TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-16-2-3p
miRNA Sequence: CCAAUAUUACUGUGCUGCUUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX103428 3292 3125 3101 2790 2782 2379 1206 688 382 --22984 83 32412 2262 407
NM_000055chr33458 413 154 ----2385 129
NM_000084chrX136002 5761 5638 5465 4497 4305 2706 2246 2152 2057 548 525 56 ------
NM_000091chr2122894 2880 2857 2841 2815 2763 2673 2539 2365 1095 776 328 12802 1101 --
NM_000092chr2144549 4415 4091 3383 3375 2928 1822 1794 1773 1732 1626 1334 818 778 ------
NM_000104chr2112772 2611 2168 2086 2013 936 751 573 452 356 34 ----1984
NM_000112chr595431 4220 3901 3712 1709 1665 1286 236 120 24094 262 1425 1941
NM_000115chr1392224 2108 1899 1657 793 475 283 123 39 --11677 22366 1694
NM_000125chr673916 3438 2833 2665 2659 2644 1620 ----12826
NM_000176chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_000202chrX133962 3216 3085 3048 2937 1353 1331 1286 1204 1122 1006 925 489 11148 23176 96 --
NM_000208chr1964670 4254 4138 3590 3062 1218 ----24729 3322
NM_000222chr492104 2074 2013 1985 1922 1857 1574 1442 499 ----11957
NM_000232chr4132908 2797 2638 2488 2013 1976 1210 1104 1086 901 574 559 380 ----13114
NM_000242chr1092685 2150 2021 1904 1047 860 744 510 214 --2756 103 --
NM_000245chr771515 838 700 517 243 124 82 --21912 1868 1330
NM_000259chr15136002 5915 5786 5565 5490 4803 2170 1780 1420 1365 918 670 563 1482 35582 5549 575 --
NM_000264chr9132928 2823 2787 2537 2457 2341 2326 2301 487 446 350 178 166 --2401 367 --
NM_000267chr17123253 3119 2974 2555 2222 2190 1368 1030 649 462 139 89 --13200 --
NM_000297chr432028 1723 575 21692 254 1375 21377 221
NM_000314chr10112992 2842 2802 2575 2522 2325 2317 1288 1076 716 677 --12149 11995
NM_000332chr6137112 6955 6586 6303 5864 5812 5132 2193 2060 1919 1865 1563 85 21542 1298 16925 12608
NM_000337chr5116613 6286 6183 6173 2093 2077 1763 1650 1119 620 389 15290 25188 4037 --
NM_000390chrX173148 2915 2819 2745 2666 2512 2282 2181 1129 1071 844 785 732 707 635 611 87 23335 527 ----
NM_000393chr281979 1912 1789 541 503 343 212 169 1828 --1765
NM_000408chr293315 3020 2859 2624 1315 1151 978 561 337 11243 ----
NM_000430chr1763168 1387 1103 327 156 142 23648 1002 33689 1228 94 --
NM_000439chr5132473 2416 2184 2140 2070 1930 1875 1825 1021 1007 560 462 31 22579 2158 21911 787 --
NM_000452chr1362095 649 270 257 244 136 --1187 --
NM_000459chr94829 371 342 334 2807 356 --1738
NM_000461chr3134522 4479 4463 4369 4208 3972 3788 3699 3064 951 764 684 555 23457 657 34043 1724 1492 --
NM_000489chrX103171 3093 3032 2349 2316 2114 592 492 232 193 12440 32309 2222 1041 12763
NM_000555chrX187529 7397 6910 6737 6694 6597 5782 5122 2959 2859 2823 2437 2302 1553 1300 1256 381 151 ------
NM_000618chr12146041 5741 5494 4930 4708 4596 4453 4301 4099 2512 2455 1868 1792 241 --24844 4292 --
NM_000618chr12146041 5741 5494 4930 4708 4596 4453 4301 4099 2512 2455 1868 1792 241 --24844 4292 --
NM_000793chr14135090 4733 4467 3498 3156 1966 1916 1906 1588 1541 936 447 395 12043 14748 --
NM_000809chr4358871 8730 8692 8608 8207 8178 8157 7938 7921 7903 7774 7753 7229 7214 7135 6897 6768 6493 6084 5656 3243 2806 2515 1752 1695 1513 1317 1271 1200 901 789 591 309 81 61 11598 28961 3643 18469
NM_000813chr5185318 4898 4747 4616 3985 3964 3874 3851 3542 3481 1599 1486 1467 1393 1120 985 309 261 12228 35599 5269 4635 --
NM_000826chr492509 2367 2248 2155 1944 1790 1624 610 557 --1755 12175
NM_000899chr12114144 4061 3895 3878 3674 3573 3034 2916 486 294 179 --23763 2775 --
NM_000902chr342852 2801 1101 254 2904 369 --1810
NM_000926chr11269418 9323 9025 8819 8771 8103 6747 6540 5978 3350 2916 2808 2716 2448 2386 2259 2211 2163 2028 1927 1836 1564 737 511 189 89 29107 2404 39434 6348 673 28460 1692
NM_000945chr282097 2048 1838 1825 1668 1662 329 104 12012 11644 --
NM_000950chrX123543 3433 3144 2739 2687 2613 2469 2339 1355 1064 984 82 ----22795 2557
NM_000963chr1152434 2299 2189 2155 2126 2067 1979 1965 1886 842 829 695 480 403 67 11959 12022 --
NM_001001419chr5185216 5170 5091 5006 4970 4838 4815 4291 4270 4028 3910 3533 3515 3226 1944 227 100 28 --1808 --
NM_001001420chr5185216 5170 5091 5006 4970 4838 4815 4291 4270 4028 3910 3533 3515 3226 1944 227 100 28 --1808 --
NM_001001484chr1082241 2151 2006 984 825 549 376 80 ----21867 390
NM_001001664chr2114098 3528 3213 3067 2848 2803 1612 1032 715 448 134 14021 12702 33728 3044 327
NM_001001668chr19103792 3508 3058 2838 1663 1575 1375 1245 1216 1163 --24298 2759 --
NM_001001974chr10122262 2145 2117 2056 2022 1961 1784 923 426 402 315 283 --1442 --
NM_001002257chr292975 2830 1166 1130 884 249 131 99 49 --2741 160 --
NM_001002860chr1484532 4062 3946 3933 3633 3163 1693 1567 1324 1193 13608
NM_001003652chr18188511 8353 7650 7316 7253 6981 6826 6810 6167 6097 5935 5307 3004 1751 1393 1234 1069 172 36049 3377 1475 28096 341 --
NM_001003674chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_001003675chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_001003679chr191931 1808 1791 1675 1437 1403 461 259 64 21562 153 ----
NM_001003712chr12163797 3637 3613 3278 2802 2774 2638 2618 1346 1299 1246 1219 966 652 351 96 23248 138 13007 --
NM_001004317chr6124305 4271 4033 4025 3713 3066 1244 869 835 739 370 74 14498 33504 1520 1397 --
NM_001004419chr12104642 4607 4188 3878 3293 3113 1737 260 236 114 --33074 2893 1554 13606
NM_001004441chr5151582 1548 1530 1213 1203 1151 1059 1049 595 463 345 308 241 77 34 ----1522
NM_001005375chrY91824 1777 1751 693 680 506 334 136 76 ----1516
NM_001005473chr5146199 5282 5221 5165 2573 2484 2230 2136 1919 1495 1130 672 634 188 --32173 1569 769 1581
NM_001005502chr1295227 4454 4309 4260 4165 4073 3379 751 533 --24711 4124 24135 1593
NM_001006600chr582374 2327 2258 2027 1521 989 423 71 1495 22401 1742 --
NM_001006657chr283254 2957 2530 2508 2134 1090 885 289 12930 1767 23144 3075
NM_001007023chr14135090 4733 4467 3498 3156 1966 1916 1906 1588 1541 936 447 395 12043 14748 --
NM_001007278chr13145200 5077 5040 4967 4670 4474 4305 3743 2068 1584 1374 973 733 110 2785 299 33458 293 240 15261
NM_001007466chr6135067 4700 3965 3349 1984 1944 1933 1892 1733 1609 1512 1255 724 ------
NM_001008405chr781858 716 690 666 619 578 551 387 21185 333 11714 --
NM_001008541chr1072305 2004 1669 226 219 210 36 ------
NM_001008541chr1072305 2004 1669 226 219 210 36 ------
NM_001008726chr1461262 1211 667 561 476 462 --2577 257 --
NM_001008738chr5112943 2857 2704 2660 2193 973 820 814 677 494 292 --1658 --
NM_001009554chr484649 4432 4022 3479 2981 1363 923 323 --31552 1462 972 --
NM_001009554chr484649 4432 4022 3479 2981 1363 923 323 --31552 1462 972 --
NM_001009899chr3156520 6422 6205 4674 4234 3968 2460 1991 1958 1020 989 925 866 804 254 35412 486 475 ----
NM_001009909chr11113717 3668 3535 3190 2937 2581 1587 1393 660 623 215 1868 1359 13492
NM_001010000chr18133523 3442 3311 3204 2945 2330 1322 605 581 519 341 288 114 1414 --23476 2420
NM_001010853chr6133197 3055 2920 2828 2584 2502 2414 1992 884 869 709 359 209 --1911 --
NM_001010891chr5196796 6546 5914 5596 4906 4838 4323 4275 2701 2383 2219 2168 1802 1698 1649 1428 1075 604 307 15283 26875 6779 --
NM_001010895chr9132036 1919 1895 1835 1784 1605 1583 684 591 569 509 444 29 12016 ----
NM_001010984chr182583 2403 2224 2140 2085 941 263 195 22452 2122 1743 --
NM_001011513chr4103966 3955 3812 3687 3298 2950 2752 2559 160 83 --23187 2695 12833
NM_001011666chr7246569 6163 6089 5751 5706 5391 5356 4990 4826 4222 4108 4079 4065 2506 2367 2280 2080 1905 1785 1748 1541 858 713 521 1441 46189 6047 5203 150 --
NM_001011708chr272731 2677 2070 1896 1887 955 673 2769 450 --12034
NM_001012755chrX114970 4790 3901 3862 3856 3514 3224 1383 930 469 178 13650 24330 3761 --
NM_001012756chr1993204 2858 2852 2536 2028 1292 595 155 65 --13215 1450
NM_001013399chr64959 281 203 117 11060 2833 756 21121 781
NM_001013620chr12358510 8374 8264 8197 8054 7827 7755 7438 7427 7307 7017 6733 6649 6205 6071 6061 5952 5789 5736 5697 5635 5628 5333 5151 2761 2677 2220 1755 1710 1474 1380 741 485 464 288 16282 36238 967 263 25520 1430
NM_001013659chr19155404 5193 4865 4835 4769 4557 4546 4229 4063 3927 3466 1617 1545 1477 607 ------
NM_001014797chr1086595 6396 6331 6317 6225 5900 5125 5006 27900 3290 21919 294 1130
NM_001015877chrX133068 3036 2775 2575 2562 2492 2276 2146 1132 969 961 915 849 22523 193 ----
NM_001018067chr1135347 5098 4821 4472 3933 1990 1445 1220 1081 916 546 281 219 --21483 417 --
NM_001018068chr1135347 5098 4821 4472 3933 1990 1445 1220 1081 916 546 281 219 --21483 417 --
NM_001018069chr1135347 5098 4821 4472 3933 1990 1445 1220 1081 916 546 281 219 --21483 417 --
NM_001018074chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_001018075chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_001018076chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_001018077chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_001018090chr15132564 2467 2234 2188 2084 1115 1083 891 251 241 234 187 85 --1196 --
NM_001018091chr15112674 2577 2344 2298 2194 1001 361 351 344 297 195 --1306 --
NM_001018102chr15132564 2467 2234 2188 2084 1115 1083 891 251 241 234 187 85 --1196 --
NM_001024094chr593895 3816 3562 2866 2483 2412 1559 1496 745 --13189 --
NM_001024647chr12167593 7257 7235 6895 6465 5568 4689 2667 1267 975 943 686 469 271 76 57 ------
NM_001024956chr11185839 5792 5743 5375 4983 4776 4593 4401 4084 2306 2070 2009 1792 1548 1157 1139 1050 225 11984 ----
NM_001025076chr10176239 6199 5955 5320 4927 4595 4049 3995 3975 3930 1918 1829 1192 830 784 634 371 16063 1441 11466
NM_001025077chr10177597 7557 7313 6678 6285 5953 5407 5353 5333 5288 5063 2550 2188 2142 1992 1729 627 17421 34702 4643 1799 12824
NM_001025079chr3104116 3960 3947 3003 1627 1531 1423 1197 1081 214 1583 ----
NM_001025233chr1292751 2254 2075 2059 1983 698 580 40 28 ------
NM_001025266chr384858 4776 4230 4208 4060 3100 3064 89 ----24829 4719
NM_001025356chr1282993 2971 2951 2929 2108 968 511 227 32579 2247 807 --1727
NM_001025580chrX104326 4269 4198 3889 2974 1218 1002 935 840 267 12764 12885 --
NM_001029858chr6113388 3337 3096 3083 2508 2469 2264 2161 572 280 67 22626 1171 13138 --
NM_001030055chr14174765 4656 4635 4442 4278 3599 3537 3499 1711 1536 1502 1354 1186 820 515 476 305 --21472 677 --
NM_001031695chr22125374 5250 5222 4645 4540 3885 3813 2107 1390 1023 475 65 14694 14184 1691
NM_001031732chr4143553 3265 3160 3143 2936 2547 1397 1323 1315 997 689 569 363 282 12329 --22341 440
NM_001031804chr16103775 3634 3285 3227 2977 1754 1539 1288 690 362 11741 13377 --
NM_001032282chr861298 1207 1086 862 847 249 --1462 1995
NM_001032394chr682863 2841 2651 2191 2019 793 709 94 ----1758
NM_001033047chr4112619 2600 2316 2054 2009 1957 781 693 676 669 33 --1641 1423
NM_001033925chr10112190 1927 1564 797 789 691 534 491 344 117 96 1737 1627 --
NM_001035260chr1071594 1557 1503 1297 585 508 257 11096 --1442
NM_001037132chr7112001 1613 1606 1528 847 730 443 432 122 41 23 11746 ----
NM_001037133chr7112001 1613 1606 1528 847 730 443 432 122 41 23 11746 ----
NM_001037174chr2152302 2261 1861 1710 1683 1646 787 620 466 442 426 411 402 394 346 --1569 11567
NM_001037535chrX101568 1429 1337 1092 967 476 469 452 259 198 ------
NM_001037536chrX101568 1429 1337 1092 967 476 469 452 259 198 ------
NM_001037540chrX101568 1429 1337 1092 967 476 469 452 259 198 ------
NM_001039547chr3228093 7922 7117 6833 6790 6553 6153 6021 3063 3022 2953 2814 2513 2476 2462 1968 1575 1565 1546 524 494 380 1659 12370 1706
NM_001039577chr1104527 1753 1662 1197 1159 1141 1135 1128 959 803 1199 21172 461 --
NM_001039580chr4115115 4944 4093 4053 3988 3896 3199 3123 1923 1418 48 33465 3189 902 ----
NM_001039590chrX143433 3391 3271 3105 3077 3024 2921 2775 1404 1242 842 771 611 81 13773 13661 1260
NM_001039591chrX143433 3391 3271 3105 3077 3024 2921 2775 1404 1242 842 771 611 81 13773 13661 1260
NM_001039618chr11235825 5807 5779 5525 5436 5380 5121 4905 4868 4790 4681 4675 4353 4066 3931 2218 2101 1608 1550 1506 1124 931 722 11048 14014 1123
NM_001039840chrX215540 5434 5389 5009 4968 4660 3694 2414 2404 1916 1887 1750 1448 1225 1073 997 820 812 632 537 121 --45193 4396 3973 564 --
NM_001039937chr13113284 2994 2925 2782 1551 1541 1331 829 480 417 241 12987 13266 11350
NM_001040020chr761156 545 469 408 240 82 1321 21561 122 11338
NM_001040157chr492911 2266 2052 2005 1824 1121 317 168 49 12252 ----
NM_001040284chr16255725 5556 5233 5130 4769 4541 4331 4296 4043 3860 3757 3741 3643 2203 2062 2050 1976 1871 1466 1265 1215 532 470 338 81 25291 1924 --24228 3637
NM_001040402chr493236 3092 2931 2701 2271 555 331 260 128 --12972 12512
NM_001040441chr195512 4862 4368 4194 4186 3598 1577 681 420 24351 1546 3706 632 306 13993
NM_001040450chr15102585 2550 2481 2279 1958 1851 700 525 426 395 ------
NM_001040453chr15102585 2550 2481 2279 1958 1851 700 525 426 395 ------
NM_001040665chr7144826 4245 4066 3824 3652 3595 3478 3216 3102 3075 1891 1527 1264 319 --25012 4907 --
NM_001042355chr16155010 4061 4039 3379 3343 2026 1415 1365 1266 1109 1012 894 766 289 175 11837 14972 --
NM_001042412chr16155010 4061 4039 3379 3343 2026 1415 1365 1266 1109 1012 894 766 289 175 11837 14972 --
NM_001042440chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042441chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042442chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042443chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042444chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042445chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042446chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001042453chrX111770 1686 1602 1452 1319 1305 1231 1211 648 553 367 ----2527 241
NM_001042492chr17123253 3119 2974 2555 2222 2190 1368 1030 649 462 139 89 --13200 --
NM_001042550chr9121867 1818 1655 1531 1478 1299 781 709 682 381 233 96 ----11381
NM_001042555chr12154598 4556 3794 3439 3322 3231 3084 2997 1652 1553 1342 1046 912 290 124 --34068 3756 1349 12976
NM_001042599chr2187662 7548 7480 7213 7123 6323 6111 5950 5713 4967 4900 2835 2237 1795 1786 833 766 211 36744 6379 2212 47267 2351 2269 1804 --
NM_001042603chr12125397 5187 5132 4904 4307 3624 2103 1943 1518 907 301 225 --193 14461
NM_001042604chr3114620 4447 3546 1937 1741 1705 1464 1425 1414 813 648 ------
NM_001042749chrX91907 1786 1638 1328 752 604 594 421 233 --41629 1611 745 532 --
NM_001042750chrX91907 1786 1638 1328 752 604 594 421 233 --41629 1611 745 532 --
NM_001042751chrX91907 1786 1638 1328 752 604 594 421 233 --41629 1611 745 532 --
NM_001046chr5132973 2926 2770 2198 2173 2078 1139 1115 1038 994 940 932 532 --12989 --
NM_001071775chr1391958 1875 1730 1460 766 753 715 591 452 21789 651 --11269
NM_001083620chr4102507 2365 2246 2153 1942 1788 1623 609 556 203 --1754 12173
NM_001099678chr3196430 6205 6037 5743 5727 5602 5463 4536 4268 2301 2285 1983 1945 1446 1425 1242 1210 780 611 26026 4661 15932 15661
NM_001146chr8102366 2177 2103 1986 1876 1499 922 904 892 538 --22141 97 --
NM_001167chrX186615 6433 6335 5680 5211 4869 4527 4349 2055 1820 1571 1497 1428 1261 1129 1070 909 29 11345 36594 1776 1540 --
NM_001173chr14174765 4656 4635 4442 4278 3599 3537 3499 1711 1536 1502 1354 1186 820 515 476 305 --21472 677 --
NM_001177chr1281724 1614 1597 887 214 195 157 131 32493 2111 619 22137 534 1829
NM_001186chr21153265 3257 3225 3201 2976 2967 2904 2615 2563 2547 2464 2451 2384 498 416 12644 1944 --
NM_001201chr493874 3641 3333 3276 3243 3055 2637 2517 317 1977 --21044 1002
NM_001204chr2217326 7145 6763 6553 6436 6404 5728 5668 5289 3014 2765 2701 2163 2150 1817 1742 1642 880 792 326 294 27697 450 12338 --
NM_001241chr292342 2209 1785 1687 1673 942 606 337 217 --11925 --
NM_001241chr292342 2209 1785 1687 1673 942 606 337 217 --11925 --
NM_001259chr7155902 5894 5198 5182 4833 4758 4376 4139 4078 3887 3867 2303 2073 1428 1147 15606 13860 --
NM_001304chr17113555 3010 2749 2535 2403 1394 1125 889 769 347 308 12570 23367 862 --
NM_001390chr1893655 3516 3480 3469 2390 2362 796 456 395 1429 13529 22235 1144
NM_001412chrX123624 3549 3476 3034 2813 2569 2512 2377 1163 791 412 137 12727 --23608 630
NM_001432chr4203862 3759 3722 3550 3529 3173 3124 3050 2500 1314 975 859 755 218 194 135 84 77 57 51 23833 2953 ----
NM_001527chr6184701 4661 4558 4254 3842 3828 3553 3100 1429 1275 1204 1181 1166 1143 732 489 225 61 1709 14875 149
NM_001609chr10174485 4455 4447 4118 3140 3094 2996 2878 2790 1275 1051 1032 877 702 642 467 115 --13886 --
NM_001616chr2123427 3263 2334 2240 2202 2141 1237 1193 923 892 496 118 --33487 3328 149 11344
NM_001621chr782978 2874 2726 1119 868 644 602 328 1811 42642 1225 967 793 --
NM_001621chr782978 2874 2726 1119 868 644 602 328 1811 42642 1225 967 793 --
NM_001650chr18164113 4081 4059 4029 4006 3723 3196 2910 1354 1251 1127 668 391 224 213 147 13291 1365 13062
NM_001656chr592072 1944 1786 1583 1538 1448 1415 812 656 --2831 442 --
NM_001742chr771672 1662 1627 1188 372 354 73 --11590 1722
NM_001750chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_001777chr3104116 3960 3947 3003 1627 1531 1423 1197 1081 214 1583 ----
NM_001854chr151334 1185 1095 1005 962 2591 585 --11432
NM_001858chr6114938 4900 4867 4800 3855 3288 3204 2006 1330 779 484 11682 ----
NM_001874chr1295227 4454 4309 4260 4165 4073 3379 751 533 --24711 4124 24135 1593
NM_001918chr1199081 8976 8778 8445 8426 8050 7531 7102 6539 6431 6137 5801 3486 2797 2670 1336 712 137 93 25635 3580 11348 18362
NM_001980chr1292261 2216 2174 2060 1823 1457 814 298 289 11791 --21600 276
NM_002006chr4135713 5597 5107 5057 5027 4900 4391 1793 1607 1472 1047 1002 208 13564 14486 --
NM_002024chrX102145 1680 1563 1489 858 626 577 474 283 156 21804 1721 11512 11529
NM_002025chrX199230 9037 8118 8008 7951 7499 7169 6611 6531 6327 6317 6197 5609 3082 2944 2658 2280 1835 531 --1289 27595 2251
NM_002035chr18113679 3509 2819 2640 2513 2495 952 806 708 180 96 --33537 2863 1300 --
NM_002040chr21133174 2977 2891 2803 2766 2618 2531 2319 497 416 284 137 43 ----12965
NM_002126chr1784105 2618 1623 1460 1419 1377 785 765 --11580 14162
NM_002182chr372701 2594 2381 2025 1032 657 566 ----11862
NM_002203chr5103872 3822 3576 3343 3100 3032 3001 1226 1085 388 --24130 1219 1468
NM_002214chr7115403 4990 4514 4171 4144 3866 1645 1630 1363 978 797 23895 3857 15515 15146
NM_002223chr1294024 3915 3260 3010 2950 2724 2691 2669 2564 31027 832 132 13328 --
NM_002264chr3104237 4003 3862 3850 3754 3505 1693 953 593 99 --11471 14718
NM_002270chr5205675 5618 5592 5482 4460 3912 3802 3763 3679 2252 2243 1892 1495 1373 1316 1142 972 327 195 87 24173 521 15067 --
NM_002290chr671341 1308 1275 1135 1063 513 149 1237 --11414
NM_002310chr5176138 6007 5993 5976 5510 5343 4815 4698 4692 4624 4570 2451 1757 1572 1550 868 773 15756 26597 102 --
NM_002336chr12104719 3822 3649 1406 1357 994 844 583 174 153 --14183 --
NM_002387chr5115186 5154 5046 4900 4681 4658 3711 3149 2023 1865 1648 1672 14946 --
NM_002481chr1137974 7939 7908 7475 7099 6542 6277 5649 5221 5184 3038 1898 1813 25938 476 12615 15165
NM_002547chrX134145 3975 3557 3525 3350 3111 3062 2775 1407 1386 1063 567 480 --11618 23421 2988
NM_002577chr3103416 3222 3112 2902 1291 1175 1087 939 577 510 23534 1325 ----
NM_002581chr9135637 5539 5001 4915 4549 4540 4480 3922 3891 3862 2238 2106 1159 25137 61 ----
NM_002610chr282783 2653 2440 2425 2336 2280 2225 2200 22749 2564 12055 12194
NM_002645chr11133151 3077 2974 2766 2724 2604 2560 2301 1922 746 605 402 108 --12874 --
NM_002655chr8225213 4891 4655 4432 4426 4397 4266 4009 4002 3826 3572 3509 3417 1986 1832 1772 1696 1243 725 644 585 519 --24995 1373 --
NM_002709chr2103349 3224 2446 2385 2299 1312 1098 791 680 181 --32191 1134 1120 --
NM_002731chr1143048 2876 2859 2680 2665 2452 2417 2325 2131 1938 1251 1241 861 364 --1410 --
NM_002745chr22164496 4336 3849 3812 3706 3692 3661 3608 3270 3239 3073 2903 1250 1160 793 543 --14288 --
NM_002822chr1291550 1349 1309 614 529 406 364 217 157 182 11380 --
NM_002837chr12194493 4475 4395 4318 4252 4226 4116 4047 3605 3470 3244 1258 1207 969 387 231 224 167 133 ------
NM_002869chr1171804 1645 1391 811 290 221 116 --182 22137 1993
NM_002886chr3115220 5110 4518 3953 3655 3563 3459 1885 851 820 752 14310 1681 --
NM_002902chr154419 271 209 177 1195 1216 2494 77
NM_002906chr1182388 2301 1979 1912 1542 900 653 646 ----12096
NM_002977chr2153424 3413 3390 3147 2811 2777 2512 2396 2177 1052 642 473 415 105 21 --2943 698 --
NM_003016chr1791980 1913 1253 669 652 641 549 406 383 --2326 316 --
NM_003034chr12177607 7505 7268 6556 5912 5470 5010 4903 2912 2484 2416 2197 2053 1944 869 542 403 25575 1275 47889 6036 6028 356 --
NM_003042chr3112167 2124 1989 1967 1911 1829 1653 1545 1445 1431 602 ------
NM_003048chr282761 2251 2013 2006 1739 1082 1040 891 12650 12269 12242
NM_003082chr148916 574 454 372 366 351 91 60 171 ----
NM_003099chr15136545 6428 6333 5151 2514 2263 2030 2018 1888 1618 1561 1421 377 16467 22398 408 1266
NM_003108chr296585 5974 5935 5249 4816 4678 1212 1085 539 36440 909 163 14563 --
NM_003112chr7113203 3054 2594 2346 1122 876 860 796 522 211 128 1933 ----
NM_003161chr17133381 3300 3108 3056 2830 2692 2572 2188 1401 1235 927 312 297 1276 1202 13174
NM_003199chr18175582 5488 5398 5267 5075 4080 4052 3773 1835 1682 1489 1406 1103 1082 971 887 390 24692 506 45537 5438 5057 1025 --
NM_003211chr1281766 1503 1214 1159 1128 1105 320 97 ----21714 1666
NM_003262chr3155203 5141 4715 3965 3298 3215 2079 1896 1874 1761 1551 1260 981 785 56 24864 73 1167 --
NM_003274chr2192946 2694 2130 1969 1861 1084 885 794 689 ----1720
NM_003292chr162265 1596 385 279 131 113 21921 362 11435 32245 1636 289
NM_003298chr3145695 5557 5518 5490 5450 5122 4718 2228 1282 600 413 314 195 93 14746 26146 5942 --
NM_003304chr3101610 1435 1230 1181 648 549 334 281 131 58 194 ----
NM_003338chr1061845 1599 1460 1427 766 557 1773 --1498
NM_003392chr384230 4098 3919 3901 635 219 172 89 33327 3178 742 --14208
NM_003410chrX153038 3020 2821 2135 1159 1098 1079 964 897 706 513 377 360 300 32 2385 98 12893 --
NM_003412chr393018 2990 2425 2263 1193 925 793 629 558 --22449 710 --
NM_003463chr6123376 3226 3115 3027 2300 2086 1139 1079 1046 850 717 77 --1798 32519 277 115
NM_003478chr11183296 3142 2911 2845 2822 2688 2680 2579 985 888 873 848 614 535 390 191 111 23 --1632 --
NM_003489chr2173243 3066 2807 2411 2182 808 283 22723 147 21210 130 --
NM_003506chr8121267 1136 1100 1024 923 836 475 453 368 352 303 224 --11259 --
NM_003566chr12153475 3270 2933 2828 2783 2660 2410 1113 848 710 630 450 397 142 28 --33055 1249 1058 --
NM_003574chr18154678 4547 4265 3937 3931 1800 1533 1477 1422 1157 1079 1020 726 718 331 ----15011
NM_003583chr1293536 3438 3371 3332 2839 2731 1378 1332 1142 --23499 2515 --
NM_003590chr2193683 3247 3214 3170 3102 3078 3069 3006 2892 2856 2765 1494 1343 1284 1230 1135 1108 715 79 ------
NM_003597chr292230 1898 1861 1835 1790 1684 394 387 281 11921 --11477
NM_003615chr3143938 3896 3845 3725 3279 3258 2914 2750 2560 1075 1050 949 765 219 13572 21363 81 11444
NM_003679chr183120 2861 2568 2182 1332 1184 550 67 --13334 13434
NM_003722chr342609 2582 2539 1069 12523 1388 21101 901
NM_003759chr4124274 4208 4032 3653 3581 2617 1549 1335 1281 991 808 457 13421 11254 1491
NM_003774chr1282935 2904 2384 2169 1354 646 310 192 1355 11334 13359
NM_003799chr18134542 4476 3590 3305 2945 1080 835 791 680 482 352 237 79 23443 1466 ----
NM_003800chr6102423 2133 1996 1927 1513 909 672 655 646 384 1107 ----
NM_003822chr1103174 3117 3057 2686 2678 2498 2055 1150 761 204 32442 1065 138 --23188 2850
NM_003895chr21122154 2122 1998 1840 1684 1631 1545 1468 837 390 162 71 ------
NM_003913chr6124121 4063 3713 3666 3593 2980 2882 1556 1403 1025 147 91 --21489 306 23883 880
NM_003941chr782522 2416 1846 1618 855 838 251 92 ----1482
NM_003994chr12114144 4061 3895 3878 3674 3573 3034 2916 486 294 179 --23763 2775 --
NM_004028chr18164113 4081 4059 4029 4006 3723 3196 2910 1354 1251 1127 668 391 224 213 147 13291 1365 13062
NM_004035chr1745041 3710 3406 2045 11370 12038 24282 937
NM_004081chrY91824 1777 1751 693 680 506 334 136 76 ----1516
NM_004094chr14113065 2861 2713 2395 2256 2203 1206 417 132 124 107 ----187
NM_004100chr672686 2162 2141 1886 1642 821 635 11902 32655 2113 604 12221
NM_004113chr3101912 1895 1616 1557 1529 1427 1399 747 289 273 ------
NM_004124chr14163591 3529 3209 3024 2980 2954 2889 2864 2589 2412 1206 1124 846 372 205 27 12528 13341 1460
NM_004171chr11279628 9592 8124 7900 7855 7449 7344 7092 6990 6969 6821 6695 6616 6280 6057 6045 3551 3514 3008 2262 1812 1471 1234 937 814 738 579 48181 2758 1092 764 16838 --
NM_004279chr791974 1903 1819 1572 1537 905 258 249 193 ----1550
NM_004293chr9133799 2733 2546 2466 1443 1321 1186 1141 1132 970 736 362 138 11078 21310 1050 --
NM_004338chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_004342chr762255 2037 1631 1498 832 404 186 --22332 912
NM_004392chr1392358 2227 2210 2202 977 958 213 144 125 21045 607 21785 776 --
NM_004412chr10165692 5486 5190 4718 4236 3978 2332 2305 2224 1868 1256 563 457 429 261 36 ----15843
NM_004447chr1261142 996 962 868 779 223 --21040 347 1812
NM_004458chrX112520 2456 2337 2288 2271 2108 1874 1678 873 400 299 --22005 590 1308
NM_004464chr494223 3108 2857 1115 647 396 377 259 157 1117 13494 --
NM_004496chr1461374 1332 1282 1169 967 391 --1976 1518
NM_004504chr2123086 2782 2492 2271 1212 1095 1081 1007 619 361 327 243 12582 ----
NM_004586chrX135207 5111 4902 4784 3988 3651 2101 1301 1198 1036 1017 353 335 --25407 595 --
NM_004612chr9154487 4242 4226 4055 4003 3976 3918 3911 3810 3473 1728 1155 1000 908 105 ----11498
NM_004622chr261979 892 722 712 368 264 22144 516 --21752 1733
NM_004657chr241442 1203 1197 387 11495 21552 1301 --
NM_004660chrY102203 2028 1890 1748 1725 1514 881 761 707 75 ----21837 1434
NM_004685chr1392998 2147 1971 1951 1841 474 454 447 421 ----22563 773
NM_004719chr12122890 2815 2757 2608 2448 2391 2082 1994 1861 1788 474 465 12426 11799 12559
NM_004726chrX105556 5000 3747 2319 2304 2291 2030 1496 585 62 15612 13953 --
NM_004731chr1291893 1876 1626 1580 727 688 407 130 77 --21399 611 --
NM_004745chr8177063 6826 6438 6330 6087 5653 4938 4779 4759 4385 2669 2572 2342 1919 1722 1192 855 --36622 2065 1129 --
NM_004748chr15114232 4049 4033 4014 3947 3506 3338 2974 2568 1119 595 24089 3347 --13125
NM_004760chr7152371 2301 2206 2142 2089 1786 1775 877 531 396 296 238 216 52 46 ------
NM_004775chr18122069 1990 1932 1896 1707 1652 1606 1556 861 748 738 725 ----11800
NM_004795chr1391909 1753 1659 1441 765 573 536 365 334 --21828 1296 21819 178
NM_004815chr1174842 4756 3754 3649 3366 3205 3071 1896 1519 1210 900 799 562 412 173 76 53 24296 1561 --14794
NM_004842chr691797 1416 1396 1329 1224 1142 649 467 349 --11436 11095
NM_004857chr14114814 4740 4654 3936 3409 3274 3120 3103 1393 1303 1119 34821 1848 579 --11445
NM_004859chr17132544 2453 2150 2005 1161 986 791 785 675 547 395 282 226 --1845 1350
NM_004866chr5244920 4843 4771 4645 3934 3800 3783 3556 3235 3164 3115 3063 1968 1693 1410 1252 993 693 570 231 213 187 110 71 1421 13851 --
NM_004896chr1081509 1472 1418 1212 635 500 423 172 11011 --1357
NM_004898chr472245 1769 1029 983 282 273 249 12402 1518 22042 116
NM_004904chr7246569 6163 6089 5751 5706 5391 5356 4990 4826 4222 4108 4079 4065 2506 2367 2280 2080 1905 1785 1748 1541 858 713 521 1441 46189 6047 5203 150 --
NM_004956chr7114461 4361 3835 3457 1546 1417 1131 1089 836 773 357 11072 --11531
NM_004985chr12144490 4447 3812 3488 3469 3352 3213 2952 2927 2856 1447 1233 591 190 34182 4086 2935 24390 318 --
NM_004999chr6114163 2926 2802 2775 1406 1329 1113 1058 830 691 447 ----23204 1082
NM_005010chr7112001 1613 1606 1528 847 730 443 432 122 41 23 11746 ----
NM_005056chr12115641 5431 5376 5148 4551 3868 2187 1762 1151 545 469 --1337 14705
NM_005065chr14135389 5290 5209 4576 4471 4343 4260 4124 3466 3356 503 376 203 --34226 3664 1751 13796
NM_005095chr162235 777 711 296 196 34 --11865 12028
NM_005121chr17173295 3241 3125 3109 2989 2878 2665 2555 1075 1020 933 855 649 607 416 322 275 --23228 134 --
NM_005156chr9135228 5008 4978 4503 4364 4257 4130 3662 3628 3282 1117 900 121 1520 24175 1561 13259
NM_005164chr12102544 2272 2158 2136 1819 1788 947 660 431 332 ----1937
NM_005188chr11198338 8256 8233 8159 8112 7484 7183 6296 6194 5771 5684 3197 3036 2179 2154 1594 1196 733 309 --26688 5838 12099
NM_005190chr64959 281 203 117 11060 2833 756 21121 781
NM_005197chr14106189 6111 5410 5402 4763 4468 4435 3841 775 733 25577 231 11061 --
NM_005233chr3112617 2533 2518 2178 1963 1947 1831 1796 1653 391 229 ------
NM_005235chr2187662 7548 7480 7213 7123 6323 6111 5950 5713 4967 4900 2835 2237 1795 1786 833 766 211 36744 6379 2212 47267 2351 2269 1804 --
NM_005295chr75251 232 112 93 69 --1103 --
NM_005339chr4153960 3498 3279 3149 2848 2779 2728 2710 2652 1645 1574 1567 1467 646 351 24298 1400 13345 --
NM_005359chr18125802 5420 4853 4629 4514 2445 1092 1069 1029 949 556 535 21240 659 1370 16206
NM_005399chr1114447 4300 4142 3842 3159 1388 1295 1257 1248 943 845 13985 24413 261 --
NM_005433chr18102768 2613 2488 2249 1710 1068 812 641 594 167 --32635 2627 894 22142 1077
NM_005436chr1083965 3724 3224 3196 1480 912 720 148 14094 31488 995 765 --
NM_005497chr17176095 6013 5815 5009 4896 4174 3752 3746 2129 1888 1484 1298 1197 1045 977 509 307 35915 5909 5306 14604 --
NM_005502chr993260 3239 2980 2830 2152 1287 1046 1030 726 12877 22938 2741 12036
NM_005504chr1285973 5471 4590 2638 1539 1370 853 629 26527 930 22627 1308 35008 4433 4051
NM_005578chr3104624 4357 4208 3938 3554 1488 1167 790 707 480 1470 23920 903 --
NM_005596chr9206220 5913 5653 4878 4656 4102 4073 2456 2418 2390 1890 1810 1758 1749 1617 1086 843 468 435 315 25280 1367 24686 4295 --
NM_005655chr861298 1207 1086 862 847 249 --1462 1995
NM_005665chr1224912 4489 3762 3754 3714 3685 3638 3449 3192 3036 1726 1504 1343 1199 1182 1106 962 697 378 273 267 257 11596 ----
NM_005668chr5194489 4022 3952 3876 3730 3538 3398 3298 3233 2874 1568 1535 1387 1345 1282 1240 1051 558 187 --11477 --
NM_005746chr7112642 2499 2427 2069 1934 1772 1032 981 808 705 45 1255 ----
NM_005795chr2112906 2871 2803 2624 2373 2247 2225 1095 372 203 89 12103 11938 12180
NM_005798chr13145200 5077 5040 4967 4670 4474 4305 3743 2068 1584 1374 973 733 110 2785 299 33458 293 240 15261
NM_005840chrX117083 5858 5828 5333 5021 3042 2936 2308 2227 2218 1313 16069 ----
NM_005868chr762448 1915 913 896 826 298 12333 1904 12358
NM_005901chr18188511 8353 7650 7316 7253 6981 6826 6810 6167 6097 5935 5307 3004 1751 1393 1234 1069 172 36049 3377 1475 28096 341 --
NM_005903chr5185216 5170 5091 5006 4970 4838 4815 4291 4270 4028 3910 3533 3515 3226 1944 227 100 28 --1808 --
NM_005909chr5154270 4236 3635 3424 3207 3176 3093 2886 1550 1536 1502 1417 1283 668 196 ------
NM_005941chr893734 3496 2714 2615 2602 1638 912 809 344 --23696 1597 --
NM_005955chr185525 4498 4145 3550 3469 2043 1660 1247 --35464 1757 1221 --
NM_005962chr1072305 2004 1669 226 219 210 36 ------
NM_005962chr1072305 2004 1669 226 219 210 36 ------
NM_005966chr292284 1989 1822 1762 1668 1521 1480 834 569 1347 2556 279 1221
NM_006007chr9204477 4395 3996 3793 3585 3186 2814 2764 1772 1633 1561 1458 1422 1308 1073 1035 903 883 534 140 ------
NM_006036chr282504 2452 2249 2090 1944 1880 1865 42 22555 2405 ----
NM_006095chr4164420 4260 4083 3640 3178 2956 2782 2774 2744 1592 971 700 667 526 387 297 ----14334
NM_006106chr11143346 3287 3269 3209 3131 3000 2724 2202 1196 548 481 469 327 180 --12986 --
NM_006166chr1292643 2563 1990 1890 1733 1628 839 280 224 22441 330 1608 --
NM_006203chr5125597 5587 5560 4860 4721 3485 2015 1787 1777 1493 850 363 24872 614 ----
NM_006241chr392198 1668 1554 760 710 459 443 283 123 1933 11744 --
NM_006251chr5123293 3045 2547 2471 2261 1266 961 945 934 695 376 304 --12480 12635
NM_006252chr1237507 7144 6956 6864 6828 6809 6284 5625 5619 4747 4732 4716 4615 2184 2160 2067 1919 1579 1525 1394 1333 542 475 16380 36884 2626 711 1488
NM_006287chr2102456 2175 1935 1747 991 829 801 482 53 39 1572 ----
NM_006315chr494481 4105 3976 3926 3292 1772 469 462 118 --23916 3717 --
NM_006420chr20103427 3217 2997 2940 2915 2167 774 588 481 41 1605 13318 --
NM_006457chr4103966 3955 3812 3687 3298 2950 2752 2559 160 83 --23187 2695 12833
NM_006467chr5112387 2309 2157 2123 2007 1475 936 930 647 135 24 --11799 --
NM_006482chr1293536 3438 3371 3332 2839 2731 1378 1332 1142 --23499 2515 --
NM_006520chrX91723 1485 1472 1436 1404 1393 478 297 141 ----11386
NM_006534chr20113321 3253 2923 2840 2696 2555 1068 989 749 666 240 --1423 --
NM_006544chr14155647 5580 4833 4702 4166 3983 3879 3853 3747 2449 2351 1920 1294 819 323 --1299 --
NM_006561chr10176239 6199 5955 5320 4927 4595 4049 3995 3975 3930 1918 1829 1192 830 784 634 371 16063 1441 11466
NM_006575chr14131486 1342 1318 1165 1103 1089 1047 915 463 430 285 151 116 ------
NM_006599chr16228220 8209 8137 7927 7604 6639 5938 5897 5810 5790 5742 5003 3245 3215 3172 3149 2555 2397 2178 1508 809 188 ------
NM_006603chrX91907 1786 1638 1328 752 604 594 421 233 --41629 1611 745 532 --
NM_006614chr3153647 3598 3565 3368 3214 3146 2522 1302 1152 1098 1078 913 566 341 208 1142 13277 11142
NM_006628chr15114469 3962 3783 3635 3103 1616 1434 987 625 563 307 21203 380 --14167
NM_006654chr12154598 4556 3794 3439 3322 3231 3084 2997 1652 1553 1342 1046 912 290 124 --34068 3756 1349 12976
NM_006729chrX85541 4148 1929 1468 816 647 487 29 25501 5070 --1878
NM_006731chr9135786 5685 4633 4539 3837 3815 3636 1931 1347 941 730 483 348 --15511 --
NM_006746chrX101568 1429 1337 1092 967 476 469 452 259 198 ------
NM_006750chr16137933 7542 7466 6994 6764 6731 6369 5694 5683 2918 2148 190 45 22390 1092 17288 11457
NM_006766chr862372 1974 748 666 560 411 12715 32195 396 102 --
NM_006775chr6103072 2922 2598 2530 2311 2240 796 603 582 512 --22432 1130 --
NM_006777chrX132918 2852 2746 2493 2394 1827 1155 1125 1048 990 983 839 300 ------
NM_006827chr14113100 2953 2685 2405 2204 1082 1035 987 679 623 489 1413 23366 858 12385
NM_006873chr2143415 3161 2672 2461 2447 1391 1384 1276 1191 968 854 749 611 215 33179 1251 487 ----
NM_006918chr11185839 5792 5743 5375 4983 4776 4593 4401 4084 2306 2070 2009 1792 1548 1157 1139 1050 225 11984 ----
NM_006924chr17144305 4069 3992 3789 3695 3569 3523 3405 1004 945 664 294 250 35 --13112 1529
NM_006999chr541763 1733 1724 515 ----21816 483
NM_007006chr16103569 3404 3179 2890 2629 2243 1028 890 818 196 13327 32785 1229 336 --
NM_007007chr12204714 4687 4037 3901 3766 3720 3711 3491 3245 1861 1815 1787 1634 1107 671 664 640 513 357 194 24826 1181 --13166
NM_007038chr21136013 5638 5609 4563 4550 4020 3825 2047 1768 1275 1197 1085 532 14408 ----
NM_007054chr5163954 3948 3216 3065 2846 2418 1596 1581 1558 994 624 571 557 439 419 40 11063 ----
NM_007106chr13102808 2770 1893 1870 1799 1779 1756 1000 815 234 --1526 --
NM_007114chr3163064 2976 2910 2896 2618 2555 1079 933 923 916 797 708 400 326 185 158 --11129 --
NM_007157chrX132866 2683 1166 1148 982 967 880 632 562 515 405 76 62 --22897 1937 --
NM_007195chr18123646 3376 3360 3351 3221 3120 2427 2409 1366 838 268 96 23291 488 ----
NM_007212chr1112026 1634 1511 1402 860 603 393 386 201 102 56 11933 12207 --
NM_007249chr13159080 9038 8168 8042 7856 7173 6787 6221 5765 3746 2816 2449 2043 1807 862 11466 17209 27308 5806
NM_007287chr342852 2801 1101 254 2904 369 --1810
NM_007288chr342852 2801 1101 254 2904 369 --1810
NM_007289chr342852 2801 1101 254 2904 369 --1810
NM_007292chr1745041 3710 3406 2045 11370 12038 24282 937
NM_007345chr1871981 1798 1594 1565 1538 601 31 11792 --21811 1503
NM_007347chr15133039 2989 2960 2917 2429 2156 2040 1111 1079 796 469 292 238 1561 --13001
NM_007358chr191856 1737 1698 708 374 259 243 171 162 1526 1410 1489
NM_007375chr182217 970 881 599 558 299 140 73 ----32643 1820 217
NM_012081chr5153763 3553 3508 3208 3116 2958 2627 1422 1358 1345 1077 474 330 249 115 13219 1972 11331
NM_012096chr393643 3592 2886 2468 996 757 485 474 22 180 13234 --
NM_012097chr2152302 2261 1861 1710 1683 1646 787 620 466 442 426 411 402 394 346 --1569 11567
NM_012120chr6122776 2713 2615 2192 2151 1141 1102 912 740 695 687 28 ------
NM_012141chr13113284 2994 2925 2782 1551 1541 1331 829 480 417 241 12987 13266 11350
NM_012164chr9117203 7024 6747 5073 4864 2407 1592 942 580 431 246 12002 1297 --
NM_012214chr2196257 6199 5999 5717 5253 5246 5084 4991 4974 4536 4479 1851 1197 1175 983 678 438 322 289 16422 25642 1045 --
NM_012252chr7125403 5360 4982 4844 4407 3969 3771 2141 1827 1732 1294 81 24263 719 23437 967 24196 1022
NM_012262chr1135276 4980 4651 4510 3413 3405 3218 1958 1767 766 648 523 499 24429 114 25211 966 1704
NM_012281chr7132296 2100 1923 1702 1534 915 902 699 647 522 324 210 85 1456 ----
NM_012287chr394298 4172 3820 3286 3190 2997 1608 1142 1103 21758 110 ----
NM_012345chr13121660 1650 1394 1266 571 497 441 294 268 227 207 135 ----1557
NM_012382chr5124457 4101 3946 3496 1700 1611 1450 1202 649 469 416 331 24397 3137 --23700 671
NM_012431chr7123251 3231 3064 3030 1399 1288 1252 1222 1192 1098 591 387 --1950 1330
NM_012464chr4142922 2842 2698 2614 2605 2586 1927 1909 944 556 407 191 89 77 12258 ----
NM_012465chr10133341 3230 3203 2811 1319 1298 1291 1098 770 404 220 197 104 --1753 --
NM_013255chr7278890 8833 8401 8051 7789 7675 7360 7087 6496 5779 5578 5424 3415 3050 3043 2861 2355 2070 2010 1781 1280 1123 1023 935 724 694 390 27712 570 35383 3406 400 --
NM_013261chr4103792 3697 3049 2372 1442 1210 1134 1102 1080 471 12858 12899 1910
NM_013269chr12104569 4534 4115 3805 3220 3040 1664 187 163 41 --33001 2820 1481 13533
NM_013322chr7131687 1441 1164 1139 654 616 558 542 531 470 407 162 133 11124 ----
NM_013341chr272731 2677 2070 1896 1887 955 673 2769 450 --12034
NM_013372chr15123371 3187 3009 2990 2959 2860 2515 2499 1198 776 578 375 ------
NM_013381chr1292369 2214 2147 1766 1478 718 512 361 164 1307 1478 12319
NM_013396chr2191571 1432 1328 1003 966 578 459 386 282 --11115 --
NM_013943chr1123287 3196 2654 2189 2138 2123 595 542 458 430 354 181 11247 1502 13180
NM_013989chr14135090 4733 4467 3498 3156 1966 1916 1906 1588 1541 936 447 395 12043 14748 --
NM_013995chrX102588 2552 2338 2243 1923 1909 1662 1605 705 275 ----11798
NM_014005chr592714 1244 1192 1077 631 451 249 232 72 12189 11066 1530
NM_014011chr262479 2439 2316 2102 371 351 1901 1341 11598
NM_014016chr371659 1521 1278 1266 1252 1209 1141 ----11492
NM_014021chr1142875 2853 2527 2466 2372 1161 1127 971 911 888 871 775 563 331 13496 --23320 671
NM_014028chr6153299 3244 2746 2714 2704 2693 2683 2648 2541 855 646 477 450 216 191 22043 986 23188 3142 --
NM_014048chr16115274 5077 4775 4662 3607 1941 1477 1189 1166 874 111 --25255 1405 13851
NM_014106chr1572383 2123 2111 2026 1027 561 169 22249 265 32739 2263 240 --
NM_014112chr8155290 5248 4939 4852 4672 4218 3766 3640 2179 1782 1578 1499 1404 1358 674 23528 1538 15340 --
NM_014155chr11247313 7289 7109 6697 6558 6263 6090 5396 5166 4914 4907 4755 4624 3001 2917 2731 2430 1894 1772 1144 1107 741 712 703 37355 2503 487 12715 25586 1883
NM_014253chrX92327 2225 2024 1957 1646 767 581 218 70 --1162 --
NM_014309chr22125364 5240 5212 4635 4530 3875 3803 2097 1380 1013 465 55 14684 14174 1681
NM_014331chr4177819 7397 6919 6636 6131 5447 4965 3076 3037 3024 2911 2839 2582 2189 1328 1315 968 --26512 2155 --
NM_014372chr1122065 1946 1871 1804 1616 1391 1319 835 755 222 163 142 21476 321 --22002 1488
NM_014393chr872366 2113 1855 1809 940 526 354 22398 1889 12285 1457
NM_014423chr5145528 5393 5231 5083 4748 3666 3660 3585 1525 593 584 536 387 181 45453 4042 1938 801 ----
NM_014445chr352132 2031 1945 1753 1712 --42361 2265 2039 620 12242
NM_014584chr1461672 652 530 516 290 137 11534 --1245
NM_014615chr1683616 3576 3569 3004 1185 74 67 43 ----11005
NM_014616chr373064 1241 955 902 741 365 355 12429 53357 3269 1386 1352 964 --
NM_014637chr871248 1186 1140 1131 955 509 103 ----11443
NM_014666chr5111347 1322 1212 1111 1044 968 944 931 861 165 60 11270 ----
NM_014701chr15103363 3143 3076 2855 2332 2301 1259 524 124 93 1785 --12377
NM_014702chr6142876 2731 2621 2591 2531 2344 2322 1333 1072 768 725 715 643 508 43013 2231 1217 894 1249 --
NM_014705chr7112138 2115 1664 1583 1448 1440 823 744 317 156 147 11619 1346 --
NM_014707chr7122246 1979 1869 1602 1588 1447 861 806 719 620 508 164 --1766 --
NM_014721chr6197365 7012 6472 6355 6273 6179 6128 4847 2926 2018 1678 1304 1232 648 609 580 419 255 74 17410 1940 --
NM_014735chrX92033 1952 1939 1720 1561 1321 265 155 49 ----11900
NM_014739chr6123964 3904 3496 3167 1632 1607 1380 1252 1015 762 638 350 21207 177 11526 --
NM_014746chr274337 3567 3313 1047 704 361 167 11631 34268 1488 1375 1727
NM_014802chr1231122 1038 1012 1280 1826 2947 706
NM_014803chr10102818 2772 2427 2309 2118 1811 1795 952 520 167 --1686 --
NM_014819chr582285 2222 2183 2109 1809 871 174 136 --1832 21889 198
NM_014820chr362093 2013 1813 680 380 105 1394 --21687 715
NM_014829chr5112366 1946 1882 1781 799 650 474 294 268 248 78 ------
NM_014839chr172532 2453 2443 1967 824 697 407 149 11814 22356 2051
NM_014873chr1114685 4643 4338 3853 3704 3244 3150 1960 1402 150 131 12969 13578 1553
NM_014877chr17226989 6555 6203 5091 5034 4896 4842 4784 3058 2993 2872 2113 1589 1213 1078 1028 885 737 391 250 109 31 12314 ----
NM_014888chr761156 545 469 408 240 82 1321 21561 122 11338
NM_014904chr10113587 3279 2985 2767 2689 1565 1315 945 398 201 149 123 33069 2924 1327 12808
NM_014906chr1763670 2582 1277 1220 1203 672 14104 32826 1060 185 --
NM_014915chr10101370 1356 1291 1122 1093 1043 144 132 80 57 --11257 1199
NM_014920chr661165 988 460 386 355 148 22892 1329 23752 398 1178
NM_014934chr13113802 3487 3357 2464 1546 853 791 681 382 192 40 --13715 1170
NM_014946chr2103121 2820 2728 2313 2243 891 857 767 336 317 --11249 --
NM_014947chr1123083 2991 2905 2869 2861 2435 2320 1113 830 686 624 112 ------
NM_014951chr10122633 2593 2556 2316 2189 2133 1921 1801 1667 702 525 452 ------
NM_014953chr13114361 3998 3689 2759 1636 1311 919 831 592 558 347 13414 --11108
NM_014982chr14135384 5222 4302 4270 4201 3394 3339 3327 1525 1237 1204 445 208 --15333 25404 5147
NM_015020chr1663883 3832 3796 3030 3022 308 12536 33039 2490 1424 11458
NM_015026chr12174413 4192 3928 3521 3239 3219 2941 1618 1515 1441 1427 1334 899 819 568 352 46 14266 23670 1866 1561
NM_015032chr13122873 2546 2506 2194 2072 2060 1929 968 892 876 742 281 ----1677
NM_015040chr2123310 3084 3063 2833 2754 2743 2595 2317 1057 691 576 449 23293 3217 12423 12446
NM_015045chr10112161 2081 1774 1701 1636 1599 1401 879 743 426 251 1366 ----
NM_015046chr982404 2244 2035 1027 813 385 165 39 --1291 1244
NM_015071chr5106252 6153 5453 5397 4766 4254 2259 1738 985 136 ----36292 5612 4377
NM_015115chr493236 3092 2931 2701 2271 555 331 260 128 --12972 12512
NM_015144chr16123985 3916 3879 3872 3845 3541 2923 2659 1446 1422 1372 650 21110 593 --12813
NM_015156chr14124011 3906 3853 3828 3665 3600 2718 2549 1194 1013 519 182 --12823 --
NM_015176chr111150 2719 506 21652 1636 3570 543 274
NM_015206chr15113767 3580 3154 3046 2911 1130 1034 770 447 367 284 --13461 23418 131
NM_015208chr18203669 3579 3416 2978 2596 1537 1398 1388 1242 1218 1197 1160 1100 1003 771 533 340 251 220 25 --1499 --
NM_015247chr16155010 4061 4039 3379 3343 2026 1415 1365 1266 1109 1012 894 766 289 175 11837 14972 --
NM_015263chr1571183 1078 1041 950 935 845 139 31007 800 90 3961 340 216 --
NM_015271chr494222 3896 3809 3779 3581 3415 3048 2741 1495 11207 33606 3548 2883 14144
NM_015310chr8208292 8249 8143 8078 8056 7626 6984 6390 6342 5997 5882 5441 5090 2301 2217 2033 2014 1796 1358 1081 1975 16948 --
NM_015314chr7112603 2469 2436 2398 2381 2117 2034 1745 669 182 130 3928 869 507 ----
NM_015317chr282776 2319 2253 1814 1074 514 505 359 21835 860 1686 --
NM_015323chr641305 1218 1169 1110 --1146 21421 312
NM_015336chr12142686 2582 2498 2111 1768 1681 1081 582 557 530 390 347 286 27 --22080 415 --
NM_015349chr6103053 3030 2990 2940 2929 2752 1967 1063 864 739 1720 ----
NM_015365chrX104326 4269 4198 3889 2974 1218 1002 935 840 267 12764 12885 --
NM_015446chr121140 243 --2602 586 21392 394
NM_015455chr5113774 3476 3369 3313 3149 3097 2692 2552 843 522 280 13429 12859 13831
NM_015458chr8165248 5116 5014 4879 4450 4402 3867 3844 3364 3279 1218 1204 1146 959 642 432 11000 25105 4796 --
NM_015532chr15132564 2467 2234 2188 2084 1115 1083 891 251 241 234 187 85 --1196 --
NM_015553chr6144962 4582 4363 4326 4219 3948 3805 1553 1510 1163 1081 674 455 58 ----22063 862
NM_015565chr21142288 2193 2136 2098 1714 1509 1417 838 480 472 433 241 220 192 --21635 885 --
NM_015569chr194427 4315 4168 3560 3323 1365 1127 837 220 41592 1577 1167 817 --13067
NM_015571chr6112221 1796 612 595 575 470 456 406 386 331 303 11984 12354 --
NM_015640chr1135347 5098 4821 4472 3933 1990 1445 1220 1081 916 546 281 219 --21483 417 --
NM_015693chr43325 261 134 --1125 1114
NM_015852chr773632 3540 2935 2742 2612 2420 289 --23616 3491 12709
NM_015879chr18168499 8165 7956 6032 5971 5674 5346 3086 2071 2059 1780 1211 1006 804 586 266 28260 3450 23150 226 --
NM_015886chr8205746 5649 5576 5462 5330 5186 4612 4544 4482 4472 4428 2262 2195 1923 875 807 608 228 179 125 --45662 4325 2032 1303 13649
NM_015888chr1213328 3319 3298 3229 2966 2956 2908 2896 2716 2629 2409 2106 2075 1349 1275 1253 938 704 310 271 62 22813 2795 ----
NM_015906chr1114492 4266 3823 3630 1683 1561 1525 1105 1059 809 151 11699 --31827 1202 304
NM_015975chrX101608 1594 1573 1501 1357 1265 708 643 119 73 --11215 1232
NM_016009chr184867 4753 3832 1945 1430 553 205 163 11538 34357 3704 3146 --
NM_016040chr172780 2507 2407 2253 2197 208 95 --2933 313 --
NM_016072chr12122314 1907 1687 965 825 757 604 572 477 411 104 65 11623 22405 35 --
NM_016083chr6113848 3614 3353 3280 2915 2528 1299 607 476 418 155 1828 23685 955 21434 706
NM_016087chr7101731 1622 1591 1541 1533 1421 1395 1355 1178 468 2514 258 --1213
NM_016132chr1593274 3047 2671 2597 2166 2121 1193 1054 144 --22485 79 1726
NM_016206chr3228812 7946 7863 7587 7552 7024 6684 6493 6396 6043 5798 3584 3398 2935 2888 2511 2102 1741 766 596 529 353 --47791 5792 2406 653 13241
NM_016217chr6123455 3116 2810 2699 2668 2560 2321 2226 1441 625 361 39 --11453 13600
NM_016248chr13133634 3220 3121 3047 2987 2967 2882 2837 1604 958 588 92 31 1939 33666 2559 1396 --
NM_016255chr6163153 3110 3043 3036 2944 2447 2172 2118 1219 1194 1078 1032 907 876 690 200 --12725 1143
NM_016260chr2147631 6911 6685 6573 6105 5020 4968 4908 3054 2837 1265 771 346 116 11608 25877 213 191
NM_016277chr671632 1512 1085 632 581 484 327 --1136 21580 417
NM_016308chr172035 1967 1878 1700 1502 1351 1268 11522 21482 42 --
NM_016315chr291550 1430 1160 746 657 605 118 110 100 ------
NM_016374chr161576 1168 1097 557 530 387 11087 --11499
NM_016374chr161576 1168 1097 557 530 387 11087 --11499
NM_016377chr691797 1416 1396 1329 1224 1142 649 467 349 --11436 11095
NM_016472chr1461494 1264 1095 1068 1046 579 11148 --21211 47
NM_016507chr17123215 3146 2849 2685 2264 2095 1187 1123 993 545 291 182 ----1351
NM_016513chr661165 988 460 386 355 148 22892 1329 23752 398 1178
NM_016531chr464191 3776 3614 2715 961 430 11423 23333 3045 11059
NM_016542chrX111770 1686 1602 1452 1319 1305 1231 1211 648 553 367 ----2527 241
NM_016607chrX91562 1447 1183 1119 1091 1075 239 137 118 11364 ----
NM_016617chr1382221 2213 2037 2006 1632 1578 812 784 --22156 45 11882
NM_017447chr21154435 4369 4099 4056 3881 3691 3141 3039 1724 1459 1153 677 560 398 130 --23941 3381 --
NM_017563chr3146402 6366 6297 5244 4847 2343 2063 1629 1053 920 810 486 470 113 22051 1327 14887 --
NM_017628chr4155330 5322 4670 4168 3549 3464 3411 3214 1701 1686 1605 1354 594 558 318 35206 4466 1329 21522 472 21321 806
NM_017633chr6103924 3803 3208 2665 1531 1347 1186 1130 996 459 23420 1377 13386 --
NM_017637chr9239073 8405 8152 7623 7170 6943 6626 6596 6563 3788 2932 2824 2337 2190 2146 1888 1762 1698 1555 1234 1120 972 531 57736 7281 6995 3622 570 13281 17656
NM_017641chr1271185 1141 1052 1033 821 423 228 --21111 68 1416
NM_017645chr9123192 3164 3131 3052 3040 2862 2747 2729 2533 222 153 88 --12772 --
NM_017650chr7226057 5345 5112 5079 4981 4857 4281 3709 3683 2370 2361 2324 2269 2242 2168 2026 1881 1530 1462 1032 785 721 12293 25255 1722 --
NM_017651chr691195 1132 1119 1046 1029 1011 391 382 250 --21292 238 --
NM_017658chr14244682 4641 4489 4434 3778 3740 3609 3594 3386 3280 3233 3191 3068 3006 2976 1844 1640 1277 1183 1075 1057 816 661 632 1415 ----
NM_017762chr1592295 1861 1828 1763 934 673 425 254 132 1146 --22482 2200
NM_017769chr14113270 2581 2509 2156 2140 2113 2038 939 604 538 146 --22410 2393 12448
NM_017779chr191940 1841 1068 1041 1025 703 577 434 370 12741 1473 --
NM_017813chr8185671 4962 4861 4642 4287 4151 4120 3993 3617 2330 2294 2143 1886 1677 1567 973 525 122 14524 2505 202 14623
NM_017824chr1062501 2235 1703 905 632 312 --12585 1655
NM_017831chr18104763 4614 4308 2955 1532 1332 1036 979 958 947 13415 ----
NM_017919chr9155563 5496 5402 4939 4536 4326 4254 3722 3716 3556 2295 2203 2040 1774 901 --21759 1674 --
NM_017938chrX112136 2107 2046 1961 1545 1517 1506 827 757 675 640 22164 522 1568 --
NM_018017chr1092703 2269 2257 2202 2196 2070 1874 502 450 11780 22621 110 --
NM_018036chr14154486 4405 3979 3782 3766 3535 3462 2947 2824 1397 1279 1035 1013 994 203 24324 4260 1570 --
NM_018247chr672448 1226 963 877 722 339 246 2346 205 1691 --
NM_018254chr162153 1970 1743 1533 275 183 --1565 2377 241
NM_018279chr1292949 2666 2509 2238 1050 1040 1026 371 258 1282 1428 --
NM_018293chr3122868 2823 2508 2442 2140 1980 1923 1890 1135 900 411 394 ------
NM_018313chr372545 2349 2308 2165 1688 1656 835 ----11670
NM_018323chr4101707 1618 1289 714 663 590 341 242 211 169 --1461 1331
NM_018351chr12154734 4429 4302 3494 3250 3151 3133 1602 990 893 874 830 617 580 499 --1911 --
NM_018361chr8133941 3838 3600 3488 3460 3233 3218 3129 967 618 565 436 411 13850 ----
NM_018362chr11123676 3582 1611 1327 1173 1063 856 699 625 503 305 21 33915 1539 1370 13046 --
NM_018364chr1154116 3774 3645 3568 3253 3106 2759 2698 1481 1451 1334 1170 1098 735 636 --11497 1758
NM_018373chr14125366 5180 5153 4718 4198 2285 1866 1590 900 529 361 182 --16460 22275 1970
NM_018374chr7154954 4629 4384 3657 3537 3338 1701 1012 939 915 647 489 473 375 44 --14443 14606
NM_018429chr5122761 2605 2563 2363 1961 1944 1152 1061 987 888 657 75 11993 1310 --
NM_018440chr8198666 8547 8010 7990 7765 6470 5926 5286 5259 3271 3173 3067 2702 2560 2471 1901 1386 888 805 11980 33319 1379 819 --
NM_018482chr8102585 2439 2286 1689 1603 962 917 780 572 380 ------
NM_018566chr1174974 4929 4791 4708 4095 4019 3986 3772 3726 3535 1850 1578 841 699 607 399 292 14121 ----
NM_018638chr12155005 4611 3515 1806 1706 1697 1523 745 720 710 684 610 600 278 78 45264 5143 3947 1094 34436 935 879 --
NM_018695chr582374 2327 2258 2027 1521 989 423 71 1495 22401 1742 --
NM_018844chr782100 1363 820 793 629 178 156 135 31427 575 242 11956 --
NM_018976chr1292384 2359 2310 2239 855 814 569 329 82 1952 --22548 408
NM_018999chr10164251 4188 4168 3881 3697 3683 3427 3365 3234 1844 1785 1646 1544 1318 1023 695 1365 24938 4832 13142
NM_019001chr3114620 4447 3546 1937 1741 1705 1464 1425 1414 813 648 ------
NM_019022chr18123183 3016 2851 2661 2560 2312 2029 792 569 320 284 22 1814 ----
NM_019072chr5104129 3765 3336 2760 2752 1126 731 544 483 57 1724 1557 --
NM_019117chrX103496 3345 1355 1117 1039 953 818 748 702 287 2759 594 12676 11174
NM_019593chr20102589 2551 1165 1029 707 686 643 268 239 126 --22944 2399 --
NM_019885chr282895 2887 2768 2714 2686 2619 2585 2527 --12917 12801
NM_020199chr591306 995 923 528 491 458 282 70 59 ------
NM_020228chr1182247 2189 1851 1588 815 542 332 319 --11901 32467 1604 868
NM_020245chr6134973 4606 3871 3255 1890 1850 1839 1798 1639 1515 1418 1161 630 ------
NM_020336chr2093685 3644 3122 3001 2381 2375 1295 835 813 1447 --13845
NM_020347chr3122313 2071 1802 1757 1710 920 777 756 357 339 128 113 11694 ----
NM_020390chr3154878 4813 4723 4072 3823 3778 3667 3342 3244 1624 1379 1121 883 437 223 34362 868 366 23145 1856 --
NM_020420chrY91824 1777 1751 693 680 506 334 136 76 ----1516
NM_020455chr682863 2841 2651 2191 2019 793 709 94 ----1758
NM_020466chr6164546 4391 4322 4190 4000 3979 3727 3667 3529 3441 3207 1993 1916 1600 188 108 --13143 --
NM_020648chr18102873 2219 2196 1915 1891 1761 1123 1090 547 477 22290 367 ----
NM_020654chr3141623 1528 1390 1327 1184 1171 1146 1123 1111 1037 559 423 302 241 ------
NM_020673chr20137705 7561 7307 6775 6706 6129 5393 4706 3097 2539 1047 839 172 12830 27689 1479 --
NM_020718chr16116080 5957 5290 4463 4294 4161 2285 1779 1482 565 551 24494 1080 11562 --
NM_020727chr21123963 3673 2799 2780 2641 2524 2444 1600 1204 536 357 82 --22760 197 34018 454 246
NM_020739chr15114232 4049 4033 4014 3947 3506 3338 2974 2568 1119 595 24089 3347 --13125
NM_020748chr1772068 2062 1958 1870 1717 1689 1380 --22157 100 1557
NM_020766chrX184611 3829 3704 3643 3610 3089 2856 2830 1797 1748 1510 1491 1157 808 597 273 238 128 33692 3603 3397 ----
NM_020768chr573093 2495 2446 2276 1991 642 530 1511 --12853
NM_020771chr6111558 1459 1436 1357 1243 1149 1076 622 548 535 508 ------
NM_020772chr17168387 8029 7971 7927 7466 6957 6366 5861 5630 3207 3169 3031 2744 1907 841 751 ----13298
NM_020774chr18126237 5925 4857 4538 4336 4103 4046 4022 2473 1825 1338 1080 --15359 --
NM_020779chr283254 2957 2530 2508 2134 1090 885 289 12930 1767 23144 3075
NM_020792chr3122588 2428 2176 1998 1761 1111 1058 1032 920 754 585 440 ------
NM_020794chr171521 1344 486 449 428 159 46 1550 21559 1461 --
NM_020819chr661161 991 257 196 101 48 11012 2888 767 1843
NM_020841chr12163797 3637 3613 3278 2802 2774 2638 2618 1346 1299 1246 1219 966 652 351 96 23248 138 13007 --
NM_020871chrX162497 2490 2291 2190 2128 1623 900 878 805 788 671 548 527 210 82 59 1893 ----
NM_020918chr1093633 3527 2655 2443 1351 1307 665 640 610 --13256 --
NM_020937chr146640 302 121 113 100 44 ------
NM_020940chr10112961 2700 2213 1871 1835 1825 1818 1794 645 327 301 --3181 171 112 12760
NM_020948chr193208 3133 2908 2794 2754 2634 2278 1477 1183 --13590 --
NM_020951chr1982341 2209 2065 977 892 323 201 192 12092 22114 460 --
NM_020964chr1884725 3282 1771 1664 1300 1265 371 149 --34526 4254 509 --
NM_021032chr3101912 1895 1616 1557 1529 1427 1399 747 289 273 ------
NM_021033chr13123067 2993 2872 2860 2761 2652 2490 1309 1044 895 418 381 --23074 3018 --
NM_021038chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_021163chr7163769 3481 3140 2506 2429 1408 1329 1072 1037 951 651 635 601 338 253 246 ------
NM_021183chrX112303 2278 2033 1616 1020 988 846 676 370 309 136 ------
NM_021255chr14143978 3834 3749 3237 2903 2778 2709 1558 1493 1361 1345 1063 644 589 --13337 --
NM_021622chr10122262 2145 2117 2056 2022 1961 1784 923 426 402 315 283 --1442 --
NM_021629chr384661 4508 4153 3096 2037 1533 1112 662 14518 45086 4386 3876 1653 --
NM_021647chr484649 4432 4022 3479 2981 1363 923 323 --31552 1462 972 --
NM_021813chr6104987 4679 4649 3920 2107 2094 2069 1992 1066 365 --24794 3660 --
NM_021815chr292504 2419 2413 2353 1070 1046 611 570 107 11918 1869 1214
NM_021911chr5185318 4898 4747 4616 3985 3964 3874 3851 3542 3481 1599 1486 1467 1393 1120 985 309 261 12228 35599 5269 4635 --
NM_021961chr11167164 7108 6938 6350 6258 5951 5635 5075 4712 4521 2568 1489 947 879 784 601 15556 35568 4938 4736 1350
NM_021964chr3246607 6198 6182 6156 6009 5909 5853 5561 5484 5196 5038 5022 4506 4404 4176 2629 1947 1794 1715 1610 1340 759 724 197 1567 ----
NM_021998chrX121489 1384 1307 1283 1141 1054 1011 587 466 326 249 143 ------
NM_022041chr1682466 2377 2275 2191 2021 833 508 239 --22560 2475 12575
NM_022048chr15125977 5919 5862 5727 5469 4763 4704 2162 1973 1264 816 801 15736 26357 2234 15629
NM_022351chr893871 3142 1420 1287 1056 935 365 211 202 --1310 --
NM_022456chr12167593 7257 7235 6895 6465 5568 4689 2667 1267 975 943 686 469 271 76 57 ------
NM_022459chr13106050 5376 5346 5115 5079 4838 4649 4576 4526 4455 36108 5412 4744 25394 4449 12284
NM_022473chr1574370 3796 3614 3233 2692 947 216 --23073 859 14321
NM_022474chr1482821 2573 2283 2176 1112 1036 468 27 1857 --2427 368
NM_022483chr571608 1456 1393 1195 707 677 216 2517 426 --1787
NM_022763chr3103208 3142 3067 2993 2955 2910 2614 2410 592 458 22595 2030 12867 --
NM_022841chr15122776 2182 2155 1985 1889 938 678 593 473 455 210 49 22316 895 22717 1925 1688
NM_022893chr292874 2741 2288 2262 1964 1104 841 426 337 32296 2195 1219 ----
NM_022898chr1454696 4503 1188 1097 385 --11502 34761 4656 1340
NM_022977chrX112520 2456 2337 2288 2271 2108 1874 1678 873 400 299 --22005 590 1308
NM_024345chr9156145 5978 5885 5482 5421 4723 3868 2249 2229 944 749 678 464 455 72 1543 13908 --
NM_024511chr4123200 3149 3093 2875 2290 1337 1185 1055 803 621 517 266 ------
NM_024524chr3113115 2842 2767 2151 2055 502 292 282 237 39 25 --22340 762 --
NM_024539chrX81271 873 859 832 310 198 159 131 21238 428 1787 --
NM_024665chr3114743 4680 4193 1467 1447 1197 1138 1121 1040 655 577 24048 3152 ----
NM_024744chr2162673 2523 2509 2322 2055 1898 1829 1754 1003 989 974 756 527 494 319 241 12216 12616 --
NM_024751chr4112107 2057 2013 1975 1909 1803 1745 1708 1629 385 24 --11989 --
NM_024761chr9135313 5211 4444 4117 3740 3565 3407 3377 3244 2136 1667 1381 805 --11283 --
NM_024770chr296031 5243 5003 4971 4316 4206 4129 2312 289 24490 2333 --15888
NM_024834chr1061413 643 258 251 159 64 --1282 1274
NM_024920chr491612 1490 1312 577 553 437 330 214 190 1613 1587 --
NM_024942chr10121375 1045 1018 550 509 477 387 307 221 88 71 32 ------
NM_024947chr3249595 9573 9400 9120 8252 7767 7501 6979 6446 6321 6302 6100 5797 3777 3413 2975 2402 1854 1590 1560 1520 992 972 259 --49505 8764 6778 910 37266 1758 712
NM_024949chr485017 4867 4590 3552 2014 2007 1985 1312 14650 1248 --
NM_024989chr2298204 8118 8071 7042 6922 6219 6209 6070 6041 6026 5734 5685 5635 5548 5390 5299 5266 3266 3105 2903 2564 2526 2378 2073 1945 1666 979 777 153 ----26239 127
NM_025054chr8154186 4079 3989 3877 3759 3594 2778 2762 1666 1353 1128 508 298 51 31 --13103 1384
NM_025073chr1164745 4368 4060 3678 3470 3398 3138 3066 3009 2971 1351 1305 1224 817 670 654 13212 1151 13419
NM_025107chr672281 1961 1805 1583 1542 334 205 1465 22211 1575 --
NM_025160chr1134324 4108 3529 3339 3233 3190 3045 2778 1244 1221 1186 692 599 1223 12869 --
NM_025191chr1113557 3437 3209 2984 2866 2685 2673 2625 2317 2287 1155 --33282 771 447 12556
NM_030625chr10132571 2405 2376 2319 2204 1955 1945 1824 814 544 527 246 77 ------
NM_030627chr5124132 4076 3923 3820 2827 2784 2686 2669 912 332 305 207 14150 13666 --
NM_030647chr7126181 6079 6039 4691 4585 2167 1491 1197 1126 1114 950 534 11332 25721 4189 26295 6211
NM_030648chr4125607 5548 5523 5449 5112 4942 4097 3808 3786 890 730 222 15261 ----
NM_030664chr1082241 2151 2006 984 825 549 376 80 ----21867 390
NM_030674chr12155909 5472 5399 5266 5059 4967 4117 2253 2213 1965 1905 924 755 571 341 11038 ----
NM_030751chr10111791 1319 1249 1193 750 640 599 469 390 375 55 ------
NM_030751chr10111791 1319 1249 1193 750 640 599 469 390 375 55 ------
NM_030755chr1483047 2702 2684 2112 749 413 360 26 --42079 1175 317 98 --
NM_030777chr2092483 2467 2329 2313 2268 2257 778 279 264 ------
NM_030806chr199300 8819 8127 7780 3681 2531 1495 1268 127 13661 21282 178 11193
NM_030816chr1113640 2940 2665 2457 2366 1264 827 718 616 528 460 --23452 2804 23352 1119
NM_030885chr382314 2245 2068 1573 636 593 396 361 ----12215
NM_030945chr582653 2424 2414 2383 2174 965 730 290 31905 1645 747 3739 155 126 --
NM_031271chr8141732 1717 1678 1570 1416 1325 690 566 541 534 470 445 93 51 ------
NM_031296chr4122686 2431 2325 2307 2144 1941 1770 984 649 461 331 64 ------
NM_031362chr2122820 2806 2783 2767 2741 2689 2599 2465 2291 1021 702 254 12728 127 --
NM_031365chr2122956 2942 2919 2903 2877 2825 2735 2601 2427 1157 838 390 12864 1163 --
NM_031366chr2122956 2942 2919 2903 2877 2825 2735 2601 2427 1157 838 390 12864 1163 --
NM_031371chr161576 1168 1097 557 530 387 11087 --11499
NM_031371chr161576 1168 1097 557 530 387 11087 --11499
NM_031427chr14105957 5335 5216 5174 4967 3865 3694 951 746 329 22134 2067 --15944
NM_031435chr12133515 3422 3341 2917 2562 2508 2144 1374 1243 681 597 586 354 22716 975 23407 3317 --
NM_031438chr571809 1747 305 131 116 66 25 --21428 188 --
NM_031483chr20113496 3202 2949 2560 2290 1298 1235 694 287 131 48 --23316 2173 --
NM_032012chr9115273 5173 4759 4702 3610 1990 1956 1787 1771 895 411 14619 24557 1223 --
NM_032047chr3122362 2355 2334 1833 1573 827 710 540 389 136 110 69 --2835 666 --
NM_032105chr1138107 8072 8041 7608 7232 6675 6410 5782 5354 5317 3171 2031 1946 26071 609 12748 15298
NM_032145chr6111903 1860 1609 1183 785 462 422 261 184 125 86 ------
NM_032189chr13105009 5003 4670 4528 4350 4344 4194 1901 1506 1249 ----1717
NM_032199chr10163902 3888 3861 3679 3499 3277 3080 3049 2989 2953 2480 2449 1303 1119 662 93 --33596 2894 965 1984
NM_032291chr151989 1957 1366 552 185 1787 2349 205 1418
NM_032373chr10195820 5773 5709 5533 5505 5492 5188 4891 4666 4585 4491 3843 1557 1412 1317 950 326 294 161 --1721 --
NM_032424chr1191266 1201 603 555 540 362 247 229 29 21045 620 ----
NM_032439chr1091529 1312 1157 1132 1041 584 570 558 262 --1386 --
NM_032446chr5133675 3494 3375 3088 2568 2509 1379 1191 1008 466 356 266 94 --33324 2864 673 13637
NM_032457chr4103711 2461 1338 1134 1101 986 714 662 597 572 13746 12849 --
NM_032458chrX133398 3366 3105 2905 2892 2822 2606 2476 1299 1291 1245 1179 251 42853 523 277 65 ----
NM_032804chr1092559 2495 2008 1778 1723 1636 1001 975 771 11008 ----
NM_032859chr13112929 2856 1448 1439 1415 1084 1069 361 263 142 59 --1379 --
NM_032869chr8112076 2053 1941 1766 1745 1544 1269 824 484 325 40 21850 1427 31839 1564 407 31803 1382 401
NM_032968chrX104244 4072 4036 3813 3303 1612 610 315 284 75 --13106 21701 983
NM_032969chrX104244 4072 4036 3813 3303 1612 610 315 284 75 --13106 21701 983
NM_032973chrY134236 4064 4028 3805 3676 3442 3298 1611 610 432 315 284 75 --13101 21695 983
NM_032975chr1893655 3516 3480 3469 2390 2362 796 456 395 1429 13529 22235 1144
NM_032980chr1893655 3516 3480 3469 2390 2362 796 456 395 1429 13529 22235 1144
NM_033020chr1114492 4266 3823 3630 1683 1561 1525 1105 1059 809 151 11699 --31827 1202 304
NM_033138chr762255 2037 1631 1498 832 404 186 --22332 912
NM_033139chr762255 2037 1631 1498 832 404 186 --22332 912
NM_033140chr762255 2037 1631 1498 832 404 186 --22332 912
NM_033143chr4114554 3439 3188 2857 1446 978 727 708 590 488 335 1448 13825 --
NM_033157chr762255 2037 1631 1498 832 404 186 --22332 912
NM_033181chr6113848 3614 3353 3280 2915 2528 1299 607 476 418 155 1828 23685 955 21434 706
NM_033211chr581645 1599 1470 706 648 585 504 321 11651 --2493 230
NM_033224chr7117041 6795 6526 6304 6191 5903 5458 3049 2094 2066 1691 --26146 1921 --
NM_033225chr883216 3096 3002 2760 2216 1178 807 636 ----1848
NM_033285chr8103913 3821 3444 3326 2990 1656 1618 1083 1075 782 --24149 81 --
NM_033360chr12144611 4568 3933 3609 3590 3473 3334 3073 3048 2977 1568 1354 712 311 34303 4207 3056 24511 439 --
NM_033389chr17114863 4481 3670 3537 3238 3193 3152 1222 1178 100 38 11333 11194 --
NM_033430chr4163710 3060 2936 2886 2854 2715 1431 1357 1249 1212 811 574 380 296 268 160 --43775 2975 1288 1073 23995 2763
NM_033437chr4163710 3060 2936 2886 2854 2715 1431 1357 1249 1212 811 574 380 296 268 160 --43775 2975 1288 1073 23995 2763
NM_033505chr2186495 5900 5391 4878 4754 4624 4470 4339 2552 2410 1897 1774 1467 1186 1082 576 247 52 --1282 --
NM_033655chr921079 444 1989 --3754 727 715
NM_033656chr21175618 5309 5168 5120 4753 4157 4077 3958 3870 3686 2056 1586 1576 1476 1466 928 243 --15987 13765
NM_052811chr13145200 5077 5040 4967 4670 4474 4305 3743 2068 1584 1374 973 733 110 2785 299 33458 293 240 15261
NM_052879chr12114041 3802 3648 3252 3192 3125 1424 1015 662 491 392 22750 65 33923 3232 2756 --
NM_052885chr12184878 4742 4703 4581 4301 4167 3606 3517 3415 3207 3048 1976 1909 1851 1636 604 203 191 --24839 278 23361 1917
NM_052917chr2133333 3179 2966 2270 2212 1087 782 507 383 275 152 113 72 1547 ----
NM_052932chr1162210 1610 890 765 742 84 --1833 1684
NM_052937chr882612 2596 2228 2018 1047 984 810 736 1536 22355 216 --
NM_053016chr9138018 7009 6692 6069 6036 5205 5087 1299 1222 1196 1102 877 858 16682 27706 570 --
NM_057168chr7101731 1622 1591 1541 1533 1421 1395 1355 1178 468 2514 258 --1213
NM_058241chr292242 2109 1685 1587 1573 842 506 237 117 --11825 --
NM_058241chr292242 2109 1685 1587 1573 842 506 237 117 --11825 --
NM_080629chr151334 1185 1095 1005 962 2591 585 --11432
NM_080630chr151334 1185 1095 1005 962 2591 585 --11432
NM_080666chr1461262 1211 667 561 476 462 --2577 257 --
NM_080759chr1392358 2227 2210 2202 977 958 213 144 125 21045 607 21785 776 --
NM_080760chr1392358 2227 2210 2202 977 958 213 144 125 21045 607 21785 776 --
NM_080867chr14175042 4248 4047 4020 3891 2028 1812 1513 1225 1067 611 530 485 437 410 199 51 --2506 352 --
NM_080927chr3113274 3263 3211 3179 2615 2481 2151 1251 717 709 304 13168 ----
NM_130439chr1072305 2004 1669 226 219 210 36 ------
NM_130439chr1072305 2004 1669 226 219 210 36 ------
NM_130847chr1195940 5679 5367 4319 4215 2173 957 618 152 35693 5255 1150 15845 15784
NM_133334chr4165948 5923 5740 5376 5149 4836 4685 4597 4563 4279 4195 4075 2544 2277 917 598 --21232 472 --
NM_133370chr4143553 3265 3160 3143 2936 2547 1397 1323 1315 997 689 569 363 282 12329 --22341 440
NM_133372chr5112943 2857 2704 2660 2193 973 820 814 677 494 292 --1658 --
NM_133493chr6124602 4256 4129 4090 3856 3844 3532 3163 3046 1555 1518 1506 24559 4296 34595 2839 1729 14212
NM_133496chr1103801 3487 2815 2792 2775 1664 1011 876 587 456 1332 14248 14284
NM_133646chr2165490 5414 5374 5281 5237 5185 4797 1998 1912 1513 1448 1317 1306 1135 890 34 --11250 14552
NM_134470chr35605 580 468 284 178 2700 545 1167 --
NM_138270chrX103171 3093 3032 2349 2316 2114 592 492 232 193 12440 32309 2222 1041 12763
NM_138286chr19134292 4144 3731 3350 3067 2840 2830 2815 1669 1308 574 450 307 11068 --22935 1021
NM_138426chr782428 2228 2186 1847 1797 571 564 557 12080 1866 --
NM_138444chr13124573 4194 3944 3784 3707 3446 3408 3223 3102 1765 1555 1149 24775 4143 13489 13852
NM_138468chr2136208 5451 4340 1961 1747 1161 894 870 833 613 267 243 219 16363 ----
NM_138576chr1454696 4503 1188 1097 385 --11502 34761 4656 1340
NM_138633chr691797 1416 1396 1329 1224 1142 649 467 349 --11436 11095
NM_138713chr16228220 8209 8137 7927 7604 6639 5938 5897 5810 5790 5742 5003 3245 3215 3172 3149 2555 2397 2178 1508 809 188 ------
NM_138714chr16228220 8209 8137 7927 7604 6639 5938 5897 5810 5790 5742 5003 3245 3215 3172 3149 2555 2397 2178 1508 809 188 ------
NM_138731chr14124236 4089 4035 3777 3495 3267 3141 899 828 709 541 160 --32852 720 388 13291
NM_138771chr771376 1324 1257 1056 989 524 390 1553 11403 1514
NM_138782chr5122360 2001 1947 1858 1749 1487 909 890 464 419 215 194 22120 299 12079 --
NM_138959chr166788 4636 2198 1892 1604 1489 34496 2266 2255 --12241
NM_139283chr1262384 1737 763 641 446 221 --1335 1320
NM_144567chr1112690 2409 2321 2094 2042 1920 947 611 189 82 42 --12165 --
NM_144571chr4226902 6787 6546 5910 5892 5418 5001 4282 2267 2241 1923 1720 1468 1218 987 914 768 711 404 251 194 159 14959 12547 --
NM_144578chr14125510 4410 4127 4049 3986 3660 2013 1747 1545 1484 770 374 23501 265 34790 1766 1341 14058
NM_144599chr15165502 5454 5365 5194 5154 4405 4385 3412 3334 1612 1065 1014 760 752 365 280 15139 13527 15329
NM_144632chr291934 1799 1761 1681 966 890 841 813 22 11751 1757 12344
NM_144664chr11142583 2464 2349 2304 2172 2058 2052 1901 829 764 698 607 249 93 --22442 1026 --
NM_144778chr1392731 2601 2390 2024 1863 1677 980 384 184 --21812 317 --
NM_144949chr262479 2439 2316 2102 371 351 1901 1341 11598
NM_144963chr832653 1048 121 12731 12504 22369 482
NM_144973chr12175263 5187 5172 4623 4515 4430 4338 4056 3831 3738 3628 3285 1023 629 480 285 200 24476 4274 45256 1297 319 154 --
NM_145011chr1082152 2043 1818 883 619 551 542 206 --21793 1565 --
NM_145259chr2317054 7019 6966 6944 6912 6780 6238 6177 6137 5960 5486 5088 4914 4821 2808 2779 2773 2662 2647 2366 2343 2151 1293 1197 1104 997 959 825 298 118 69 21119 847 1486 --
NM_148170chr11115612 5456 4389 3806 3447 3408 2003 1906 1539 1392 1022 11050 21262 1034 --
NM_148955chr15136545 6428 6333 5151 2514 2263 2030 2018 1888 1618 1561 1421 377 16467 22398 408 1266
NM_152270chr1791957 1900 1883 1684 1508 1467 1453 741 657 --11753 --
NM_152332chr14112313 2192 2008 977 933 884 815 717 349 244 201 ----12170
NM_152400chr472072 2018 1967 1619 1594 1503 476 --21527 546 11853
NM_152407chr5103261 3229 3074 2729 2361 2166 1020 143 124 79 23123 1211 ----
NM_152409chr5153405 3379 3341 3328 3315 3271 2881 2752 2330 1448 1397 1233 880 549 528 ----13475
NM_152417chr871321 1225 1043 516 462 99 49 ----21288 919
NM_152594chr15102283 2269 2261 1752 815 676 649 626 505 214 21783 713 ----
NM_152622chr5143430 3291 3285 3088 3021 2873 2358 2263 1348 1298 1000 929 455 157 --11200 23201 3007
NM_152624chr5197194 7133 7067 6844 6694 6626 6128 6025 6004 2862 2551 2247 2190 2069 1590 1359 866 379 115 1306 15003 1897
NM_152641chr12102670 2012 1991 1905 1896 1789 1140 773 621 379 --22629 338 --
NM_152699chr3133759 2883 2578 2427 2405 2398 2298 1439 1271 289 241 186 93 1758 ----
NM_152754chr7143738 3649 3632 3469 2404 2341 1497 1455 1182 1127 1094 765 620 257 --23316 1394 --
NM_152756chr5114196 4173 4143 3800 3721 3299 3132 2775 1430 762 536 11695 ----
NM_152758chr8102576 2561 2464 2440 2386 2265 2256 1931 1103 942 ----2631 495
NM_152787chrX93614 3532 3454 3138 2908 1058 841 596 501 12923 13366 --
NM_152826chr15136545 6428 6333 5151 2514 2263 2030 2018 1888 1618 1561 1421 377 16467 22398 408 1266
NM_152999chr7144826 4245 4066 3824 3652 3595 3478 3216 3102 3075 1891 1527 1264 319 --25012 4907 --
NM_153042chr691799 1547 1508 1478 1435 686 635 568 118 ----21242 477
NM_153184chr371844 1273 762 701 621 472 274 1301 31718 1545 572 --
NM_153188chr5205675 5618 5592 5482 4460 3912 3802 3763 3679 2252 2243 1892 1495 1373 1316 1142 972 327 195 87 24173 521 15067 --
NM_153207chr12143711 3611 3521 3443 2584 2535 1557 1203 737 472 427 368 145 133 --21061 1045 23124 1195
NM_153235chr6112253 2242 2090 2039 1944 1861 727 709 614 512 133 --11669 --
NM_153332chr893247 2976 2863 2666 2461 2436 2262 2219 214 ----1976
NM_153354chr56900 827 763 275 176 138 1862 1617 1886
NM_153365chr482440 2274 2216 2161 2088 2041 497 94 1868 --1333
NM_153607chr572368 1265 1113 792 706 637 249 1759 22028 320 12603
NM_153689chr2112265 2160 1717 1711 1608 1573 1512 920 405 350 161 12080 ----
NM_153810chr10154742 4610 4533 4475 3972 3633 3476 1876 1474 1325 930 638 460 400 132 14619 34641 873 797 --
NM_170710chr4133221 3093 2659 2556 2488 2445 2229 1205 1191 766 598 551 397 11233 11252 2425 333
NM_172069chr2142335 2315 2194 1816 1785 1723 1621 1556 1503 901 400 332 171 159 --1721 --
NM_172071chr1107342 7095 5653 4542 2867 2675 1808 1714 1159 323 26557 5693 11151 21177 803
NM_172103chr672686 2162 2141 1886 1642 821 635 11902 32655 2113 604 12221
NM_172105chr672686 2162 2141 1886 1642 821 635 11902 32655 2113 604 12221
NM_172193chr1481285 1231 1208 1141 1108 478 223 165 21279 1164 --1516
NM_173060chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_173061chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_173063chr582056 2008 1651 1622 539 517 502 429 --21930 155 1218
NM_173214chr16228220 8209 8137 7927 7604 6639 5938 5897 5810 5790 5742 5003 3245 3215 3172 3149 2555 2397 2178 1508 809 188 ------
NM_173468chr4226070 6025 5285 5238 5212 5098 4691 4625 4488 4345 4227 4169 3884 2166 1966 1415 1296 1278 596 485 449 55 31684 712 618 25692 274 25746 4134
NM_173470chrX72609 1985 1100 1066 971 958 92 32829 2233 100 32838 296 49 --
NM_173510chr2272880 2794 1133 1018 703 339 33 --2579 238 22702 1806
NM_173511chr2103896 3399 2801 2612 1059 837 733 675 473 442 --12922 --
NM_173552chr3102439 2362 2301 2262 1580 983 909 757 620 139 1819 1279 --
NM_173582chr11145734 4639 4015 3940 3808 2037 1947 1089 1051 529 515 390 262 248 --24240 2303 --
NM_173602chr12103647 3467 2738 1495 1401 877 661 262 193 114 --1673 13811
NM_173698chrX111899 1692 1532 1419 1311 821 804 739 731 724 220 ----1392
NM_173808chr1134480 3783 3666 3532 2946 1717 1436 1042 889 662 630 533 257 --2473 351 --
NM_173829chr5165972 5878 5831 5048 4840 4255 4224 2283 2188 2151 1923 1782 1304 800 417 186 --32479 529 366 --
NM_173851chr853996 1511 1214 804 669 --43592 3006 2963 1472 12760
NM_174916chr15102385 2176 2103 1856 1598 1563 953 329 228 142 22341 1635 2158 94 --
NM_175056chr392223 2123 2060 1456 440 279 247 171 103 1229 1417 11724
NM_175061chr7102031 2002 1976 1625 554 531 481 317 304 297 ------
NM_175623chr12167593 7257 7235 6895 6465 5568 4689 2667 1267 975 943 686 469 271 76 57 ------
NM_175854chr13102788 2628 2579 2162 2050 1875 1757 1724 1717 167 --22262 1966 --
NM_175861chr12165911 5024 4900 4885 4810 4663 4565 4376 1728 1238 1092 894 857 804 728 408 1936 15531 15034
NM_176081chr10165692 5486 5190 4718 4236 3978 2332 2305 2224 1868 1256 563 457 429 261 36 ----15843
NM_176083chr10165692 5486 5190 4718 4236 3978 2332 2305 2224 1868 1256 563 457 429 261 36 ----15843
NM_176814chr7121504 1381 1257 1117 1097 973 530 514 299 231 223 129 11390 ----
NM_176823chr1113824 3249 3163 2971 2797 2699 2633 2518 1076 1054 736 13078 ----
NM_176824chr451278 1141 484 121 53 ----1924
NM_177538chr2118931 8861 8136 7017 6438 6302 5747 5689 2082 1837 308 2200 70 11196 --
NM_177947chrX91562 1447 1183 1119 1091 1075 239 137 118 11364 ----
NM_177948chrX91562 1447 1183 1119 1091 1075 239 137 118 11364 ----
NM_177985chr2152302 2261 1861 1710 1683 1646 787 620 466 442 426 411 402 394 346 --1569 11567
NM_178151chrX187529 7397 6910 6737 6694 6597 5782 5122 2959 2859 2823 2437 2302 1553 1300 1256 381 151 ------
NM_178152chrX187529 7397 6910 6737 6694 6597 5782 5122 2959 2859 2823 2437 2302 1553 1300 1256 381 151 ------
NM_178153chrX187529 7397 6910 6737 6694 6597 5782 5122 2959 2859 2823 2437 2302 1553 1300 1256 381 151 ------
NM_181265chr4133221 3093 2659 2556 2488 2445 2229 1205 1191 766 598 551 397 11233 11252 2425 333
NM_181358chr1174223 4184 4114 3898 3876 3870 3451 3044 2726 2670 2593 1319 1247 1214 1183 767 327 22703 1274 163 --
NM_181481chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_181482chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_181483chr18146994 6634 6513 5898 5209 4510 1596 1586 1577 1356 1308 719 642 605 --45429 4343 2605 1563 1598
NM_181504chr563982 1669 1231 1011 925 457 --52770 1195 1177 901 721 --
NM_181523chr563982 1669 1231 1011 925 457 --52770 1195 1177 901 721 --
NM_181524chr563982 1669 1231 1011 925 457 --52770 1195 1177 901 721 --
NM_181659chr20113321 3253 2923 2840 2696 2555 1068 989 749 666 240 --1423 --
NM_181659chr20113321 3253 2923 2840 2696 2555 1068 989 749 666 240 --1423 --
NM_181705chr5135437 5428 4840 4415 4031 1786 1261 899 611 423 406 298 188 31763 1428 103 15344 --
NM_181714chr6101873 1693 1653 1643 1614 1583 641 604 58 45 1648 --139
NM_181723chr8132335 1937 1915 1737 1658 1489 1436 1419 890 611 317 199 137 --2921 452 1383
NM_181782chr672311 1632 1439 924 798 571 517 22281 636 12241 --
NM_181787chr893557 3392 2543 1083 978 930 483 275 215 13060 2779 105 1310
NM_181836chr582210 1955 1911 908 703 500 344 226 --284 42 1512
NM_182485chr4193728 3604 3472 3365 3266 2958 2830 2717 2710 2595 2497 2383 2275 1017 810 802 293 233 212 23333 2348 23738 1404 --
NM_182503chr6145533 5324 5297 5125 4448 3740 3387 2240 2020 1426 1269 1260 617 98 24975 2181 14008 --
NM_182515chr19136524 6346 6168 6132 6012 5964 5928 4686 2170 1915 1574 1127 1108 25463 1250 12482 12137
NM_182551chr292975 2830 1166 1130 884 249 131 99 49 --2741 160 --
NM_182620chr1762188 1948 1847 1816 1449 364 --12035 2606 464
NM_182646chr4193728 3604 3472 3365 3266 2958 2830 2717 2710 2595 2497 2383 2275 1017 810 802 293 233 212 23333 2348 23738 1404 --
NM_182758chr15123282 3118 3112 2987 2782 2579 1001 901 471 371 276 201 --53936 3468 969 542 230 13894
NM_182762chr7126205 5887 4890 4871 4063 4021 3978 3800 2287 1927 1064 295 --14647 --
NM_182767chr12102001 1934 1862 1607 1600 1524 1470 762 531 278 1475 11577 --
NM_182898chr7246569 6163 6089 5751 5706 5391 5356 4990 4826 4222 4108 4079 4065 2506 2367 2280 2080 1905 1785 1748 1541 858 713 521 1441 46189 6047 5203 150 --
NM_182899chr7246569 6163 6089 5751 5706 5391 5356 4990 4826 4222 4108 4079 4065 2506 2367 2280 2080 1905 1785 1748 1541 858 713 521 1441 46189 6047 5203 150 --
NM_182948chr1143048 2876 2859 2680 2665 2452 2417 2325 2131 1938 1251 1241 861 364 --1410 --
NM_183227chr671632 1512 1085 632 581 484 327 --1136 21580 417
NM_194247chr2144522 4492 4453 4422 4322 4091 3984 2938 1812 1667 1374 893 390 326 ------
NM_194285chr11153451 3233 2527 2424 2405 2384 2204 1037 970 894 797 718 680 172 162 13186 1455 12098
NM_194314chr1155647 5352 4452 4101 1918 1796 1772 1299 962 522 459 296 285 194 169 25620 5121 --21637 828
NM_194356chr1292384 2339 2297 2183 1946 1580 937 421 412 11914 --21723 399
NM_194434chr18154678 4547 4265 3937 3931 1800 1533 1477 1422 1157 1079 1020 726 718 331 ----15011
NM_194463chrX81271 873 859 832 310 198 159 131 21238 428 1787 --
NM_198268chr1174223 4184 4114 3898 3876 3870 3451 3044 2726 2670 2593 1319 1247 1214 1183 767 327 22703 1274 163 --
NM_198269chr1174223 4184 4114 3898 3876 3870 3451 3044 2726 2670 2593 1319 1247 1214 1183 767 327 22703 1274 163 --
NM_198281chr4133331 3292 3038 2969 2942 2640 2507 2266 994 890 593 288 112 23381 393 12519 13235
NM_198320chr1295227 4454 4309 4260 4165 4073 3379 751 533 --24711 4124 24135 1593
NM_198465chrX122746 2558 2294 2215 2188 2157 1893 1082 950 905 794 84 ------
NM_198468chr693913 3609 2914 1455 1302 1165 765 294 93 --14308 13792
NM_198484chr3116344 6174 6095 6029 5595 5516 5449 5125 5094 1407 777 1860 --13987
NM_198581chr2287563 6876 6821 6611 6191 6024 5667 5339 2754 2682 2242 2176 2077 2062 2006 1691 1402 1214 1060 978 905 792 764 599 553 394 315 177 15040 27276 545 --
NM_198715chr1146224 6198 6044 5425 5350 5036 4890 4530 4403 1022 1007 893 506 317 --35795 2509 531 --
NM_198793chr3104112 3956 3943 2999 1623 1527 1419 1193 1077 210 1579 ----
NM_198794chr14131486 1342 1318 1165 1103 1089 1047 915 463 430 285 151 116 ------
NM_198859chr364679 3983 1909 1723 447 76 1186 --3877 861 538
NM_198896chr1171804 1645 1391 811 290 221 116 --182 22137 1993
NM_198904chr53547 266 152 --12023 21906 1440
NM_198935chr20102787 2516 2483 2196 1243 904 863 765 281 92 --22378 225 12578
NM_198968chr13113802 3487 3357 2464 1546 853 791 681 382 192 40 --13715 1170
NM_199072chr7122868 2756 2666 2491 2471 2451 2415 2367 2263 1062 294 267 12860 ----
NM_199188chr12114041 3802 3648 3252 3192 3125 1424 1015 662 491 392 22750 65 33923 3232 2756 --
NM_199190chr12114041 3802 3648 3252 3192 3125 1424 1015 662 491 392 22750 65 33923 3232 2756 --
NM_199324chr4123069 3020 1246 1200 1175 910 893 659 600 358 272 48 22460 1337 1639 --
NM_199355chr1671810 1778 1714 1158 1115 658 646 ----11731
NM_199421chr14175042 4248 4047 4020 3891 2028 1812 1513 1225 1067 611 530 485 437 410 199 51 --2506 352 --
NM_199436chr2103121 2820 2728 2313 2243 891 857 767 336 317 --11249 --
NM_199437chr1182247 2189 1851 1588 815 542 332 319 --11901 32467 1604 868
NM_199438chr1182247 2189 1851 1588 815 542 332 319 --11901 32467 1604 868
NM_199439chr1182247 2189 1851 1588 815 542 332 319 --11901 32467 1604 868
NM_203282chr1941858 1769 1194 714 --21534 319 11161
NM_203406chr5122948 2737 2668 2294 2176 1173 1051 825 688 662 391 366 --1876 --
NM_203446chr21132964 2932 2808 2650 2494 2441 2355 2278 2052 1200 972 881 186 ------
NM_203458chr1133305 3236 3228 3050 2970 2624 2503 2369 1203 1171 1048 1032 721 21336 844 --13011
NM_203459chr1111918 1880 1686 1665 1036 636 605 301 267 214 158 --12063 --
NM_203463chr2164353 4328 4037 4021 3710 3545 3508 3302 3064 1674 1645 968 787 253 228 54 23039 1058 ----
NM_205852chr1281662 1581 1388 840 823 727 301 242 1538 21974 1561 1122
NM_205860chr1103174 3117 3057 2686 2678 2498 2055 1150 761 204 32442 1065 138 --23188 2850
NM_206853chr6174122 4059 3997 3812 3729 3289 3278 3178 2678 1303 1187 1114 714 693 596 568 174 ------
NM_206854chr6165383 5320 5258 5073 4990 4550 4539 4439 3939 3526 3496 1975 1954 1857 1829 1435 11009 --1209
NM_206855chr6176348 6285 6223 6038 5955 5515 5504 5404 4904 4491 4461 4223 4056 2400 953 443 22 11974 1670 11174
NM_206866chr21153265 3257 3225 3201 2976 2967 2904 2615 2563 2547 2464 2451 2384 498 416 12644 1944 --
NM_206876chr2103349 3224 2446 2385 2299 1312 1098 791 680 181 --32191 1134 1120 --
NM_206907chr5123293 3045 2547 2471 2261 1266 961 945 934 695 376 304 --12480 12635
NM_206909chr8208292 8249 8143 8078 8056 7626 6984 6390 6342 5997 5882 5441 5090 2301 2217 2033 2014 1796 1358 1081 1975 16948 --
NM_207292chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_207293chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_207294chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_207295chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_207296chr3172796 2620 2418 2253 2235 2195 2137 1206 944 695 646 529 383 243 226 142 84 --23188 2244 12943
NM_207297chr3172821 2645 2443 2278 2260 2220 2162 1231 969 720 671 554 408 268 251 167 109 --23213 2269 12968
NM_207304chr1382618 2488 2277 1911 1750 867 271 71 --21699 204 --
NM_207325chr19102077 1778 1419 624 502 494 319 265 231 215 11310 ----
NM_207361chr13146171 5912 5816 5286 5195 5148 4898 4645 4521 4381 2297 2077 1271 864 16182 25321 5216 34274 899 378
NM_207406chr4186435 6408 6202 5465 5456 4914 4741 4660 2526 2496 2073 2003 1689 1620 1566 1459 1179 199 15288 --12376
NM_212558chr9114140 3817 3566 3373 3269 3197 1705 1336 276 269 165 ------
NM_213590chr13145200 5077 5040 4967 4670 4474 4305 3743 2068 1584 1374 973 733 110 2785 299 33458 293 240 15261
NM_213606chr10122722 2710 2578 2471 2276 2267 2191 1764 1098 1084 957 142 --21687 949 --