TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-155-3p
miRNA Sequence: CUCCUACAUAUUAGCAUUAACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr645858 1994 390 67 22044 354 17011 25048 1595
NM_001003674chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_001003675chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_001009899chr341801 1317 366 316 --16157 24062 142
NM_001012753chr1921017 227 ----5892 808 370 268 186
NM_001014797chr10106813 6783 6670 6464 6450 6102 6051 2969 2067 885 37632 5698 2649 15291 26439 5239
NM_001204chr246240 5255 2315 916 12478 12170 12923
NM_004338chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_017848chrX93705 3544 3487 3277 914 899 893 424 121 21570 791 23472 3086 --
NM_020718chr1656106 5020 1006 640 440 22621 980 25177 5014 25520 2635
NM_021116chr7108746 8013 7954 6430 3497 2300 1831 1666 1327 459 48043 515 282 41 48918 8226 3196 1549 13420
NM_033083chr373187 2794 2456 2266 954 413 115 ----22999 710
NM_152605chr19------4884 477 142 58
NM_152636chr111954 --33000 2347 572 32665 630 377
NM_181481chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_181482chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_181483chr1866041 1850 1335 1250 420 251 --36490 6404 1240 25684 4658
NM_194285chr1133438 391 285 11090 --23003 1347