TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-15a-3p
miRNA Sequence: CAGGCCAUAUUGUGCUGCCUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1252293 1834 1629 247 195 ------
NM_000021chr1421104 962 ------
NM_000038chr52772 175 ------
NM_000051chr1121150 218 --22619 178 13357
NM_000053chr1351994 775 610 212 181 ------
NM_000070chr151540 ------
NM_000081chr131696 1396 1170 ------
NM_000084chrX116575 6066 5879 5803 5746 5293 4469 2795 2135 2073 1645 16930 14318 --
NM_000089chr71324 ------
NM_000091chr252701 2324 1985 1769 1763 ------
NM_000092chr264529 4164 4053 3837 257 28 13900 ----
NM_000093chr921947 625 ------
NM_000104chr21398 12409 ----
NM_000109chrX--1833 1557 --
NM_000110chr1------11108
NM_000125chr683702 3297 3005 1238 1125 694 396 136 13319 1121 --
NM_000129chr651168 602 354 297 38 21472 1286 ----
NM_000138chr1552517 2411 1934 928 788 ----11025
NM_000141chr1021049 495 --11116 --
NM_000163chr552289 1981 572 360 302 --11720 --
NM_000167chrX1624 1153 ----
NM_000189chr241489 927 856 99 11567 12237 --
NM_000214chr2031814 1537 291 1135 ----
NM_000217chr121797 1263 1735 11121
NM_000222chr451941 1629 369 149 52 11917 ----
NM_000232chr422537 2188 --22501 2262 21293 137
NM_000237chr831697 617 212 --11832 --
NM_000248chr322993 879 ------
NM_000252chrX1993 11306 ----
NM_000258chr3----1229 --
NM_000259chr1515003 15479 --11752
NM_000271chr181531 ------
NM_000278chr1062220 2090 1547 1528 851 757 ------
NM_000280chr111102 ------
NM_000297chr411809 --11608 --
NM_000314chr1012883 ------
NM_000319chr1221148 481 ------
NM_000321chr1331437 300 95 ----11131
NM_000330chrX42109 2053 1591 412 ------
NM_000332chr6137044 6772 6222 6195 5198 4678 4609 4570 2845 2075 1707 1161 800 12595 25327 1881 --
NM_000333chr31254 1961 ----
NM_000334chr1742098 408 354 300 11569 21834 824 --
NM_000337chr575651 4824 4131 1625 1540 593 51 35884 1591 599 25798 804 1858
NM_000338chr15--1275 11102 --
NM_000340chr321195 430 ------
NM_000345chr41240 1859 ----
NM_000378chr1131020 905 180 --1858 --
NM_000386chr17----1662 --
NM_000391chr1121644 1355 --3450 415 26 --
NM_000393chr22150 106 11699 1136 --
NM_000399chr101953 --1471 --
NM_000406chr41537 --12518 --
NM_000408chr223103 2711 ----13238
NM_000429chr10101793 1680 1659 1576 1435 1395 1230 156 48 25 --11263 --
NM_000430chr1733015 2374 702 --1383 --
NM_000439chr552534 1725 1608 1558 720 ------
NM_000448chr1152567 2069 1296 485 368 --13101 --
NM_000451chrX1401 ------
NM_000461chr354069 3938 1817 1079 445 --1521 --
NM_000480chr1131116 653 410 ------
NM_000484chr212751 215 ------
NM_000489chrX23014 1078 ------
NM_000530chr13755 377 69 ------
NM_000533chrX2703 472 ------
NM_000555chrX66746 6584 5253 5149 5135 2448 14864 35483 4785 1605 --
NM_000599chr283976 3740 3528 3501 3137 3084 3064 424 ------
NM_000600chr71333 ------
NM_000609chr1033011 691 368 ------
NM_000611chr11146473 6049 5415 5402 4973 4758 4699 4544 4301 2709 2320 1530 1325 735 11756 11899 --
NM_000612chr1183402 2867 2795 2679 545 394 358 234 ------
NM_000615chr1132679 2410 1143 --22214 1921 --
NM_000618chr1256566 5507 4369 529 199 --14696 --
NM_000618chr1256566 5507 4369 529 199 --14696 --
NM_000621chr1311170 --1434 --
NM_000633chr18105048 4222 3414 3256 1356 1311 1075 1042 566 449 ----11863
NM_000693chr1511489 ------
NM_000701chr11318 ------
NM_000721chr151978 1957 1650 630 517 1349 1291 --
NM_000724chr102215 206 ------
NM_000738chr111109 --1936 --
NM_000756chr81332 ------
NM_000767chr1931249 434 69 ------
NM_000792chr14992 903 782 79 ------
NM_000793chr1453934 1247 1124 1101 1068 24171 97 --13608
NM_000801chr203988 715 325 ------
NM_000806chr511982 ------
NM_000807chr41657 ------
NM_000813chr535408 1162 680 2832 128 --14043
NM_000814chr1523600 556 ------
NM_000817chr2--1270 ----
NM_000826chr41586 --12586 --
NM_000827chr542432 1788 1676 907 12152 ----
NM_000831chr1116070 5758 5209 4846 4356 4151 1540 1153 1012 749 456 ------
NM_000839chr31489 ------
NM_000845chr71411 ------
NM_000859chr531232 1205 1139 1529 ----
NM_000865chr61202 ------
NM_000868chrX31883 1624 79 ------
NM_000875chr15166999 6808 6116 6107 5953 5124 4757 4470 4423 4413 4403 2098 1922 1840 893 424 --14654 --
NM_000876chr631351 1082 206 ------
NM_000880chr81118 ------
NM_000895chr121106 ------
NM_000899chr1253690 1631 933 418 340 --13363 --
NM_000901chr421885 671 --22259 1696 12172
NM_000909chr42820 21 ------
NM_000912chr842322 2311 2240 321 --31355 545 134 --
NM_000919chr51156 ------
NM_000921chr121112 1443 ----
NM_000926chr1167881 7329 6674 3711 2373 2360 17957 12497 28039 772
NM_000933chr201451 --11193 --
NM_000944chr441776 957 816 523 ------
NM_000945chr22375 266 ----11726
NM_000950chrX53268 3008 2452 2282 485 ------
NM_000965chr31349 1922 ----
NM_001001132chr2121111 272 ------
NM_001001323chr1223030 562 --12570 --
NM_001001331chr332475 1884 465 12431 1498 --
NM_001001342chr1041412 1401 1037 389 --11154 --
NM_001001344chrX22220 678 --12443 --
NM_001001394chr21197 1686 ----
NM_001001396chr134166 3964 3385 13206 ----
NM_001001433chr2032431 1290 62 --13027 --
NM_001001481chr8----12521 --
NM_001001484chr101622 --11664 --
NM_001001523chr131237 1083 148 --136 --
NM_001001549chr732685 2227 283 --1822 --
NM_001001550chr732685 2227 283 --1822 --
NM_001001555chr732685 2227 283 --1822 --
NM_001001557chr83704 611 331 ------
NM_001001664chr213290 23452 589 12839 --
NM_001001668chr1943985 3839 3231 982 1468 ----
NM_001001684chr1732388 2130 1598 11713 1280 --
NM_001001924chr821374 1342 ------
NM_001001925chr821374 1342 ------
NM_001001931chr821374 1342 ------
NM_001001933chr12563 155 ------
NM_001002252chr122205 61 ------
NM_001002257chr212466 --33521 3244 970 --
NM_001002265chr101127 --1276 --
NM_001002266chr101127 --1276 --
NM_001002843chr1521064 457 --1872 --
NM_001002860chr1424076 3055 --14715 --
NM_001002909chr173705 424 136 ------
NM_001003406chr2273257 2669 2159 951 920 184 174 --22682 2499 --
NM_001003679chr12321 274 ----1628
NM_001003694chr31105 ------
NM_001003712chr1263810 2747 1017 566 76 48 ------
NM_001003760chr61220 11393 1149 --
NM_001003792chr331062 196 71 --1185 11168
NM_001003793chr331062 196 71 --1185 11168
NM_001003794chr342587 1908 1105 436 --42984 79 65 30 --
NM_001003800chr933529 1447 710 --1478 --
NM_001003895chrY174 ------
NM_001003937chr231676 471 326 --21450 412 --
NM_001003940chr15113801 3599 3368 3337 3147 2948 2937 2720 1091 959 458 22530 2484 ----
NM_001003942chr15113801 3599 3368 3337 3147 2948 2937 2720 1091 959 458 22530 2484 ----
NM_001003943chr15113805 3603 3372 3341 3151 2952 2941 2724 1095 963 462 22534 2488 ----
NM_001004065chr953383 2888 2734 2451 1401 --12713 --
NM_001004127chr131248 ------
NM_001004128chr15500 477 431 257 47 ------
NM_001004196chr31950 21121 39 ----
NM_001004304chr1283036 1144 797 729 600 157 74 67 --12957 --
NM_001004308chrX21485 428 1452 ----
NM_001004317chr634144 3108 820 14051 ----
NM_001004342chr1146019 5269 4803 4520 4250 3812 2432 2291 2040 1763 1725 1144 974 379 --1640 --
NM_001004360chr21402 ------
NM_001005209chr25730 524 162 121 84 ------
NM_001005242chr121229 --1258 --
NM_001005266chr153756 617 254 ------
NM_001005267chr153756 617 254 ------
NM_001005268chr153756 617 254 ------
NM_001005269chr153756 617 254 ------
NM_001005271chr1731108 406 249 ------
NM_001005273chr1731108 406 249 ------
NM_001005290chr13450 419 105 ------
NM_001005353chr131248 800 517 ------
NM_001005353chr131248 800 517 ------
NM_001005375chrY11368 --11391 --
NM_001005386chr221870 602 1760 ----
NM_001005404chr1751096 910 695 607 219 --1339 --
NM_001005463chr1012288 --11026 --
NM_001005473chr526554 5041 ----11757
NM_001005505chr32436 143 --11359 --
NM_001005609chrX43338 1273 685 577 11137 13709 --
NM_001005781chr2----199 --
NM_001005845chr821212 30 --11833 --
NM_001006600chr52953 477 ------
NM_001006610chr1611007 ------
NM_001006617chr91217 ------
NM_001006619chr91217 ------
NM_001006620chr91217 ------
NM_001006621chr91217 ------
NM_001006623chr24742 429 374 113 --22550 357 --
NM_001006634chr162212 140 --1509 --
NM_001006657chr2154 21168 976 --12230
NM_001006665chr11578 --1801 --
NM_001007023chr1453934 1247 1124 1101 1068 24171 97 --13608
NM_001007024chr1773729 3374 3277 2761 736 151 50 ------
NM_001007025chr1773729 3374 3277 2761 736 151 50 ------
NM_001007067chr81136 --1969 --
NM_001007068chr81136 --1969 --
NM_001007069chr81136 --1969 --
NM_001007070chr81136 --1969 --
NM_001007098chr12949 306 ------
NM_001007099chr1----1246 --
NM_001007100chr1----1246 --
NM_001007156chr1511775 ------
NM_001007246chr2111673 ------
NM_001007271chr102762 396 ------
NM_001007466chr654517 3255 1295 973 915 14493 ----
NM_001007538chr132631 576 --21746 115 11476
NM_001007559chr1821832 535 ------
NM_001007565chr32330 45 ------
NM_001008220chr5103895 3604 2990 2806 2595 852 618 440 393 110 ----1821
NM_001008222chrX31240 337 121 --1265 --
NM_001008239chr1843546 1375 927 868 11295 13733 --
NM_001008388chr42407 57 ------
NM_001008392chr373199 2908 1341 1322 1295 130 49 --23284 3162 --
NM_001008408chr7125635 5604 4659 4127 2171 1785 1017 982 902 851 717 307 1768 34096 801 746 --
NM_001008495chr82913 744 1230 ----
NM_001008529chr17--11269 11302 --
NM_001008541chr1031990 1948 402 --12119 --
NM_001008541chr1031990 1948 402 --12119 --
NM_001008564chr1311875 ------
NM_001008660chr1111385 ------
NM_001008701chr19102972 2825 2572 2379 2279 2151 2046 1044 748 30 ------
NM_001008707chr143712 421 317 11630 ----
NM_001008738chr542668 2503 2016 367 --1168 --
NM_001008895chr1321458 584 11343 ----
NM_001009185chr51684 1675 ----
NM_001009552chr8147 ------
NM_001009554chr453560 2948 1633 1257 976 ------
NM_001009554chr453560 2948 1633 1257 976 ------
NM_001009555chr441733 1418 1360 1256 ------
NM_001009880chr2294732 4348 4275 4184 3364 3315 3170 3136 1709 --1558 --
NM_001009881chr1--129 ----
NM_001009882chr1--129 ----
NM_001009909chr1143325 2594 1576 253 ----13951
NM_001009958chr7----1232 --
NM_001009993chr263774 3707 3632 2808 737 190 13889 ----
NM_001010861chr1--1730 11071 --
NM_001010867chr1146643 5467 5364 2337 1742 1627 1448 1417 1156 1082 1005 804 218 58 1500 22194 1477 --
NM_001010888chrX53561 1428 664 640 626 --1523 13692
NM_001010891chr5106435 5578 5111 4983 4932 2714 879 661 422 21 ------
NM_001010908chr10154 ------
NM_001010917chr102248 34 --22002 597 --
NM_001010986chrX31976 223 163 ----11953
NM_001011513chr443926 1096 166 113 --13179 --
NM_001011545chr212235 207 ------
NM_001011666chr765164 4196 2354 1554 121 22 ------
NM_001011708chr222540 339 --11092 --
NM_001011713chr1411065 ------
NM_001012420chr1522001 184 ------
NM_001012423chr1522001 184 ------
NM_001012426chr693279 2850 2535 2380 2270 1162 1041 521 209 ------
NM_001012427chr693279 2850 2535 2380 2270 1162 1041 521 209 ------
NM_001012751chr10----11811 --
NM_001012755chrX51396 1014 907 626 453 ------
NM_001012756chr1963173 3140 2894 2714 2676 2549 11134 ----
NM_001012761chr532530 1926 931 ------
NM_001012989chrX----1638 --
NM_001013399chr6------11110
NM_001013415chr41127 ------
NM_001013438chr31627 ------
NM_001013620chr1298384 7010 6003 5965 3383 3039 2102 678 475 21671 943 ----
NM_001013690chr1242488 2358 603 542 11874 ----
NM_001014283chr1351772 1702 1642 1598 1575 ------
NM_001014797chr1097316 6459 5435 2775 2276 2254 594 535 58 18027 ----
NM_001014809chr44808 794 688 650 ------
NM_001014839chr13878 789 131 ------
NM_001014841chr13878 789 131 ------
NM_001015053chr1741506 611 575 160 ------
NM_001015877chrX23040 1205 ------
NM_001015881chrX1147 --11119 --
NM_001015887chr331550 1281 1272 ------
NM_001017371chr211223 ------
NM_001017395chr343182 2887 527 318 11114 12543 12735
NM_001017396chr21388 --11734 --
NM_001017415chr11115 ------
NM_001017416chr11115 ------
NM_001017916chr1762034 1944 1597 1521 579 405 --1632 11433
NM_001017917chr1762034 1944 1597 1521 579 405 --1632 11433
NM_001017923chr141254 ----1508
NM_001017926chr831596 1438 1426 ------
NM_001017930chrX----1224 --
NM_001017989chr194851 803 784 21 166 ----
NM_001017995chr584527 4012 3370 1331 1111 1102 463 45 13765 1378 --
NM_001018050chr2283062 2900 2538 1382 1297 950 595 51 --1764 --
NM_001018052chr2283062 2900 2538 1382 1297 950 595 51 --1764 --
NM_001018054chr12905 270 11336 ----
NM_001018057chr111128 --1307 --
NM_001018064chr931747 818 326 12109 --1579
NM_001018065chr9115757 5706 5564 5389 5241 4765 4655 1451 1326 1313 305 --11491 --
NM_001018066chr9115757 5706 5564 5389 5241 4765 4655 1451 1326 1313 305 --11491 --
NM_001018067chr134605 686 461 35036 4276 3475 ----
NM_001018068chr134605 686 461 35036 4276 3475 ----
NM_001018069chr134605 686 461 35036 4276 3475 ----
NM_001018090chr152841 245 ------
NM_001018091chr152951 355 ------
NM_001018102chr152841 245 ------
NM_001018108chr1541787 1748 1395 900 22051 546 21996 1549 --
NM_001018111chr743843 3585 3055 1376 --11614 --
NM_001024070chr14--1172 ----
NM_001024226chr13776 350 307 11062 ----
NM_001024227chr13776 350 307 11062 ----
NM_001024228chr13776 350 307 11062 ----
NM_001024647chr1276650 6386 5147 5093 4778 2756 50 --1445 --
NM_001024649chr542880 794 776 725 1334 ----
NM_001024688chr821785 703 --21444 578 1120
NM_001024847chr312227 ------
NM_001024858chr1482832 2645 2225 1848 1078 537 498 66 --12824 --
NM_001024934chr6--1192 ----
NM_001024935chr6--1192 ----
NM_001024936chr6--1192 ----
NM_001024948chr1--1620 13531 --
NM_001025076chr1056225 5275 2242 1253 976 ------
NM_001025077chr1077583 6633 4977 4865 2611 2334 1283 1501 ----
NM_001025079chr332645 415 325 --179 1796
NM_001025105chr521265 508 ------
NM_001025107chr132642 2095 82 1999 ----
NM_001025107chr132642 2095 82 1999 ----
NM_001025108chr273007 2970 2938 2786 1486 47 35 ------
NM_001025201chr21707 ------
NM_001025233chr1242683 1923 1908 453 12663 12279 --
NM_001025266chr364272 4260 3699 877 588 299 14040 23928 1795 11448
NM_001025389chr1131116 653 410 ------
NM_001025390chr1131116 653 410 ------
NM_001025579chr17134 ------
NM_001025580chrX34256 3348 3162 174 14189 --
NM_001025595chr421479 259 ------
NM_001025780chr921160 1127 ------
NM_001029863chr612385 ----12289
NM_001029870chr42424 105 --1489 --
NM_001029882chr1146 ------
NM_001029882chr1146 ------
NM_001029989chr151610 ------
NM_001030007chr1663584 2480 1303 1083 848 323 --11597 --
NM_001030055chr1433933 1006 716 --21148 789 --
NM_001030272chr111329 ------
NM_001030273chr111329 ------
NM_001031623chr621303 32 --1703 --
NM_001031679chr1242557 2308 2199 687 11196 3419 332 283 --
NM_001031680chr141887 838 654 114 ------
NM_001031684chr211323 --1189 --
NM_001031690chr793075 2439 2274 752 590 511 460 225 49 11960 ----
NM_001031695chr2225381 501 11615 ----
NM_001031716chr211006 ------
NM_001031732chr483227 3031 2830 2234 1401 1295 1281 681 --12794 12812
NM_001031804chr1653459 2690 1430 1039 827 ------
NM_001032282chr8289 38 ----1898
NM_001032283chr122870 32 1999 ----
NM_001032284chr122870 32 1999 ----
NM_001032293chr17----1220 --
NM_001032296chr1342447 2356 1077 891 ------
NM_001032363chr151892 604 442 265 203 --1244 --
NM_001032363chr151892 604 442 265 203 --1244 --
NM_001032380chr10----21976 359 --
NM_001033047chr462464 2427 972 496 382 153 --1850 12640
NM_001033059chr62755 394 ------
NM_001033081chr141549 1479 658 240 ------
NM_001033082chr141549 1479 658 240 ------
NM_001033087chr2052661 1023 968 807 300 --13127 --
NM_001033112chr51789 --1214 --
NM_001033117chr364455 686 96 69 59 29 24673 3385 1287 --
NM_001033507chr151886 1692 1566 1344 70 --11261 --
NM_001033518chr742098 876 193 45 ------
NM_001033519chr742098 876 193 45 ------
NM_001033520chr742098 876 193 45 ------
NM_001033551chr17153531 3300 3221 3098 3018 2957 1516 1083 1052 914 862 826 737 492 279 1529 23439 2567 --
NM_001033557chr221179 1168 --123 --
NM_001033566chr172804 213 --1278 --
NM_001033568chr172804 213 --1278 --
NM_001033602chr1342296 2244 2237 1748 ------
NM_001033667chr13572 285 216 --1772 --
NM_001033925chr1042081 1858 1591 291 ------
NM_001034954chr1042210 864 790 691 ------
NM_001034955chr1042210 864 790 691 ------
NM_001034956chr1042210 864 790 691 ------
NM_001034957chr1042210 864 790 691 ------
NM_001035chr11405 ------
NM_001035254chr932081 1043 428 12232 ----
NM_001035511chr131384 690 253 1329 ----
NM_001035512chr131491 797 360 1436 ----
NM_001035513chr131491 797 360 1436 ----
NM_001037164chr751565 1426 289 194 46 1602 ----
NM_001037317chr1--1730 11071 --
NM_001037324chr32747 24 ------
NM_001037339chr131417 1151 114 --1263 --
NM_001037340chr131417 1151 114 --1263 --
NM_001037341chr131417 1151 114 --1263 --
NM_001037341chr131417 1151 114 --1263 --
NM_001037533chr11274 1304 ----
NM_001037582chr421137 419 --152 --
NM_001037954chr1142138 391 323 139 --12174 --
NM_001038702chr552780 2714 959 923 620 ------
NM_001039199chr2064905 4090 3272 1576 1251 797 13071 11126 --
NM_001039459chr72921 232 ----1423
NM_001039479chr1452284 1646 839 782 512 ------
NM_001039538chr253621 2722 2685 801 213 --13289 13259
NM_001039583chr221106 --1187 --
NM_001039584chr221106 --1187 --
NM_001039590chrX13571 --2661 212 --
NM_001039591chrX13571 --2661 212 --
NM_001039618chr1164779 4237 4033 3888 1647 925 14365 1562 --
NM_001039690chr16122184 1913 1538 800 784 762 723 610 585 487 348 237 --1285 --
NM_001039711chr12846 365 ------
NM_001039712chr12846 365 ------
NM_001039715chr14992 903 782 79 ------
NM_001039716chr141056 967 846 143 ------
NM_001039840chrX12046 25365 4802 179 --
NM_001039877chr191105 --2728 235 --
NM_001039937chr1323894 2634 --11198 11164
NM_001040057chr7------11025
NM_001040142chr21260 ------
NM_001040143chr21260 ------
NM_001040144chr16122184 1913 1538 800 784 762 723 610 585 487 348 237 --1285 --
NM_001040146chr16122184 1913 1538 800 784 762 723 610 585 487 348 237 --1285 --
NM_001040152chr714561 --23886 1967 --
NM_001040153chr131684 ------
NM_001040214chr63775 366 60 --1834 1920
NM_001040284chr1694713 4671 4384 1620 1551 1361 1059 1008 312 --24909 1240 --
NM_001040402chr42928 397 ------
NM_001040409chr22836 743 ------
NM_001040429chr1312920 ------
NM_001040441chr134679 227 74 --14097 --
NM_001040446chr541887 999 292 251 --12262 --
NM_001040624chr852705 2296 1920 1016 606 12561 ----
NM_001040625chr852705 2296 1920 1016 606 12561 ----
NM_001040626chr852705 2296 1920 1016 606 12561 ----
NM_001040627chr852705 2296 1920 1016 606 12561 ----
NM_001040628chr852705 2296 1920 1016 606 12561 ----
NM_001040629chr852705 2296 1920 1016 606 12561 ----
NM_001040630chr852705 2296 1920 1016 606 12561 ----
NM_001040709chr152199 839 555 177 113 ------
NM_001040712chr923333 389 --13443 --
NM_001040715chr1631040 936 824 --2478 345 --
NM_001042353chr202386 198 1494 ----
NM_001042361chr1041492 1105 585 201 ------
NM_001042364chr1041492 1105 585 201 ------
NM_001042365chr1041492 1105 585 201 ------
NM_001042387chr1041492 1105 585 201 ------
NM_001042393chr1041492 1105 585 201 ------
NM_001042396chr1041492 1105 585 201 ------
NM_001042397chr1041492 1105 585 201 ------
NM_001042404chr121892 42 --11375 --
NM_001042413chr933086 2697 493 ------
NM_001042424chr442764 1092 825 523 11249 ----
NM_001042486chr2031275 1121 157 ------
NM_001042498chrX----1119 --
NM_001042537chrX1504 --12205 --
NM_001042550chr93666 612 192 11622 ----
NM_001042552chr12934 585 ------
NM_001042555chr1244242 3447 435 334 --1482 --
NM_001042599chr287345 7238 1369 1002 785 703 571 76 12258 ----
NM_001042601chr32834 694 --1658 --
NM_001042603chr12104932 4783 4031 4020 3993 1473 933 739 341 141 14145 21057 113 --
NM_001042604chr334398 503 325 ------
NM_001042632chr2041938 1897 298 107 ------
NM_001042633chr2041938 1897 298 107 ------
NM_001042683chr611148 1151 ----
NM_001042749chrX1258 ------
NM_001042750chrX1258 ------
NM_001042751chrX1258 ------
NM_001043351chr132105 1609 1452 ------
NM_001044305chr61146 ------
NM_001050chr1731213 101 73 11228 ----
NM_001068chr31214 187 ----
NM_001071775chr1311962 1169 ----
NM_001079874chr1----1193 --
NM_001083620chr41585 --12584 --
NM_001092chr1752372 2365 1731 585 526 ------
NM_001094chr172870 88 ------
NM_001095chr1241781 1741 1486 1212 11943 ----
NM_001106chr3137814 7637 6944 6893 6783 3622 2812 2691 2106 1944 1546 1387 869 --13787 19490
NM_001111chr132642 2095 82 1999 ----
NM_001113490chrX33532 3475 1259 ------
NM_001128chr1663584 2480 1303 1083 848 323 --11597 --
NM_001144chr161130 ------
NM_001146chr811913 ------
NM_001148chr422229 1690 1256 11938 1839
NM_001160chr1252377 1100 1086 821 397 --1785 --
NM_001173chr1433933 1006 716 --21148 789 --
NM_001177chr1242203 2058 1791 716 12292 ----
NM_001178chr111329 ------
NM_001198chr662339 2036 975 861 469 73 ------
NM_001204chr227068 285 ------
NM_001206chr942837 2282 1185 433 ------
NM_001219chr711739 11953 ----
NM_001222chr1051770 1721 624 476 388 --21736 1408 --
NM_001237chr43861 823 113 ------
NM_001237chr43861 823 113 ------
NM_001241chr261862 1505 951 802 456 374 ------
NM_001241chr261862 1505 951 802 456 374 ------
NM_001256chr1732485 2177 2062 12096 ----
NM_001257chr1611263 ------
NM_001259chr786176 5494 5438 4622 4126 2310 1576 1046 153 11261 --
NM_001271chr1582850 2584 2072 876 716 386 237 57 --12687 --
NM_001278chr101114 ------
NM_001280chr193696 444 36 --1173 --
NM_001299chr191518 ------
NM_001304chr173576 367 340 ------
NM_001313chr44808 794 688 650 ------
NM_001326chr11------1339
NM_001329chr1011074 --192 --
NM_001331chr1161085 1060 920 772 516 314 ------
NM_001343chr5149 --1208 --
NM_001346chr332443 1746 420 1265 11048 --
NM_001356chrX1919 1970 ----
NM_001357chr11278 ------
NM_001364chr1134714 3640 3387 --11038 --
NM_001365chr172616 57 ------
NM_001386chr822128 1539 1700 ----
NM_001389chr211474 ------
NM_001390chr1853086 2210 1011 648 98 12844 1991 --
NM_001391chr18----11114 --
NM_001396chr215835 816 788 742 322 ------
NM_001399chrX43338 1273 685 577 11137 13709 --
NM_001401chr911132 ------
NM_001402chr631996 1808 1401 ------
NM_001406chr1731323 671 481 21416 1404 ----
NM_001419chr1963858 3211 1602 1378 1271 878 14779 14578 --
NM_001420chr19----1361 --
NM_001427chr721723 464 1434 ----
NM_001429chr221213 ------
NM_001438chr122529 962 --12263 --
NM_001440chr892503 2331 2270 2183 1003 890 526 103 50 1541 12771 --
NM_001451chr16----11336 --
NM_001460chr163456 3320 2282 776 188 165 --1604 --
NM_001482chr152225 29 ------
NM_001493chrX1549 --1140 --
NM_001494chr103737 670 228 ------
NM_001497chr942576 2514 942 293 1657 1137 --
NM_001498chr61251 ------
NM_001527chr674822 4349 4267 3149 3113 284 84 --1131 --
NM_001552chr1711042 ------
NM_001555chrX1107 ------
NM_001604chr111102 ------
NM_001616chr22772 733 12148 ----
NM_001634chr62755 394 ------
NM_001642chr112521 429 ------
NM_001655chr1131841 1644 64 ------
NM_001658chr13776 350 307 11062 ----
NM_001660chr3--2533 47 ----
NM_001663chr141219 ----1438
NM_001668chr121481 1398 --1360 --
NM_001678chr1761366 1304 1281 1184 629 246 --11772 --
NM_001682chr1222744 276 --12284 --
NM_001683chr332475 1884 465 12431 1498 --
NM_001684chr133883 3681 3102 12923 ----
NM_001695chr864144 3170 3088 936 143 72 --13858 --
NM_001709chr1142695 2605 1088 877 1523 ----
NM_001730chr13----1223 --
NM_001730chr13----1223 --
NM_001742chr71713 ------
NM_001743chr2--1221 ----
NM_001746chr542880 794 776 725 1334 ----
NM_001753chr721206 420 --11698 --
NM_001773chr121343 583 --11225 --
NM_001777chr332645 415 325 --179 1796
NM_001800chr19--1129 ----
NM_001806chr1942904 628 79 35 ------
NM_001822chr21707 ------
NM_001834chr5121 1257 ----
NM_001845chr1321033 443 ------
NM_001858chr621646 368 23295 895 ----
NM_001892chr521265 508 ------
NM_001893chr172311 41 1402 165 --
NM_001901chr61263 --1918 --
NM_001904chr32858 350 ------
NM_001914chr182412 93 ------
NM_001915chr1762034 1944 1597 1521 579 405 --1632 11433
NM_001920chr12--1743 ----
NM_001933chr141115 --11174 --
NM_001938chr111714 ------
NM_001949chr642522 1064 378 330 --12958 --
NM_001955chr63215 190 53 21025 704 ----
NM_001964chr5175 11143 1802 --
NM_001967chr31184 ------
NM_001968chr41888 ------
NM_001969chr1463253 2624 1586 1231 953 146 23205 1461 --199
NM_001977chr42571 330 167 ----
NM_001991chr1772228 1519 486 323 252 207 50 1811 ----
NM_002006chr464859 3888 3693 2070 1415 1174 --24150 695 --
NM_002009chr151373 --22539 853 --
NM_002013chr14153 1190 ----
NM_002014chr121133 ------
NM_002015chr1363100 3090 3056 2463 2437 1256 --13291 --
NM_002023chr131261 68 50 ------
NM_002025chrX119103 8846 8805 6963 2948 2149 1846 1823 1059 371 64 28679 7886 17515 --
NM_002035chr1823925 2867 179 1635 --
NM_002040chr2121950 1242 2637 366 1846 --
NM_002048chr92491 86 ------
NM_002052chr811482 1307 ----
NM_002063chrX1375 ------
NM_002069chr71193 --1361 --
NM_002072chr921012 872 ------
NM_002074chr111513 ------
NM_002078chr3141 ------
NM_002079chr101446 ------
NM_002092chr494977 4581 4378 4364 3925 3312 1836 1072 737 --2833 265 --
NM_002114chr61369 ------
NM_002126chr1753211 2574 2531 852 24 --12861 --
NM_002130chr51207 ------
NM_002131chr64509 438 404 223 ------
NM_002133chr222562 84 1570 --1207
NM_002137chr71292 ------
NM_002146chr172361 157 ------
NM_002147chr172670 144 ------
NM_002165chr201282 ------
NM_002187chr531188 1084 1050 ------
NM_002196chr201379 ----1362
NM_002196chr201379 ----1362
NM_002198chr52662 285 ------
NM_002199chr4141 ------
NM_002202chr51989 ------
NM_002207chr32276 50 ------
NM_002214chr725470 1544 ------
NM_002222chr321295 60 ------
NM_002228chr12928 497 --11227 --
NM_002230chr173848 248 159 ------
NM_002232chr1158 ------
NM_002241chr172811 930 592 455 443 135 33 1272 ----
NM_002242chr21146 11505 ----
NM_002264chr384973 4943 4674 4379 4324 3896 771 515 13762 ----
NM_002265chr172817 426 ------
NM_002267chr1321743 56 ------
NM_002270chr565071 4965 4387 3992 2188 1501 ------
NM_002271chr1322159 696 1954 12467 --
NM_002285chr273007 2970 2938 2786 1486 47 35 ------
NM_002291chr7122 ------
NM_002293chr132569 657 442 ------
NM_002336chr1224924 4041 ------
NM_002356chr612395 --12696 --
NM_002359chr17124170 3620 3530 3333 3293 2945 1621 1591 1577 1533 1298 400 ------
NM_002372chr52443 37 ------
NM_002373chr152850 57 ------
NM_002374chr253621 2722 2685 801 213 --13289 13259
NM_002375chr342257 2092 1574 379 --11493 --
NM_002384chr181730 --1135 --
NM_002387chr544114 3449 1878 309 --13863 --
NM_002397chr531488 743 453 ------
NM_002399chr1511101 ------
NM_002430chr2222153 893 ------
NM_002451chr952917 2868 2588 2505 2383 --12667 --
NM_002465chr121223 ------
NM_002480chr1221281 468 --11338 --
NM_002481chr1137848 7547 6604 6284 5669 5209 3170 3159 1984 1601 1433 673 666 36192 4980 2999 25575 5193 --
NM_002485chr821785 703 --21444 578 1120
NM_002486chr921805 404 ------
NM_002499chr1532410 537 163 --12443 --
NM_002501chr1954140 3916 1523 1239 437 ------
NM_002505chr611219 --1480 --
NM_002509chr201638 ------
NM_002518chr23375 100 59 ----11127
NM_002519chr11--11453 ----
NM_002522chr1743491 984 693 399 ------
NM_002541chr731041 925 359 ------
NM_002547chrX94135 3703 3188 2804 1365 1344 1336 652 27 ----13405
NM_002553chr71163 ------
NM_002570chr153910 813 279 ------
NM_002572chr112398 346 ------
NM_002576chr1151157 1040 987 915 202 ------
NM_002577chr353884 3687 2783 2739 2701 --199 --
NM_002581chr911401 15227 192 1726
NM_002583chr12159 ------
NM_002588chr521343 479 --11760 --
NM_002592chr20--1200 ----
NM_002594chr2022269 1548 --1391 11779
NM_002595chr1221222 383 ------
NM_002599chr1151182 1053 961 919 56 ------
NM_002600chr131417 1151 114 --1263 --
NM_002603chr81211 ------
NM_002609chr52596 66 1170 ----
NM_002613chr16175388 5258 5111 4980 4625 4227 3992 3687 3595 2063 1875 1843 1393 1309 751 621 403 ------
NM_002618chr21163 ------
NM_002628chr3156 ------
NM_002641chrX------1654
NM_002643chr22202 65 ------
NM_002646chr142076 1641 881 136 --11605 --
NM_002651chr11227 1617 ----
NM_002655chr824026 1057 25259 5012 15332 --
NM_002657chr2043787 3413 2696 1141 ------
NM_002677chr821993 27 ------
NM_002687chr14--11070 ----
NM_002697chr1193 ------
NM_002698chr1952514 2451 183 131 57 ------
NM_002707chr22327 124 ------
NM_002709chr243123 3059 2528 832 ------
NM_002714chr62714 256 --172 --
NM_002716chr1133245 3057 2543 12564 1520 --
NM_002717chr82476 452 ------
NM_002719chr1432336 2107 502 --12347 --
NM_002721chr9--1539 ----
NM_002731chr122921 354 12867 21005 427 --
NM_002734chr1752188 1965 683 401 95 ------
NM_002736chr721484 511 1518 ----
NM_002737chr1786113 5822 4633 4407 4142 2014 1501 599 --14892 --
NM_002740chr332623 2420 678 --12028 --
NM_002750chr102216 78 ------
NM_002753chr41678 1553 ----
NM_002755chr151213 ------
NM_002756chr172854 685 ------
NM_002779chr103514 375 53 ------
NM_002806chr14124 144 ----
NM_002809chr171321 ------
NM_002811chr16----1546 --
NM_002819chr191324 --11355 --
NM_002821chr62297 150 --125 --
NM_002824chr121494 ------
NM_002826chr16804 781 735 648 351 269 2716 103 ----
NM_002827chr2021812 1408 ------
NM_002828chr181206 ------
NM_002834chr1283118 2984 2966 1096 1026 963 922 646 1845 23347 519 --
NM_002839chr923333 389 --13443 --
NM_002843chr1142846 2210 2127 1132 --13423 --
NM_002844chr631282 1069 532 1506 ----
NM_002849chr121709 ------
NM_002850chr1921028 784 ------
NM_002851chr71619 ------
NM_002855chr1132935 235 174 1683 12967 --
NM_002857chr142699 1080 907 325 1934 ----
NM_002858chr11345 ------
NM_002865chr8----1101 --
NM_002868chr1262205 1961 1831 921 600 196 --22059 932 --
NM_002869chr1142157 2144 740 86 --1341 --
NM_002874chr912494 --1432 --
NM_002886chr353703 3309 1693 1543 136 ------
NM_002888chr3140 ------
NM_002893chrX1359 1108 1114 --
NM_002897chr21764 1694 ----
NM_002902chr151147 ------
NM_002904chr62169 47 ------
NM_002906chr111552 --1728 --
NM_002907chr121420 ------
NM_002918chr192390 72 --1883 --
NM_002923chr13637 516 236 ------
NM_002924chr11402 ------
NM_002941chr321213 630 ------
NM_002942chr331336 546 355 ------
NM_002953chr11578 --1801 --
NM_002971chr311101 ------
NM_002977chr243202 3189 2838 426 ------
NM_002979chr1----1246 --
NM_002998chr81370 --11931 --
NM_002999chr2051798 1511 394 230 23 21720 1578 ----
NM_003001chr131491 797 360 1436 ----
NM_003011chr921310 1190 --1582 --
NM_003026chr911059 ------
NM_003028chr983764 3555 3242 3109 2934 2744 2493 2454 --11211 --
NM_003031chr1611007 ------
NM_003034chr12108067 7576 7415 7017 5438 2544 1781 433 164 75 1395 ----
NM_003039chr13401 210 30 155 ----
NM_003045chr13104851 3838 3366 3225 1681 1552 1138 1041 868 606 --25063 3486 --
NM_003068chr81243 ------
NM_003069chrX1517 ------
NM_003070chr9----1694 --
NM_003076chr123593 332 84 1247 ----
NM_003077chr171198 --1694 --
NM_003079chr172193 156 ------
NM_003081chr203895 443 185 ------
NM_003101chr111023 1410 11625 --
NM_003106chr32779 710 ------
NM_003108chr237171 5664 2657 15439 12427 --
NM_003111chr211223 ------
NM_003112chr722176 117 ------
NM_003130chr721198 1031 ------
NM_003131chr652239 2035 1796 1606 27 ------
NM_003137chr62815 209 ------
NM_003139chr112798 665 ------
NM_003144chr62596 255 --11759 --
NM_003156chr1121292 1200 --1196 --
NM_003157chr32635 206 158 ----
NM_003161chr1733322 1060 962 11286 22892 1244 12519
NM_003173chrX31186 1137 154 --11044 1288
NM_003179chrX71350 1265 1044 1016 942 529 406 --11069 --
NM_003183chr21592 ------
NM_003185chr2031102 909 237 ------
NM_003189chr193253 2555 2541 2268 2068 429 420 310 168 22074 982 1976 --
NM_003194chr61532 ------
NM_003199chr1843902 3812 1219 791 14015 --11829
NM_003200chr1972126 2031 1904 1582 1456 591 219 2463 205 ----
NM_003211chr121601 --11749 --
NM_003216chr2293253 2821 2724 2457 1309 1293 1051 726 665 --1163 --
NM_003217chr1261630 1574 1477 1256 568 191 ------
NM_003221chr643881 3441 1170 92 23796 2617 ----
NM_003236chr253270 2771 2503 744 116 12238 ----
NM_003239chr142361 132 ------
NM_003242chr312227 ------
NM_003246chr154777 699 651 104 ------
NM_003247chr631947 82 46 ------
NM_003253chr21--1574 ----
NM_003255chr1752192 2164 717 453 25 12026 ----
NM_003257chr152381 168 1389 ----
NM_003262chr384327 4073 3539 2053 1824 1436 681 635 --24171 320 --
NM_003270chrX1920 ------
NM_003275chr921479 1434 --1319 --
NM_003291chr13--1164 ----
NM_003292chr132100 1935 1439 ------
NM_003295chr13149 ------
NM_003298chr395304 5234 4960 4751 4456 2475 1974 1022 754 16214 15603 --
NM_003304chr321301 201 --11270 --
NM_003320chr11134261 3916 3807 3745 3629 3565 3493 1454 1423 1291 626 495 376 ------
NM_003334chrX177 ------
NM_003339chr531544 1391 647 ------
NM_003342chr1763085 2872 2864 2652 1252 1141 ------
NM_003347chr2262045 1617 1552 739 696 476 1163 ----
NM_003368chr11115 ------
NM_003370chr191158 ------
NM_003387chr221957 397 ------
NM_003390chr11--11076 ----
NM_003392chr333779 1604 835 ----12747
NM_003400chr22794 116 ------
NM_003404chr2011318 1646 ----
NM_003406chr831528 289 219 --11707 --
NM_003409chr1821065 409 ------
NM_003410chrX3627 566 37 ----1815
NM_003411chrY134 --11325 --
NM_003412chr342453 2083 932 456 ------
NM_003420chr32662 257 ------
NM_003432chr52491 484 ------
NM_003439chr722944 2632 ------
NM_003442chr11----1786 --
NM_003453chr131692 ------
NM_003455chr1141584 1530 1287 378 --21210 496 --
NM_003457chr17----1220 --
NM_003472chr621483 1150 ------
NM_003474chr1042145 2128 586 516 ------
NM_003478chr1132663 1338 707 ----13203
NM_003483chr1212578 --22152 95 --
NM_003488chr172962 822 1227 ----
NM_003489chr21----1842 --
NM_003502chr16--1132 ----
NM_003507chr222008 383 1799 ----
NM_003564chr12558 228 --1634 --
NM_003574chr18105327 5315 5109 4361 4104 2089 2027 892 665 90 25381 1778 14950 15276
NM_003576chr1342447 2356 1077 891 ------
NM_003583chr1283912 3826 3646 3479 3239 2861 2595 2577 --13050 --
NM_003589chr1321458 584 11343 ----
NM_003590chr223251 1443 ------
NM_003603chr432018 1588 292 ------
NM_003607chr133504 1751 1370 --14110 --
NM_003615chr313658 --13826 --
NM_003618chr221040 987 ------
NM_003626chr1111122 ------
NM_003629chr183452 3083 3033 2769 2520 2252 1391 398 --1998 11286
NM_003634chr221782 ------
NM_003637chr141562 1493 1333 458 ------
NM_003644chr1795699 5248 2251 1984 1555 1292 1144 1046 541 11902 15758 --
NM_003663chr322999 2615 ------
NM_003670chr32405 366 ------
NM_003671chr952899 2664 981 344 296 1482 22883 2655 --
NM_003677chr1252325 2084 857 647 51 --130 --
NM_003679chr133129 2409 854 ------
NM_003685chr192634 100 ------
NM_003688chrX190 ------
NM_003690chr21469 --1179 1664
NM_003693chr17--1653 1572 --
NM_003705chr2--1781 ----
NM_003716chr311028 ------
NM_003722chr332377 232 187 12265 1466 --
NM_003735chr521343 479 --11760 --
NM_003736chr521343 479 --11760 --
NM_003740chr611381 1682 136 --
NM_003741chr31281 ------
NM_003743chr22541 303 ------
NM_003749chr133566 317 302 1432 ----
NM_003750chr101928 ------
NM_003759chr443979 3633 1314 533 ------
NM_003763chr2032431 1290 62 --13027 --
NM_003768chr111570 ------
NM_003774chr1211129 --1246 --
NM_003779chr11334 ------
NM_003787chr18187 ------
NM_003796chr191634 ------
NM_003800chr632084 554 99 ------
NM_003803chr184404 348 286 106 ------
NM_003822chr122511 851 12950 ----
NM_003825chr1511023 ------
NM_003829chr9----1359 --
NM_003850chr13122 ------
NM_003860chr111371 ------
NM_003872chr232557 2027 351 ------
NM_003877chr12----1834 --
NM_003884chr321407 1339 --11233 --
NM_003885chr1722243 23 ------
NM_003895chr2131735 1450 622 --1866 --
NM_003904chr111131 1228 ----
NM_003913chr643869 364 349 338 --1490 --
NM_003916chrX21052 53 ------
NM_003924chr42383 236 --1114 --
NM_003927chr182996 80 ------
NM_003930chr7----22391 2362 --
NM_003931chr6--1192 ----
NM_003932chr22--11832 ----
NM_003934chr91372 ------
NM_003941chr732327 1949 1740 ------
NM_003948chr452541 2266 980 688 203 ------
NM_003953chr122382 471 --21156 381 --
NM_003966chr584749 2900 2174 1344 1102 791 463 21 16113 14743 --
NM_003969chr192232 120 ------
NM_003972chr101866 ------
NM_003974chr84342 111 38 22 ------
NM_003980chr61342 --31335 1322 234 --
NM_003981chr15131 ------
NM_003982chr14--2116 45 ----
NM_003987chr1062220 2090 1547 1528 851 757 ------
NM_003988chr1062297 2167 1624 1605 928 834 ------
NM_003989chr1062156 2026 1483 1464 787 693 ------
NM_003990chr1062156 2026 1483 1464 787 693 ------
NM_003994chr1253690 1631 933 418 340 --13363 --
NM_004006chrX--1833 1557 --
NM_004007chrX--1833 1557 --
NM_004009chrX--1833 1557 --
NM_004010chrX--1833 1557 --
NM_004011chrX--1833 1557 --
NM_004012chrX--1833 1557 --
NM_004013chrX--1833 1557 --
NM_004014chrX--1833 1557 --
NM_004015chrX--1833 1557 --
NM_004016chrX--1747 1471 --
NM_004017chrX--1833 1557 --
NM_004018chrX--1747 1471 --
NM_004020chrX--1833 1557 --
NM_004021chrX--1747 1471 --
NM_004022chrX--1747 1471 --
NM_004023chrX--1747 1471 --
NM_004035chr1744520 3996 3400 3314 25059 453 11045 11262
NM_004050chr1432192 2108 737 11110 ----
NM_004077chr122231 169 --1993 --
NM_004081chrY11368 --11391 --
NM_004086chr141224 1674 ----
NM_004089chrX1147 --11119 --
NM_004093chr13----12856 --
NM_004094chr1452587 2507 2184 1063 222 ------
NM_004100chr611770 --1199 --
NM_004102chr11458 ------
NM_004112chr1751660 653 647 463 236 ------
NM_004114chrX2836 461 ------
NM_004124chr1423389 2319 ------
NM_004132chr1031081 919 66 ------
NM_004133chr822406 1967 ------
NM_004156chr8147 ------
NM_004161chr221415 144 ------
NM_004162chr311046 ------
NM_004171chr1179355 9212 8259 6784 2609 1852 1288 17486 22191 2155 --
NM_004180chr2----1599 --
NM_004183chr11----1726 --
NM_004187chrX1110 --11129 --
NM_004209chr165946 840 813 273 114 ------
NM_004227chr763108 1945 965 272 228 135 ------
NM_004232chr1822520 417 12599 1701 --
NM_004235chr91116 ------
NM_004240chr19197 ------
NM_004241chr101729 --1763 --
NM_004261chr11860 ------
NM_004263chr261696 1541 1535 1507 1370 1336 --11143 --
NM_004273chr10114929 4626 4606 4462 4058 3813 3266 3073 1526 1367 917 --11344 15044
NM_004290chr521139 1057 ------
NM_004296chr1473587 2726 2601 2580 868 813 518 12607 23947 2951 --
NM_004309chr174939 703 325 140 ------
NM_004311chr1032868 2715 894 ------
NM_004319chr172514 1234 1221 1118 531 214 68 ------
NM_004321chr293423 3150 2648 2508 2331 2237 1427 1209 612 ------
NM_004326chr12969 352 ------
NM_004331chr821854 201 ------
NM_004337chr822082 76 --11739 --
NM_004349chr811005 ------
NM_004350chr141887 838 654 114 ------
NM_004364chr1941275 968 211 139 ------
NM_004367chr641755 1110 178 72 --11749 --
NM_004373chr121141 ----1174
NM_004379chr2147 ------
NM_004380chr1631691 599 192 11871 12480 --
NM_004385chr5----1525 --
NM_004394chr521464 30 --1324 --
NM_004396chr17----1276 --
NM_004397chr1144164 3627 2724 1164 ------
NM_004416chr12----11078 --
NM_004420chr1152172 2062 1847 1800 906 ------
NM_004427chr161003 898 862 326 251 159 ------
NM_004430chr832811 693 107 --11719 --
NM_004432chr9--12041 ----
NM_004434chr143712 421 317 11630 ----
NM_004438chr232274 844 468 --23250 2045 --
NM_004440chr641499 1258 207 56 ------
NM_004441chr32859 97 11148 ----
NM_004449chr2131269 494 303 11360 11047 --
NM_004474chr1----1993 --
NM_004491chr19194213 3715 3642 3572 3392 2857 2683 1691 1631 1423 1412 1286 861 436 362 344 249 212 62 ------
NM_004494chr111192 --177 --
NM_004501chr133456 2520 759 --12707 --
NM_004503chr121631 ------
NM_004505chr1721496 1323 11554 ----
NM_004514chr1742913 2346 723 140 ------
NM_004516chr192863 116 ------
NM_004535chr204413 196 144 116 11445 1687 --
NM_004537chr12--142 ----
NM_004560chr93904 846 250 ------
NM_004575chr41287 --21660 1499 --
NM_004578chr11838 ------
NM_004580chr1531367 570 35 1668 ----
NM_004582chr11418 ------
NM_004586chrX64192 4051 3843 3667 1275 617 --13644 --
NM_004588chr1173968 3362 973 646 440 371 360 --13571 --
NM_004596chr191200 ------
NM_004598chr523088 552 1249 ----
NM_004602chr2041017 328 206 172 ------
NM_004612chr953156 3045 1751 895 290 14666 11518 --
NM_004621chr11--11259 ----
NM_004622chr262478 1918 1889 1822 1615 23 ------
NM_004630chr112325 47 ------
NM_004631chr12905 270 11336 ----
NM_004634chr31105 ------
NM_004635chr341010 918 396 28 --1308 --
NM_004637chr33425 417 238 ------
NM_004660chrY2890 586 1409 ----
NM_004661chr541232 1199 817 253 ------
NM_004663chr151332 --1203 --
NM_004666chr61212 ------
NM_004680chrY174 ------
NM_004687chr1732038 1807 214 11350 11950 --
NM_004690chr61682 ------
NM_004713chr141619 ------
NM_004718chr2----1168 198
NM_004726chrX44990 4967 2168 2081 ----15423
NM_004730chr521505 536 ------
NM_004734chr1342934 2363 2215 1160 ------
NM_004736chr112183 ------
NM_004742chr321775 1132 ----1158
NM_004745chr865926 5186 5012 4814 1476 228 36288 2415 2209 25905 4621 --
NM_004748chr1553208 2578 864 817 81 ------
NM_004762chr1731766 585 24 --11611 --
NM_004765chr16145 ------
NM_004768chr1----1469 --
NM_004774chr1723060 928 --1126 --
NM_004776chr2062940 2407 1178 847 402 231 ------
NM_004779chr52867 275 --11213 --
NM_004781chr131557 1164 656 --1707 --
NM_004781chr131557 1164 656 --1707 --
NM_004788chr1142231 1949 941 201 ------
NM_004796chr1431896 1749 914 --1602 1374
NM_004798chr2043502 2899 2506 123 ------
NM_004799chr11329 ------
NM_004801chr21548 ------
NM_004805chr261045 953 897 535 305 225 ------
NM_004808chr1062489 2458 2409 2333 2309 2295 ----11339
NM_004822chr1783581 3210 3103 2694 2563 1309 1249 1119 ------
NM_004824chr621065 480 ------
NM_004827chr4--2783 250 ----
NM_004834chr262723 2707 2576 2526 813 29 --12416 --
NM_004840chrX31890 1525 92 --32027 529 273 --
NM_004842chr621781 228 ------
NM_004845chrX63609 3592 3177 2573 1207 1099 --1872 11295
NM_004849chr621622 169 1290 ----
NM_004856chr151404 ------
NM_004859chr1732964 2716 1222 11138 ----
NM_004863chr14125244 5016 4658 3662 3516 3335 925 680 613 133 92 55 --15299 --
NM_004866chr544535 3503 637 463 ------
NM_004871chr1773729 3374 3277 2761 736 151 50 ------
NM_004896chr1031481 1329 458 --1592 --
NM_004897chr101773 ------
NM_004904chr765164 4196 2354 1554 121 22 ------
NM_004905chr1------1130
NM_004924chr191230 --1962 --
NM_004926chr141219 ------
NM_004929chr821484 509 ------
NM_004947chr342049 1812 1590 204 1618 ----
NM_004953chr3148 --1156 --
NM_004956chr723114 812 13652 1157 --
NM_004962chr103303 243 233 ------
NM_004965chr21----1707 --
NM_004973chr61276 --21584 472 11633
NM_004975chr202375 331 ------
NM_004976chr11125025 4692 3160 3138 2075 1542 1406 1327 995 720 406 208 ------
NM_004978chr151543 1493 473 391 214 1436 1149 --
NM_004979chrX3455 249 148 ------
NM_004985chr1233177 2748 574 ------
NM_004992chrX186423 6054 5903 5692 2859 2786 2654 2232 1659 1640 1451 1040 818 740 720 699 657 151 --1539 --
NM_004992chrX186423 6054 5903 5692 2859 2786 2654 2232 1659 1640 1451 1040 818 740 720 699 657 151 --1539 --
NM_004993chr142956 409 ------
NM_004998chr153639 368 358 ------
NM_004999chr62955 454 1809 ----
NM_005006chr21836 1291 ----
NM_005023chr521274 1018 1553 1145 --
NM_005025chr31185 ------
NM_005028chr102349 52 ------
NM_005030chr161276 ------
NM_005032chrX1434 ----184
NM_005056chr12115176 5027 4275 4264 4237 1717 1177 983 585 385 115 14389 21301 357 --
NM_005060chr131237 1083 148 --136 --
NM_005066chr11701 --2814 139 --
NM_005067chr34851 785 192 148 ------
NM_005078chr1541458 1340 564 282 ------
NM_005095chr11524 ------
NM_005096chrX61184 337 222 201 158 51 ------
NM_005105chr131639 1581 1523 ------
NM_005109chr362351 2146 889 329 265 195 21807 70 21921 756 --
NM_005116chr20123865 3749 3704 3612 3192 1584 1576 750 729 338 242 21 11325 14484 --
NM_005119chr13959 831 55 ------
NM_005121chr1723677 3248 1551 1372 --
NM_005124chr61867 --1307 --
NM_005154chr151575 ------
NM_005156chr924940 4550 ------
NM_005160chr2275786 5731 5501 4911 2642 2483 2356 ------
NM_005173chr1751034 975 477 196 148 --11110 --
NM_005184chr1931375 585 324 ------
NM_005187chr16131909 1902 1877 1870 1845 1838 1813 1806 1782 1774 709 96 82 1438 ----
NM_005188chr11177686 7605 7005 6837 6825 5704 5219 5063 3310 3069 2655 2543 1843 1339 1264 676 362 27640 555 16904 --
NM_005190chr6------11110
NM_005194chr201476 ------
NM_005202chr151540 278 187 117 30 ------
NM_005207chr2263545 3208 2754 1410 786 485 2870 401 ----
NM_005220chr1751280 969 466 304 295 ------
NM_005224chr191714 ------
NM_005233chr31352 --12550 --
NM_005234chr193310 104 28 ------
NM_005235chr287345 7238 1369 1002 785 703 571 76 12258 ----
NM_005238chr1122838 635 22782 274 ----
NM_005239chr2161909 1671 1608 231 132 118 ------
NM_005241chr32942 49 ------
NM_005245chr41118 --1729 --
NM_005252chr141592 ------
NM_005256chr111681 --139 --
NM_005259chr221217 1124 ------
NM_005264chr101875 ------
NM_005273chr71294 ------
NM_005277chr431794 721 522 ------
NM_005279chr2----133 --
NM_005311chr732685 2227 283 --1822 --
NM_005324chr1731988 1470 855 ------
NM_005329chr161116 --1162 --
NM_005349chr4--1588 ----
NM_005359chr1886468 5148 4835 4299 2374 2330 2292 207 --14238 --
NM_005374chr1772027 847 580 495 340 300 150 ------
NM_005376chr121153 340 ------
NM_005381chr21121 ------
NM_005386chr201740 ------
NM_005387chr112659 524 ------
NM_005388chr941734 1439 532 85 ------
NM_005397chr743843 3585 3055 1376 --11614 --
NM_005398chr105928 916 323 198 24 ------
NM_005402chr72385 236 --1183 --
NM_005406chr1811546 --11329 --
NM_005407chr142181 132 1567 21502 491 --
NM_005410chr51137 ------
NM_005425chr16121 ------
NM_005430chr121991 ------
NM_005436chr1083008 2972 1056 984 792 624 487 329 ------
NM_005438chr113513 206 77 ------
NM_005440chr1732842 888 560 ------
NM_005443chr43579 492 146 ------
NM_005461chr201352 ------
NM_005474chr1741506 611 575 160 ------
NM_005475chr1262655 2462 1014 768 726 200 --12855 11041
NM_005477chr1552210 1977 1613 810 317 12414 --1731
NM_005477chr1552210 1977 1613 810 317 12414 --1731
NM_005479chr1031241 343 97 --11401 --
NM_005493chr6----1606 --
NM_005497chr1785778 4909 4828 3765 2465 2318 1833 461 15482 13949 --
NM_005502chr951209 1131 977 376 214 13307 11096 --
NM_005520chr51664 ------
NM_005523chr731549 293 149 --11378 --
NM_005530chr1521327 126 --11290 --
NM_005537chr131198 ------
NM_005550chr163575 513 44 --1482 --
NM_005561chr132934 852 ------
NM_005563chr13337 283 213 ------
NM_005578chr333879 1852 1825 --1326 --
NM_005594chr12----194 --
NM_005595chr11106 --1740 --
NM_005596chr922318 1706 25381 2300 15552 --
NM_005602chr311224 ------
NM_005604chr632344 2048 798 ----1845
NM_005625chr81136 --1969 --
NM_005627chr6----1622 --
NM_005637chr1821832 535 ------
NM_005638chrX--11726 ----
NM_005639chr1211892 --1719 --
NM_005644chr1----1299 --
NM_005647chrX63255 2607 1340 1140 1056 320 --22795 2520 12404
NM_005650chr221238 --11250 --
NM_005652chr16----1300 --
NM_005655chr8289 38 ----1898
NM_005659chr22158 1425 ----
NM_005662chr82364 69 ------
NM_005664chr15--124 1231 --
NM_005688chr331253 867 136 ------
NM_005690chr121193 ------
NM_005715chr642679 971 821 230 --2500 25 --
NM_005721chr2178 ------
NM_005722chr221870 602 1760 ----
NM_005724chr154608 135 77 30 ------
NM_005730chr1263012 2625 1453 597 581 274 --32264 925 418 --
NM_005737chr262735 2093 1984 892 696 682 ------
NM_005738chr751565 1426 289 194 46 1602 ----
NM_005748chr1232686 996 204 ----13065
NM_005749chr171254 --1220 --
NM_005759chr263756 3337 1914 1057 741 421 --1525 14561
NM_005779chr513312 33280 2565 886 --12966
NM_005785chr1221642 500 1102 11583 --
NM_005795chr22572 350 --11896 --
NM_005797chr1121616 83 ------
NM_005801chr172537 308 ------
NM_005807chr11243 ------
NM_005808chr373199 2908 1341 1322 1295 130 49 --23284 3162 --
NM_005814chr151323 946 502 156 62 --11066 --
NM_005822chr61438 --12053 --
NM_005826chr1--2569 80 ----
NM_005828chr1764201 4183 3919 3491 1997 92 ------
NM_005840chrX87156 6408 5008 4955 2803 1622 1431 1110 15974 27293 2707 --
NM_005852chr1731108 406 249 ------
NM_005859chr51407 ------
NM_005868chr71168 1687 144 --
NM_005871chr101126 ------
NM_005876chr21696 --1689 --
NM_005880chr16--1117 ----
NM_005896chr22744 658 ------
NM_005897chr121100 154 --11010 --
NM_005898chr112729 323 ------
NM_005905chr132341 56 ------
NM_005909chr534056 1309 1149 --11216 --
NM_005920chr143135 2927 2864 1041 --22712 1082 --
NM_005933chr1152450 2333 2278 2213 127 ------
NM_005935chr473545 1739 1273 927 580 515 123 24903 988 13527 1286
NM_005941chr811504 --23652 2569 --
NM_005944chr31950 21121 39 ----
NM_005955chr184555 3969 3771 3764 3748 2195 2056 878 22139 855 11448 --
NM_005962chr1031990 1948 402 --12119 --
NM_005962chr1031990 1948 402 --12119 --
NM_005966chr2--1362 ----
NM_005967chr12------1752
NM_005985chr204647 610 268 211 ------
NM_005999chr1195 ------
NM_006007chr953861 1574 977 685 80 --13690 11754
NM_006011chr1534010 1222 346 1694 ----
NM_006015chr1--11267 1351 --
NM_006016chr641776 1680 896 336 ------
NM_006030chr32436 143 --11359 --
NM_006033chr1862213 1553 948 582 152 140 ------
NM_006037chr294664 4245 4144 3312 1834 822 785 635 516 --23446 1291 --
NM_006038chr2041657 558 451 188 --1646 --
NM_006043chr161761 --1597 --
NM_006047chr2033466 2943 947 --13451 --
NM_006048chr12968 311 ------
NM_006070chr32330 45 ------
NM_006079chr61261 ------
NM_006089chrX21815 1445 ------
NM_006091chr1531768 1558 1320 --11133 --
NM_006095chr454451 3748 2981 1321 712 ------
NM_006106chr1132666 2123 452 --11234 --
NM_006108chr1161961 842 659 563 426 54 ------
NM_006113chr1----1193 --
NM_006116chr2251589 1354 1321 601 136 1648 1231 --
NM_006141chr1662800 2446 1816 1723 1093 149 1905 ----
NM_006148chr1782908 2855 2439 1822 918 879 839 286 ------
NM_006154chr1542524 652 262 93 ------
NM_006158chr841632 1499 215 207 --1731 --
NM_006178chr1731460 1414 1262 1422 --159
NM_006180chr931747 818 326 12109 --1579
NM_006190chr21878 ------
NM_006191chr122850 185 ------
NM_006194chr14--11126 11213 --
NM_006201chrX4272 231 185 165 ------
NM_006203chr544231 4148 3838 1087 ----14791
NM_006206chr432586 2565 2434 ------
NM_006216chr22643 193 ------
NM_006224chr1762319 2118 2071 1886 794 701 ------
NM_006243chr12867 174 ------
NM_006244chr113177 114 100 ----2583 402
NM_006245chr62808 167 ------
NM_006251chr532207 708 556 ------
NM_006256chr132771 1851 1046 ------
NM_006267chr211731 21815 1466 ----
NM_006275chr2052426 1893 440 135 79 ------
NM_006282chr2041658 1175 723 626 14554 23995 61 --
NM_006283chr864360 4306 4296 3920 1775 777 1447 ----
NM_006287chr2----12448 --
NM_006292chr111159 ------
NM_006296chr21110 ------
NM_006306chrX65270 5101 4451 3610 2205 207 ------
NM_006307chrX1235 ------
NM_006310chr172968 507 11236 1912 --
NM_006313chr121388 --11533 --
NM_006321chr382032 1973 1604 1373 791 575 279 212 --1658 --
NM_006336chr931327 1046 399 --11223 --
NM_006352chr1----11760 1294
NM_006353chr62401 97 ------
NM_006357chr21355 ------
NM_006359chrX1504 --12205 --
NM_006366chr631273 969 111 ------
NM_006373chr1721204 930 ------
NM_006375chrX21575 562 --11218 --
NM_006379chr742328 1838 456 196 --11489 --
NM_006386chr2232330 2288 2128 --12048 --
NM_006393chr1034539 4390 532 ------
NM_006407chr3------11382
NM_006430chr22414 116 ------
NM_006434chr1042210 864 790 691 ------
NM_006457chr443926 1096 166 113 --13179 --
NM_006458chr11124 ------
NM_006460chr1731762 322 130 11801 ----
NM_006482chr1283912 3826 3646 3479 3239 2861 2595 2577 --13050 --
NM_006496chr11528 ------
NM_006504chr10137 --12269 12010
NM_006517chrX42043 1717 515 255 ------
NM_006520chrX11576 ------
NM_006534chr2032988 2190 1140 --1638 --
NM_006538chr241162 1149 1022 996 14084 ----
NM_006546chr1775894 5258 5145 4421 4035 2138 996 --15210 --
NM_006547chr721804 1463 1350 ----
NM_006549chr1282641 2553 2401 2388 2210 1930 497 204 ----1840
NM_006555chr761839 1370 793 672 617 263 ------
NM_006559chr11173 ------
NM_006561chr1056225 5275 2242 1253 976 ------
NM_006565chr162328 91 --1355 --
NM_006566chr184411 370 364 323 ------
NM_006570chr91392 ------
NM_006572chr1721341 637 --1233 --
NM_006587chr4----31718 338 51 --
NM_006599chr1666873 2879 2432 2218 1488 917 27322 5161 28100 419 --
NM_006601chr12--1910 ----
NM_006602chr201697 ------
NM_006603chrX1258 ------
NM_006609chr222404 2333 ------
NM_006614chr343554 2546 596 399 ------
NM_006621chr121361 179 --1555 --
NM_006624chr1021923 1826 ------
NM_006625chr13375 340 98 --1732 --
NM_006625chr13375 340 98 --1732 --
NM_006625chr13375 340 98 --1732 --
NM_006628chr1564393 3942 3648 2915 966 314 11679 23416 517 --
NM_006634chr2253 33 ------
NM_006636chr22836 743 ------
NM_006650chr5103895 3604 2990 2806 2595 852 618 440 393 110 ----1821
NM_006654chr1244242 3447 435 334 --1482 --
NM_006660chr151115 ------
NM_006675chr1273384 3204 2966 2944 2892 2291 411 12425 ----
NM_006690chr2051977 1525 866 640 32 1148 ----
NM_006698chr2041115 982 210 131 ------
NM_006699chr122601 967 --1370 --
NM_006705chr9123 ------
NM_006706chr51339 ------
NM_006713chr52260 67 --1681 --
NM_006717chr941271 1157 1117 906 --12162 --
NM_006722chr322993 879 ------
NM_006729chrX85644 4673 4199 3694 2213 1489 1072 785 14707 11876 --
NM_006734chr611056 --11410 --
NM_006738chr1574583 4315 3514 2972 1534 1429 1263 --1275 --
NM_006742chr1671544 1290 677 380 306 241 99 --21926 1769 --
NM_006743chrX2728 70 ------
NM_006761chr171113 ------
NM_006764chr32456 77 ------
NM_006766chr81859 ------
NM_006769chr11490 ------
NM_006775chr621175 350 ------
NM_006777chrX42798 821 689 625 --12912 --
NM_006788chr1851991 1425 771 408 297 12096 ----
NM_006791chr151525 ------
NM_006807chr1721096 93 ------
NM_006808chr91167 ------
NM_006809chr202782 316 --1136 --
NM_006823chr82219 104 --11280 --
NM_006826chr21183 --11032 --
NM_006827chr1412698 170 13229 --
NM_006832chr14------1789
NM_006851chr121612 --22825 52 --
NM_006852chr171703 12581 ----
NM_006854chr731638 1579 1418 ------
NM_006861chr1231785 620 336 --21887 733 --
NM_006874chr421137 819 ------
NM_006885chr1643608 1336 954 275 --1463 --
NM_006892chr202335 290 ------
NM_006892chr202335 290 ------
NM_006898chr21592 ------
NM_006899chr201103 ------
NM_006902chr132621 81 27 ------
NM_006914chr9--1540 ----
NM_006915chrX22278 1924 ------
NM_006922chr242026 556 392 250 --1590 --
NM_006924chr1713210 --13435 --
NM_006940chr1241180 385 326 70 ------
NM_006946chr11----1547 --
NM_006947chr42676 518 ----1179
NM_006959chr191327 1351 ----
NM_006981chr932030 765 586 ------
NM_006999chr541949 1445 1418 791 ------
NM_007010chr171234 1730 1647 --
NM_007011chr15106362 5692 5251 5052 4591 4246 2311 2291 1831 508 ------
NM_007030chr585127 5062 4988 4209 1576 1210 981 706 ------
NM_007050chr20168069 7654 7635 7188 7118 6627 6413 5807 5600 5521 4944 2997 2819 2786 1089 133 11860 17795 --
NM_007052chrX165 --1557 --
NM_007054chr542947 2935 2859 2632 ------
NM_007067chr1741290 1166 1032 396 ------
NM_007074chr16----1100 --
NM_007078chr1052942 2009 970 845 691 ------
NM_007084chr1361408 545 494 382 354 170 11249 ----
NM_007097chr5121 1257 ----
NM_007118chr51862 ------
NM_007137chrX75077 5042 4293 4261 1985 1258 351 13981 24489 1659 --
NM_007159chr311316 1278 ----
NM_007166chr1111385 ------
NM_007172chr2282630 2511 2179 2027 665 576 413 143 12441 ----
NM_007174chr1221697 619 --1681 --
NM_007175chr853087 2681 1166 993 978 21410 289 ----
NM_007185chr141021 239 188 129 ------
NM_007191chr122623 107 ------
NM_007192chr141193 --1310 --
NM_007195chr1851416 1393 1379 1044 255 ------
NM_007197chr122752 341 ------
NM_007200chr1574583 4315 3514 2972 1534 1429 1263 --1275 --
NM_007203chr953383 2888 2734 2451 1401 --12713 --
NM_007207chr11666 ------
NM_007216chr111357 ------
NM_007218chr81185 ------
NM_007219chr204921 874 861 79 ------
NM_007222chr831596 1438 1426 ------
NM_007235chr12188 ------
NM_007236chr1562223 1896 1688 921 801 738 --1957 --
NM_007245chr161895 1298 ----
NM_007246chr4----1910 --
NM_007249chr1346895 732 361 159 12739 23209 2021 --
NM_007275chr331148 319 72 --21135 802 --
NM_007280chr152337 91 ------
NM_007282chr3----1978 --
NM_007283chr342587 1908 1105 436 --42984 79 65 30 --
NM_007285chr161356 ------
NM_007292chr1744520 3996 3400 3314 25059 453 11045 11262
NM_007294chr172360 59 1337 ----
NM_007295chr172360 59 1337 ----
NM_007296chr172360 59 1337 ----
NM_007297chr172360 59 1337 ----
NM_007298chr172360 59 1337 ----
NM_007299chr172360 59 1337 ----
NM_007300chr172360 59 1337 ----
NM_007302chr172360 59 1337 ----
NM_007303chr172360 59 1337 ----
NM_007304chr172360 59 1337 ----
NM_007305chr172360 59 1337 ----
NM_007308chr41240 ------
NM_007324chr11329 ------
NM_007332chr811359 11182 --11378
NM_007347chr1552442 1258 988 879 429 ------
NM_007350chr1224563 4343 24117 3818 11459 --
NM_007358chr121967 77 ------
NM_007365chr142270 2038 550 503 ------
NM_007373chr1021795 1174 11371 ----
NM_007375chr122649 920 --11750 --
NM_012062chr122764 193 ------
NM_012063chr121193 ------
NM_012072chr2074099 3190 3175 3148 1474 916 582 14252 ----
NM_012082chr81120 ------
NM_012090chr11849 ------
NM_012095chr1053347 2996 2667 556 339 12233 ----
NM_012098chr941293 1124 550 30 ------
NM_012104chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_012104chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_012141chr1323894 2634 --11198 11164
NM_012156chr2063245 2656 2292 2248 2151 1307 11376 ----
NM_012160chr61438 ------
NM_012193chr11115188 5077 4219 4139 3705 3287 1996 1964 1550 1314 1096 11183 ----
NM_012199chr1124681 4008 3643 3513 3320 3057 2948 1770 1760 1162 1143 1051 ------
NM_012207chr10--146 11023 --
NM_012214chr225927 2472 --14173 --
NM_012215chr1051840 1805 1782 1285 557 ------
NM_012224chr4--154 ----
NM_012232chr1742065 1485 707 234 1765 22128 714 --
NM_012238chr1011465 --1686 --
NM_012249chr243592 3396 1374 328 ------
NM_012250chr1131052 538 166 ------
NM_012252chr7--191 23641 1362 --
NM_012257chr7----1940 --
NM_012262chr144005 3731 3640 1994 --25065 4640 --
NM_012264chr2252089 1734 1549 688 207 1726 ----
NM_012264chr2252089 1734 1549 688 207 1726 ----
NM_012285chr173329 110 77 --1429 --
NM_012287chr344103 3211 1447 635 --1117 --
NM_012288chr674578 4359 636 333 295 269 169 14733 ----
NM_012290chr211261 ------
NM_012296chr1163473 1449 1387 721 573 234 12891 ----
NM_012297chr442478 2464 785 78 --1711 --
NM_012300chr532511 1774 352 --12098 --
NM_012302chr13837 350 64 ------
NM_012306chr1293500 3006 2825 2310 1389 652 525 397 115 --12544 --
NM_012307chr183817 700 325 ------
NM_012308chr1141841 1716 423 362 ------
NM_012309chr1194027 3537 1008 737 628 509 457 288 161 11749 ----
NM_012316chr194405 2244 2188 1750 1559 1530 1390 1206 1080 --35363 4519 1427 --
NM_012324chr22----2746 80 --
NM_012325chr2021614 1554 1574 ----
NM_012329chr1711403 ------
NM_012333chr131685 1468 648 ------
NM_012347chr642618 2414 1939 802 --1559 --
NM_012382chr523502 3250 --33338 771 229 --
NM_012392chr13472 248 48 ------
NM_012402chr112491 105 ------
NM_012407chr221106 --1187 --
NM_012419chr6----1136 --
NM_012425chr1042568 1900 280 25 ------
NM_012437chr11475 ------
NM_012448chr1742038 1627 940 643 ------
NM_012465chr1073240 3044 3017 2919 2402 2225 445 ------
NM_013229chr1252377 1100 1086 821 397 --1785 --
NM_013230chrY41821 1580 1540 294 ------
NM_013233chr21348 ------
NM_013240chr2174100 3930 3666 1580 1560 1302 1029 12522 ----
NM_013245chr16------1708
NM_013253chr111128 --1307 --
NM_013261chr433434 2428 947 ------
NM_013262chr61438 ------
NM_013267chr121405 --1418 --
NM_013281chr201456 --11397 --
NM_013304chr16149 155 ----
NM_013309chr1542175 2083 2028 734 ------
NM_013316chr71692 ------
NM_013323chr1751215 765 463 415 26 ------
NM_013336chr351904 1758 1615 1586 1299 1504 1596 --
NM_013341chr222540 339 --11092 --
NM_013357chr8----1803 --
NM_013368chr192589 48 --1112 --
NM_013372chr1533321 2523 313 186 ----
NM_013381chr1222156 95 21951 894 ----
NM_013386chr12291 137 ------
NM_013396chr211431 ------
NM_013403chr191105 --2728 235 --
NM_013410chr131248 800 517 ------
NM_013444chrX150 ------
NM_013446chr73540 358 28 ------
NM_013447chr1963503 3412 2495 1337 911 239 ------
NM_013943chr112740 ------
NM_013989chr1453934 1247 1124 1101 1068 24171 97 --13608
NM_013995chrX31972 1651 836 ------
NM_014011chr21261 12488 ----
NM_014016chr3129 --1178 --
NM_014038chr7186 --1421 --
NM_014042chr11297 21 1259 ----
NM_014043chr32480 146 ------
NM_014057chr921025 371 ------
NM_014089chr1311875 ------
NM_014106chr154575 390 287 29 --1783 --
NM_014112chr855108 4950 4007 3838 192 ------
NM_014117chr1652632 2142 1888 592 444 --1187 --
NM_014153chr161621 ------
NM_014154chr31136 1366 --11478
NM_014155chr1197450 7437 2442 1807 1501 1464 1028 324 288 --56959 6670 6647 6197 670 --
NM_014181chr232034 854 58 --11919 --
NM_014182chr121629 ------
NM_014191chr12----11046 --
NM_014213chr22224 164 ------
NM_014225chr19127 --1111 --
NM_014232chr1731177 395 187 ------
NM_014232chr1731177 395 187 ------
NM_014233chr1742004 1479 520 104 12126 1727 --
NM_014238chr1751423 610 455 323 195 ------
NM_014240chr373536 3144 2559 1266 1217 519 69 --13475 --
NM_014243chr412008 ------
NM_014255chr12126 ------
NM_014284chr13878 789 131 ------
NM_014286chr992589 2582 2555 2412 2357 1280 1132 891 799 ------
NM_014292chr2261729 1709 1702 1600 1465 119 ------
NM_014299chr1931516 1387 727 ------
NM_014309chr2225371 491 11605 ----
NM_014315chr14------1136
NM_014319chr1241277 756 570 59 ------
NM_014323chr22----1170 --
NM_014331chr455673 5182 2386 1836 999 47151 6810 2590 1360 16567 --
NM_014333chr1111135 ----12313
NM_014338chr223408 331 22 ------
NM_014345chr631029 342 41 --1793 --
NM_014372chr121433 132 ----11297
NM_014382chr32249 214 11089 ----
NM_014393chr822305 278 ----196
NM_014405chr1762243 654 606 298 147 124 1564 ----
NM_014409chr12953 392 ------
NM_014415chr321546 389 --11406 --
NM_014421chr42611 98 ------
NM_014423chr534291 1853 1508 --13828 --
NM_014426chr203674 632 616 ------
NM_014447chr421478 259 ------
NM_014456chr101536 ------
NM_014469chr11----2848 289 --
NM_014491chr71846 --1285 --
NM_014494chr1632042 1546 648 ------
NM_014496chrX155 ------
NM_014498chr31331 ------
NM_014505chr122360 206 ------
NM_014515chr12149 1137 ----
NM_014554chr122877 500 ------
NM_014572chr131571 ------
NM_014577chr222706 666 ------
NM_014604chr174554 169 138 80 ------
NM_014608chr15----1403 --
NM_014614chr21414 ------
NM_014630chr1563250 2931 1178 1139 292 26 --1227 --
NM_014646chr1843228 2484 999 392 ------
NM_014647chr1641986 1493 630 564 --1762 --
NM_014661chr1093870 3850 3258 2708 1327 782 577 434 171 11375 12472 --
NM_014663chr11447 1318 ----
NM_014666chr51533 ------
NM_014670chr231194 1069 623 1999 ----
NM_014671chr741584 1406 617 321 ------
NM_014680chr171141 ------
NM_014686chr1962586 2334 2071 830 237 180 ------
NM_014690chr793075 2439 2274 752 590 511 460 225 49 11960 ----
NM_014693chr32747 24 ------
NM_014702chr632866 2141 296 --23271 756 --
NM_014705chr71201 ------
NM_014707chr71748 ------
NM_014709chr22485 253 ------
NM_014729chr831745 863 643 --1385 --
NM_014730chr1285186 4937 4318 4302 3958 1875 1068 588 24928 3760 ----
NM_014730chr1285186 4937 4318 4302 3958 1875 1068 588 24928 3760 ----
NM_014737chr2063509 1663 943 935 921 775 --11637 --
NM_014739chr633776 1508 297 22578 666 21129 754 --
NM_014743chr442591 2161 508 458 ------
NM_014748chr23367 313 265 ------
NM_014751chr811555 ------
NM_014755chr244190 3429 961 519 --11664 --
NM_014757chr51928 --21975 98 --
NM_014764chr122390 301 ------
NM_014765chr122402 1917 ----1301
NM_014772chr1852888 936 255 134 87 --12239 --
NM_014774chr122994 689 12347 12943 --
NM_014781chr81155 1303 ----
NM_014784chr12167 54 --1282 --
NM_014786chr111913 --1187 --
NM_014787chr142805 2534 900 445 12215 11063 --
NM_014798chr1761661 1583 1263 1223 223 135 1514 ----
NM_014800chr72921 232 ----1423
NM_014803chr1042559 916 846 338 ------
NM_014807chr11----2827 729 --
NM_014810chr123047 862 22998 398 12478 --
NM_014812chr121892 42 --11375 --
NM_014819chr51312 12012 1735 --
NM_014820chr311864 ------
NM_014824chr113416 282 140 ------
NM_014826chr133504 1751 1370 --14110 --
NM_014827chr121214 340 ------
NM_014828chr1432152 1607 114 12286 ----
NM_014830chr1273517 3412 3214 3072 1396 924 772 ------
NM_014836chr10----21976 359 --
NM_014841chr6--11114 21332 1108 --
NM_014850chr364455 686 96 69 59 29 24673 3385 1287 --
NM_014857chr1178 ------
NM_014871chr122553 459 --169 --
NM_014873chr123236 1415 11044 14417 --
NM_014876chr2262217 1488 821 783 554 61 ------
NM_014877chr1745307 1738 898 424 --26118 1291 --
NM_014887chr131782 ------
NM_014892chr6165 ------
NM_014893chrY1423 1874 ----
NM_014897chr1753120 2676 2374 2052 939 ------
NM_014902chr2031275 1121 157 ------
NM_014903chr122682 126 ------
NM_014905chr21275 ------
NM_014906chr1743323 1412 388 115 --12751 --
NM_014921chr19102972 2825 2572 2379 2279 2151 2046 1044 748 30 ------
NM_014923chr1321620 787 21870 658 12267 --
NM_014924chr1452115 2077 895 273 172 12655 12945 --
NM_014927chrX1140 ------
NM_014932chr3169 --1483 --
NM_014937chr10----130 1497
NM_014938chr1272191 1991 1930 796 460 317 21 ------
NM_014946chr243048 2535 273 219 --11238 --
NM_014947chr132933 2604 2467 ------
NM_014950chr14------11599
NM_014952chr1561276 709 652 580 531 114 ------
NM_014961chr432222 2170 1830 ------
NM_014962chr20------12664
NM_014969chr11327 --1860 --
NM_014978chr1031355 295 200 1630 --1528
NM_014982chr1424918 2171 --25230 4286 --
NM_014989chr621961 1283 --1165 --
NM_014991chr423031 594 --22580 32 --
NM_014996chr3180 --1699 --
NM_014999chr121291 --2560 448 --
NM_015000chr1221003 321 ------
NM_015002chr12----1244 --
NM_015005chr1431706 424 202 ------
NM_015008chr343182 2887 527 318 11114 12543 12735
NM_015015chr1931319 750 439 --1689 --
NM_015017chr1----11249 --
NM_015023chr14467 419 292 171 ------
NM_015032chr132700 228 --1511 --
NM_015035chr20146378 6258 6195 6167 5761 5634 5128 4962 4580 4516 2262 1886 1698 1091 ------
NM_015039chr164043 3340 3168 1663 1360 31 --14164 --
NM_015040chr221034 508 --12140 --
NM_015042chr1594310 3930 3884 3842 3799 1464 902 354 266 23812 53 2685 311 --
NM_015049chr2172 ----1486
NM_015051chr923394 1116 ------
NM_015059chr15103676 3564 3339 2827 2667 1232 917 630 323 37 --13211 --
NM_015060chr7----1190 --
NM_015063chr193366 146 77 ------
NM_015064chr1262890 2814 2624 2583 2208 560 --1972 --
NM_015068chr713413 --22738 819 --
NM_015069chr16----1600 --
NM_015071chr576473 5269 4729 4661 4201 1448 591 1863 11881 25948 1215
NM_015074chr194713 4490 4245 3321 1768 1041 583 521 353 3494 224 109 13173 --
NM_015075chrX71437 1421 863 557 464 245 230 ------
NM_015076chr633520 2950 827 ------
NM_015079chr1582468 2373 1091 981 857 795 666 629 --11077 --
NM_015082chr562386 2041 962 743 400 131 ------
NM_015087chr1342603 1974 1922 192 --1609 --
NM_015091chr141117 ------
NM_015092chr1614500 --1202 --
NM_015097chr322264 1727 ------
NM_015100chr13680 551 419 ----12001
NM_015101chr172259 754 741 620 503 322 21 1418 ----
NM_015107chrX1519 1612 ----
NM_015110chr952114 1782 1690 662 61 ------
NM_015115chr42928 397 ------
NM_015129chrX21728 1605 --11574 --
NM_015138chr1532523 2266 902 ------
NM_015144chr1643620 2578 838 352 --13314 --
NM_015149chr141903 1805 1685 627 1711 1367 --
NM_015150chr32258 113 ------
NM_015155chr1063002 2730 814 469 448 397 ------
NM_015156chr1453132 2836 1239 1078 441 21199 619 1384 --
NM_015161chr1631098 378 212 11106 ----
NM_015170chr832327 1479 661 --1257 --
NM_015171chr162178 106 ------
NM_015172chr131398 389 232 11545 194 --
NM_015192chr2042045 792 525 34 ------
NM_015193chr831434 1146 49 ------
NM_015199chr312584 12991 ----
NM_015205chr1381914 1904 1812 1466 503 457 344 207 ------
NM_015206chr1553880 2773 932 784 430 --33822 2512 1001 --
NM_015208chr1823949 562 1762 13652 --
NM_015215chr1----11258 --
NM_015233chr1342296 2244 2237 1748 ------
NM_015234chr61585 --11005 11198
NM_015251chr16--1744 12070 12104
NM_015252chr21617 ------
NM_015256chr51684 1675 ----
NM_015264chr2294732 4348 4275 4184 3364 3315 3170 3136 1709 --1558 --
NM_015265chr242378 1040 561 114 11631 1663 --
NM_015267chr1241992 1552 749 683 ------
NM_015268chr31545 ------
NM_015269chr1--129 ----
NM_015271chr433746 2755 1352 11554 21370 33 1254
NM_015272chr1611814 --11467 --
NM_015275chr1211464 --1491 11394
NM_015278chr632625 2594 125 12100 12937 1743
NM_015284chr152009 1363 781 594 495 ------
NM_015285chr1842389 2132 2002 223 ------
NM_015288chr563730 3716 3309 3220 2455 1206 23575 187 ----
NM_015291chr152712 2290 2266 1410 129 12803 12962 --
NM_015293chr6----1157 --
NM_015296chr131137 ----1431
NM_015299chr1493720 3342 3175 3124 2861 812 535 528 395 --12711 --
NM_015310chr888022 7454 5494 3275 2976 2924 2121 1915 ------
NM_015313chr1144710 3333 2934 1080 ------
NM_015315chr523248 1294 ------
NM_015316chr1411340 --299 27 --
NM_015317chr212856 --12336 --
NM_015326chr132704 2675 2332 ------
NM_015327chr121242 1005 11227 ----
NM_015328chr742740 2520 450 307 --21962 546 --
NM_015335chr121855 --2420 297 --
NM_015336chr1222256 2248 ------
NM_015346chr1431559 230 31 --1554 --
NM_015347chr1242297 2186 493 187 1768 ----
NM_015349chr622548 1100 --1100 --
NM_015354chr9--1385 ----
NM_015355chr1721374 426 ------
NM_015358chr2111334 --1995 --
NM_015359chr821810 305 11146 ----
NM_015361chr2162 ------
NM_015365chrX34256 3348 3162 174 14189 --
NM_015375chr1124683 4496 3906 3493 3447 3364 3345 3273 1794 1574 532 274 13913 --11276
NM_015382chr14--1669 ----
NM_015385chr1042210 864 790 691 ------
NM_015387chr211525 1785 --11872
NM_015397chr931218 304 237 11192 ----
NM_015404chr92103 68 ------
NM_015443chr175955 623 460 445 256 --1377 --
NM_015446chr11334 ----1230
NM_015455chr534029 1073 77 --11507 --
NM_015460chr321608 252 ------
NM_015461chr18----1236 1310
NM_015465chr51201 ------
NM_015470chr241212 1075 998 382 ------
NM_015475chr211065 ------
NM_015477chr152886 125 1331 ----
NM_015481chr1231007 871 353 1998 ----
NM_015484chr12765 290 ------
NM_015497chr15131 1933 ----
NM_015508chr321431 334 ------
NM_015527chr163284 119 29 ------
NM_015530chr21247 ------
NM_015532chr152841 245 ------
NM_015535chr262596 2558 1552 1480 1128 1090 --1183 --
NM_015550chr7----13176 --
NM_015554chr1511833 ------
NM_015555chr621303 32 --1703 --
NM_015565chr2111649 12086 ----
NM_015567chr132885 446 ------
NM_015570chr721446 84 ------
NM_015575chr2113479 3355 3286 3128 2991 2861 2489 2449 1464 1362 1182 12710 21200 753 1418
NM_015577chr531435 426 319 1109 11514 --
NM_015578chr19149 ------
NM_015605chr1041492 1105 585 201 ------
NM_015609chr122368 1142 --11100 --
NM_015610chr742098 876 193 45 ------
NM_015630chr21810 ------
NM_015640chr134605 686 461 35036 4276 3475 ----
NM_015641chr751185 965 884 846 47 ------
NM_015657chr22971 933 --141 --
NM_015678chr1321135 553 ------
NM_015686chrX62049 1674 968 720 486 178 ------
NM_015691chrX42782 2713 2542 2485 ------
NM_015695chr641686 1595 595 87 ------
NM_015726chr131777 1189 1168 --1244 --
NM_015840chr132642 2095 82 1999 ----
NM_015841chr132642 2095 82 1999 ----
NM_015844chr181730 --1135 --
NM_015846chr181730 --1135 --
NM_015847chr181730 --1135 --
NM_015850chr861944 1783 1694 592 365 143 1502 ----
NM_015874chr4--1588 ----
NM_015878chr822226 1852 ------
NM_015879chr1897038 6842 6098 5498 2750 1399 863 741 29 ------
NM_015881chr111128 --1307 --
NM_015888chr11289 --13026 --
NM_015892chr1041720 1606 489 290 ------
NM_015905chr7----1454 --
NM_015906chr144503 3356 3340 1864 24285 3285 13306 1671
NM_015912chr822232 931 1322 12472 --
NM_015932chr131559 ------
NM_015976chr11239 ------
NM_015995chr15145434 5428 5003 4761 3964 3523 1824 1738 1476 1451 885 524 485 52 ------
NM_015999chr11208 ------
NM_016003chr742098 876 193 45 ------
NM_016009chr144857 3259 1913 133 --14723 --
NM_016021chr642743 2246 1091 807 ------
NM_016023chr851878 1848 881 439 244 ----12011
NM_016025chr161564 --11973 --
NM_016032chrX31240 337 121 --1265 --
NM_016038chr7175 ------
NM_016059chr6297 37 1381 ----
NM_016061chr211604 --1491 --
NM_016073chr1511146 ------
NM_016076chr12532 105 --22785 469 --
NM_016083chr633339 3310 1000 13456 ----
NM_016120chrX1319 ------
NM_016132chr1533175 2634 2360 ------
NM_016141chr3----1741 --
NM_016144chr5------1124
NM_016152chr31349 1922 ----
NM_016201chr321744 754 --12150 --
NM_016206chr379048 8712 7636 6427 6199 3426 1233 --17600 --
NM_016230chr61166 ------
NM_016231chr1721144 259 11315 ----
NM_016252chr21748 ------
NM_016256chr162237 58 ------
NM_016257chr173157 2779 2438 548 270 76 43 ------
NM_016258chr11256 ------
NM_016260chr245968 2588 1193 232 ----1803
NM_016271chr182851 743 ------
NM_016272chr2251789 739 697 325 307 11004 ----
NM_016277chr61109 --11386 --
NM_016284chr162821 287 ------
NM_016287chr141973 1946 1648 299 --11336 --
NM_016289chr231835 1516 263 ------
NM_016315chr241669 1596 1228 336 ------
NM_016338chr511237 ------
NM_016351chr7--1183 ----
NM_016374chr14637 628 473 37 ------
NM_016374chr14637 628 473 37 ------
NM_016376chr1743706 1198 617 435 ----24277 2649
NM_016377chr621781 228 ------
NM_016395chr1511368 1580 121 --
NM_016396chr153927 597 437 --22971 2371 --
NM_016418chr2253042 2459 1302 1061 42 --13361 --
NM_016424chr1721818 1491 --11382 --
NM_016431chr22----2746 80 --
NM_016433chr123410 98 37 1187 ----
NM_016436chr20----21710 636 --
NM_016453chr3----1183 --
NM_016463chr5155 ------
NM_016467chr22893 127 1551 ----
NM_016480chr51789 --1214 --
NM_016488chr122358 98 --11692 --
NM_016490chr2136 ------
NM_016507chr173524 499 358 --11961 --
NM_016512chr8--1231 ----
NM_016530chr1543593 2545 462 449 --23823 3811 23979 167
NM_016531chr441409 460 156 116 ------
NM_016559chr331440 994 116 ------
NM_016575chr12175156 5075 4792 4621 4554 4548 4500 4025 3754 3376 3338 1546 1502 1464 1047 986 506 13780 ----
NM_016577chr383548 3538 3378 3261 3231 3013 602 21 ----11310
NM_016578chr111228 ------
NM_016588chr61662 ------
NM_016598chr341103 254 138 21 ------
NM_016603chr511961 ------
NM_016604chr52813 246 ------
NM_016619chr4--1238 ----
NM_016620chr111310 ------
NM_016621chr1153992 3948 3205 1707 1637 ------
NM_016623chr81634 ------
NM_016626chr1841700 1389 710 183 ------
NM_016631chr211245 --1880 --
NM_016644chr51554 ------
NM_016836chr21764 1694 ----
NM_016839chr21764 1694 ----
NM_016929chr653411 3255 1182 670 183 ------
NM_016936chr1632137 1486 436 ------
NM_016946chr193077 2834 2489 2342 2306 1445 1375 1018 212 1932 ----
NM_016952chr1164001 2850 1098 1035 723 494 --1412 --
NM_017412chr81967 ------
NM_017413chrX52255 1905 753 449 65 ------
NM_017420chr1423521 1001 ------
NM_017423chr41488 --1694 --
NM_017437chr1422204 194 --1331 --
NM_017447chr2164196 1526 1424 753 101 42 ------
NM_017452chr2041017 328 206 172 ------
NM_017453chr2041017 328 206 172 ------
NM_017454chr2041017 328 206 172 ------
NM_017456chr1731766 585 24 --11611 --
NM_017482chr261537 1481 1439 1060 973 112 --11571 --
NM_017488chr221522 1178 ------
NM_017519chr6--11292 ----
NM_017522chr12905 270 11336 ----
NM_017553chr15164 --175 --
NM_017582chr161718 1385 694 624 466 148 ------
NM_017590chr2262535 2265 2041 1756 1746 971 --1850 --
NM_017594chr932162 560 459 ------
NM_017596chr1134599 4183 4025 3979 3798 3723 1703 1461 1203 973 857 722 689 1147 13173 --
NM_017602chrX3835 661 77 ------
NM_017610chr152502 341 ------
NM_017623chr25875 804 520 389 120 1658 1496 --
NM_017629chr131888 1617 104 ------
NM_017633chr6--12993 13615 --
NM_017635chr112533 450 11180 ----
NM_017637chr988972 8732 8019 6509 3153 2704 1371 366 --31948 937 709 23359 45
NM_017640chr62689 228 ------
NM_017644chr334079 745 230 --1718 --
NM_017650chr745977 4946 3822 954 ------
NM_017658chr1434005 3211 64 --21102 1030 --
NM_017661chr1521064 457 --1872 --
NM_017670chr11187 ------
NM_017681chrX1848 ------
NM_017693chr1311537 ------
NM_017709chr163054 1426 1232 886 842 92 ------
NM_017712chr19176203 5828 5521 5288 5143 5081 2463 1978 1678 1301 1149 1113 503 490 400 294 75 14591 ----
NM_017719chr31506 --1160 --
NM_017737chr11371 --12240 --
NM_017738chr971138 1118 904 861 406 314 215 ------
NM_017742chr1821449 189 ------
NM_017748chr171870 ------
NM_017752chrX12141 ------
NM_017753chr91882 ------
NM_017754chr674451 4074 3861 3788 3699 3146 1043 ------
NM_017768chr11627 ------
NM_017770chr632288 1860 47 12007 ----
NM_017778chr811337 ------
NM_017780chr81664 ------
NM_017786chr8----1554 --
NM_017811chr942240 2106 327 79 --1964 --
NM_017824chr1021979 1707 ------
NM_017848chrX84627 3219 2839 1735 1686 552 437 185 13812 21852 653 --
NM_017849chr282845 2529 2491 2178 2025 1279 1069 1010 ------
NM_017851chr153970 922 268 1963 --1138
NM_017857chr113676 636 455 ------
NM_017870chr111178 ------
NM_017893chr1031363 427 410 ------
NM_017895chr20174 ------
NM_017896chr2073225 3135 1392 813 568 554 511 --31138 738 156 11380
NM_017902chr1095765 4679 4567 4334 2149 1532 820 570 129 ------
NM_017907chr113482 342 192 ------
NM_017922chr14--1250 ----
NM_017926chr14----1889 --
NM_017933chr211064 ------
NM_017938chrX41831 1740 579 38 --1118 --
NM_017945chr32878 281 ------
NM_017955chr141823 ------
NM_017964chr22667 44 ------
NM_017972chr14----1889 --
NM_017987chr102632 552 12004 11655 --
NM_017988chr123359 320 79 --1669 --
NM_017994chr752935 2025 1949 860 746 1488 12320 --
NM_017998chr921022 934 ------
NM_018000chr21589 ------
NM_018011chr131260 ------
NM_018014chr2163 ------
NM_018018chr1231866 536 468 ------
NM_018024chr82382 95 1569 1583 --
NM_018027chr1062775 2061 2002 1091 616 362 ------
NM_018028chr1911327 ------
NM_018045chr142358 1231 994 384 ------
NM_018046chr51693 ------
NM_018047chr51869 --1809 --
NM_018054chr162212 140 --1509 --
NM_018061chr121181 399 ------
NM_018064chr62256 226 ------
NM_018072chr11160 ------
NM_018085chr178099 6632 6530 3219 1932 125 69 --12298 --
NM_018092chr1611244 ------
NM_018116chr13548 502 489 ------
NM_018121chr1042047 2029 1205 686 ------
NM_018133chr321564 303 ------
NM_018155chr343393 1252 394 171 --11387 --
NM_018167chr141368 ------
NM_018179chr127687 663 614 591 551 484 50 ------
NM_018181chr1821898 772 ------
NM_018184chr321701 328 --21495 571 --
NM_018192chr31999 --1939 1229
NM_018200chr1522030 682 ------
NM_018206chr161571 ------
NM_018211chr112053 21679 719 ----
NM_018214chr61192 ------
NM_018241chr4--1179 1956 --
NM_018244chr204933 489 92 36 2851 374 ----
NM_018247chr6------11994
NM_018254chr122198 429 ------
NM_018265chr131994 1891 1692 1242 ----
NM_018268chr52619 349 ------
NM_018287chr10----11272 --
NM_018293chr321102 112 1177 2326 95 --
NM_018299chr8----12521 --
NM_018302chr432455 2445 930 ----1498
NM_018307chr172804 213 --1278 --
NM_018312chr1191905 1881 1863 1839 1807 1776 1396 804 312 --1770 --
NM_018315chr41127 ------
NM_018327chr201654 ------
NM_018334chr71201 ------
NM_018362chr1122763 71 ----13615
NM_018364chr143924 3851 1144 693 173 13652 --
NM_018368chr62223 117 ------
NM_018371chr821132 1125 ------
NM_018374chr734616 3403 1088 --21691 750 --
NM_018388chrX31319 1156 937 1342 153 --
NM_018393chr11184 1525 1397 --
NM_018403chr332680 1529 1500 13150 ----
NM_018416chr1231807 887 755 12337 12597 --
NM_018424chr931597 411 69 ------
NM_018440chr8108466 7819 7407 5984 5351 2678 2023 547 503 288 15571 21925 970 --
NM_018444chr811945 ------
NM_018448chr121145 ------
NM_018451chr131291 1794 ----
NM_018452chr6_random52966 2770 1550 713 533 ------
NM_018469chr1721374 86 --1281 --
NM_018471chr21227 ------
NM_018482chr83936 327 309 11940 ----
NM_018490chr1111445 ------
NM_018492chr8126 ------
NM_018553chr1711423 ------
NM_018557chr21446 ------
NM_018566chr174360 3438 1771 1625 1491 845 815 --13704 --
NM_018569chr431557 1278 225 ------
NM_018590chr10----1645 --
NM_018602chr154540 307 149 22 --187 --
NM_018638chr1225049 765 11433 ----
NM_018639chr12187 --1398 --
NM_018644chr1162190 1833 410 242 72 45 ------
NM_018650chr132237 2027 86 --11508 --
NM_018657chr32644 176 ------
NM_018682chr71454 ------
NM_018683chr2021703 1079 ------
NM_018689chr1552295 2120 955 456 76 --1408 --
NM_018695chr52953 477 ------
NM_018698chrX11914 1654 1445 --
NM_018699chr42275 108 ------
NM_018704chr121878 186 ------
NM_018711chr1241451 1027 487 26 ------
NM_018715chr132158 1904 1558 12013 ----
NM_018719chr721231 361 ------
NM_018841chr153457 3333 2821 2589 1384 --1232 1339
NM_018898chr531678 401 220 ------
NM_018899chr531678 401 220 ------
NM_018900chr531678 401 220 ------
NM_018901chr531678 401 220 ------
NM_018902chr531678 401 220 ------
NM_018903chr531678 401 220 ------
NM_018904chr531678 401 220 ------
NM_018905chr531678 401 220 ------
NM_018906chr531678 401 220 ------
NM_018907chr531678 401 220 ------
NM_018908chr531678 401 220 ------
NM_018909chr531678 401 220 ------
NM_018910chr531678 401 220 ------
NM_018911chr531678 401 220 ------
NM_018912chr521343 479 --11760 --
NM_018913chr521343 479 --11760 --
NM_018914chr521343 479 --11760 --
NM_018915chr521343 479 --11760 --
NM_018916chr521343 479 --11760 --
NM_018917chr521343 479 --11760 --
NM_018918chr521343 479 --11760 --
NM_018919chr521343 479 --11760 --
NM_018920chr521343 479 --11760 --
NM_018921chr521343 479 --11760 --
NM_018922chr521343 479 --11760 --
NM_018923chr521343 479 --11760 --
NM_018924chr521343 479 --11760 --
NM_018925chr521343 479 --11760 --
NM_018926chr521343 479 --11760 --
NM_018927chr521343 479 --11760 --
NM_018928chr521343 479 --11760 --
NM_018929chr521343 479 --11760 --
NM_018945chr633398 1400 437 13673 12420 --
NM_018948chr12984 494 ------
NM_018970chr743173 903 746 62 ------
NM_018976chr12----12839 11115
NM_018993chr2031392 1362 1139 1287 1397 --
NM_018994chr13573 391 33 ------
NM_018999chr1064331 4054 3492 3048 1135 683 13746 14543 --
NM_019001chr334398 503 325 ------
NM_019004chr71378 ------
NM_019006chr151449 ------
NM_019027chr432328 1706 861 ------
NM_019032chr11726 ------
NM_019041chr631927 1039 196 ------
NM_019042chr711093 ------
NM_019045chrX3958 370 188 ------
NM_019063chr212146 ------
NM_019072chr531054 740 43 ------
NM_019084chr1051604 1034 651 354 252 ------
NM_019091chr22417 324 ------
NM_019094chr1243790 3707 1448 882 --32906 2824 960 --
NM_019096chr66778 753 371 352 271 172 ------
NM_019106chr2252593 2112 1198 697 507 ------
NM_019114chr942361 2000 1915 147 ------
NM_019555chr3--11750 11805 --
NM_019557chr11352 ------
NM_019592chr91601 ------
NM_019605chr11621 ----1483
NM_019610chr111513 11408 ----
NM_019613chr172930 120 ------
NM_019842chr62426 173 ------
NM_019854chr121708 ------
NM_019857chrX71786 1574 1462 1268 1236 1222 1171 --11389 --
NM_019860chr1021611 609 ------
NM_020039chr1241781 1741 1486 1212 11943 ----
NM_020066chr1----1787 --
NM_020122chr244677 4121 4020 1779 ------
NM_020123chr101250 1142 ----
NM_020140chr12--183 ----
NM_020144chr741877 1855 1429 134 ------
NM_020148chr1842397 2301 642 258 --13117 12555
NM_020178chr1741211 1002 834 828 ------
NM_020179chr111136 --174 --
NM_020182chr2053381 2954 2681 162 112 --22538 2519 --
NM_020193chr1131068 279 256 ------
NM_020209chr19------168
NM_020228chr1122195 276 --12057 --
NM_020240chr552780 2714 959 923 620 ------
NM_020245chr654423 3161 1201 879 821 14399 ----
NM_020342chr232469 817 101 12454 11688 --
NM_020344chr9139 ------
NM_020346chr11----11101 --
NM_020362chr11292 1151 1807 --
NM_020363chrY11368 --11391 --
NM_020381chr631866 508 339 11724 ----
NM_020382chr12----2440 202 --
NM_020404chr11148 --197 --
NM_020405chr1764455 4309 3522 1269 127 83 --21609 788 --
NM_020420chrY11368 --11391 --
NM_020429chr762703 2156 1111 964 264 36 ------
NM_020443chr174392 2106 1434 1279 1269 967 239 ------
NM_020456chr1322284 1844 176 11441 --
NM_020463chr2133 ------
NM_020466chr653988 3219 3075 624 241 ----14254
NM_020473chrX------1654
NM_020630chr102681 63 --1666 --
NM_020640chr3--12024 11442 --
NM_020647chr82211 87 ------
NM_020651chr2----11181 --
NM_020654chr311406 ------
NM_020673chr2086500 6252 6180 5958 5250 4714 1237 236 11451 37434 7408 2892 --
NM_020697chr82330 230 11265 ----
NM_020699chr121877 1814 --15136 --
NM_020708chr202773 711 --12478 --
NM_020715chr1432153 569 531 --1643 --
NM_020717chrX63522 1921 1505 1304 1093 423 --1858 --
NM_020727chr2123141 2489 --13459 --
NM_020732chr6--11292 ----
NM_020734chr1232937 858 318 ------
NM_020738chr231201 200 178 ------
NM_020739chr1553208 2578 864 817 81 ------
NM_020742chrX22712 441 1938 ----
NM_020748chr1731431 1407 294 ------
NM_020749chr821374 1342 ------
NM_020752chr101705 ------
NM_020760chr21639 --1598 --
NM_020762chr122404 120 ------
NM_020764chr1621064 985 ------
NM_020765chr1141 ------
NM_020766chrX63777 3684 1580 829 441 212 ------
NM_020769chrX1810 1837 1710 --
NM_020771chr611501 ------
NM_020772chr1758191 7633 5923 1405 738 1818 18144 16020
NM_020773chr462183 1833 1783 906 539 135 ------
NM_020774chr1854970 4610 1966 1165 249 --14813 --
NM_020779chr2154 21168 976 --12230
NM_020791chr17--11144 1366 --
NM_020794chr111121 11097 ----
NM_020795chr1731705 735 83 11802 ----
NM_020796chr552739 2385 2130 909 428 1986 ----
NM_020801chr552521 1857 1789 929 261 ------
NM_020804chr642579 1845 387 211 21054 864 ----
NM_020808chr13953 704 297 ------
NM_020809chr1141603 1471 744 524 ------
NM_020810chr1433423 3144 1345 1478 1470 --
NM_020819chr631233 464 307 ------
NM_020820chr2071455 1111 1019 362 286 90 75 ------
NM_020824chr101689 ------
NM_020826chr1132388 338 128 ------
NM_020841chr1263810 2747 1017 566 76 48 ------
NM_020850chr1673088 3077 2785 2718 2384 929 127 ------
NM_020854chr18----1218 --
NM_020858chr153365 116 29 ------
NM_020859chr453465 3401 2978 1284 353 --11556 --
NM_020868chr21402 ------
NM_020870chr431453 878 97 --11676 --
NM_020871chrX42199 2116 505 463 ------
NM_020896chr115985 861 415 227 196 1714 ----
NM_020899chr1741727 518 461 74 --31566 647 230 1840
NM_020904chr192138 44 ------
NM_020927chr1622328 1484 ------
NM_020935chr264470 3565 3026 1131 463 189 34368 4252 1172 23075 1821 --
NM_020956chr19124237 4143 3556 1816 1738 1660 1267 1220 1002 802 408 264 ------
NM_020962chr1572258 2155 1950 1006 551 289 66 ------
NM_020967chr202475 44 ------
NM_020971chr192887 803 ------
NM_020977chr422229 1690 1256 11938 1839
NM_021007chr21260 ------
NM_021020chr893326 2646 2543 847 669 526 334 288 227 --1151 --
NM_021025chr51352 ------
NM_021033chr132773 671 --12191 --
NM_021035chr20--1119 ----
NM_021044chr12--1142 ----
NM_021047chr192487 449 ------
NM_021061chr854281 4158 1650 866 852 1935 ----
NM_021064chr63725 442 316 11797 11369 --
NM_021065chr6123 ------
NM_021069chr432018 1588 292 ------
NM_021072chr512521 1131 22247 871 --
NM_021077chr15183 135 ----
NM_021079chr17103261 2446 2300 2237 1291 1059 760 573 394 209 1503 13056 --
NM_021088chr21388 --11734 --
NM_021090chr2274515 3497 3394 3129 1583 1262 28 11744 21217 337 13201
NM_021096chr2273257 2669 2159 951 920 184 174 --22682 2499 --
NM_021097chr222533 336 --1999 --
NM_021120chrX32481 2295 892 ----13186
NM_021132chr1021248 979 --21340 433 --
NM_021137chr1752000 1733 909 780 732 11784 ----
NM_021141chr22669 256 ------
NM_021148chr731987 1890 1638 ----12276
NM_021155chr1932544 1199 784 1868 21150 524 --
NM_021159chr421102 468 11356 ----
NM_021174chr81758 ------
NM_021183chrX41959 282 172 23 ------
NM_021189chr11232 ------
NM_021190chr131291 1150 468 1923 ----
NM_021191chr1242465 2261 646 323 ------
NM_021202chr2042811 1165 1137 326 ------
NM_021215chr2022046 458 ------
NM_021224chr92311 65 ------
NM_021238chr1231388 639 290 ------
NM_021240chr93581 207 24 ------
NM_021249chr1431602 658 318 11332 ----
NM_021253chr631088 1073 908 ------
NM_021255chr1433961 2937 2639 13643 2831 517 --
NM_021614chr5148 ------
NM_021619chr941178 936 928 271 ------
NM_021627chr321241 901 1796 ----
NM_021629chr315074 24021 1729 ----
NM_021637chrX2531 142 ------
NM_021639chr12320 150 ------
NM_021643chr221495 1339 --11860 --
NM_021644chr10--146 11023 --
NM_021647chr453560 2948 1633 1257 976 ------
NM_021648chr622496 1690 1165 2310 239 --
NM_021705chr611219 --1480 --
NM_021723chr7--1183 ----
NM_021813chr681839 1727 1424 1407 1388 844 610 325 ------
NM_021814chr61606 1102 ----
NM_021825chr11133 ------
NM_021905chr631729 536 33 --1422 --
NM_021911chr535408 1162 680 2832 128 --14043
NM_021912chr1523600 556 ------
NM_021914chr142824 372 ------
NM_021940chr61146 ------
NM_021943chr661945 851 767 540 478 258 --1399 --
NM_021946chrX71421 1241 1230 1170 954 356 308 --1350 --
NM_021949chrX42515 1869 973 61 --12738 --
NM_021960chr13564 330 145 12497 ----
NM_021961chr1187178 5677 2985 2906 2182 2010 1527 829 ------
NM_021962chr1752372 2365 1731 585 526 ------
NM_021964chr316481 --14046 1466
NM_021998chrX11289 ------
NM_022037chr2132 ------
NM_022048chr1565529 4672 4569 1599 1406 564 11765 14083 --
NM_022107chr6138 ------
NM_022118chr13----1609 --
NM_022130chr52134 108 1274 ----
NM_022133chr821755 1426 ------
NM_022138chr631296 1140 182 --1336 --
NM_022140chr531952 1840 357 11485 11584 --
NM_022166chr16105127 4890 3864 2457 2305 2109 1838 760 635 207 15409 ----
NM_022171chr321126 48 11597 ----
NM_022173chr2132 ------
NM_022336chr242337 2025 821 805 --1841 --
NM_022340chr373570 3385 3024 2753 2394 773 348 13192 ----
NM_022351chr8----12805 --
NM_022368chrX126 ------
NM_022373chr72338 236 ------
NM_022455chr51271 ------
NM_022456chr1276650 6386 5147 5093 4778 2756 50 --1445 --
NM_022458chr742857 1107 165 97 ------
NM_022459chr1345219 4515 4127 676 12530 11119 --
NM_022462chr1973543 2869 1097 815 686 313 197 13632 ----
NM_022465chr121839 ------
NM_022469chr152693 2679 2355 1089 894 ------
NM_022473chr1574138 3152 3117 2997 1276 916 566 13993 --13268
NM_022477chr2031308 111 85 ------
NM_022497chr353797 2906 660 365 355 ------
NM_022553chr61183 ----1128
NM_022644chr172399 180 ------
NM_022648chr263380 3140 2935 1844 1838 1298 --14641 --
NM_022720chr2281591 1349 1294 695 427 393 172 116 1568 ----
NM_022726chr61504 ------
NM_022731chr11238 --1104 --
NM_022735chr12436 117 --1506 --
NM_022744chr1651270 1017 951 892 300 1278 ----
NM_022749chr831069 378 323 --2494 201 --
NM_022750chr74677 521 494 49 ------
NM_022758chr662952 2941 1015 898 726 681 --22443 1994 --
NM_022766chr2262182 2089 546 431 299 256 --12629 --
NM_022768chr11318 1117 ----
NM_022771chr12----2948 727 --
NM_022776chr3----21340 1221 --
NM_022781chr932685 2652 85 ------
NM_022802chr1011074 --192 --
NM_022817chr271808 1530 765 681 581 379 77 ------
NM_022826chr211190 ------
NM_022832chr442501 1893 880 91 --2359 124 --
NM_022841chr151880 ------
NM_022875chr52485 77 ------
NM_022877chr52485 77 ------
NM_022893chr263094 3071 2887 2538 861 385 --12223 --
NM_022898chr1484016 3684 3410 3011 1039 983 916 846 12939 11415 14686
NM_022912chr232749 2718 528 1695 2521 187 --
NM_022970chr1021049 495 --11116 --
NM_023034chr81225 ------
NM_023074chr19--1868 ----
NM_023076chr1692643 2557 2539 2458 2191 1829 1086 790 167 --12546 --
NM_023079chr1721677 1313 ------
NM_023105chr861944 1783 1694 592 365 143 1502 ----
NM_023106chr861944 1783 1694 592 365 143 1502 ----
NM_023110chr861944 1783 1694 592 365 143 1502 ----
NM_023111chr861944 1783 1694 592 365 143 1502 ----
NM_023927chr521170 474 11138 ----
NM_023929chr822723 2089 --12309 --
NM_023931chr1681551 1510 1472 1384 1195 1113 410 381 ------
NM_023940chr4131 1982 ----
NM_023943chr31201 ------
NM_024007chr522967 2560 --22869 821 --
NM_024019chr41171 ------
NM_024046chr31241 ------
NM_024052chr173811 230 167 ------
NM_024054chr71324 ------
NM_024061chr7----1232 --
NM_024076chr1972343 2325 2233 1667 960 743 121 ----11553
NM_024086chr1773740 3288 2612 2439 1359 953 53 ------
NM_024094chr83801 777 277 --1884 --
NM_024107chr17----131 --
NM_024117chr91217 ------
NM_024294chr662952 2941 1015 898 726 681 --22443 1994 --
NM_024295chr821632 833 --11305 --
NM_024344chr151540 ------
NM_024408chr11572 --13294 --
NM_024416chr921025 371 ------
NM_024424chr1131020 905 180 --1858 --
NM_024425chr1131020 905 180 --1858 --
NM_024426chr1131020 905 180 --1858 --
NM_024503chr1130 ------
NM_024524chr331252 1031 712 ----1552
NM_024529chr1--1167 ----
NM_024539chrX11096 ----1152
NM_024551chr1232429 1936 296 1244 ----
NM_024551chr1232429 1936 296 1244 ----
NM_024554chr131091 455 104 ------
NM_024556chr11----1420 --
NM_024563chr531349 1311 726 ------
NM_024586chr1----1550 --
NM_024595chr12859 47 1471 ----
NM_024612chr171282 2826 118 ----
NM_024635chr91215 ------
NM_024639chr622172 1946 ------
NM_024664chr11325 --177 --
NM_024665chr32624 100 1812 ----
NM_024674chr162918 2336 2298 1012 935 300 ------
NM_024721chr822442 978 --11979 --
NM_024742chr1651921 1476 1286 752 421 11927 1227 --
NM_024751chr4--12032 ----
NM_024770chr256382 6036 5457 2250 655 --25962 1638 11283
NM_024779chr1221393 559 --11146 --
NM_024811chr111280 ------
NM_024834chr1031951 1624 791 ------
NM_024881chr1933187 3163 3149 1998 23392 3246 --
NM_024884chr1464519 4117 1370 1281 1137 358 14069 ----
NM_024911chr11107 --1711 --
NM_024920chr411402 ------
NM_024939chr1641273 303 191 103 --1246 --
NM_024944chr2111278 --182 --
NM_024946chr162314 168 --11737 --
NM_024947chr378701 8167 7552 6399 3104 2137 1736 36901 6077 79 22544 2287 --
NM_024949chr464710 4352 3901 3649 878 831 13829 14814 --
NM_024953chr1242138 1999 1952 408 --11735 --
NM_024989chr247681 6309 2391 1572 17024 17449 --
NM_024991chr1042210 864 790 691 ------
NM_025027chr1911030 ----1251
NM_025054chr831225 968 721 --12991 --
NM_025073chr184155 4111 4073 3539 3343 3205 1656 930 13143 13241 --
NM_025076chr2161 ------
NM_025079chr11502 ------
NM_025106chr121872 126 --11750 --
NM_025133chr211166 ------
NM_025134chr1622070 814 ------
NM_025141chr151511 ------
NM_025146chr332681 1027 273 1630 1783 --
NM_025160chr133455 1735 817 --160 --
NM_025176chr202685 677 --1152 --
NM_025179chr164555 4496 4075 1977 1597 895 --13832 --
NM_025187chr1651240 511 502 199 171 11004 11376 --
NM_025208chr1122320 381 ------
NM_025222chr323066 2046 --1125 --
NM_025224chr20102120 1830 819 513 495 395 341 318 308 296 ------
NM_025230chr145689 584 430 261 179 ------
NM_025244chr21202 ------
NM_025248chr1792423 1982 1250 1200 962 777 727 536 282 --23080 2005 --
NM_025251chr84869 421 363 165 ------
NM_030576chr1762464 2372 2340 2290 755 385 ------
NM_030594chr15297 24 1233 ----
NM_030621chr1424022 2972 ------
NM_030627chr5--21657 1116 ----
NM_030634chr142135 2034 1695 388 ------
NM_030637chr14----1738 127
NM_030645chr141334 1076 335 24 1358 ----
NM_030648chr445344 1657 1467 381 --22026 510 --
NM_030650chr243884 3044 2847 2808 ------
NM_030660chr142956 409 ------
NM_030661chr741655 1391 363 215 ------
NM_030664chr101622 --11664 --
NM_030665chr1711242 ------
NM_030670chr1241541 1523 497 154 ------
NM_030671chr1241541 1523 497 154 ------
NM_030674chr1253708 1941 1565 795 298 1622 14511 --
NM_030758chr2231470 1376 1177 --184 --
NM_030759chr101270 ------
NM_030762chr1221977 1931 ------
NM_030774chr11137 --21315 600 --
NM_030790chr16266 31 ------
NM_030796chr731893 757 51 ------
NM_030806chr1108970 8599 8411 8202 7463 6317 2795 2683 2150 674 47325 3052 2838 927 18462 --
NM_030809chr1231880 863 635 ------
NM_030820chr62657 50 ------
NM_030877chr20178 ------
NM_030881chr2232330 2288 2128 --12048 --
NM_030884chr342257 2092 1574 379 --11493 --
NM_030915chr252191 1963 1681 1452 928 1588 1696 --
NM_030918chr1125360 4325 4270 4259 3868 2056 2042 1668 810 660 498 54 ------
NM_030938chr171265 1881 ----
NM_030939chr6----1338 --
NM_030962chr112524 304 ------
NM_030964chr533113 2664 902 --12785 --
NM_030965chr1------1635
NM_030978chr9--1465 ----
NM_031216chr1811657 ----1781
NM_031243chr71292 ------
NM_031268chr16175388 5258 5111 4980 4625 4227 3992 3687 3595 2063 1875 1843 1393 1309 751 621 403 ------
NM_031272chr17132 --1260 --
NM_031296chr431958 555 474 --1997 --
NM_031362chr232627 2250 1911 ------
NM_031365chr252763 2386 2047 1831 1825 ------
NM_031366chr252763 2386 2047 1831 1825 ------
NM_031371chr14637 628 473 37 ------
NM_031371chr14637 628 473 37 ------
NM_031372chr431449 1258 73 ------
NM_031409chr641755 1110 178 72 --11749 --
NM_031411chr531678 401 220 ------
NM_031417chr1952742 1921 1082 228 105 12781 ----
NM_031424chr202386 198 1494 ----
NM_031426chr932389 1966 476 --12692 --
NM_031427chr1465811 4499 4077 1233 883 653 23663 1840 --12155
NM_031439chr81591 1144 ----
NM_031442chrX12857 ------
NM_031445chr252915 2902 2857 47 37 --13336 --
NM_031453chr1012333 ------
NM_031459chr141635 1016 502 336 ------
NM_031461chr81357 11550 1621 --
NM_031477chr16163 --1264 --
NM_031844chr133456 2520 759 --12707 --
NM_031845chr253621 2722 2685 801 213 --13289 13259
NM_031847chr253621 2722 2685 801 213 --13289 13259
NM_031849chr531678 401 220 ------
NM_031857chr531678 401 220 ------
NM_031860chr531678 401 220 ------
NM_031890chr2282371 2321 2092 1165 937 871 517 384 ------
NM_031914chr14----1157 --
NM_031954chr1292213 2107 2071 1109 978 709 702 613 562 ------
NM_031990chr191324 --11355 --
NM_031991chr191324 --11355 --
NM_032012chr974370 4187 3974 1164 283 132 69 24923 571 23291 248 --
NM_032013chr2031308 111 85 ------
NM_032017chr131858 796 609 ------
NM_032041chr852705 2296 1920 1016 606 12561 ----
NM_032047chr322251 839 ------
NM_032050chr22----1170 --
NM_032088chr521343 479 --11760 --
NM_032092chr521343 479 --11760 --
NM_032102chr1152797 2015 715 628 337 ----12655
NM_032105chr1117981 7680 6737 6417 5802 5342 2117 1734 1566 806 799 36325 5113 3132 25708 5326 --
NM_032121chrX2855 524 ------
NM_032139chr191107 1925 ----
NM_032144chr21592 --1191 --
NM_032145chr611919 ------
NM_032153chr311070 12106 22676 2307 --
NM_032160chr1843824 3668 3490 2993 1173 ----
NM_032175chr521303 142 21758 1176 ----
NM_032186chr111310 ------
NM_032192chr171143 ------
NM_032193chr11101855 1769 1665 1492 1299 697 686 420 399 177 ------
NM_032199chr1053669 2881 1540 329 36 23375 73 11194 --
NM_032207chr192965 793 --11110 --
NM_032208chr241136 1063 872 783 1430 ----
NM_032211chr102343 186 2864 216 11121 --
NM_032217chr421031 59 ------
NM_032221chr20----11266 11743
NM_032233chr141850 ------
NM_032246chr1511221 ------
NM_032281chr19----1361 --
NM_032283chr171769 1500 1333 457 405 140 31 ------
NM_032327chr101379 ------
NM_032329chr2124117 3912 3623 3288 3181 3173 3146 2848 1307 671 218 117 ------
NM_032345chr12--1108 ----
NM_032352chr1431124 988 517 ------
NM_032357chr22311 51 ------
NM_032364chr123804 368 330 ------
NM_032373chr1074191 2308 2049 1814 1768 900 348 ------
NM_032389chr1151174 907 771 168 135 ----1323
NM_032403chr521343 479 --11760 --
NM_032430chr19--1296 ----
NM_032439chr1011048 ----1337
NM_032440chr103770 213 196 ------
NM_032445chr1542385 2056 896 773 ------
NM_032446chr523512 1082 23682 1350 ----
NM_032449chr162625 1836 1145 452 367 304 1927 --12218
NM_032452chr1421434 27 --11364 --
NM_032457chr433943 3250 889 ------
NM_032458chrX23370 2205 ------
NM_032468chr8167 ------
NM_032547chr42960 94 ------
NM_032560chr14191 ------
NM_032569chr1631452 682 349 ------
NM_032575chr1661672 1490 1422 1387 189 157 ------
NM_032580chr171404 1146 ----
NM_032582chr1741519 1342 750 117 11577 ----
NM_032590chr122986 193 ------
NM_032595chr1731283 423 277 --1190 --
NM_032638chr361457 1285 1102 544 490 380 ------
NM_032682chr321246 836 --21156 672 --
NM_032689chr1931188 1076 643 11533 198 --
NM_032711chr17124170 3620 3530 3333 3293 2945 1621 1591 1577 1533 1298 400 ------
NM_032737chr1952458 1844 1785 548 70 --12148 --
NM_032788chr2--21242 1095 ----
NM_032802chr15----1218 --
NM_032808chr154879 860 725 624 ------
NM_032812chr10--1306 ----
NM_032826chr774847 4273 4048 3787 1137 1110 493 14396 25188 330 --
NM_032828chr1964212 3276 3196 1488 428 347 21462 1004 24061 3329 --
NM_032833chr132592 1811 489 ----11926
NM_032838chr192409 46 ----1505
NM_032846chr1431287 606 388 1287 ----
NM_032857chr15----1155 --
NM_032873chr1163089 3078 3066 1657 1333 1111 --11347 --
NM_032875chr17----1220 --
NM_032876chr144773 389 213 49 21731 434 ----
NM_032880chr11115 ------
NM_032900chr1063298 2536 1547 1257 1163 26 --11305 --
NM_032975chr1853086 2210 1011 648 98 12844 1991 --
NM_032978chr18----11114 --
NM_032979chr18----11114 --
NM_032980chr1853086 2210 1011 648 98 12844 1991 --
NM_032981chr18----11114 --
NM_032998chr12846 365 ------
NM_033014chr921025 371 ------
NM_033018chrX4272 231 185 165 ------
NM_033020chr144503 3356 3340 1864 24285 3285 13306 1671
NM_033030chr2161 --11385 --
NM_033044chr11849 ------
NM_033071chr6----1157 --
NM_033089chr202541 469 11459 ----
NM_033116chr143232 225 89 ------
NM_033117chr9139 ------
NM_033121chr1241661 1299 649 268 ------
NM_033133chr1783298 1445 1414 1324 1195 854 574 440 ------
NM_033135chr1122320 381 ------
NM_033143chr454544 2882 1559 346 97 --22870 1782 --
NM_033161chr971573 1343 745 730 496 171 40 --11513 --
NM_033181chr633339 3310 1000 13456 ----
NM_033201chr161208 ------
NM_033211chr51638 ------
NM_033222chr91955 ----11205
NM_033224chr787923 7246 6945 6808 6651 2625 1423 1000 --23077 2929 --
NM_033225chr823105 99 ------
NM_033226chr161101 ------
NM_033240chr1551508 1440 674 469 359 --11080 --
NM_033255chr132151 25 ------
NM_033266chr16168 --128 --
NM_033274chr562703 2596 982 561 517 62 --1207 --
NM_033278chr11124 ------
NM_033285chr854339 4068 1684 1154 520 ------
NM_033290chrX33656 1341 1036 13136 ----
NM_033300chr12905 270 11336 ----
NM_033310chr11164 ------
NM_033315chr1741434 721 575 205 ------
NM_033326chr1152400 2339 1992 1862 853 --1116 --
NM_033331chr952899 2664 981 344 296 1482 22883 2655 --
NM_033340chr1041221 977 426 81 1583 ----
NM_033360chr1233298 2869 695 ------
NM_033389chr1774740 3905 3764 3628 973 692 605 11832 ----
NM_033393chr452893 2146 1184 1079 551 --22525 2513 --
NM_033394chr21280 ----11547
NM_033425chr1142138 391 323 139 --12174 --
NM_033429chr1582385 2091 1228 1019 946 872 768 271 --1860 --
NM_033480chr642618 2414 1939 802 --1559 --
NM_033481chr642618 2414 1939 802 --1559 --
NM_033503chr15113801 3599 3368 3337 3147 2948 2937 2720 1091 959 458 22530 2484 ----
NM_033505chr286331 6178 6130 5961 5798 5753 4634 4529 --36470 4552 533 --
NM_033549chr55964 802 261 180 63 ------
NM_033551chr523248 1294 ------
NM_033624chr12----1244 --
NM_033626chrX51625 1589 1374 574 544 --21250 1134 --
NM_033631chr123710 2681 23002 614 11382 --
NM_033632chr41127 ------
NM_033642chrX2836 461 ------
NM_033644chr532511 1774 352 --12098 --
NM_033645chr532511 1774 352 --12098 --
NM_033656chr2135071 1266 174 11729 15442 --
NM_044472chr11283 ------
NM_052828chr641426 1364 420 189 1404 1386 --
NM_052832chr832856 2287 668 ------
NM_052834chr1842389 2132 2002 223 ------
NM_052840chr1511489 ------
NM_052845chr1253051 1310 1234 1146 46 2843 615 ----
NM_052846chr205933 497 445 346 315 ------
NM_052851chr1321898 197 12051 ----
NM_052864chr421889 1357 ------
NM_052875chr1122174 2113 --22146 650 --
NM_052879chr1233554 2585 455 13317 23295 484 --
NM_052885chr1263904 1679 1572 1533 911 407 34266 1275 471 --1437
NM_052898chr82164 61 1225 ----
NM_052905chr221879 328 11177 ----
NM_052907chr1252965 1620 970 404 319 24145 4129 23784 1419 --
NM_052910chr1351900 1839 759 523 422 ------
NM_052932chr1111797 1548 ----
NM_052934chr13669 492 389 ------
NM_052978chr141752 1481 21386 170 --
NM_053002chr31890 --1462 --
NM_053016chr956903 6222 5665 5371 1703 16596 26320 584 --
NM_053023chr1132878 1031 668 ------
NM_053024chr31378 ------
NM_053025chr31653 ------
NM_053026chr31653 ------
NM_053027chr31653 ------
NM_053028chr31653 ------
NM_053031chr31653 ------
NM_053032chr31653 ------
NM_053043chr7125635 5604 4659 4127 2171 1785 1017 982 902 851 717 307 1768 34096 801 746 --
NM_053064chr1432342 2277 1162 1552 ----
NM_053281chrX1289 ------
NM_054025chr1162190 1833 410 242 72 45 ------
NM_057159chr911132 ------
NM_057175chr4----1867 --
NM_058241chr251762 851 702 356 274 ------
NM_058241chr251762 851 702 356 274 ------
NM_078474chr151511 ------
NM_079421chr19--1129 ----
NM_080415chr171830 ------
NM_080491chr1163473 1449 1387 721 573 234 12891 ----
NM_080546chr91231 ------
NM_080654chr1131294 125 35 ------
NM_080664chr1412006 --1511 --
NM_080669chr1764787 4577 4174 3475 1746 1252 11259 11947 1566
NM_080670chr51376 1682 ----
NM_080671chr232047 1747 1733 ------
NM_080676chr2052661 1023 968 807 300 --13127 --
NM_080679chr63813 768 666 ------
NM_080680chr63813 768 666 ------
NM_080681chr63813 768 666 ------
NM_080764chr2232691 2568 512 1220 22788 746 --
NM_080792chr2062286 1935 1786 1662 581 266 ------
NM_080827chr20168 ------
NM_080867chr1454288 3775 3258 1151 711 --24715 3280 14193
NM_080872chr863873 3793 3246 2910 1253 32 13904 23021 460 --
NM_080927chr332869 2543 346 --3639 402 46 --
NM_130387chr3151 162 1850 --
NM_130391chr923333 389 --13443 --
NM_130392chr923333 389 --13443 --
NM_130393chr923333 389 --13443 --
NM_130435chr10137 --12269 12010
NM_130436chr215835 816 788 742 322 ------
NM_130438chr2131365 1319 899 ------
NM_130439chr1031990 1948 402 --12119 --
NM_130439chr1031990 1948 402 --12119 --
NM_130442chr72921 232 ----1423
NM_130798chr1511023 ------
NM_130811chr203895 443 185 ------
NM_130846chr121709 ------
NM_133170chr20168069 7654 7635 7188 7118 6627 6413 5807 5600 5521 4944 2997 2819 2786 1089 133 11860 17795 --
NM_133264chr1773760 2924 2605 2531 1528 1061 60 --13403 --
NM_133330chr442764 1092 825 523 11249 ----
NM_133331chr442764 1092 825 523 11249 ----
NM_133334chr4105808 4898 4792 4536 4088 1921 1493 1382 1190 323 --15987 11260
NM_133335chr442764 1092 825 523 11249 ----
NM_133370chr483227 3031 2830 2234 1401 1295 1281 681 --12794 12812
NM_133372chr542668 2503 2016 367 --1168 --
NM_133433chr5----1359 --
NM_133486chrX--1371 182 --
NM_133496chr154179 3624 3115 1406 210 --24108 889 --
NM_133498chr192119 83 ------
NM_133503chr12--1743 ----
NM_133504chr12--1743 ----
NM_133505chr12--1743 ----
NM_133506chr12--1743 ----
NM_133507chr12--1921 ----
NM_133631chr321213 630 ------
NM_133638chr5----1195 --
NM_133650chr6----1157 --
NM_134442chr2147 ------
NM_134447chr191634 ------
NM_138270chrX23014 1078 ------
NM_138285chr2----1410 --
NM_138288chr1422033 1792 12134 11440 --
NM_138292chr1121150 218 --22619 178 13357
NM_138319chr153910 813 279 ------
NM_138338chr2283062 2900 2538 1382 1297 950 595 51 --1764 --
NM_138396chr124872 396 158 62 ------
NM_138415chr2221655 292 ------
NM_138417chr1----130 --
NM_138426chr732473 820 466 --12451 1499
NM_138453chr5------168
NM_138457chr693279 2850 2535 2380 2270 1162 1041 521 209 ------
NM_138473chr1255132 4197 3316 592 543 ------
NM_138479chr111733 ------
NM_138492chr5--11254 ----
NM_138555chr151404 ------
NM_138559chr2153 ------
NM_138576chr1484016 3684 3410 3011 1039 983 916 846 12939 11415 14686
NM_138621chr241162 1149 1022 996 14084 ----
NM_138633chr621781 228 ------
NM_138638chr142824 372 ------
NM_138713chr1666873 2879 2432 2218 1488 917 27322 5161 28100 419 --
NM_138714chr1666873 2879 2432 2218 1488 917 27322 5161 28100 419 --
NM_138731chr1422913 354 ----13414
NM_138735chr21548 ------
NM_138766chr51156 ------
NM_138771chr711073 179 ----
NM_138779chr13--1221 ----
NM_138795chr13597 557 294 ------
NM_138821chr51156 ------
NM_138822chr51156 ------
NM_138966chr181621 ------
NM_138970chr1431896 1749 914 --1602 1374
NM_138971chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138971chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138972chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138972chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138973chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138973chr1173612 3356 2669 2488 1317 1237 94 12579 ----
NM_138980chr42547 233 ------
NM_138981chr41678 1553 ----
NM_138982chr42547 233 ------
NM_139015chr1241618 1368 81 29 ------
NM_139035chrX1517 ------
NM_139045chr9----1694 --
NM_139046chr102216 78 ------
NM_139047chr10182 ------
NM_139049chr10182 ------
NM_139057chr1571977 969 953 900 471 193 79 --12353 --
NM_139062chr174393 123 60 50 1484 1147 --
NM_139071chr123593 332 84 1247 ----
NM_139131chr112659 524 ------
NM_139135chr1--11267 1351 --
NM_139166chr8----140 --
NM_139167chr81107 ------
NM_139169chr105919 746 527 461 424 --1181 --
NM_139177chr173618 409 58 1388 ----
NM_139244chr61157 ------
NM_139245chr341368 1253 134 54 ------
NM_139246chr982213 934 920 854 823 394 382 279 11613 ----
NM_139278chr861069 974 845 378 35 22 ------
NM_139283chr1262349 935 829 496 234 107 12362 ----
NM_139321chr2033657 552 87 --1410 --
NM_139323chr2011318 1646 ----
NM_144571chr467030 5923 5716 5209 1123 85 --15516 --
NM_144579chr2122831 2772 2765 2387 2212 2027 836 588 539 502 489 458 ------
NM_144582chr292612 2538 2302 2146 1904 1618 622 369 110 12200 22259 389 --
NM_144595chr131684 ------
NM_144599chr1575408 5236 4661 1724 1321 150 127 --14996 --
NM_144600chr161433 1624 ----
NM_144609chr1741212 1182 441 126 ------
NM_144610chr17--1389 ----
NM_144632chr211708 1342 ----
NM_144633chr34512 405 330 231 ------
NM_144635chr341140 891 823 250 ------
NM_144642chr32259 216 --11116 --
NM_144644chr4----121 --
NM_144664chr1131575 1013 919 12469 ----
NM_144667chr126952 711 312 195 136 89 ------
NM_144721chr442527 2429 1911 351 ------
NM_144723chr51620 131 ----
NM_144726chr511041 ------
NM_144728chr11666 ------
NM_144729chr11666 ------
NM_144767chr1574583 4315 3514 2972 1534 1429 1263 --1275 --
NM_144775chr17124933 4135 3955 3502 3404 1684 1662 1323 1298 884 601 240 ------
NM_144949chr21261 12488 ----
NM_144967chrX2277 187 ------
NM_145010chr1032193 1945 137 ----11558
NM_145021chr101127 --1276 --
NM_145049chr51123 ------
NM_145055chr1843546 1375 927 868 11295 13733 --
NM_145058chr122350 28 ------
NM_145109chr172854 685 ------
NM_145119chrX126 ------
NM_145175chr261328 1022 449 363 350 130 --21189 331 --
NM_145203chr13------1732
NM_145206chr10165 12157 11075 --
NM_145207chr495225 5015 4814 1948 1934 924 583 498 471 15272 ----
NM_145259chr21570 25819 5792 15813 --
NM_145284chrX22518 346 --11764 --
NM_145296chr192827 742 ------
NM_145307chr1023754 3390 ------
NM_145320chr7----13176 --
NM_145321chr7----13176 --
NM_145322chr7----13176 --
NM_145341chr101536 ------
NM_145349chr173903 551 542 12047 11966 --
NM_145350chr172487 255 11399 11318 --
NM_145638chr115985 861 415 227 196 1714 ----
NM_145647chr81162 --1173 --
NM_145686chr262723 2707 2576 2526 813 29 --12416 --
NM_145687chr262723 2707 2576 2526 813 29 --12416 --
NM_145690chr831528 289 219 --11707 --
NM_145714chr161360 ------
NM_145793chr101875 ------
NM_145799chrX73059 2936 1215 1157 458 421 329 --12905 --
NM_145899chr64509 438 404 223 ------
NM_145901chr64509 438 404 223 ------
NM_145902chr64509 438 404 223 ------
NM_145903chr64509 438 404 223 ------
NM_145904chr64509 438 404 223 ------
NM_145905chr64509 438 404 223 ------
NM_145909chr61261 1151 1543 --
NM_147150chr953383 2888 2734 2451 1401 --12713 --
NM_147156chr1021547 327 ------
NM_147175chrX2597 347 ------
NM_147189chr82359 160 --11789 --
NM_147223chr231527 724 486 ------
NM_147233chr22541 303 ------
NM_148174chr822226 1852 ------
NM_148414chr161443 ------
NM_148415chr161383 ------
NM_148416chr161360 ------
NM_148571chr1741466 1433 1409 239 ------
NM_148894chr42968 69 ------
NM_148898chr71846 --1285 --
NM_148899chr71846 --1285 --
NM_148904chr1----1550 --
NM_148905chr1----1550 --
NM_148906chr1----1550 --
NM_148907chr1----1550 --
NM_148908chr1----1550 --
NM_148909chr1----1550 --
NM_152227chr203674 632 616 ------
NM_152233chr1431602 658 318 11332 ----
NM_152237chr2271747 1548 1318 1183 281 134 58 ------
NM_152238chr11239 ------
NM_152244chr1751215 765 463 415 26 ------
NM_152253chr22104038 3793 3770 3625 3251 3036 2900 1667 822 185 --11170 --
NM_152261chr1232457 1776 138 ------
NM_152263chr155980 4791 4661 2349 2192 ------
NM_152265chr121129 577 ------
NM_152267chr2231890 662 75 1729 ----
NM_152271chr83975 364 54 ------
NM_152277chr51290 ------
NM_152280chr173423 3160 3017 2711 1311 730 439 ------
NM_152289chr1921062 99 --11283 11706
NM_152300chr171234 1730 1647 --
NM_152332chr1452718 2589 1879 1018 767 --12635 --
NM_152335chr152621 109 ------
NM_152342chr164535 488 396 197 ------
NM_152344chr17158 --1546 --
NM_152371chr141769 1717 312 21 --1597 --
NM_152375chr142318 2108 1677 109 --32471 2252 1785 --
NM_152407chr552779 786 679 172 128 --1228 12391
NM_152408chr5142 ------
NM_152409chr543013 2681 447 262 --194 --
NM_152410chr6--1127 ----
NM_152414chr811424 ------
NM_152423chrX11544 ----11189
NM_152424chrX84576 4483 4279 3784 3151 1815 619 178 --14271 --
NM_152440chr12171 --1416 --
NM_152470chr18104112 2524 1334 1260 1143 1134 1016 919 817 724 ------
NM_152493chr111460 --1452 --
NM_152520chr2--1353 ----
NM_152538chr331550 1281 1272 ------
NM_152574chr9--1159 ----
NM_152594chr15----11491 --
NM_152624chr557402 6714 6532 5488 5122 --21994 1489 14926
NM_152629chr933086 2697 493 ------
NM_152641chr12----22467 2110 --
NM_152652chr162281 221 ------
NM_152660chr1--1651 ----
NM_152665chr131312 837 361 ------
NM_152688chr6153 ------
NM_152695chrX----11957 --
NM_152713chr11----1215 --
NM_152724chr1042568 1900 280 25 ------
NM_152733chr686316 5675 4573 4270 2199 1974 1104 887 1914 15122 --
NM_152734chr685330 5320 4529 1313 867 470 343 162 --45386 3862 1510 733 --
NM_152758chr822457 2244 --11010 --
NM_152774chr712010 --1421 --
NM_152787chrX33098 684 326 --23640 130 --
NM_152788chr12--183 ----
NM_152789chr7------11025
NM_152829chr751185 965 884 846 47 ------
NM_152836chr821755 1426 ------
NM_152837chr821755 1426 ------
NM_152838chr2033466 2943 947 --13451 --
NM_152896chr9135 ------
NM_152902chr111493 ------
NM_152919chr1963503 3412 2495 1337 911 239 ------
NM_152924chr15106362 5692 5251 5052 4591 4246 2311 2291 1831 508 ------
NM_152989chr1241180 385 326 70 ------
NM_153028chr161205 --1265 --
NM_153029chr1693665 3534 3163 2944 2514 1550 911 830 761 --23901 3043 --
NM_153035chr132475 577 90 ------
NM_153038chr21723 ------
NM_153050chr2274515 3497 3394 3129 1583 1262 28 11744 21217 337 13201
NM_153051chr2274515 3497 3394 3129 1583 1262 28 11744 21217 337 13201
NM_153181chr181621 ------
NM_153184chr3------11698
NM_153188chr565071 4965 4387 3992 2188 1501 ------
NM_153207chr1223572 944 ------
NM_153223chr51261 ------
NM_153228chr17----192 --
NM_153252chrX----141 --
NM_153260chr152587 275 ------
NM_153280chrX177 ------
NM_153367chr1063706 3493 3429 2945 1570 1366 --11445 --
NM_153450chr11162 --1616 --
NM_153499chr1292739 2651 2499 2486 2308 2028 1885 595 302 ----1938
NM_153500chr1292739 2651 2499 2486 2308 2028 1885 595 302 ----1938
NM_153607chr532474 1161 832 ------
NM_153616chr153365 116 29 ------
NM_153617chr153365 116 29 ------
NM_153618chr153365 116 29 ------
NM_153619chr1531354 1267 408 12386 1175 --
NM_153631chr741655 1391 363 215 ------
NM_153632chr741655 1391 363 215 ------
NM_153645chr2282630 2511 2179 2027 665 576 413 143 12441 ----
NM_153649chr132105 1609 1452 ------
NM_153693chr121631 ------
NM_153705chr112809 117 --12373 --
NM_153756chr111376 2405 146 ----
NM_153757chr4----1265 --
NM_153810chr1074799 4169 3709 3543 3332 701 503 ----14542
NM_170662chr31187 ------
NM_170665chr1283689 2956 2791 1815 1521 1069 598 542 1886 ----
NM_170674chr1511101 ------
NM_170675chr151777 ------
NM_170676chr151777 ------
NM_170677chr1511101 ------
NM_170679chr511127 --11118 --
NM_170706chr164043 3340 3168 1663 1360 31 --14164 --
NM_170711chr193882 665 28 1591 ----
NM_170731chr1142695 2605 1088 877 1523 ----
NM_170732chr1142695 2605 1088 877 1523 ----
NM_170733chr1142695 2605 1088 877 1523 ----
NM_170734chr1142695 2605 1088 877 1523 ----
NM_170735chr1142695 2605 1088 877 1523 ----
NM_170751chr621065 480 ------
NM_170752chr621065 480 ------
NM_170774chr2063509 1663 943 935 921 775 --11637 --
NM_170775chr5148 ------
NM_171999chr182762 139 ------
NM_172016chr631088 1073 908 ------
NM_172070chr2--1518 11419 --
NM_172071chr176398 4701 2814 2620 2172 2017 1718 16112 ----
NM_172103chr611770 --1199 --
NM_172105chr611770 --1199 --
NM_172169chr1051770 1721 624 476 388 --21736 1408 --
NM_172170chr1051770 1721 624 476 388 --21736 1408 --
NM_172171chr1051770 1721 624 476 388 --21736 1408 --
NM_172173chr1051770 1721 624 476 388 --21736 1408 --
NM_172216chr1282641 2553 2401 2388 2210 1930 497 204 ----1840
NM_172226chr1292739 2651 2499 2486 2308 2028 1885 595 302 ----1938
NM_172315chr1511101 ------
NM_172316chr1511101 ------
NM_172349chr51271 ------
NM_172375chr1411090 1267 ----
NM_173065chr153125 2737 2323 1260 691 ------
NM_173074chr23346 83 38 ------
NM_173076chr22971 933 --141 --
NM_173087chr151540 ------
NM_173088chr151540 ------
NM_173089chr151540 ------
NM_173090chr151540 ------
NM_173163chr161476 ------
NM_173165chr161357 ------
NM_173172chr2147 ------
NM_173198chr932030 765 586 ------
NM_173200chr932030 765 586 ------
NM_173214chr1666873 2879 2432 2218 1488 917 27322 5161 28100 419 --
NM_173353chr12----197 --
NM_173354chr2131535 129 74 ------
NM_173359chr32760 245 ------
NM_173468chr455000 3681 2280 732 344 ------
NM_173470chrX52810 2782 2771 2005 136 --1418 --
NM_173476chr1672049 2026 1935 1576 1507 673 275 ----11870
NM_173478chr1711094 ------
NM_173489chr5126 ------
NM_173500chr1531354 1177 497 ------
NM_173510chr2222837 1031 12536 ----
NM_173511chr233443 1024 493 --13217 --
NM_173515chr63902 312 202 ------
NM_173525chr11160 ------
NM_173531chr1922662 1563 12531 13224 --
NM_173552chr32411 317 ------
NM_173595chr1264416 3880 3230 1833 171 33 --15297 --
NM_173602chr1262942 2455 1342 1316 605 104 11482 ----
NM_173609chr153756 617 254 ------
NM_173642chr1139130 7973 6333 6027 5956 3582 2427 2300 2045 1809 768 735 332 28314 5623 28569 3217 1159
NM_173694chrX32042 289 229 ----12019
NM_173809chr1041412 1401 1037 389 --11154 --
NM_173822chr231848 717 378 ------
NM_173825chr322726 581 ------
NM_173854chr132285 2051 326 --2645 200 --
NM_174856chr201103 ------
NM_174890chr101752 ------
NM_174909chr5----1818 --
NM_174934chr1183579 3409 3129 2671 2223 657 431 202 --12430 --
NM_174953chr1751034 975 477 196 148 --11110 --
NM_174957chr1751034 975 477 196 148 --11110 --
NM_175061chr7----11674 --
NM_175610chr152381 168 1389 ----
NM_175623chr1276650 6386 5147 5093 4778 2756 50 --1445 --
NM_175624chr1276745 6481 5242 5188 4873 2851 145 --1540 --
NM_175625chr1276745 6481 5242 5188 4873 2851 145 --1540 --
NM_175630chr22356 215 1597 284 45 --
NM_175634chr811005 ------
NM_175635chr811005 ------
NM_175636chr811005 ------
NM_175709chr2282820 2485 2455 2257 2060 624 438 360 ------
NM_175733chr1192090 2039 1830 1675 1606 665 199 177 142 12015 ----
NM_175747chr61376 ------
NM_175767chr51737 ------
NM_175847chr191324 --11355 --
NM_175848chr202335 290 ------
NM_175848chr202335 290 ------
NM_175849chr202335 290 ------
NM_175849chr202335 290 ------
NM_175850chr202335 290 ------
NM_175850chr202335 290 ------
NM_175854chr1341013 950 190 31 ------
NM_175856chr52630 127 ------
NM_175859chrX71786 1574 1462 1268 1236 1222 1171 --11389 --
NM_175861chr1245109 4282 2401 1478 1469 15722 --
NM_175863chr6--11292 ----
NM_175873chr52300 39 11185 ----
NM_175876chr12882 261 ------
NM_175884chr721429 353 1933 ----
NM_175895chr12126 11036 ----
NM_175907chr183484 401 213 --32532 620 258 --
NM_175931chr16131909 1902 1877 1870 1845 1838 1813 1806 1782 1774 709 96 82 1438 ----
NM_176823chr123817 574 12860 2499 207 --
NM_177398chr151886 1692 1566 1344 70 --11261 --
NM_177399chr151886 1692 1566 1344 70 --11261 --
NM_177438chr1424022 2972 ------
NM_177441chr17----131 --
NM_177454chr21292 1184 ----
NM_177553chr111681 --139 --
NM_177925chr1252605 2534 324 209 55 ------
NM_177968chr22713 463 11435 ----
NM_177972chr11134261 3916 3807 3745 3629 3565 3493 1454 1423 1291 626 495 376 ------
NM_177983chr22327 124 ------
NM_177996chr2063245 2656 2292 2248 2151 1307 11376 ----
NM_177999chr993609 3146 2596 2551 1458 1154 469 443 191 --13271 13391
NM_178006chr1321898 197 12051 ----
NM_178007chr1321898 197 12051 ----
NM_178010chr1241180 385 326 70 ------
NM_178013chr1441184 706 388 278 12123 ----
NM_178031chr111178 ------
NM_178037chr1262890 2814 2624 2583 2208 560 --1972 --
NM_178038chr1262890 2814 2624 2583 2208 560 --1972 --
NM_178126chr1751474 689 651 501 124 ------
NM_178135chr4----11111 --
NM_178151chrX66746 6584 5253 5149 5135 2448 14864 35483 4785 1605 --
NM_178152chrX66746 6584 5253 5149 5135 2448 14864 35483 4785 1605 --
NM_178153chrX66746 6584 5253 5149 5135 2448 14864 35483 4785 1605 --
NM_178313chr221860 63 ------
NM_178424chr51231 ------
NM_178426chr121581 1498 --1460 --
NM_178427chr121481 1398 --1360 --
NM_178450chr51505 ------
NM_178454chr1--1636 --1558
NM_178470chrX1100 --1240 --
NM_178496chr321566 1402 ------
NM_178505chr1053636 3373 3014 1011 958 12585 ----
NM_178526chr1971907 1901 1790 1531 1480 1290 569 ------
NM_178539chr1211796 11571 41774 1731 445 145 --
NM_178565chr831341 1075 154 ------
NM_178566chr921828 577 ------
NM_178585chr423031 594 --22580 32 --
NM_178586chr1432336 2107 502 --12347 --
NM_178812chr821490 1323 ----1625
NM_178818chr1642246 2018 1581 175 --11627 --
NM_178830chr194254 194 180 71 ------
NM_180976chr62808 167 ------
NM_180977chr62808 167 ------
NM_181050chr16--1132 ----
NM_181332chrX22712 441 1938 ----
NM_181349chr762703 2156 1111 964 264 36 ------
NM_181351chr1132679 2410 1143 --22214 1921 --
NM_181353chr201539 ------
NM_181354chr8134 11381 ----
NM_181357chr145689 584 430 261 179 ------
NM_181358chr153702 3268 3188 3078 32 ------
NM_181425chr911194 131 ----
NM_181443chr20------12664
NM_181457chr231249 970 522 ------
NM_181458chr231382 1103 44 ------
NM_181459chr231148 869 421 ------
NM_181460chr231195 916 468 ------
NM_181492chr221176 --11188 --
NM_181504chr544026 3287 3246 419 --23013 988 --
NM_181505chr171143 ------
NM_181507chr111357 ------
NM_181508chr111357 ------
NM_181521chr1687027 6799 6362 4956 2082 836 553 150 --16408 --
NM_181523chr544026 3287 3246 419 --23013 988 --
NM_181524chr544026 3287 3246 419 --23013 988 --
NM_181537chr172144 26 ------
NM_181571chr105934 913 860 830 82 --1888 --
NM_181659chr2032988 2190 1140 --1638 --
NM_181659chr2032988 2190 1140 --1638 --
NM_181672chrX1271 ------
NM_181673chrX1271 ------
NM_181689chr201740 ------
NM_181706chr1132122 968 837 2920 372 ----
NM_181782chr622145 1874 --11718 --
NM_181825chr22----1307 --
NM_181828chr2253042 2459 1302 1061 42 --13361 --
NM_181829chr2253042 2459 1302 1061 42 --13361 --
NM_181830chr2253042 2459 1302 1061 42 --13361 --
NM_181832chr2253057 2474 1317 1076 57 --13376 --
NM_181838chr531544 1391 647 ------
NM_181839chr82219 104 --11280 --
NM_181861chr1252377 1100 1086 821 397 --1785 --
NM_181868chr1252377 1100 1086 821 397 --1785 --
NM_181869chr1242462 1171 906 482 --1870 --
NM_181873chr1------147
NM_182314chrX21575 562 --11218 --
NM_182485chr431371 1319 1181 153 --1703
NM_182493chr1654432 1918 676 135 90 14840 14985 --
NM_182501chr272279 1270 1126 791 754 672 121 12493 21303 595 --
NM_182503chr665020 4704 4165 1533 523 335 35526 5478 5340 ----
NM_182520chr22--1910 ----
NM_182526chr1462487 2121 1972 857 599 530 --12393 12724
NM_182527chr22101741 1599 1523 735 666 539 245 215 177 44 --11559 --
NM_182528chr22199 154 ------
NM_182529chr7126 ------
NM_182551chr212466 --33521 3244 970 --
NM_182557chr1152085 1839 1688 1674 741 --185 --
NM_182620chr1751873 1689 547 396 120 1349 ----
NM_182646chr431371 1319 1181 153 --1703
NM_182649chr20--1200 ----
NM_182663chr141954 1901 1398 377 ------
NM_182664chr142084 2031 1528 507 ------
NM_182665chr141954 1901 1398 377 ------
NM_182678chr21355 ------
NM_182687chr16----1188 --
NM_182691chr71102 ------
NM_182692chr71102 ------
NM_182700chr731771 1715 218 ------
NM_182717chr1051339 1318 1265 1235 487 --11293 --
NM_182718chr105934 913 860 830 82 --1888 --
NM_182719chr105934 913 860 830 82 --1888 --
NM_182720chr1051339 1318 1265 1235 487 --11293 --
NM_182721chr1051339 1318 1265 1235 487 --11293 --
NM_182722chr1051339 1318 1265 1235 487 --11293 --
NM_182723chr1051339 1318 1265 1235 487 --11293 --
NM_182724chr105934 913 860 830 82 --1888 --
NM_182725chr105934 913 860 830 82 --1888 --
NM_182734chr2042292 1039 772 281 ------
NM_182756chr2--1418 ----
NM_182765chr1031841 505 235 ------
NM_182769chr105934 913 860 830 82 --1888 --
NM_182770chr105934 913 860 830 82 --1888 --
NM_182771chr105934 913 860 830 82 --1888 --
NM_182772chr105934 913 860 830 82 --1888 --
NM_182797chr201471 --11213 --
NM_182830chr142634 362 --1414 --
NM_182848chr133625 605 193 ------
NM_182850chr105934 913 860 830 82 --1888 --
NM_182853chr1051339 1318 1265 1235 487 --11293 --
NM_182896chr311629 --1440 --
NM_182898chr765164 4196 2354 1554 121 22 ------
NM_182899chr765164 4196 2354 1554 121 22 ------
NM_182907chr662339 2036 975 861 469 73 ------
NM_182911chr21202 ------
NM_182917chr3148 --1156 --
NM_182918chr2131269 494 303 11360 11047 --
NM_182920chr311272 --11228 --
NM_182931chr71454 ------
NM_182948chr122921 354 12867 21005 427 --
NM_182961chr6----1157 --
NM_182970chr2084320 3542 3447 3119 2926 1655 1461 939 13702 134 --
NM_182972chr162560 2253 2243 1849 651 120 --11937 --
NM_183004chr1463253 2624 1586 1231 953 146 23205 1461 --199
NM_183006chr2031275 1121 157 ------
NM_183011chr1051339 1318 1265 1235 487 --11293 --
NM_183012chr1051339 1318 1265 1235 487 --11293 --
NM_183013chr1051339 1318 1265 1235 487 --11293 --
NM_183060chr105934 913 860 830 82 --1888 --
NM_183079chr2021250 1066 ------
NM_183227chr61109 --11386 --
NM_183234chr1531367 570 35 1668 ----
NM_183235chr1531367 570 35 1668 ----
NM_183236chr1531367 570 35 1668 ----
NM_183353chrX1319 ------
NM_183376chr1542381 553 447 195 ------
NM_183377chr172870 88 ------
NM_183381chr3----1978 --
NM_183383chr3----1978 --
NM_183384chr3----1978 --
NM_183393chr311028 ------
NM_183394chr311028 ------
NM_183397chr2065024 4919 4414 4053 1652 411 --13439 --
NM_183398chr521139 1057 ------
NM_183399chr521139 1057 ------
NM_183400chr521139 1057 ------
NM_183401chr521139 1057 ------
NM_184231chr3----1183 --
NM_194247chr233438 3428 1701 ------
NM_194282chr4----11157 --
NM_194285chr1132495 2177 722 ------
NM_194286chr12146156 6139 5210 4709 3918 3763 2320 1413 1199 962 928 834 749 431 --14406 14763
NM_194317chr232159 77 51 --11725 12625
NM_194328chr932685 2652 85 ------
NM_194329chr932685 2652 85 ------
NM_194330chr932685 2652 85 ------
NM_194332chr932685 2652 85 ------
NM_194358chr1221642 500 1102 11583 --
NM_194359chr1221642 500 1102 11583 --
NM_194434chr18105327 5315 5109 4361 4104 2089 2027 892 665 90 25381 1778 14950 15276
NM_194449chr18----1326 --
NM_194463chrX11096 ----1152
NM_197939chr172293 195 ----1461
NM_197956chr962013 1803 831 306 84 78 ------
NM_197968chr131692 ------
NM_197970chr2161 --11385 --
NM_198040chr161003 898 862 326 251 159 ------
NM_198043chr101379 ------
NM_198044chr101379 ------
NM_198045chr101379 ------
NM_198046chr101379 ------
NM_198047chr21528 ------
NM_198057chrX1147 --11119 --
NM_198081chr622003 129 ------
NM_198086chr144773 389 213 49 21731 434 ----
NM_198128chr182851 743 ------
NM_198147chr172950 209 ------
NM_198158chr322993 879 ------
NM_198159chr322993 879 ------
NM_198177chr322993 879 ------
NM_198178chr322993 879 ------
NM_198217chr131198 ------
NM_198218chr131198 ------
NM_198219chr131198 ------
NM_198225chr10----21976 359 --
NM_198236chr12167 54 --1282 --
NM_198241chr3148 --1156 --
NM_198242chr3148 --1156 --
NM_198244chr3148 --1156 --
NM_198268chr153702 3268 3188 3078 32 ------
NM_198269chr153702 3268 3188 3078 32 ------
NM_198270chrX22494 788 --22812 2402 --
NM_198279chrX1417 1472 ----
NM_198324chr122231 169 --1993 --
NM_198353chr42416 83 ------
NM_198391chr201456 --11397 --
NM_198393chr17132 --1260 --
NM_198400chr1542524 652 262 93 ------
NM_198401chr831553 1415 46 1528 ----
NM_198513chr811780 ------
NM_198530chr17--11209 11242 --
NM_198549chr142884 2480 384 204 --12733 --
NM_198560chr3103427 3007 2933 868 804 744 702 292 167 31 ------
NM_198567chr5------1198
NM_198581chr286678 5906 5680 5390 5366 1941 1829 1636 16707 ----
NM_198793chr332641 411 321 --175 1792
NM_198844chr171904 ------
NM_198859chr343638 1661 640 547 199 14289 --
NM_198889chr421031 59 ------
NM_198896chr1142157 2144 740 86 --1341 --
NM_198901chr721198 1031 ------
NM_198902chr154608 135 77 30 ------
NM_198947chr112416 330 ------
NM_198956chr731771 1715 218 ------
NM_198993chr1721280 555 1139 ----
NM_199040chr1243790 3707 1448 882 --32906 2824 960 --
NM_199078chr25875 804 520 389 120 1658 1496 --
NM_199129chr2041124 1089 1000 386 ------
NM_199133chr521080 258 ----1319
NM_199168chr101391 1449 ----
NM_199169chr2053381 2954 2681 162 112 --22538 2519 --
NM_199170chr2053381 2954 2681 162 112 --22538 2519 --
NM_199171chr2053381 2954 2681 162 112 --22538 2519 --
NM_199188chr1233554 2585 455 13317 23295 484 --
NM_199190chr1233554 2585 455 13317 23295 484 --
NM_199205chr81758 ------
NM_199229chr231735 1208 1099 ------
NM_199245chr1232275 1874 250 ------
NM_199262chr1732103 1853 82 1838 ----
NM_199286chr121374 ------
NM_199321chr171904 ------
NM_199324chr42734 320 ------
NM_199334chr171485 1417 ----
NM_199413chr15131 ------
NM_199421chr1454288 3775 3258 1151 711 --24715 3280 14193
NM_199436chr243048 2535 273 219 --11238 --
NM_199437chr1122195 276 --12057 --
NM_199438chr1122195 276 --12057 --
NM_199439chr1122195 276 --12057 --
NM_199461chr1033179 2911 624 --13488 --
NM_199462chr1124683 4496 3906 3493 3447 3364 3345 3273 1794 1574 532 274 13913 --11276
NM_199478chrX2703 472 ------
NM_199482chr211525 1785 --11872
NM_199487chr204933 489 92 36 2851 374 ----
NM_201266chr232557 2027 351 ------
NM_201269chr111310 ------
NM_201279chr232557 2027 351 ------
NM_201280chr62660 555 1382 --11604
NM_201413chr212751 215 ------
NM_201414chr212751 215 ------
NM_201432chr1795699 5248 2251 1984 1555 1292 1144 1046 541 11902 15758 --
NM_201433chr1795699 5248 2251 1984 1555 1292 1144 1046 541 11902 15758 --
NM_201570chr102215 206 ------
NM_201571chr102215 206 ------
NM_201572chr102215 206 ------
NM_201590chr102215 206 ------
NM_201591chr431794 721 522 ------
NM_201592chr431794 721 522 ------
NM_201593chr102215 206 ------
NM_201596chr102215 206 ------
NM_201597chr102215 206 ------
NM_201599chrX61184 337 222 201 158 51 ------
NM_201624chr1----11249 --
NM_201628chr183348 3243 2623 1109 1096 833 821 63 ------
NM_201999chr421137 819 ------
NM_203282chr1931796 1506 248 ------
NM_203283chr4--1588 ----
NM_203284chr4--1588 ----
NM_203301chr1411255 ------
NM_203305chr932081 1043 428 12232 ----
NM_203307chr191589 --11379 --
NM_203327chr20123865 3749 3704 3612 3192 1584 1576 750 729 338 242 21 11325 14484 --
NM_203329chr11146473 6049 5415 5402 4973 4758 4699 4544 4301 2709 2320 1530 1325 735 11756 11899 --
NM_203330chr11146473 6049 5415 5402 4973 4758 4699 4544 4301 2709 2320 1530 1325 735 11756 11899 --
NM_203331chr11146473 6049 5415 5402 4973 4758 4699 4544 4301 2709 2320 1530 1325 735 11756 11899 --
NM_203344chr192589 48 --1112 --
NM_203349chr1521931 608 1672 ----
NM_203382chr5--11576 ----
NM_203391chrX1624 1153 ----
NM_203394chr1222636 2142 ------
NM_203399chr13337 283 213 ------
NM_203401chr13337 283 213 ------
NM_203406chr521948 504 ------
NM_203446chr2142545 2260 772 287 --1470 --
NM_203463chr244836 4810 4394 1721 13401 ----
NM_203464chr131248 800 517 ------
NM_203504chr442478 2464 785 78 --1711 --
NM_203505chr442478 2464 785 78 --1711 --
NM_205768chr1----11760 1294
NM_205846chr5--11254 ----
NM_205848chr122554 746 ------
NM_205860chr122511 851 12950 ----
NM_206594chr122529 962 --12263 --
NM_206595chr122529 962 --12263 --
NM_206809chr61773 --1330 --
NM_206819chr121233 ------
NM_206820chr121233 ------
NM_206821chr121233 ------
NM_206839chr151525 ------
NM_206853chr633741 2980 364 --12901 --
NM_206854chr635002 4241 1625 13624 24162 1244 --
NM_206855chr625967 5206 14589 25127 2209 --
NM_206876chr243123 3059 2528 832 ------
NM_206907chr532207 708 556 ------
NM_206909chr888022 7454 5494 3275 2976 2924 2121 1915 ------
NM_206914chr122486 227 ------
NM_207012chr1053347 2996 2667 556 339 12233 ----
NM_207043chr112182 ------
NM_207044chr112182 ------
NM_207047chr112182 ------
NM_207121chr202386 198 1494 ----
NM_207170chr12765 290 ------
NM_207171chr13680 551 419 ----12001
NM_207299chr91882 ------
NM_207303chr1042959 2542 190 152 --33642 446 71 --
NM_207351chr31188 ----156
NM_207356chr1----1586 --
NM_207372chr1082372 1999 1546 970 796 680 273 174 --21756 88 --
NM_207406chr485988 5927 5088 4524 2163 2117 1949 1093 --24014 2300 --
NM_207412chr8--21366 331 1125 --
NM_207422chrX31130 393 146 ------
NM_207429chr111389 --1600 --
NM_207481chr211316 ------
NM_207577chr1192874 2739 2640 2529 1119 954 565 526 152 ------
NM_207645chr1121302 967 ------
NM_212460chr751565 1426 289 194 46 1602 ----
NM_212464chr1522104 1577 ------
NM_212465chr151540 ------
NM_212471chr1752188 1965 683 401 95 ------
NM_212472chr1752188 1965 683 401 95 ------
NM_212551chr12302 157 ----190
NM_213589chr244684 4107 3572 861 ----15519
NM_213593chr14992 903 782 79 ------
NM_213606chr1011781 ------
NM_213651chr12291 137 ------
NM_213654chr31136 1366 --11478
NM_213662chr1752239 2188 1917 1834 1669 --12167 --