833chr192666 2512 2352 2220 2169 1825 852 604 116 1375 1515 --
NM_032859chr1353868 3337 1516 795 299 1989 11510 --
NM_032873chr1133189 2771 1540 23517 819 14019 --
NM_032932chr1745806 5621 4626 1565 --15189 --
NM_032949chr13----1469 --
NM_032968chrX43662 727 455 100 11580 11606 --
NM_032969chrX43662 727 455 100 11580 11606 --
NM_032971chrY2201 30 1120 ----
NM_032972chrY2201 30 1120 ----
NM_032973chrY43654 727 455 100 11579 11605 --
NM_032975chr1883438 2528 2286 1374 1182 715 584 223 1299 22825 2423 --
NM_032980chr1883438 2528 2286 1374 1182 715 584 223 1299 22825 2423 --
NM_033020chr134619 3657 692 1827 ----
NM_033027chr31171 ------
NM_033030chr231169 1102 295 1243 1256 --
NM_033055chr13790 731 287 ----1763
NM_033121chr1241413 1242 668 473 --11336 --
NM_033132chr13163 --11550 --
NM_033133chr1753044 757 738 148 126 1116 ----
NM_033135chr1162244 2069 1986 1913 313 103 11643 1638 --
NM_033138chr772087 1611 681 661 476 270 165 --11437 1895
NM_033139chr772087 1611 681 661 476 270 165 --11437 1895
NM_033140chr772087 1611 681 661 476 270 165 --11437 1895
NM_033143chr442899 1495 737 660 21662 1577 33860 3655 3175 --
NM_033157chr772087 1611 681 661 476 270 165 --11437 1895
NM_033181chr683751 1312 1225 905 802 647 336 97 13905 1587 --
NM_033211chr52561 512 1807 ----
NM_033222chr921254 523 11382 ----
NM_033224chr7167557 6822 6427 6254 6163 2831 2527 2346 1669 1586 1169 1134 578 408 309 153 26891 5427 15405 --
NM_033285chr874505 4206 1672 1554 1126 370 105 11400 1436 --
NM_033360chr1264559 4536 4099 3982 3674 2997 24502 1829 23840 1003 --
NM_033379chr10------1144
NM_033425chr1193464 2600 2310 2275 2254 1268 735 535 492 22918 1325 22569 1175 --
NM_033427chr73723 164 30 ------
NM_033480chr682778 2528 2446 2399 2374 2259 828 600 12240 ----
NM_033481chr682778 2528 2446 2399 2374 2259 828 600 12240 ----
NM_033495chrX1952 ------
NM_033505chr2146597 5396 5366 4923 4209 4103 1936 1866 1842 1455 1372 885 642 264 14276 25429 142 --
NM_033549chr51344 ----1906
NM_033632chr43596 367 193 1607 --11594
NM_033637chr1073314 3259 2953 2865 2778 2584 1508 --33016 566 414 --
NM_033644chr542506 2298 2235 797 ------
NM_033645chr542506 2298 2235 797 ------
NM_033656chr21115935 5450 5265 4494 2362 2260 1924 1277 1178 477 462 24766 4477 55732 4133 1939 846 777 --
NM_052832chr843046 2475 2159 622 12416 32047 400 105 12815
NM_052879chr1243567 1446 920 652 23891 440 --13727
NM_052885chr1274972 4397 3585 3379 1097 1044 87 34820 357 221 1664 --
NM_052898chr811483 --1761 --
NM_052905chr21493 21772 1469 ----
NM_052907chr1263559 3551 3448 1627 1153 511 11017 13159 --
NM_052910chr133657 487 135 ------
NM_052917chr242575 2524 1126 77 ------
NM_052932chr1172472 2357 1817 955 773 663 302 --11663 --
NM_052948chr193298 124 116 1149 1155 --
NM_052953chr31310 ------
NM_053002chr311142 11215 ----
NM_053016chr9177890 7431 7265 6156 5218 5063 4912 3011 2979 2888 2727 1933 1695 1579 1473 1113 308 21653 896 36362 5804 669 --
NM_053023chr1152694 2641 480 366 102 ----11079
NM_053025chr341526 1155 286 253 1189 11621 --
NM_053026chr341526 1155 286 253 1189 11621 --
NM_053027chr341526 1155 286 253 1189 11621 --
NM_053028chr341526 1155 286 253 1189 11621 --
NM_053031chr341526 1155 286 253 1189 11621 --
NM_053032chr341526 1155 286 253 1189 11621 --
NM_053043chr7106287 5823 5387 5264 4691 4559 4482 4402 529 23 ------
NM_054016chr121713 647 21607 357 ----
NM_054016chr121713 647 21607 357 ----
NM_054016chr121713 647 21607 357 ----
NM_057089chr72329 117 ----1192
NM_058170chr171653 1307 1269 1197 661 589 191 1166 ----
NM_058241chr291880 1800 1781 1599 1424 777 769 627 88 1596 21772 563 1931
NM_058241chr291880 1800 1781 1599 1424 777 769 627 88 1596 21772 563 1931
NM_080546chr972101 1971 1902 821 623 341 58 --22287 701 1325
NM_080597chr183407 321 127 133 --11096
NM_080645chr63357 211 176 ------
NM_080664chr1482032 2001 1817 711 525 137 94 79 --1758 --
NM_080737chrX31472 1233 561 31141 514 310 11452 1256
NM_080752chr201437 ------
NM_080832chrX41821 1172 609 386 --11484 --
NM_080867chr1494803 4782 4320 4270 3789 3103 987 646 383 44742 1135 548 421 24037 2047 --
NM_080872chr854098 3994 1450 1331 115 22776 2485 ----
NM_080921chr1--1395 2994 471 --
NM_100264chr101318 --1675 1726
NM_100486chr101318 --1675 1726
NM_130391chr972806 2575 2542 817 614 532 98 22294 1145 13431 1192
NM_130392chr972806 2575 2542 817 614 532 98 22294 1145 13431 1192
NM_130393chr972806 2575 2542 817 614 532 98 22294 1145 13431 1192
NM_130398chr11144 ------
NM_130435chr102971 309 22766 1141 ----
NM_130436chr212251 147 11907 21923 828 --
NM_130438chr2152275 828 724 308 164 22484 2190 12500 --
NM_130439chr103910 665 459 ----11541
NM_130439chr103910 665 459 ----11541
NM_130809chr552359 1964 962 608 126 1313 21172 644 --
NM_133330chr452364 2334 1995 340 197 12176 1802 --
NM_133331chr452364 2334 1995 340 197 12176 1802 --
NM_133334chr4126376 5253 5207 5082 4550 4102 2014 1636 1589 1512 1246 175 35108 4519 358 1101 --
NM_133335chr452364 2334 1995 340 197 12176 1802 --
NM_133367chr673476 3054 2872 2834 2795 2294 583 21055 734 ----
NM_133370chr483583 2930 2424 1189 654 599 352 135 21392 920 ----
NM_133372chr521016 993 --12924 12287
NM_133445chr983089 3008 2498 1192 286 269 261 36 ------
NM_133468chr762277 1887 1038 892 646 238 ------
NM_133486chrX2335 303 ------
NM_133496chr183964 3855 3512 3405 3129 2765 903 536 11741 24553 738 --
NM_133503chr12--1683 130 --
NM_133504chr12--1683 130 --
NM_133505chr12--1683 130 --
NM_133506chr12--1683 130 --
NM_133507chr12--1861 1208 --
NM_133631chr341626 1064 1018 447 --1437 --
NM_133646chr2104898 4495 3946 2130 1967 1644 1086 650 136 55 11210 25000 4696 --
NM_134428chr91121 ------
NM_138270chrX23041 2267 --13368 21290 671
NM_138286chr1923091 1626 24377 1543 23703 3528 --
NM_138288chr1462003 1979 1454 317 267 106 11908 ----
NM_138292chr1153078 2670 2565 68 55 12554 2788 738 --
NM_138316chr1031186 373 280 ------
NM_138333chr962169 2074 1808 1751 692 296 --22493 1731 150
NM_138340chr181514 1594 ----
NM_138348chr595639 5531 5112 4696 2432 2034 1056 916 573 ------
NM_138426chr73699 539 424 --11954 --
NM_138437chrX1119 194 ----
NM_138444chr1354508 4487 4272 4125 519 11200 33746 3629 3148 11248
NM_138459chr693512 3282 3205 2580 2426 1031 849 755 108 ------
NM_138473chr12105169 5023 4856 4708 4653 4050 1732 1511 1431 1366 23822 3756 24897 1014 --
NM_138572chr653063 590 578 443 87 --13262 1163
NM_138621chr294156 4032 3883 3749 3516 2849 1558 555 428 1458 1376 --
NM_138638chr1422074 936 ------
NM_138694chr662681 2456 2355 1469 1404 730 1269 ----
NM_138713chr16117958 7523 7490 7177 7139 6453 5921 1286 924 701 446 46901 6072 962 952 48199 6468 2204 1559 --
NM_138714chr16117958 7523 7490 7177 7139 6453 5921 1286 924 701 446 46901 6072 962 952 48199 6468 2204 1559 --
NM_138731chr1453406 2714 2582 1439 521 34127 3508 90 ----
NM_138773chr52887 613 --141 --
NM_138775chr111176 ------
NM_138782chr531814 683 84 1957 1396 --
NM_138799chr241783 1270 362 329 21712 1450 ----
NM_138970chr1451975 577 428 388 122 ----12106
NM_138971chr1153536 3396 2757 2710 1142 ------
NM_138971chr1153536 3396 2757 2710 1142 ------
NM_138972chr1153536 3396 2757 2710 1142 ------
NM_138972chr1153536 3396 2757 2710 1142 ------
NM_138973chr1153536 3396 2757 2710 1142 ------
NM_138973chr1153536 3396 2757 2710 1142 ------
NM_138980chr41211 ------
NM_138981chr41342 ------
NM_138982chr41211 ------
NM_139012chr62550 539 --11642 --
NM_139057chr1532792 2367 235 ------
NM_139169chr1041842 1759 379 276 ------
NM_139207chr1262217 679 650 586 526 513 11844 131 147
NM_139276chr1752392 964 461 128 103 --1566 --
NM_139283chr1242082 1797 991 919 ----11747
NM_139312chr1031266 945 344 1421 31231 1121 480 --
NM_139319chr121461 --11598 --
NM_139321chr2083741 2985 2918 2866 2823 1458 666 194 13492 ----
NM_139323chr2072035 640 569 536 380 365 348 --1817 --
NM_144571chr4126329 5637 5400 5353 4860 4580 4555 2615 1141 762 602 461 16244 2698 542 21525 885
NM_144574chr142499 201 ------
NM_144578chr14135164 5052 4345 4121 1871 1429 1350 669 562 433 423 385 141 ------
NM_144595chr132663 332 ----1946
NM_144599chr15105511 5292 5264 4568 4365 3983 1564 1348 911 261 22161 686 --15538
NM_144600chr161447 ----155
NM_144632chr22971 939 --1104 --
NM_144664chr1132361 1922 204 1575 22432 2209 12223
NM_144723chr5146 ------
NM_144728chr1----1172 --
NM_144729chr1----1172 --
NM_144767chr1554308 4132 3693 3148 1504 21871 1598 13363 --
NM_144778chr1362156 1822 1727 919 333 47 21036 869 ----
NM_144949chr242572 1817 971 555 1702 1406 --
NM_144963chr822112 1670 ----1589
NM_144973chr1285126 4083 3801 3795 1491 1253 910 752 1743 1717 --
NM_144982chr122821 617 ------
NM_145055chr1893443 3326 3103 2881 2750 2536 2344 681 281 33109 2850 650 ----
NM_145060chr1871899 1725 1696 1590 716 94 87 1423 ----
NM_145165chr1442407 701 528 27 --32495 2167 1831 --
NM_145251chr1441454 1400 639 600 11542 --1552
NM_145259chr296978 6918 5598 4979 4830 2235 1893 602 151 --26897 5053 --
NM_145263chr452299 1714 1593 495 172 ------
NM_145267chr6--158 ----
NM_145305chrX61256 1039 447 242 70 63 11177 ----
NM_145307chr1084609 4090 3924 3461 2841 655 538 40 --24132 1281 --
NM_145313chr10----1117 --
NM_145320chr763315 2519 2436 1209 966 949 ------
NM_145321chr763315 2519 2436 1209 966 949 ------
NM_145322chr763315 2519 2436 1209 966 949 ------
NM_145644chr2----1382 1305
NM_145686chr253367 3065 2888 2744 1041 12128 33041 1129 595 --
NM_145687chr253367 3065 2888 2744 1041 12128 33041 1129 595 --
NM_145690chr821493 785 11314 11425 --
NM_145697chr1----1193 --
NM_145698chr1041998 1981 660 212 --52163 1699 1597 549 46 --
NM_145714chr162324 315 --1277 --
NM_145810chr261243 985 967 423 339 134 --11266 --
NM_145859chr31324 ------
NM_145860chr31324 ------
NM_145891chr1611104 11438 ----
NM_145892chr1611104 11438 ----
NM_145893chr1621226 1169 11560 ----
NM_147150chr953131 2984 2905 2556 984 23694 1487 ----
NM_147156chr102539 255 2206 124 ----
NM_147164chr91559 ------
NM_147233chr221914 1645 ------
NM_148174chr862168 2096 1967 1733 668 528 21372 520 ----
NM_148414chr163518 407 398 --1360 --
NM_148415chr163458 347 338 --1300 --
NM_148416chr163435 324 315 --1277 --
NM_148898chr741040 898 54 46 --1952 --
NM_148899chr741040 898 54 46 --1952 --
NM_148904chr1----1565 --
NM_148905chr1----1565 --
NM_148906chr1----1565 --
NM_148907chr1----1565 --
NM_148908chr1----1565 --
NM_148909chr1----1565 --
NM_148977chr1031186 373 280 ------
NM_148978chr1031186 373 280 ------
NM_152230chr101145 --1156 --
NM_152233chr1461623 1493 538 360 285 277 11661 ----
NM_152261chr1252517 2325 1962 1836 447 --11653 --
NM_152263chr1116059 5995 5783 5398 4442 2363 1730 1648 1532 984 824 25428 1755 11821 --
NM_152265chr111417 1631 ----
NM_152270chr1731525 1502 1476 21646 1447 ----
NM_152271chr821106 38 ------
NM_152291chr43749 224 131 ----1249
NM_152298chr1----186 --
NM_152387chr23863 803 766 --1299 --
NM_152388chr273917 3713 1603 527 410 286 30 12774 21328 619 2572 327
NM_152408chr5175 ------
NM_152415chr82401 348 ------
NM_152422chr94526 392 344 320 --1327 --
NM_152437chr1262248 2147 1833 1590 932 576 22454 622 ----
NM_152442chr122879 191 --11183 11410
NM_152447chr14------1337
NM_152451chr15--1705 --1823
NM_152468chr171190 ----1244
NM_152520chr22956 421 1801 ----
NM_152529chr273906 3875 3829 1660 1218 958 72 33419 2915 1578 22873 1773 1688
NM_152556chr731971 1669 1003 --1700 1830
NM_152594chr1552095 1987 1788 169 56 1740 22109 767 --
NM_152608chr142057 1666 113 103 --1786 11959
NM_152622chr553305 2233 1310 844 764 ------
NM_152624chr5167356 7302 6751 6107 5321 5080 5058 4844 4659 1849 1233 1178 1091 969 626 524 11393 44586 2638 2147 187 --
NM_152673chr384367 3407 3371 1754 1467 1109 798 60 1589 --1649
NM_152688chr63293 122 22 --146 1878
NM_152725chr10--1135 ----
NM_152739chr731133 828 103 ----1802
NM_152744chr742662 1165 194 83 ------
NM_152745chr71957 --1449 --
NM_152756chr564150 3518 3222 1512 487 422 11054 24338 565 --
NM_152758chr883050 2549 2123 2110 1860 814 456 208 --2806 573 --
NM_152765chr832278 844 661 42264 2079 1692 1649 ----
NM_152774chr732719 1927 1805 21752 580 11860 1389
NM_152793chr794370 3688 1811 1161 1119 533 377 240 189 31665 1273 46 ----
NM_152862chr2164 --2347 147 --
NM_152903chr1362217 2162 1773 1141 1079 121 1439 1331 --
NM_152924chr1574310 2178 1744 1247 809 104 93 --22346 2106 11353
NM_152999chr7114996 4896 4101 3380 3036 1571 1490 853 841 279 253 --13342 13505
NM_153013chr552218 2052 1993 1884 251 1487 ----
NM_153035chr143018 2210 1147 1001 12702 ----
NM_153050chr22104766 4662 4569 4267 3899 3818 1931 1345 1098 724 ------
NM_153051chr22104766 4662 4569 4267 3899 3818 1931 1345 1098 724 ------
NM_153183chrX2416 207 --1858 1838
NM_153188chr585338 4332 4236 3449 1959 1878 1157 1010 15037 13465 --
NM_153207chr1244108 2768 1035 750 21011 818 1798 --
NM_153223chr531280 434 270 21602 1267 41135 631 458 254 --
NM_153261chr1641625 1264 1246 1082 11450 21166 37 --
NM_153262chr142506 1136 967 759 ------
NM_153267chr91697 ------
NM_153331chr3------1267
NM_153340chr1----189 --
NM_153346chrX21642 1418 --11759 --
NM_153365chr442007 792 515 404 ------
NM_153371chr1391996 1670 1620 1596 843 695 464 424 212 ------
NM_153374chr151122 ----1412
NM_153607chr522801 438 --12911 --
NM_153619chr1583528 2694 2215 1374 837 693 681 237 ------
NM_153634chr1251526 1474 1091 483 419 11388 --11074
NM_153645chr222999 582 --13275 1114
NM_153686chr452257 2234 2129 1787 729 12303 32268 950 359 --
NM_153704chr8136 --2164 149 --
NM_153810chr1075014 4122 3858 3828 3672 3653 3642 --23529 1695 14768
NM_170606chr721280 487 --1575 --
NM_170665chr1274119 3837 3287 1558 1388 1146 858 44416 1404 1360 34 ----
NM_170679chr551212 987 518 330 321 --1994 --
NM_170706chr164078 3630 3321 3030 1279 894 --24222 3100 --
NM_170709chr841998 1742 755 92 31713 1701 260 1563 --
NM_170710chr482389 2295 1241 933 878 826 155 72 ----1269
NM_170751chr62192 178 ------
NM_170752chr62192 178 ------
NM_170775chr51242 ------
NM_171998chrX52389 903 721 701 429 ------
NM_172070chr232227 1896 1890 173 22040 1557 --
NM_172071chr167085 5953 5803 2834 2786 764 36235 1516 824 46609 6498 283 75 14732
NM_172097chr152275 71 ------
NM_172127chr421773 436 11917 ----
NM_172128chr421729 392 11873 ----
NM_172164chr1----186 --
NM_172206chr1731837 704 592 --1146 --
NM_172341chr191153 ------
NM_173078chrX2416 71 ------
NM_173083chr12984 906 ----187
NM_173174chr81834 ------
NM_173175chr81834 ------
NM_173176chr81834 ------
NM_173198chr962952 2741 2233 2209 1876 333 --12390 12551
NM_173200chr962952 2741 2233 2209 1876 333 --12390 12551
NM_173214chr16117958 7523 7490 7177 7139 6453 5921 1286 924 701 446 46901 6072 962 952 48199 6468 2204 1559 --
NM_173354chr2122123 173 --149 12065
NM_173468chr4105803 5566 5512 5490 5464 4814 3695 2042 2011 1333 --34925 4380 4361 24600 3773
NM_173469chr1521203 335 --1134 --
NM_173471chr3----11105 --
NM_173497chr1031313 576 306 --1916 1950
NM_173511chr241002 742 590 199 22543 2533 ----
NM_173540chr10125 --1416 --
NM_173576chr1052305 832 785 727 339 1200 ----
NM_173582chr1195474 5442 5181 4950 4794 2009 1781 1321 998 --14294 --
NM_173591chr122407 55 --11041 --
NM_173602chr1242443 1443 1177 485 --21272 1049 1934
NM_173607chr1471854 1824 1764 1712 638 610 529 --11498 21745 849
NM_173642chr1118893 7529 7293 6820 6565 6278 5737 3469 2732 2523 1955 15840 13141 --
NM_173694chrX52352 1877 529 308 221 1654 12112 11863
NM_173698chrX21955 1923 --31632 758 258 --
NM_173797chr521175 1156 1920 1306 1392
NM_173808chr143440 1293 565 98 22961 283 13650 13182
NM_173809chr1011277 1500 2597 216 --
NM_173822chr222111 1718 --11457 1415
NM_173825chr362764 2405 1080 985 869 610 11060 --12188
NM_173829chr5116004 5370 5142 4528 4319 3927 1895 1541 1456 1026 211 24404 4073 36136 5321 1960 21648 1400
NM_173851chr853928 3413 2860 649 624 ------
NM_174916chr15--11764 22347 417 --
NM_174936chr111187 ------
NM_175610chr1541091 994 466 285 152 ----
NM_175623chr1286804 6491 5915 4752 2392 2024 958 39 11806 ----
NM_175624chr1286899 6586 6010 4847 2487 2119 1053 134 11901 ----
NM_175625chr1286899 6586 6010 4847 2487 2119 1053 134 11901 ----
NM_175736chr1297465 6979 6652 5406 5229 4971 1749 1283 943 27057 286 11999 --
NM_175907chr1812875 --22286 1102 11948
NM_175913chr202841 321 ------
NM_175921chr564212 3073 1187 1000 805 268 --13881 --
NM_176823chr133756 1142 128 196 13286 --
NM_176894chr331592 1364 22 ------
NM_177424chr141989 1336 827 613 2220 160 ----
NM_177438chr1423864 697 1800 13201 --
NM_177559chr201213 ----1894
NM_177560chr201213 ----1894
NM_177937chr921164 629 --1325 --
NM_177947chrX------1408
NM_177948chrX------1408
NM_177969chr2177 148 3753 606 128 1662
NM_177995chr94526 392 344 320 --1327 --
NM_178011chr1073003 2014 1048 880 821 234 44 12731 12754 --
NM_178043chr4181 ------
NM_178140chr532630 1686 774 12364 32693 2607 561 --
NM_178151chrX137434 7347 7053 6940 5980 5698 4903 2919 2846 1444 1292 1122 225 27500 2965 46189 5466 2367 275 --
NM_178152chrX137434 7347 7053 6940 5980 5698 4903 2919 2846 1444 1292 1122 225 27500 2965 46189 5466 2367 275 --
NM_178153chrX137434 7347 7053 6940 5980 5698 4903 2919 2846 1444 1292 1122 225 27500 2965 46189 5466 2367 275 --
NM_178423chr73871 450 203 11218 11013 --
NM_178424chr51502 1491 ----
NM_178425chr73871 450 203 11218 11013 --
NM_178445chr32941 851 ------
NM_178505chr1043494 2532 2481 1123 --12918 --
NM_178578chr2042244 919 813 784 1803 31847 1678 138 --
NM_178585chr473012 2336 2315 1123 947 890 681 ------
NM_178812chr831529 1368 988 --21229 460 --
NM_178815chr1092751 1768 1761 1685 563 333 221 194 172 11746 1325 --
NM_180989chr1352328 1641 996 275 134 --11613 --
NM_181077chr1521890 67 1813 21608 611 --
NM_181265chr482389 2295 1241 933 878 826 155 72 ----1269
NM_181302chr142499 201 ------
NM_181308chr142499 201 ------
NM_181361chr321370 193 --2575 224 --
NM_181481chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_181482chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_181483chr1877087 6821 6203 5943 5257 4477 2304 1734 25452 1626 --
NM_181504chr584064 2961 1606 1574 1365 629 449 191 --13005 --
NM_181521chr16147256 6811 6777 6267 5811 5635 5563 5079 4452 2151 1704 1462 1086 586 15605 12515 --
NM_181523chr584064 2961 1606 1574 1365 629 449 191 --13005 --
NM_181524chr584064 2961 1606 1574 1365 629 449 191 --13005 --
NM_181571chr10----1170 1453
NM_181581chr73755 710 692 ------
NM_181671chr172900 314 ------
NM_181702chr84913 806 209 133 ----166
NM_181723chr81584 1880 ----
NM_181762chrX51108 1095 773 349 107 --11158 --
NM_181777chrX51108 1095 773 349 107 --11158 --
NM_181784chr262596 2568 744 733 594 289 ------
NM_181787chr883607 3584 3383 3173 2999 2981 2570 737 11166 ----
NM_181789chr1563232 2653 2488 964 556 257 12738 1110 --
NM_181836chr532441 2181 1886 ----12370
NM_181861chr1282054 1985 1879 1764 1749 933 799 189 --11954 --
NM_181868chr1282054 1985 1879 1764 1749 933 799 189 --11954 --
NM_181869chr1282139 2070 1964 1849 1834 1018 884 274 --22039 51 --
NM_181874chr341193 1071 401 74 --161 --
NM_181886chr441016 490 306 195 --125 --
NM_181887chr441016 490 306 195 --125 --
NM_181888chr441016 490 306 195 --125 --
NM_181889chr441016 490 306 195 --125 --
NM_181890chr441016 490 306 195 --125 --
NM_181891chr441016 490 306 195 --125 --
NM_181892chr441063 537 353 242 --172 --
NM_181893chr441016 490 306 195 --125 --
NM_181897chr352410 804 744 645 607 2537 170 12487 --
NM_182485chr432919 2580 370 11395 1547 --
NM_182493chr1694999 3840 3749 3731 3663 1799 1140 1073 564 24009 505 15299 --
NM_182503chr654172 918 890 108 40 11998 --13908
NM_182507chr122753 376 11719 --11703
NM_182522chr32540 202 1931 --11244
NM_182551chr273508 3394 2785 2701 1109 1021 179 --1236 --
NM_182646chr432919 2580 370 11395 1547 --
NM_182648chr141645 --2740 475 --
NM_182666chr3--1155 ----
NM_182700chr741765 1324 347 162 ------
NM_182717chr10----1575 --
NM_182718chr10----1170 1453
NM_182719chr10----1170 1453
NM_182720chr10----1575 --
NM_182721chr10----1575 --
NM_182722chr10----1575 --
NM_182723chr10----1575 --
NM_182724chr10----1170 1453
NM_182725chr10----1170 1453
NM_182757chr673508 3142 3128 1220 1159 377 76 12198 --11136
NM_182762chr7116255 4728 4277 4161 4142 4123 3952 1006 621 530 239 --95069 4834 4117 4077 4035 3992 3946 2270 1973 --
NM_182763chr152765 2241 906 408 76 1583 12027 --
NM_182765chr1061992 1950 891 849 555 67 --32153 567 24 --
NM_182767chr1231968 1954 393 ------
NM_182769chr10----1170 1453
NM_182770chr10----1170 1453
NM_182771chr10----1170 1453
NM_182772chr10----1170 1453
NM_182789chr52982 673 ----1183
NM_182830chr1452238 1565 647 548 219 --1213 22189 186
NM_182850chr10----1170 1453
NM_182853chr10----1575 --
NM_182896chr341286 1144 272 50 1494 --1201
NM_182898chr7105773 4727 2345 2038 1842 1479 1259 868 827 288 ----35252 2063 1128
NM_182899chr7105773 4727 2345 2038 1842 1479 1259 868 827 288 ----35252 2063 1128
NM_182907chr662046 2008 1668 1556 357 83 --2655 306 1691
NM_182943chr311064 ------
NM_182948chr153160 2627 1267 1073 555 23033 2424 ----
NM_182972chr142832 2735 2660 1977 12012 ----
NM_183011chr10----1575 --
NM_183012chr10----1575 --
NM_183013chr10----1575 --
NM_183043chr133805 783 414 1707 1237 --
NM_183044chr133805 783 414 1707 1237 --
NM_183049chr4179 ------
NM_183060chr10----1170 1453
NM_183078chr663148 3044 2608 1323 1032 570 23281 2822 11392 --
NM_183079chr2051525 1368 269 257 35 ------
NM_183227chr611408 11399 21460 1207 --
NM_183238chr1273790 3668 3288 3281 3152 2823 1210 --13884 --
NM_183323chr52982 673 ----1183
NM_183381chr32951 250 ----199
NM_183383chr32951 250 ----199
NM_183384chr32951 250 ----199
NM_183387chr144732 725 186 31 --1944 --
NM_183397chr20115095 4717 4229 3376 2043 1621 1553 1376 1320 1044 781 --11770 1148
NM_183398chr531007 70 46 --1976 --
NM_183399chr531007 70 46 --1976 --
NM_183400chr531007 70 46 --1976 --
NM_183401chr531007 70 46 --1976 --
NM_183419chr821211 312 1955 2998 988 --
NM_184234chr201342 --1718 --
NM_194247chr244212 2929 381 200 14312 14438 11230
NM_194271chr121747 ------
NM_194285chr1143371 1184 1176 524 23079 484 ----
NM_194286chr1275914 5677 5512 5249 3798 1890 521 --16175 --
NM_194291chr872615 2470 2031 1938 1878 1053 708 1143 33026 2323 2099 --
NM_194314chr1104285 4279 4272 1970 1924 1698 1125 650 397 241 24949 1024 35045 4749 4309 --
NM_194328chr943185 2085 2054 76 --1560 --
NM_194329chr943185 2085 2054 76 --1560 --
NM_194330chr943185 2085 2054 76 --1560 --
NM_194332chr943185 2085 2054 76 --1560 --
NM_194434chr1874060 3951 3682 1794 1146 808 343 25285 4353 24840 4249 --
NM_194442chr13579 262 167 21434 188 ----
NM_194449chr182227 138 ------
NM_194454chr741611 1401 338 247 --21097 654 --
NM_194455chr741611 1401 338 247 --21097 654 --
NM_194456chr741611 1401 338 247 --21097 654 --
NM_194463chrX2173 165 1903 ----
NM_197968chr131256 --1149 --
NM_197970chr231169 1102 295 1243 1256 --
NM_198066chr1441013 492 245 92 --12123 13033
NM_198128chr1831503 467 84 --11772 1402
NM_198158chr363043 2364 1912 676 618 132 12260 13062 166
NM_198159chr363043 2364 1912 676 618 132 12260 13062 166
NM_198177chr363043 2364 1912 676 618 132 12260 13062 166
NM_198178chr363043 2364 1912 676 618 132 12260 13062 166
NM_198240chr1231003 912 330 ------
NM_198243chr15--1626 1733 --
NM_198256chr231980 1511 559 ----1578
NM_198273chr552306 2192 1127 701 255 11980 ----
NM_198279chrX2477 106 --21108 122 --
NM_198281chr4103415 3242 3111 2552 2290 1171 1056 465 340 156 ------
NM_198318chr19------1158
NM_198319chr19------1158
NM_198320chr12105134 5042 4802 4600 3221 1908 1827 1035 853 253 --12026 --
NM_198381chr1131321 387 105 ----11356
NM_198400chr1541900 1050 383 48 12674 12667 --
NM_198465chrX62660 2058 2030 974 486 241 11041 ----
NM_198468chr654644 3103 2932 1326 1065 13352 24443 1488 1846
NM_198503chr152110 683 554 275 122 11708 ----
NM_198513chr891986 1886 1661 1563 687 681 643 470 161 1777 11978 --
NM_198549chr132696 680 430 --23113 2170 --
NM_198560chr373580 3379 3013 2678 2514 798 36 1235 23463 1047 --
NM_198566chr52153 135 ------
NM_198581chr297355 7230 6638 6289 6049 4810 4790 1201 309 35799 2502 211 87454 4693 2457 1291 1125 687 187 148 12194
NM_198679chr942683 2638 2553 308 12306 ----
NM_198793chr353397 3387 709 358 331 12587 23933 1665 --
NM_198794chr144988 513 483 319 ------
NM_198829chr7--1952 ----
NM_198830chr17--1648 ----
NM_198859chr384355 3645 1609 1597 1319 1307 1037 663 14430 ----
NM_198889chr421267 21 1149 2548 264 --
NM_198896chr1152114 1855 1530 1373 439 11879 1244 --
NM_198900chr1297465 6979 6652 5406 5229 4971 1749 1283 943 27057 286 11999 --
NM_198903chr52448 81 ----1558
NM_198904chr54846 808 448 81 --21843 1687 32053 1700 558
NM_198956chr741765 1324 347 162 ------
NM_198965chr12------1463
NM_198966chr12------1463
NM_198968chr1353781 3244 3168 2870 1041 --43674 3145 1011 578 --
NM_198992chr121162 1457 ----
NM_199003chr841472 511 342 28 --11189 --
NM_199044chr142709 2206 1079 1060 --1567 --
NM_199072chr742249 1972 445 133 12286 12350 1235
NM_199131chr1012598 12237 21365 1188 --
NM_199168chr1011190 ------
NM_199188chr1243567 1446 920 652 23891 440 --13727
NM_199189chr54935 889 847 63 ------
NM_199190chr1243567 1446 920 652 23891 440 --13727
NM_199229chr231426 1329 181 --11646 --
NM_199246chr541204 1177 971 294 --11080 --
NM_199324chr453668 3245 2759 2313 1277 --23474 822 --
NM_199421chr1494803 4782 4320 4270 3789 3103 987 646 383 44742 1135 548 421 24037 2047 --
NM_199436chr252597 2191 814 759 290 ------
NM_199440chr21131 --175 --
NM_199454chr144747 1407 450 438 --11418 --
NM_199461chr1052874 856 844 766 732 --1782 --
NM_199478chrX31821 1516 1288 ------
NM_199482chr231976 727 456 --12014 --
NM_201263chr141961 1820 1714 162 11722 ----
NM_201266chr242894 2874 2289 637 22064 1891 197 --
NM_201279chr242894 2874 2289 637 22064 1891 197 --
NM_201428chr11--1412 --1562
NM_201429chr11--1412 --1562
NM_201430chr11--1338 --1488
NM_201437chr81304 1135 11485 --
NM_201439chr121396 ------
NM_201440chr121396 ------
NM_201515chr121396 ------
NM_201559chr694873 4531 4083 3751 1726 1342 1263 1089 433 14926 21945 1143 14635
NM_201570chr1051818 1734 1512 1402 51 11838 11380 --
NM_201571chr1051818 1734 1512 1402 51 11838 11380 --
NM_201572chr1051818 1734 1512 1402 51 11838 11380 --
NM_201590chr1051818 1734 1512 1402 51 11838 11380 --
NM_201593chr1051818 1734 1512 1402 51 11838 11380 --
NM_201596chr1051818 1734 1512 1402 51 11838 11380 --
NM_201597chr1051818 1734 1512 1402 51 11838 11380 --
NM_203291chr18--1197 ----
NM_203292chr18--1190 ----
NM_203301chr1441691 1650 516 276 --21501 389 --
NM_203349chr1542138 2028 1958 1561 ------
NM_203354chr146908 774 620 354 264 203 ------
NM_203355chr146908 774 620 354 264 203 ------
NM_203356chr146908 774 620 354 264 203 ------
NM_203372chr241666 1175 1168 341 --11091 --
NM_203390chr83639 290 118 --31175 699 589 --
NM_203394chr1272311 2007 1998 1754 776 666 129 --22510 2432 --
NM_203403chr931180 1073 516 --2973 101 1876
NM_203406chr522389 2025 12649 --2579 341
NM_203446chr2182939 2779 2529 2423 2385 2214 537 83 ------
NM_203458chr153022 2918 1517 1080 218 33486 1214 231 11405 13159
NM_203487chr1321573 1166 --2121 28 --
NM_203499chr171750 ------
NM_205768chr131455 403 121 ----22022 1618
NM_205842chr21636 ------
NM_205860chr182954 2870 2693 2399 1202 482 375 159 11029 ----
NM_206594chr143408 3389 884 500 11105 12537 --
NM_206595chr143408 3389 884 500 11105 12537 --
NM_206852chr141649 --1117 1537
NM_206853chr663426 2875 2746 1571 723 504 21028 93 33644 1383 1139 --
NM_206854chr694687 4136 4007 3556 3272 1984 1765 500 493 11354 24905 135 --
NM_206855chr685652 5101 4972 4521 4237 1465 1458 614 12319 35870 1100 624 --
NM_206857chr141649 --1117 1537
NM_206866chr2172423 2257 1238 1182 275 263 75 --12045 --
NM_206876chr242627 1190 875 538 2737 121 12994 --
NM_206907chr553263 3084 2671 432 98 --1479 --
NM_206909chr8177721 7700 6930 6605 6203 6042 5703 5083 3221 3158 2605 1942 1568 1429 1296 1203 769 13325 --11999
NM_206933chr12312 26 12852 --22655 644
NM_206937chr135944 818 356 175 152 ------
NM_207009chr105928 821 788 235 143 ------
NM_207012chr1053417 2925 2217 2201 1309 1929 1314 --
NM_207015chr31429 1489 --12054
NM_207303chr1052688 2563 1533 533 143 --1997 13320
NM_207304chr1352043 1709 1614 806 220 2923 756 ----
NM_207321chr1031138 1078 979 --1929 --
NM_207337chr123954 247 131 --1297 --
NM_207372chr1061955 921 910 868 636 319 --2536 245 --
NM_207391chr1941150 1094 506 191 ------
NM_207404chr361608 681 607 107 91 71 1100 ----
NM_207422chrX51300 1192 1161 927 141 ------
NM_207506chr83567 298 96 --1533 --
NM_207518chr191166 --11262 --
NM_212471chr1721885 615 12062 1911 11700
NM_212472chr1721885 615 12062 1911 11700
NM_212558chr952854 2615 952 289 107 --23315 131 --
NM_213589chr284888 3899 3538 2214 1744 1154 436 261 24810 409 13980 --
NM_213594chr121849 1880 ----
NM_213606chr1042646 659 318 219 ------
NM_213654chr32651 157 11278 ----
NM_213662chr1752486 555 222 197 68 --1660 --