TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-16-5p
miRNA Sequence: UAGCAGCACGUAAAUAUUGGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51107 ----11260
NM_000020chr1242403 2318 1891 188 ------
NM_000021chr1451107 1035 1023 720 292 ------
NM_000024chr5----1340 --
NM_000037chr842368 2206 1905 727 12311 ----
NM_000038chr531329 775 734 ----1344
NM_000081chr121366 614 11629 11160 --
NM_000084chrX65391 4950 4734 1855 1653 1517 --31656 677 618 26505 6037
NM_000088chr1721109 352 ------
NM_000090chr21859 --1174 --
NM_000092chr223582 177 23918 1241 24192 3080 --
NM_000104chr222206 646 --194 --
NM_000108chr711429 11640 41747 1536 1311 275 --
NM_000109chrX12371 ----11073
NM_000110chr13772 336 22 --1464 --
NM_000112chr553706 1971 1542 426 382 34518 4442 4323 45505 5111 1675 1470 --
NM_000125chr673853 3744 1708 1337 1269 996 41 ------
NM_000127chr8154 ------
NM_000135chr162753 76 1329 ----
NM_000141chr10----1529 --
NM_000142chr441193 623 257 230 11604 154 --
NM_000147chr1132 1481 ----
NM_000163chr5------12099
NM_000167chrX1125 --11575 --
NM_000168chr742916 1253 942 77 --3799 377 374 --
NM_000176chr51603 --23848 2751 --
NM_000188chr101480 --1178 --
NM_000194chrX1159 ------
NM_000202chrX33310 3189 1335 --11582 --
NM_000208chr1994602 4531 3924 3852 1777 1653 1583 580 231 11202 63659 3620 3444 3135 583 234 --
NM_000210chr24693 659 580 78 ------
NM_000212chr1721695 870 ------
NM_000214chr2031709 537 90 ------
NM_000217chr1245171 1849 1648 150 13516 ----
NM_000232chr432678 321 120 ------
NM_000238chr7151 ------
NM_000248chr312447 --12966 1701
NM_000252chrX41523 1401 399 388 ------
NM_000259chr1596363 5883 4858 4323 4231 3924 2495 379 192 12366 --1639
NM_000266chrX1910 --1272 --
NM_000267chr1753247 3154 183 140 98 11247 --11259
NM_000276chrX52078 2025 1789 383 293 12203 ----
NM_000280chr11--1106 ----
NM_000282chr131218 ------
NM_000304chr172965 145 1835 1148 --
NM_000310chr1----1825 11212
NM_000314chr1053122 2754 1088 1039 1021 ----1959
NM_000319chr122943 436 --1278 --
NM_000321chr1321342 276 ------
NM_000322chr621363 366 --31627 1407 405 11656
NM_000329chr11784 ------
NM_000332chr666326 6185 4614 2386 1234 793 ------
NM_000333chr31146 ------
NM_000334chr1721506 261 --2863 639 --
NM_000337chr565572 4102 2094 867 773 563 --55450 5250 5024 1903 1834 --
NM_000345chr421042 226 --2323 320 --
NM_000346chr1711656 ------
NM_000362chr2253599 3439 2807 1121 146 ----23515 1078
NM_000368chr974843 4806 4018 3928 3797 3482 426 --24407 4021 --
NM_000408chr221115 173 --23413 2615 --
NM_000411chr2122202 2103 ------
NM_000428chr1412493 --22333 2219 --
NM_000430chr1743589 3455 2540 2481 --43719 2641 2312 1230 --
NM_000445chr83940 838 154 ------
NM_000449chr12466 161 ------
NM_000451chrX21592 792 ------
NM_000458chr171876 ------
NM_000461chr344077 4061 3963 3468 --23303 501 --
NM_000462chr15----1566 --
NM_000476chr911443 ------
NM_000484chr212427 140 ------
NM_000489chrX42982 2489 2376 194 --32584 2224 863 --
NM_000492chr731364 1167 1018 ------
NM_000495chrX2407 99 ------
NM_000500chr6192 ------
NM_000503chr841830 190 125 33 --11649 11653
NM_000522chr7156 ------
NM_000523chr221075 169 ------
NM_000533chrX163 ------
NM_000552chr12----131 --
NM_000555chrX107797 7741 7306 6219 4811 1711 1644 1585 1104 357 --11588 --
NM_000578chr231416 1286 472 --1140 --
NM_000581chr3124 --143 --
NM_000599chr224552 3154 ------
NM_000601chr71331 ------
NM_000602chr721241 556 ------
NM_000610chr1122894 707 ------
NM_000611chr1186445 5689 5133 2292 1933 1916 449 63 11863 14850 --
NM_000615chr1142175 1951 887 221 ------
NM_000618chr1241410 1377 449 365 16060 1221 --
NM_000618chr1241410 1377 449 365 16060 1221 --
NM_000627chr2--1652 --1266
NM_000633chr1853715 1803 1781 459 103 ------
NM_000673chr41316 ------
NM_000676chr172414 214 ------
NM_000678chr202549 123 ------
NM_000679chr51150 ------
NM_000681chr1021025 184 11152 21028 160 11347
NM_000685chr32657 228 ----1831
NM_000685chr32657 228 ----1831
NM_000687chr202152 32 ------
NM_000719chr1275064 4264 2531 2222 1959 1700 741 15223 36238 6058 2261 --
NM_000721chr112283 ----12274
NM_000722chr72281 208 ------
NM_000724chr1021656 288 --2138 135 --
NM_000726chr22573 116 ------
NM_000756chr8183 ------
NM_000767chr1941388 1326 574 256 ------
NM_000780chr811110 --1793 --
NM_000801chr2021054 1022 --1844 --
NM_000806chr521253 653 11797 ----
NM_000812chr42409 365 --185 --
NM_000813chr554721 4083 1394 161 122 --1391 --
NM_000814chr1514057 12909 ----
NM_000816chr51205 ------
NM_000817chr21349 --2425 76 --
NM_000818chr10122 1210 ----
NM_000826chr422448 113 ------
NM_000829chr1121786 743 ------
NM_000831chr1106273 4795 4364 3972 2442 1909 1424 924 534 179 --11645 --
NM_000832chr9----163 --
NM_000833chr16--11526 ----
NM_000838chr632779 2023 127 --71915 1831 701 151 148 133 130 --
NM_000844chr32866 160 --11007 --
NM_000859chr51216 --11408 --
NM_000865chr6----1187 --
NM_000868chrX31958 1688 101 ------
NM_000875chr1565069 2249 1874 726 672 132 21275 564 1732 --
NM_000883chr72283 158 ------
NM_000883chr72283 158 ------
NM_000885chr22846 472 ------
NM_000891chr1743609 2818 2294 424 1392 22944 1191 --
NM_000899chr1223035 1697 --33768 3765 3271 --
NM_000901chr42701 164 12156 ----
NM_000910chr431969 522 401 --1131 --
NM_000919chr5--1456 ----
NM_000922chr113880 748 237 --1292 --
NM_000933chr2021206 74 ------
NM_000939chr2177 ------
NM_000944chr4173 ------
NM_000945chr241645 1510 1492 771 ------
NM_000949chr5------1220
NM_000950chrX32919 2393 433 --22754 1447 11160
NM_000958chr521185 301 --11237 --
NM_000959chr133984 3962 3481 13522 13427 --
NM_000962chr932392 1937 722 --12368 --
NM_000965chr3----184 --
NM_000966chr1211016 --1803 --
NM_001001132chr2121134 435 --11197 --
NM_001001323chr1222307 831 22725 693 2685 193 --
NM_001001331chr31737 --1181 --
NM_001001342chr1011082 --11030 --
NM_001001344chrX22312 447 --22253 2163 --
NM_001001389chr1122894 707 ------
NM_001001390chr1122894 707 ------
NM_001001391chr1122894 707 ------
NM_001001392chr1122940 753 ------
NM_001001396chr164477 4230 1724 1058 710 384 --13905 13894
NM_001001419chr544816 3605 809 542 --25059 794 24626 3232
NM_001001420chr544816 3605 809 542 --25059 794 24626 3232
NM_001001479chr221796 --1746 --
NM_001001483chr111320 ------
NM_001001484chr10----2656 415 --
NM_001001549chr721066 896 --2978 181 --
NM_001001550chr721066 896 --2978 181 --
NM_001001555chr721066 896 --2978 181 --
NM_001001556chr15--1114 ----
NM_001001664chr212703 --14089 --
NM_001001740chr1----1232 --
NM_001001740chr1----1232 --
NM_001001787chr1161 ------
NM_001001933chr11130 ------
NM_001001971chr101126 11403 --1564
NM_001001974chr1022268 483 --11979 11555
NM_001001995chrX61605 1564 1330 1272 134 62 --11214 --
NM_001002026chr311633 --32432 618 435 --
NM_001002032chr172645 25 --1726 --
NM_001002033chr172745 125 --1826 --
NM_001002233chr832018 1570 441 ------
NM_001002243chr2----1251 --
NM_001002252chr12183 ------
NM_001002295chr101254 ------
NM_001002762chr1052354 1177 1039 810 235 --1321 --
NM_001002838chrX2660 547 ----1382
NM_001002843chr1521271 296 11068 180 --
NM_001002860chr1464294 4072 3919 3425 1225 194 1709 13050 14368
NM_001002909chr1742241 1702 459 409 --22068 833 --
NM_001002914chr1711059 ----11083
NM_001003406chr2263227 3025 2992 2928 1071 1054 1571 12115 --
NM_001003407chr1075059 5022 4768 4646 1787 1248 968 --11008 --
NM_001003408chr1075059 5022 4768 4646 1787 1248 968 --11008 --
NM_001003652chr1887978 7661 5595 3058 2346 2239 1359 395 --45598 2591 2325 348 26231 1436
NM_001003674chr18117052 5525 5473 5295 4992 4643 2588 1889 1178 966 778 --117008 6996 4614 4611 4608 4605 4602 4599 4596 4345 1310 16637
NM_001003675chr18117052 5525 5473 5295 4992 4643 2588 1889 1178 966 778 --117008 6996 4614 4611 4608 4605 4602 4599 4596 4345 1310 16637
NM_001003688chr41765 ------
NM_001003694chr3----1442 --
NM_001003792chr31174 ------
NM_001003793chr31174 ------
NM_001003800chr941450 1292 1235 223 ------
NM_001003845chr2----1468 --
NM_001003940chr1523203 1262 --2833 830 --
NM_001003942chr1523203 1262 --2833 830 --
NM_001003943chr1523207 1266 --2837 834 --
NM_001004065chr973437 2944 2926 2876 1392 469 311 --23791 3495 --
NM_001004105chr5134 ------
NM_001004303chr11667 ------
NM_001004303chr11667 ------
NM_001004317chr633047 1808 1677 --34162 1683 1680 --
NM_001004342chr195893 5685 5668 3980 3717 1823 1806 1797 1736 ------
NM_001004354chr92748 51 ------
NM_001004360chr231300 316 80 ----1182
NM_001004431chr171210 ------
NM_001005209chr21256 --1581 --
NM_001005210chr1152135 2126 1920 463 46 --130 --
NM_001005271chr1731071 1052 76 ------
NM_001005273chr1731071 1052 76 ------
NM_001005291chr171134 ------
NM_001005353chr13381 313 68 --1316 11048
NM_001005353chr13381 313 68 --1316 11048
NM_001005360chr192852 227 ------
NM_001005361chr192852 227 ------
NM_001005362chr192852 227 ------
NM_001005366chr121241 ------
NM_001005386chr24711 575 488 435 --1241 1315
NM_001005404chr1743885 3736 3125 2929 --23184 791 --
NM_001005407chr161694 ------
NM_001005417chr12545 74 ------
NM_001005463chr1011864 ------
NM_001005505chr31317 --11381 --
NM_001005526chr2198 ------
NM_001005609chrX83537 2984 1244 1189 658 406 316 103 --43729 1319 409 78 12743
NM_001005732chr212663 601 ------
NM_001005733chr212620 558 ------
NM_001005739chr21588 ------
NM_001005743chr142986 475 --1236 --
NM_001005744chr142986 475 --1236 --
NM_001005745chr142986 475 --1236 --
NM_001005746chr22573 116 ------
NM_001005747chr22573 116 ------
NM_001005849chr17--1489 ----
NM_001005909chr3159 ------
NM_001005910chr33585 448 268 ------
NM_001005911chr33585 448 268 ------
NM_001005920chr162795 384 ------
NM_001006115chr332428 870 471 --62631 2015 2012 1928 858 855 --
NM_001006600chr532448 1908 972 ------
NM_001006610chr16--1140 ----
NM_001006612chrX------1104
NM_001006613chrX------1104
NM_001006614chrX------1104
NM_001006617chr91933 --1936 --
NM_001006618chr9159 ------
NM_001006619chr91933 --1936 --
NM_001006620chr91933 --1936 --
NM_001006621chr91933 --1936 --
NM_001006623chr21105 --3695 692 157 12389
NM_001006636chr22961 123 ------
NM_001006938chrX----1506 1561
NM_001006944chr111727 ------
NM_001006946chr221516 1313 ------
NM_001007024chr1763747 3526 1571 511 245 185 --12719 12834
NM_001007025chr1763747 3526 1571 511 245 185 --12719 12834
NM_001007026chr121355 --1108 --
NM_001007027chr11193 ------
NM_001007067chr82740 106 --1364 --
NM_001007068chr82740 106 --1364 --
NM_001007069chr82740 106 --1364 --
NM_001007070chr82740 106 --1364 --
NM_001007072chr15----1186 --
NM_001007097chr9104902 4639 4455 4445 3346 3223 1512 1016 783 56 --45046 951 109 86 --
NM_001007098chr12354 329 ----1899
NM_001007102chr621438 1399 --21599 1596 --
NM_001007156chr1531720 1415 447 ------
NM_001007226chr172967 933 --2207 56 --
NM_001007227chr172967 933 --2207 56 --
NM_001007228chr172967 933 --2207 56 --
NM_001007229chr172967 933 --2207 56 --
NM_001007230chr172967 933 --2207 56 --
NM_001007237chr192850 2804 2619 2299 2036 1847 908 850 837 --12003 --
NM_001007246chr2121697 103 --21864 1861 11266
NM_001007257chr111477 --1179 11237
NM_001007271chr101414 --2982 79 --
NM_001007277chr111978 ------
NM_001007553chr1----2794 791 --
NM_001007559chr181134 11367 --12051
NM_001008220chr563898 3799 3535 2859 1517 1261 --23901 3811 --
NM_001008222chrX31099 388 158 ------
NM_001008239chr1852856 1523 989 667 100 11370 53587 3584 3349 2894 2575 --
NM_001008392chr343240 2930 978 626 22261 1037 --1999
NM_001008405chr731785 63 27 ------
NM_001008407chr71322 ----1627
NM_001008408chr796279 3922 3874 2547 2048 1654 1589 1552 938 --12498 --
NM_001008495chr822257 1753 ------
NM_001008539chr855135 5000 771 665 104 11890 25357 2076 --
NM_001008540chr22384 318 ------
NM_001008541chr1032174 1461 718 ------
NM_001008541chr1032174 1461 718 ------
NM_001008564chr1312278 ------
NM_001008567chr9184 ------
NM_001008660chr1121270 85 ------
NM_001008701chr1941039 898 454 430 --11912 12007
NM_001008738chr532875 2453 1100 --11126 12457
NM_001008777chr171279 ------
NM_001008860chr15----1670 --
NM_001008892chr15----1670 --
NM_001008894chr15----1670 --
NM_001008895chr131385 ------
NM_001008938chr11----1192 --
NM_001009552chr81237 ------
NM_001009554chr443765 3314 707 46 14505 11007 1711
NM_001009554chr443765 3314 707 46 14505 11007 1711
NM_001009566chr121345 47 --11135 --
NM_001009598chr1140 ------
NM_001009814chr13--179 ----
NM_001009881chr1160 ------
NM_001009882chr1160 ------
NM_001009899chr376238 5983 5380 5268 3948 2419 1364 1376 ----
NM_001009955chr11506 ------
NM_001009955chr11506 ------
NM_001009959chr232623 1722 653 ----12475
NM_001009993chr274588 4210 3575 1630 1193 632 67 --11028 --
NM_001010000chr1833524 3116 1380 122 ----
NM_001010857chr11112 ------
NM_001010861chr132779 2293 2154 ----12377
NM_001010888chrX34614 3944 93 ----11756
NM_001010891chr585885 5444 4284 2534 1742 1115 1093 40 --22703 309 12296
NM_001010895chr91292 --21757 77 --
NM_001010908chr10----1479 --
NM_001010924chr1041223 1034 875 481 ------
NM_001010927chr61374 --1482 --
NM_001010932chr71331 ------
NM_001010986chrX21570 1538 --32447 1699 1682 --
NM_001011537chr342352 1838 1513 409 ------
NM_001011545chr213449 277 214 177 ----
NM_001011666chr776447 6406 6269 6048 5204 1542 452 11120 11177 --
NM_001011705chr13125 ------
NM_001011713chr1431573 1108 152 --11545 --
NM_001011724chr13--1113 1282 --
NM_001011725chr13--1113 1282 --
NM_001012329chr152036 1847 709 685 404 --32371 602 33 --
NM_001012338chr15135 ------
NM_001012393chr1164605 3462 3455 1893 1807 1718 ------
NM_001012410chr31448 ------
NM_001012415chr91107 ------
NM_001012418chr6104214 4073 4035 3607 3236 2648 1001 171 44 37 --32682 50 47 13023
NM_001012420chr1542955 716 700 25 --1422 --
NM_001012423chr1532955 716 700 ------
NM_001012426chr622457 1347 12366 1573 --
NM_001012427chr622457 1347 12366 1573 --
NM_001012506chr31150 ------
NM_001012512chr181183 1268 ----
NM_001012513chr181194 1279 ----
NM_001012614chr41528 ------
NM_001012643chr192525 206 ------
NM_001012732chr43860 514 331 157 ----
NM_001012751chr10----1118 --
NM_001012761chr532737 2465 165 1599 12390 --
NM_001012968chrX1694 --22741 921 --
NM_001012977chrX1905 --1466 --
NM_001012989chrX1586 ------
NM_001013031chr1073458 3386 3087 1317 1022 532 448 --12452 22628 1321
NM_001013406chr711135 ------
NM_001013415chr421198 214 --1619 --
NM_001013437chr18164 ------
NM_001013438chr32653 403 ------
NM_001013439chr31249 ------
NM_001013620chr1227037 1714 15479 13156 --
NM_001013629chr1032133 1953 1681 --11925 --
NM_001013635chr122901 108 ------
NM_001013693chr132600 1916 1149 --12919 --
NM_001013693chr132600 1916 1149 --12919 --
NM_001013699chr12194 1373 1181 --
NM_001013843chr15--1578 ----
NM_001014283chr1372169 1516 1473 1381 325 201 162 1449 ----
NM_001014380chr1311596 --15251 15832
NM_001014765chr121628 50 --21532 515 --
NM_001014797chr1076332 6240 6075 2985 2966 2584 1230 --47440 7437 946 825 1975
NM_001014809chr41678 ------
NM_001014812chr151132 1378 ----
NM_001014839chr11685 ------
NM_001014841chr11685 ------
NM_001015045chr442468 871 507 444 ------
NM_001015877chrX1882 --22890 323 --
NM_001015887chr321598 1216 --11816 1142
NM_001017369chr411081 ------
NM_001017371chr211147 ------
NM_001017395chr373416 2642 2630 1156 1057 1008 999 13587 52597 1066 1063 1060 957 --
NM_001017396chr21159 1392 ----
NM_001017424chr121527 1374 11343 169 --
NM_001017425chr121527 1374 11343 169 --
NM_001017440chr786234 5331 3112 2778 2275 1935 756 28 --11967 --
NM_001017916chr1741604 713 408 229 1189 22062 140 --
NM_001017917chr1741604 713 408 229 1189 22062 140 --
NM_001017926chr811391 --11330 --
NM_001017961chr11151 ------
NM_001017969chr92659 545 ------
NM_001017977chr1----1369 --
NM_001017999chr131656 423 24 ----1928
NM_001017999chr131656 423 24 ----1928
NM_001018000chr131656 423 24 ----1928
NM_001018000chr131656 423 24 ----1928
NM_001018001chr131656 423 24 ----1928
NM_001018004chr152525 217 ------
NM_001018006chr152525 217 ------
NM_001018007chr152525 217 ------
NM_001018020chr152525 217 ------
NM_001018038chr92611 78 ------
NM_001018050chr2253243 2144 679 447 216 ------
NM_001018052chr2253243 2144 679 447 216 ------
NM_001018054chr131178 369 145 ------
NM_001018057chr1141226 483 263 173 --1543 --
NM_001018064chr92501 96 --11578 --
NM_001018067chr165053 4836 3735 1991 1956 504 24432 593 24682 286 --
NM_001018068chr165053 4836 3735 1991 1956 504 24432 593 24682 286 --
NM_001018069chr165053 4836 3735 1991 1956 504 24432 593 24682 286 --
NM_001018074chr51603 --23848 2751 --
NM_001018075chr51603 --23848 2751 --
NM_001018076chr51603 --23848 2751 --
NM_001018077chr51603 --23848 2751 --
NM_001018108chr1541805 1790 667 560 --1642 --
NM_001018111chr753800 1425 1164 950 414 --21395 227 --
NM_001018676chr8----1156 1160
NM_001018677chr8----1156 1160
NM_001020658chr12677 113 1595 1234 --
NM_001020658chr12677 113 1595 1234 --
NM_001020818chr1951717 1645 1608 258 229 --31730 1727 206 --
NM_001020819chr1951717 1645 1608 258 229 --31730 1727 206 --
NM_001020820chr1951717 1645 1608 258 229 --31730 1727 206 --
NM_001020821chr1951717 1645 1608 258 229 --31730 1727 206 --
NM_001020825chr5----21323 226 --
NM_001023560chr61790 --1875 --
NM_001023567chr1532347 544 25 --12358 --
NM_001023587chr331105 934 118 ------
NM_001024071chr142800 209 ------
NM_001024094chr51603 --23848 2751 --
NM_001024226chr11129 11029 ----
NM_001024227chr11129 11029 ----
NM_001024228chr11129 11029 ----
NM_001024380chr822135 2057 12164 ----
NM_001024381chr822135 2057 12164 ----
NM_001024455chrX52671 2641 2244 843 67 1490 11896 11745
NM_001024463chr153881 863 778 ------
NM_001024647chr1297459 6248 4983 4793 4667 2157 1165 934 166 --16557 2938 512
NM_001024649chr522924 957 ------
NM_001024668chr121743 ------
NM_001024808chr1231115 1025 185 --2299 296 --
NM_001024934chr61262 ------
NM_001024935chr61262 ------
NM_001024936chr61262 ------
NM_001024947chr5183 ------
NM_001024948chr132165 2149 1345 --12621 --
NM_001024956chr1123788 182 15881 15750 --
NM_001024957chr11122 ------
NM_001025076chr1085910 4482 4327 2158 2110 1361 1259 259 --35870 5468 3803 --
NM_001025077chr10107268 5840 5685 4948 4578 2719 2617 1617 1352 1244 --37228 6826 5161 --
NM_001025079chr344076 2573 1082 756 ----24017 3712
NM_001025105chr531520 1167 177 ------
NM_001025108chr222926 1165 --22710 2655 --
NM_001025205chr31107 ------
NM_001025266chr354760 4596 4461 3651 1616 --183 23067 1204
NM_001025366chr61489 ----1283
NM_001025366chr61489 ----1283
NM_001025367chr61489 ----1283
NM_001025367chr61489 ----1283
NM_001025368chr61489 ----1283
NM_001025368chr61489 ----1283
NM_001025369chr61505 ----1299
NM_001025369chr61505 ----1299
NM_001025370chr61489 ----1283
NM_001025370chr61489 ----1283
NM_001025579chr174989 756 423 72 ------
NM_001025580chrX21586 289 12730 13462 --
NM_001025595chr421687 1234 ------
NM_001025603chr12466 161 ------
NM_001025616chr42607 321 11878 1519 --
NM_001025780chr91289 ------
NM_001029858chr622768 581 ----1317
NM_001029863chr62314 62 --1985 --
NM_001029870chr4182 ------
NM_001029875chr51216 ------
NM_001029882chr11494 ------
NM_001029882chr11494 ------
NM_001029883chr263033 2660 2224 1983 1119 777 ------
NM_001030006chr1762601 2329 851 269 81 33 --1233 1237
NM_001030007chr1683984 3832 3553 3433 2631 1424 598 207 ----12856
NM_001030055chr1444673 3115 1553 241 23532 1842 31556 1216 244 --
NM_001030287chr13993 738 483 ------
NM_001031679chr1222635 572 ------
NM_001031684chr211455 ------
NM_001031685chr12771 367 ------
NM_001031690chr7112622 2563 2542 2492 2361 2003 1057 970 803 501 396 ------
NM_001031694chr12799 352 --1218 --
NM_001031694chr12799 352 --1218 --
NM_001031695chr2245126 3856 3598 1378 21661 1523 35376 4980 2072 12076
NM_001031700chr412372 --32091 432 317 --
NM_001031702chr33778 274 115 --1781 --
NM_001031717chr3124 175 --1772
NM_001031732chr443313 3212 2613 930 ----1421
NM_001031803chr171223 ------
NM_001031804chr162540 237 ----13432
NM_001031812chr562101 1735 879 705 680 50 ----11669
NM_001032221chr951577 1361 717 128 92 --31238 1235 1232 --
NM_001032279chr111311 --1279 --
NM_001032280chr611343 --4118 115 112 100 1104
NM_001032282chr8----1331 --
NM_001032288chr2011321 --51339 1230 1227 1224 349 --
NM_001032293chr171501 --159 --
NM_001032296chr1352636 2517 1065 932 169 12290 12442 --
NM_001032367chr153462 442 431 ------
NM_001033057chr331578 1367 352 ------
NM_001033059chr62432 237 ------
NM_001033081chr161907 1821 1702 1540 628 217 11497 11705 --
NM_001033082chr161907 1821 1702 1540 628 217 11497 11705 --
NM_001033085chr2153 ------
NM_001033087chr2063259 2449 1314 1038 907 788 --13105 --
NM_001033117chr3104781 4519 4431 4378 4246 4227 3509 1507 1014 747 11557 ----
NM_001033506chr112408 163 --197 --
NM_001033507chr121880 611 --1130 --
NM_001033518chr722787 2423 ----172
NM_001033519chr722787 2423 ----172
NM_001033520chr722787 2423 ----172
NM_001033551chr1793931 3332 3236 2966 1601 1290 910 752 475 --43093 2851 1296 1293 --
NM_001033557chr21341 --2134 131 --
NM_001033566chr171985 --1661 --
NM_001033568chr171985 --1661 --
NM_001033578chr81183 1543 ----
NM_001033602chr1392692 2463 2345 2121 1726 1057 978 873 386 ------
NM_001033723chr842534 522 273 197 ------
NM_001033756chr62727 423 ----1217
NM_001033756chr62727 423 ----1217
NM_001034833chr51292 ------
NM_001034837chr53774 327 273 ------
NM_001034838chr53774 327 273 ------
NM_001034845chr42505 199 ------
NM_001034852chr1441762 1472 424 339 --1396 --
NM_001034954chr1063247 1205 967 610 463 340 ------
NM_001034955chr1063247 1205 967 610 463 340 ------
NM_001034956chr1063247 1205 967 610 463 340 ------
NM_001034957chr1063247 1205 967 610 463 340 ------
NM_001035254chr952474 1932 821 774 313 ------
NM_001035256chr2177 ------
NM_001035267chr121288 ------
NM_001035511chr151465 1344 693 475 323 11608 ----
NM_001035512chr151572 1451 800 582 430 11715 ----
NM_001035513chr151572 1451 800 582 430 11715 ----
NM_001035521chr21512 ------
NM_001035534chr941004 440 333 23 --11188 --
NM_001037132chr721713 111 ------
NM_001037133chr721713 111 ------
NM_001037164chr741818 1770 1374 152 --11938 --
NM_001037172chr351386 1034 925 911 168 ------
NM_001037317chr132779 2293 2154 ----12377
NM_001037331chr18----1345 --
NM_001037334chr1842278 712 320 200 --3500 476 384 1867
NM_001037339chr12716 229 11219 1232 --
NM_001037340chr12716 229 11219 1232 --
NM_001037341chr12716 229 11219 1232 --
NM_001037341chr12716 229 11219 1232 --
NM_001037637chr5--151 ----
NM_001037738chr52299 207 ------
NM_001037954chr11151 1327 1570 1837
NM_001038493chr211343 --11064 --
NM_001038702chr551919 1723 830 774 508 --21949 462 1529
NM_001038707chr122040 68 --22064 704 --
NM_001038707chr122040 68 --22064 704 --
NM_001039140chr204429 383 160 67 ------
NM_001039459chr721168 898 ----1856
NM_001039465chr142514 489 ------
NM_001039479chr1422376 1752 11508 31808 1684 1681 1259
NM_001039538chr23977 882 355 --13673 --
NM_001039547chr353215 2649 1810 1723 1406 ------
NM_001039550chr22713 680 ------
NM_001039574chr121068 1020 --21060 717 --
NM_001039577chr163881 695 380 250 140 21 --31179 1161 1143 --
NM_001039585chr154241 4219 3738 212 146 13779 13684 1216
NM_001039590chrX63243 2779 2589 644 370 157 --63785 3113 3110 3107 2471 1412 --
NM_001039591chrX63243 2779 2589 644 370 157 --63785 3113 3110 3107 2471 1412 --
NM_001039618chr1155381 5046 4703 1394 1367 --34690 1471 329 11617
NM_001039671chr19126 1209 438 35 32 29 --
NM_001039672chr19126 1209 438 35 32 29 --
NM_001039673chr19126 1209 438 35 32 29 --
NM_001039690chr1631826 1563 1511 ------
NM_001039711chr12962 728 --11118 --
NM_001039712chr12962 728 --11118 --
NM_001039716chr12897 288 --143 --
NM_001039771chr1441211 966 876 231 ------
NM_001039772chr113542 504 23 1519 ----
NM_001039802chr11364 ------
NM_001039840chrX42428 1767 317 89 --46019 5391 4579 711 --
NM_001039888chr11722 --1601 --
NM_001039916chr121799 ------
NM_001039917chr121799 ------
NM_001039918chr121799 ------
NM_001039919chr121799 ------
NM_001039920chr121799 ------
NM_001039937chr1311228 1900 11018 13809
NM_001040001chr611912 ------
NM_001040056chr162697 32 ------
NM_001040057chr731139 995 174 --1182 --
NM_001040092chr8------1362
NM_001040100chr3----146 --
NM_001040101chr44474 363 273 157 --1137 --
NM_001040113chr162936 910 ------
NM_001040135chr72732 525 2808 258 1103 --
NM_001040142chr231500 566 406 ----12157
NM_001040143chr231500 566 406 ----12157
NM_001040144chr1631826 1563 1511 ------
NM_001040146chr1631826 1563 1511 ------
NM_001040152chr745071 3659 3116 312 --33615 1516 173 15122
NM_001040153chr13----1973 --
NM_001040167chr731193 171 65 --1806 11173
NM_001040181chr3----2463 427 --
NM_001040182chr3----2463 427 --
NM_001040183chr3----2463 427 --
NM_001040199chr3----2463 427 --
NM_001040200chr3----2463 427 --
NM_001040260chr461014 891 829 240 80 32 ------
NM_001040261chr461014 891 829 240 80 32 ------
NM_001040284chr1684841 4267 3625 1078 1020 888 731 230 ------
NM_001040402chr453006 1006 897 191 164 --3265 92 71 --
NM_001040424chr2133000 2668 916 ------
NM_001040429chr1343608 2764 1156 1117 --22525 111 --
NM_001040441chr133928 707 177 --1193 --
NM_001040450chr1522330 221 ----12397
NM_001040453chr1522330 221 ----12397
NM_001040455chr11178 --2975 248 --
NM_001040458chr541172 1156 208 81 1154 21340 1175 --
NM_001040624chr862634 2476 2461 1757 708 34 ------
NM_001040625chr862634 2476 2461 1757 708 34 ------
NM_001040626chr862634 2476 2461 1757 708 34 ------
NM_001040627chr862634 2476 2461 1757 708 34 ------
NM_001040628chr862634 2476 2461 1757 708 34 ------
NM_001040629chr862634 2476 2461 1757 708 34 ------
NM_001040630chr862634 2476 2461 1757 708 34 ------
NM_001040633chr72749 236 ------
NM_001040653chr311895 1897 ----
NM_001040694chr1141059 915 160 83 1853 1360 --
NM_001040708chr8160 ------
NM_001040709chr152570 2521 2356 306 148 ------
NM_001040712chr942657 881 684 357 ----1885
NM_001040875chr811929 --12398 --
NM_001042355chr1623536 1145 --25369 3984 --
NM_001042388chr183802 644 622 --1821 --
NM_001042412chr1623536 1145 --25369 3984 --
NM_001042413chr943982 942 552 188 12939 33454 436 45 --
NM_001042425chr611343 --4118 115 112 100 1104
NM_001042453chrX11516 ------
NM_001042475chr6----148 --
NM_001042481chr1421734 616 12437 ----
NM_001042492chr1753247 3154 183 140 98 11247 --11259
NM_001042494chr1543775 2542 852 531 --23132 2962 --
NM_001042495chr1543775 2542 852 531 --23132 2962 --
NM_001042496chr1543775 2542 852 531 --23132 2962 --
NM_001042497chr1543775 2542 852 531 --23132 2962 --
NM_001042506chrX21128 905 --1466 --
NM_001042510chr852169 2054 1352 541 77 --1141 --
NM_001042511chr852169 2054 1352 541 77 --1141 --
NM_001042533chr31551 ------
NM_001042537chrX31996 593 462 --2964 888 12285
NM_001042555chr1254727 1353 1290 1061 885 --24026 606 --
NM_001042599chr255961 5551 5135 5065 287 14880 17269 16653
NM_001042601chr3----43083 706 400 376 1260
NM_001042603chr1243870 3797 1535 755 13997 42038 1040 995 95 --
NM_001042604chr384802 4480 4231 3996 3527 591 563 538 --34263 3548 159 --
NM_001042616chr42212 23 ------
NM_001042632chr2052531 1741 472 452 258 ------
NM_001042633chr2052531 1741 472 452 258 ------
NM_001042669chr42607 321 11878 1519 --
NM_001042728chr1211016 --1803 --
NM_001042749chrX--1250 ----
NM_001042750chrX--1250 ----
NM_001042751chrX--1250 ----
NM_001043318chr1494007 3932 3758 3335 1189 1031 1000 778 395 --33479 1104 771 --
NM_001043351chr152170 2065 1431 875 114 --3588 28 25 --
NM_001044305chr631320 1219 259 --21323 508 --
NM_001044385chr2113200 3167 3153 2996 2930 2716 1423 1211 1015 946 605 --32818 1171 166 --
NM_001044722chr562101 1735 879 705 680 50 ----11669
NM_001044723chr562101 1735 879 705 680 50 ----11669
NM_001046chr522997 149 --13000 12262
NM_001049chr141121 --12498 --
NM_001077628chr11510 ------
NM_001079874chr152010 1896 1761 264 113 ------
NM_001083620chr422446 113 ------
NM_001095chr1251336 676 629 344 271 --11612 --
NM_001106chr3137817 7247 6953 6644 3686 3397 3322 3105 2971 2441 2382 970 408 1115 79656 9351 8024 7786 6956 1288 1285 19355
NM_001109977chr43574 220 79 ------
NM_001113490chrX11128 --22963 427 --
NM_001116chr1642575 2482 2097 68 ------
NM_001117chr1842126 1927 571 331 12207 ----
NM_001119chr441321 1297 1228 1039 --1994 --
NM_001121chr1011619 ------
NM_001122chr9128 ------
NM_001122679chr51107 ----11260
NM_001124chr11----1468 --
NM_001126chr1----2231 222 --
NM_001128chr1683984 3832 3553 3433 2631 1424 598 207 ----12856
NM_001135chr151714 ------
NM_001143chrY146 ------
NM_001146chr82485 277 ------
NM_001148chr432060 1779 384 ------
NM_001149chr1041265 1007 489 114 ----2943 283
NM_001154chr4128 ------
NM_001157chr10------1233
NM_001167chrX26710 5544 --22617 2614 --
NM_001173chr1444673 3115 1553 241 23532 1842 31556 1216 244 --
NM_001174chrX2142 37 ------
NM_001187chr213420 190 149 ------
NM_001191chr2041271 1185 983 538 ------
NM_001204chr277758 7523 6554 6419 5966 5043 1861 11257 ----
NM_001206chr923070 468 ------
NM_001207chr5--151 ----
NM_001222chr1051773 693 650 600 194 ------
NM_001227chr1021355 151 ------
NM_001233chr7195 --1646 --
NM_001235chr111442 ----1644
NM_001238chr19164 ----1492
NM_001241chr251674 956 860 634 381 1979 51907 450 230 200 197 --
NM_001241chr251674 956 860 634 381 1979 51907 450 230 200 197 --
NM_001249chr141151 ------
NM_001253chr61290 ------
NM_001256chr1721849 369 1187 22669 2666 --
NM_001257chr1631327 995 588 ------
NM_001259chr7106354 5601 2384 1981 1819 1186 315 286 271 118 --46380 5470 4467 2340 --
NM_001260chr13241 32 ------
NM_001270chr51194 ------
NM_001271chr1573244 3049 2836 2235 1098 981 415 --3478 115 112 --
NM_001274chr11------145
NM_001278chr102996 465 --1973 145
NM_001282chr1762601 2329 851 269 81 33 --1233 1237
NM_001284chr5----2173 170 --
NM_001290chr41744 --1747 --
NM_001299chr19142 --248 45 --
NM_001304chr1753641 3020 2984 1411 890 --31414 810 807 --
NM_001310chr1222566 963 --32438 1946 694 --
NM_001312chr142486 319 --1472 --
NM_001313chr41678 ------
NM_001315chr67803 700 689 655 469 300 94 ------
NM_001316chr201348 --1140 1352
NM_001328chr41528 ------
NM_001329chr1061593 1459 657 536 343 130 ------
NM_001331chr1142867 2725 389 272 12178 22625 705 --
NM_001332chr5----11080 --
NM_001343chr51128 ------
NM_001345chr12184 ------
NM_001351chr3135 ------
NM_001356chrX22446 220 ----11780
NM_001364chr1133563 864 93 ------
NM_001365chr171753 ------
NM_001385chr81168 ------
NM_001387chr523113 309 11956 1724 12060
NM_001390chr1853367 3250 3137 2268 927 13209 1374 23522 378
NM_001392chr18155 --1231 --
NM_001396chr2122555 81 11777 12268 --
NM_001399chrX83537 2984 1244 1189 658 406 316 103 --43729 1319 409 78 12743
NM_001406chr1761631 1593 1546 1504 1213 134 ------
NM_001408chr12669 421 --11627 --
NM_001417chr1211526 --1163 --
NM_001418chr111300 ----144
NM_001418chr111300 ----144
NM_001419chr1931949 1802 1571 13464 23256 3253 1752
NM_001420chr1932563 1928 246 ------
NM_001427chr72389 267 --11880 --
NM_001430chr231826 1723 417 ------
NM_001431chr6----2398 379 --
NM_001438chr132313 2252 782 12705 1534 --
NM_001440chr84998 928 728 657 11973 22514 743 --
NM_001448chrX11756 ------
NM_001449chrX1420 ------
NM_001453chr611760 --21723 1720 --
NM_001455chr654777 4341 3983 3059 1320 --23439 3143 --
NM_001457chr32344 41 --31276 126 50 --
NM_001458chr71713 ------
NM_001463chr2------2784 290
NM_001483chr72905 109 ------
NM_001493chrX126 --1572 --
NM_001497chr952669 2568 935 799 51 ----1400
NM_001498chr611226 --1868 --
NM_001508chr2--1943 ----
NM_001518chr72789 764 --11095 --
NM_001521chr21512 ------
NM_001523chr19158 ------
NM_001527chr654737 4089 3948 3399 3195 24048 3701 23632 472 --
NM_001542chr192850 2804 2619 2299 2036 1847 908 850 837 --12003 --
NM_001546chr61249 --11077 --
NM_001570chr331406 1262 119 ----11179
NM_001584chr111832 --11119 --
NM_001587chrX52078 2025 1789 383 293 12203 ----
NM_001604chr11--1106 ----
NM_001610chr112648 206 --3798 72 69 --
NM_001614chr172710 31 1520 1174 --
NM_001614chr172710 31 1520 1174 --
NM_001616chr222969 909 2610 53 72606 2603 798 511 508 445 151 --
NM_001618chr12282 90 ------
NM_001619chr112423 166 ------
NM_001620chr112830 810 ------
NM_001621chr72968 224 ----2989 796
NM_001621chr72968 224 ----2989 796
NM_001634chr62432 237 ------
NM_001635chr721070 1030 ------
NM_001650chr1824114 3050 --23053 2587 --
NM_001654chrX195 ------
NM_001655chr1141686 650 554 319 1225 ----
NM_001656chr52473 412 ----11485
NM_001658chr11129 11029 ----
NM_001659chr1232353 335 198 12409 22126 2123 --
NM_001660chr32671 135 --1679 1166
NM_001662chr71393 ------
NM_001663chr1452327 2026 789 464 428 1268 1860 --
NM_001664chr3----149 --
NM_001665chr111394 ------
NM_001668chr15799 740 484 159 144 --1854 --
NM_001674chr13993 738 483 ------
NM_001677chr13859 422 314 ------
NM_001679chr32195 186 ------
NM_001681chr121261 ------
NM_001682chr1232021 1079 545 22439 407 1399 --
NM_001683chr31737 --1181 --
NM_001684chr164194 3947 1441 775 427 101 --13622 13611
NM_001690chr332411 1690 656 --12017 --
NM_001693chr83256 226 153 --2498 495 --
NM_001699chr1931768 1446 321 ------
NM_001701chr911004 11432 ----
NM_001702chr8----148 --
NM_001704chr61560 ------
NM_001707chr73595 319 73 ------
NM_001709chr1162600 2328 2085 942 816 249 --32649 503 306 --
NM_001716chr1121170 398 --127 --
NM_001718chr611151 --1935 --
NM_001722chr8143 --1217 --
NM_001730chr1331496 1390 209 --11499 11212
NM_001730chr1331496 1390 209 --11499 11212
NM_001742chr72738 698 --1171 --
NM_001743chr21211 ------
NM_001746chr522924 957 ------
NM_001748chr141080 928 770 438 ------
NM_001753chr721195 1144 181 ----
NM_001755chr162728 72 --12058 --
NM_001759chr1244679 4445 3755 611 21699 626 --11771
NM_001773chr121261 502 --11417 --
NM_001777chr344076 2573 1082 756 ----24017 3712
NM_001791chr11364 ------
NM_001797chr16----1765 --
NM_001798chr1221002 385 ------
NM_001800chr192391 100 ------
NM_001802chr162875 831 ------
NM_001821chr133798 877 408 21168 400 21457 25 --
NM_001823chr14----134 --
NM_001826chr1183 1312 1336 --
NM_001827chr91273 ------
NM_001829chr4----4980 977 952 358 --
NM_001830chrX32991 1419 247 11550 --1453
NM_001834chr5163 195 ----
NM_001838chr171102 ------
NM_001839chr13722 693 191 ------
NM_001842chr91564 ------
NM_001845chr131420 11373 --11327
NM_001854chr11282 ------
NM_001858chr661808 1692 1374 1331 826 91 --13857 --
NM_001859chr933953 3534 3154 ------
NM_001860chr921124 238 ------
NM_001876chr111496 ------
NM_001892chr531520 1167 177 ------
NM_001895chr2041177 801 339 121 ------
NM_001896chr16126 --1295 --
NM_001903chr52612 590 ------
NM_001904chr321035 361 --1281 --
NM_001915chr1741604 713 408 229 1189 22062 140 --
NM_001918chr157792 7559 6407 3428 3315 --38192 8153 2115 --
NM_001921chr43860 514 331 157 ----
NM_001923chr112267 53 ------
NM_001933chr1441206 1118 946 414 --2511 110 --
NM_001935chr21257 ------
NM_001938chr121916 418 ------
NM_001939chrX53635 2349 1526 791 269 12744 23680 886 --
NM_001940chr121355 --1108 --
NM_001946chr123351 207 76 ------
NM_001949chr652755 2494 693 652 335 ----12498
NM_001967chr3138 --141 1521
NM_001968chr41837 ------
NM_001969chr1473561 3005 2985 2584 1034 661 38 ------
NM_001970chr171405 ------
NM_001977chr41580 --21413 1410 --
NM_001978chr81862 --143 --
NM_001981chr122337 579 ------
NM_001991chr1712089 --172 1839
NM_001995chr431275 380 192 --1403 --
NM_001999chr51961 1369 ----
NM_002006chr433631 1688 1393 11060 21119 754 45647 5606 5073 220
NM_002009chr15--1377 1649 --
NM_002010chr131107 ------
NM_002014chr121627 ------
NM_002015chr13----1222 --
NM_002017chr1111079 1958 ----
NM_002024chrX21608 758 ------
NM_002025chrX38326 7117 6716 13183 22572 2569 --
NM_002026chr21988 1839 ----
NM_002027chr8----1156 1160
NM_002028chr1421265 1113 11032 ----
NM_002031chr62831 593 ------
NM_002035chr1842923 2476 1164 946 --1617 156
NM_002037chr6182 ------
NM_002040chr2112988 1742 32821 418 406 --
NM_002044chr15--1114 ----
NM_002051chr101254 ------
NM_002056chr22708 281 1896 ----
NM_002063chrX21254 343 ------
NM_002072chr911000 1876 ----
NM_002074chr151556 1269 1161 623 203 --21283 1164 --
NM_002076chr1253258 2927 2368 2095 647 --12594 --
NM_002077chr922104 721 1368 --1249
NM_002080chr161710 ----1935
NM_002086chr1721987 425 --41690 1652 488 239 --
NM_002091chr181183 1268 ----
NM_002092chr455058 3777 3143 1647 529 13068 23620 1619 --
NM_002103chr1911053 --170 --
NM_002107chr1----1488 --
NM_002111chr4123857 3457 3374 3297 2644 1395 648 380 366 322 307 253 --21398 1078 --
NM_002126chr1733145 756 543 --1595 14124
NM_002128chr1342524 2445 2263 415 ------
NM_002129chr41333 ------
NM_002131chr621184 315 --11025 11029
NM_002136chr12--1113 ----
NM_002137chr741915 1711 592 479 --32419 843 726 --
NM_002140chr9----1179 --
NM_002146chr172948 168 ------
NM_002147chr172850 643 ------
NM_002148chr21181 ------
NM_002156chr21179 ------
NM_002157chr2138 ------
NM_002158chr233492 2635 1500 ----1168
NM_002181chr2134 --1535 --
NM_002193chr2------11879
NM_002199chr42275 139 ------
NM_002202chr5----1398 --
NM_002203chr511071 --2518 56 --
NM_002205chr122986 915 ------
NM_002207chr3----2494 117 --
NM_002214chr754604 2057 350 176 114 24782 1461 ----
NM_002221chr151983 596 399 368 283 ----1390
NM_002222chr311126 --1481 --
NM_002223chr1243506 3078 1572 943 13447 33736 3733 989 --
NM_002226chr141750 1219 ----
NM_002227chr12863 391 --11145 --
NM_002232chr1124 --1153 --
NM_002239chr2--1821 ----
NM_002241chr132101 1971 1130 ------
NM_002242chr211291 --21569 254 --
NM_002247chr1031778 808 600 ------
NM_002264chr344519 3230 1541 1108 --31966 1512 811 --
NM_002265chr17--1193 ----
NM_002267chr1322308 785 12465 1765 --
NM_002268chr331641 1209 597 --1134 --
NM_002270chr575555 1978 1867 1210 988 973 171 ------
NM_002271chr1332342 983 158 ----12012
NM_002285chr222926 1165 --22710 2655 --
NM_002293chr122680 2572 1230 32202 2157 109 --
NM_002296chr131688 1134 90 ------
NM_002298chr132603 453 --11510 --
NM_002309chr2272335 2193 1941 1039 421 117 23 1809 ----
NM_002310chr596187 5099 4934 4213 2572 2346 1207 1156 695 16529 --36383 1903 60
NM_002313chr1075059 5022 4768 4646 1787 1248 968 --11008 --
NM_002319chr71825 1343 ----
NM_002332chr121219 ------
NM_002334chr1151885 1317 710 680 151 ------
NM_002336chr1231564 1365 740 11587 64791 4326 895 612 609 207 --
NM_002355chr121991 --21018 483 --
NM_002356chr612807 --12061 --
NM_002359chr17104265 3386 3316 3162 2884 1702 1510 1336 966 293 --33935 3186 3165 --
NM_002360chr721006 412 --22622 2506 --
NM_002373chr1521341 845 --11295 --
NM_002374chr23977 882 355 --13673 --
NM_002375chr372216 1995 1861 1803 749 715 687 ------
NM_002380chr8----1380 --
NM_002384chr181965 ------
NM_002397chr521602 312 22086 399 ----
NM_002398chr21956 ------
NM_002399chr1511281 ----11353
NM_002401chr1792497 2239 1815 747 676 591 76 55 39 --32130 79 58 --
NM_002428chr1611179 ------
NM_002430chr2262415 2014 1010 980 943 415 --1372 --
NM_002436chrX2480 85 ------
NM_002442chr1221449 169 ------
NM_002444chrX41797 1289 1256 591 ------
NM_002460chr633739 1242 1046 --23526 2581 --
NM_002473chr2251314 1241 1124 188 102 --1463 --
NM_002478chr111482 ------
NM_002480chr1231129 606 246 ------
NM_002481chr176493 5747 5281 5185 2791 1627 46 12461 45328 3135 2010 310 11631
NM_002489chr72299 26 ------
NM_002494chr4149 ------
NM_002499chr1562429 2378 1728 833 628 332 1597 31878 764 637 --
NM_002500chr22881 96 --11195 --
NM_002501chr191627 --11319 --
NM_002509chr201577 ------
NM_002515chr1431536 1381 637 ------
NM_002518chr241083 929 336 167 ------
NM_002519chr111584 --1145 --
NM_002522chr1732871 898 261 --1743 --
NM_002530chr15135 ------
NM_002538chr51128 ------
NM_002539chr21248 ------
NM_002541chr72866 749 ------
NM_002545chr1164605 3462 3455 1893 1807 1718 ------
NM_002546chr8123 ------
NM_002567chr124730 721 156 65 --2745 598 --
NM_002577chr374023 3643 3517 2752 940 562 454 --12971 --
NM_002578chrX162 ------
NM_002581chr945204 4857 672 78 14005 55530 5346 1279 1276 854 1840
NM_002582chr163902 372 34 --1271 --
NM_002583chr12186 ------
NM_002588chr521624 237 ------
NM_002594chr2021699 716 1408 22424 719 --
NM_002595chr1221922 433 --11577 1322
NM_002600chr12716 229 11219 1232 --
NM_002607chr721124 1034 ------
NM_002608chr2221223 53 ------
NM_002612chr7----2688 55 --
NM_002613chr16164893 4884 4590 4339 4069 3679 3311 2089 1721 1480 1203 1163 978 907 629 399 --34204 1724 1206 --
NM_002618chr2------1128
NM_002628chr3----11123 1991
NM_002645chr111151 1458 1221 --
NM_002648chr621065 955 --1507 --
NM_002655chr845277 4748 3953 1958 14034 13371 25225 4445
NM_002656chr61877 1271 ----
NM_002657chr2063437 3269 3226 1468 1068 449 1629 ----
NM_002660chr2041165 974 744 37 ------
NM_002670chr321646 346 --1262 11214
NM_002687chr14189 ------
NM_002698chr1912395 ------
NM_002699chr12317 87 ------
NM_002709chr212702 --33079 3076 362 --
NM_002710chr121732 --1794 --
NM_002715chr5----1955 --
NM_002716chr1133387 3077 899 --13583 1652
NM_002717chr81612 ------
NM_002721chr91111 --1101 --
NM_002730chr1941340 1065 518 190 --11375 --
NM_002731chr122880 1147 --1387 --
NM_002732chr92480 186 --1322 --
NM_002734chr172412 139 --11971 1229
NM_002736chr722138 1773 ------
NM_002737chr17115007 4714 4660 2199 2041 1884 1876 1847 903 734 292 --11804 15106
NM_002739chr192727 494 ------
NM_002742chr141704 1117 ----
NM_002745chr2234068 3515 544 --33531 1687 274 --
NM_002747chr1821839 97 ------
NM_002748chr151779 ------
NM_002752chr5----1413 --
NM_002753chr43744 351 125 ------
NM_002755chr15----2800 323 --
NM_002756chr173974 260 130 --3977 306 237 --
NM_002806chr141243 ------
NM_002811chr162204 145 ----167
NM_002813chr1231451 1330 1283 --21471 487 --
NM_002814chrX1277 ------
NM_002821chr61809 ------
NM_002823chr21599 --1602 --
NM_002827chr2021755 570 ------
NM_002830chr21142 --171 --
NM_002834chr1263553 3092 2771 1411 899 694 22505 1386 23850 814 --
NM_002835chr71242 ------
NM_002839chr942657 881 684 357 ----1885
NM_002840chr161556 1433 1234 591 269 105 ------
NM_002843chr1113395 --23388 1328 12328
NM_002844chr62333 65 ------
NM_002845chr181446 --1184 --
NM_002848chr1221308 1184 --1832 --
NM_002849chr1221032 360 1434 ----
NM_002850chr1921035 912 ------
NM_002852chr31244 ------
NM_002855chr1133468 3393 2663 --43451 3448 3382 450 --
NM_002859chr1211154 ------
NM_002866chr192530 441 ------
NM_002867chr12546 132 ----1136
NM_002868chr122846 185 ------
NM_002869chr1152226 2078 1555 535 133 ------
NM_002874chr922365 936 --2502 499 12248
NM_002880chr33318 156 110 ----1114
NM_002886chr324354 1064 --24231 3284 --
NM_002890chr51351 ------
NM_002892chr1441452 389 170 35 ------
NM_002893chrX----1301 --
NM_002897chr25751 635 628 524 209 --1509 --
NM_002906chr11----12122 --
NM_002912chr62701 625 ------
NM_002924chr11100 ------
NM_002931chr61206 ------
NM_002941chr31223 ------
NM_002942chr321059 28 ------
NM_002950chr3148 ------
NM_002951chr20----1250 --
NM_002959chr123556 1032 1990 31035 1020 122 --
NM_002968chr162287 276 ----1808
NM_002970chrX1135 --175 --
NM_002971chr311134 ------
NM_002972chr22124 ------
NM_002973chr12----1228 --
NM_002994chr411453 1315 --1247
NM_002996chr1641624 1399 433 336 --1250 --
NM_002997chr221516 1313 ------
NM_002998chr832170 776 325 ------
NM_002999chr2021788 1414 --11201 --
NM_003001chr151572 1451 800 582 430 11715 ----
NM_003010chr1741950 1677 805 647 --21738 541 --
NM_003011chr921484 1277 ------
NM_003013chr42195 102 ------
NM_003016chr1731674 1653 203 11639 2252 118 --
NM_003017chr641277 471 437 124 ------
NM_003026chr921355 1147 --31261 257 73 --
NM_003028chr963789 3154 2908 2793 2587 1217 --3786 151 87 --
NM_003030chr3171 ------
NM_003031chr16--1140 ----
NM_003037chr12204 102 ------
NM_003043chr32986 427 1824 140 --
NM_003046chr855135 5000 771 665 104 11890 25357 2076 --
NM_003047chr141437 1424 1120 62 --21362 929 --
NM_003051chr131716 1581 621 --11866 --
NM_003063chr112147 77 ------
NM_003069chrX1733 --1574 --
NM_003071chr31689 --11964 --
NM_003072chr192296 282 ------
NM_003075chr121248 ------
NM_003076chr123598 517 58 --1112 --
NM_003077chr173763 306 106 --1163 --
NM_003081chr202922 33 1447 31011 885 320 --
NM_003087chr10----1225 --
NM_003091chr20----195 --
NM_003093chr6----170 --
NM_003107chr632292 1787 878 ------
NM_003108chr287085 6926 6237 4908 4737 1668 1004 448 11261 ----
NM_003111chr211147 ------
NM_003112chr7133 12696 12894 --
NM_003127chr9253 32 ------
NM_003128chr242458 2447 1140 500 --1318 --
NM_003131chr641715 685 517 57 --1233 --
NM_003136chr141385 ------
NM_003137chr632167 1817 463 ------
NM_003144chr61524 11562 4743 562 559 316 --
NM_003150chr1732378 2268 2237 ------
NM_003155chr822483 1922 --11861 12404
NM_003156chr114937 323 271 230 --2274 233 --
NM_003161chr1722402 1133 --43328 2714 1054 314 --
NM_003162chr231087 190 31 ------
NM_003164chr113532 505 69 ------
NM_003173chrX41086 397 379 67 ------
NM_003178chr32238 101 --31458 868 865 --
NM_003179chrX11330 --1123 --
NM_003188chr62609 133 1332 ----
NM_003189chr142390 952 527 47 ------
NM_003194chr62234 221 ------
NM_003199chr1834977 4925 1026 14934 21322 889 --
NM_003202chr5151 1750 ----
NM_003204chr1721579 272 11274 11803 --
NM_003211chr122560 33 --21398 1192 --
NM_003220chr611343 --4118 115 112 100 1104
NM_003221chr633737 3507 3182 14146 11367 --
NM_003223chr16----2532 529 --
NM_003224chr203978 849 675 --176 --
NM_003247chr651665 1276 1232 795 465 --1798 --
NM_003250chr171189 ------
NM_003255chr1762473 1928 1713 990 846 802 ------
NM_003257chr1521269 1183 ------
NM_003262chr321345 1053 ----13736
NM_003263chr4----145 --
NM_003269chr641169 1110 826 242 ------
NM_003275chr931454 1107 325 --21227 972 --
NM_003281chr184902 3617 3495 1765 1733 1557 809 533 --13498 --
NM_003297chr12121 ------
NM_003298chr385062 5012 2348 2229 2179 1794 1359 1145 14175 26187 5666 --
NM_003304chr311579 --21088 251 --
NM_003314chr51396 --147 155
NM_003317chr14184 ------
NM_003319chr21874 ------
NM_003325chr222446 124 ------
NM_003330chr122479 22 ------
NM_003336chrX2910 793 --1118 --
NM_003337chr51204 1405 ----
NM_003338chr10------1731
NM_003339chr51145 ------
NM_003340chr431068 885 87 ------
NM_003341chr33624 279 52 1593 ----
NM_003342chr1722784 2225 --13154 --
NM_003344chr761636 1450 1421 637 503 464 --11104 --
NM_003345chr16184 --3531 528 448 --
NM_003347chr2272338 2322 2211 2147 1867 775 501 --11845 --
NM_003348chr1221331 576 ------
NM_003349chr2011321 --51339 1230 1227 1224 349 --
NM_003369chr1132113 1740 837 --11125 --
NM_003370chr192616 184 ------
NM_003371chr93716 519 374 --1465 --
NM_003373chr1031632 444 85 --21211 479 1546
NM_003374chr51812 ------
NM_003376chr61489 ----1283
NM_003376chr61489 ----1283
NM_003378chr7169 ------
NM_003385chr21299 1838 ----
NM_003387chr24440 366 241 39 --1973 149
NM_003390chr112938 747 --2285 271 --
NM_003392chr334221 1611 1260 2755 530 22822 2819 --
NM_003400chr21638 --1685 --
NM_003405chr221190 --1799 --
NM_003406chr8168 ----1622
NM_003410chrX2553 108 ------
NM_003411chrY41620 1514 220 103 ------
NM_003412chr322367 1057 12027 --12531
NM_003413chrX11452 --11802 --
NM_003418chr32778 523 ------
NM_003423chr191445 --11053 --
NM_003439chr742822 2800 1281 398 --31360 1084 484 --
NM_003453chr131597 ----156
NM_003457chr171501 --159 --
NM_003458chr363957 3878 3578 3470 1565 49 --1276 --
NM_003459chr23671 564 66 ------
NM_003463chr63799 624 214 ------
NM_003467chr22384 318 ------
NM_003468chr264392 3957 3154 1300 453 280 1983 1101 --
NM_003469chr2--1170 ----
NM_003470chr163711 142 113 ------
NM_003471chr341788 1763 242 149 --2673 105 --
NM_003472chr621308 296 --21283 170 --
NM_003473chr10--1423 ----
NM_003474chr101149 ------
NM_003477chr111260 ------
NM_003478chr1163249 3065 2591 1244 1100 192 --3750 330 215 1412
NM_003482chr1252721 2091 1991 1903 909 --2706 376 --
NM_003483chr1232832 2201 239 --12665 --
NM_003487chr171277 --170 --
NM_003488chr172881 245 --1387 --
NM_003489chr2132974 2635 338 --12391 --
NM_003490chr2211047 ------
NM_003507chr241875 439 370 316 ------
NM_003508chr72295 29 ------
NM_003513chr6----127 --
NM_003528chr131641 298 46 --1262 --
NM_003557chr131395 1121 138 ------
NM_003558chr91259 --2217 214 --
NM_003563chr172967 933 --2207 56 --
NM_003564chr11482 ------
NM_003566chr1243041 2523 1062 421 --33452 413 410 --
NM_003567chr11280 ------
NM_003569chr61617 ------
NM_003574chr1854421 4149 2288 1660 1639 --45668 4324 365 23 24197 369
NM_003576chr1352636 2517 1065 932 169 12290 12442 --
NM_003580chr81476 1176 ----
NM_003583chr1283693 3515 2631 2516 2467 1126 732 701 --23776 830 --
NM_003586chr16171 ------
NM_003589chr131385 ------
NM_003590chr243070 3031 544 249 13296 2753 384 13550
NM_003591chr10----2423 124 --
NM_003603chr431941 427 162 ------
NM_003607chr134378 479 253 11655 11696 --
NM_003613chr15--1626 ----
NM_003615chr31445 --43666 3132 2664 95 --
NM_003620chr171203 --1933 1833
NM_003622chr1242275 1866 261 121 ------
NM_003624chr194919 488 392 32 --135 1528
NM_003629chr153400 3132 2268 672 456 23350 1142 --13042
NM_003630chr6----1672 --
NM_003632chr174822 592 310 241 --1777 --
NM_003633chr5102323 2057 1842 1662 1010 788 771 444 336 142 1646 1447 --
NM_003636chr151765 1696 1575 494 69 ------
NM_003637chr111449 --2486 158 --
NM_003642chr2153 ------
NM_003644chr1764944 4646 4531 1082 746 248 15065 54828 4634 4477 1326 1323 --
NM_003654chr112613 73 ------
NM_003659chr22298 288 --2833 311 --
NM_003663chr32388 321 --12341 --
NM_003664chr5165 ------
NM_003668chr122247 115 ------
NM_003670chr3292 81 21221 464 123 --
NM_003671chr961025 722 611 547 339 105 --23126 235 22381 1142
NM_003672chr121205 27 --2698 428 --
NM_003673chr17291 78 ------
NM_003677chr1252071 1599 1563 469 316 --21835 1832 --
NM_003684chr121012 851 --2890 712 --
NM_003685chr191782 ------
NM_003687chr53930 320 231 --11063 --
NM_003690chr21474 ------
NM_003692chr92919 645 ------
NM_003704chr43484 223 124 ------
NM_003705chr21190 ----1575
NM_003709chr22337 303 ------
NM_003710chr153462 442 431 ------
NM_003711chr5----1116 1120
NM_003713chr141532 1078 304 24 --161 --
NM_003714chr542320 2216 2204 417 ------
NM_003716chr31936 ------
NM_003718chr7----1186 --
NM_003722chr332656 2092 920 ------
NM_003728chr41270 ------
NM_003735chr521624 237 ------
NM_003736chr521624 237 ------
NM_003741chr31343 ------
NM_003744chr142986 475 --1236 --
NM_003749chr132582 89 --22352 224 --
NM_003750chr102706 223 --1956 --
NM_003758chr152184 35 21242 216 --1259
NM_003758chr152184 35 21242 216 --1259
NM_003760chr11628 ------
NM_003768chr141800 1483 1397 165 ------
NM_003769chr122272 49 ------
NM_003774chr1232682 2371 2056 --2185 182 --
NM_003780chr12545 74 ------
NM_003787chr18------1436
NM_003792chr91140 ------
NM_003794chr31336 --21089 1073 1845
NM_003795chr6181 --1226 --
NM_003799chr1864498 3186 792 584 156 121 --13369 13190
NM_003800chr62190 56 --11840 --
NM_003816chr8192 ------
NM_003818chr203914 812 292 --2827 824 --
NM_003819chr11200 ------
NM_003821chr8----158 --
NM_003822chr142971 2499 1230 1086 --1839 --
NM_003827chr191171 --1437 --
NM_003829chr931064 879 87 ----1793
NM_003831chr1841817 1794 1514 409 ------
NM_003835chr171257 ------
NM_003846chr11711 ------
NM_003870chr15----22081 1330 --
NM_003872chr242784 2336 1964 628 --11991 --
NM_003873chr102514 69 --1599 --
NM_003877chr121811 ----1981
NM_003885chr1731734 1666 1007 --32170 661 587 12102
NM_003893chr101469 ------
NM_003895chr2142204 1961 1923 1700 --12082 11604
NM_003902chr1------1707
NM_003907chr3----1334 --
NM_003908chr2041109 1092 1045 165 --21323 957 --
NM_003909chr841977 1201 377 314 --22432 1864 --
NM_003913chr622740 1073 --22625 379 --
NM_003916chrX21311 928 --11506 --
NM_003924chr41104 ------
NM_003927chr181947 ------
NM_003930chr71612 1478 --1227
NM_003931chr61262 ------
NM_003932chr2231653 672 591 ------
NM_003934chr91357 ------
NM_003936chr21794 187 1982 --
NM_003938chr1931132 823 160 ------
NM_003941chr742523 708 120 107 --11569 11701
NM_003942chr111727 ------
NM_003947chr32348 230 --11331 --
NM_003953chr162528 2304 1852 997 908 202 --1252 --
NM_003956chr10140 ------
NM_003957chr11146 --280 77 --
NM_003958chr693923 3883 3732 3044 2750 935 482 179 90 --33827 3824 3047 12445
NM_003968chr32634 93 ------
NM_003972chr10------131
NM_003980chr6----11074 --
NM_003983chr1654063 3122 1337 1070 383 13421 34036 849 671 --
NM_003988chr1041932 1456 868 53 ------
NM_003994chr1223035 1697 --33768 3765 3271 --
NM_004006chrX12371 ----11073
NM_004007chrX12371 ----11073
NM_004009chrX12371 ----11073
NM_004010chrX12371 ----11073
NM_004011chrX12371 ----11073
NM_004012chrX12371 ----11073
NM_004013chrX12371 ----11073
NM_004014chrX12371 ----11073
NM_004015chrX12371 ----11073
NM_004016chrX12285 ----1987
NM_004017chrX12371 ----11073
NM_004018chrX12285 ----1987
NM_004020chrX12371 ----11073
NM_004021chrX12285 ----1987
NM_004022chrX12285 ----1987
NM_004023chrX12285 ----1987
NM_004027chr2--128 ----
NM_004028chr1824114 3050 --23053 2587 --
NM_004037chr13835 712 73 ------
NM_004040chr22468 209 ------
NM_004050chr1432166 817 456 1443 31939 783 679 --
NM_004055chr1151394 902 690 298 123 --1693 --
NM_004061chr51438 ------
NM_004067chr72523 225 ------
NM_004068chr31107 ------
NM_004075chr12126 ------
NM_004085chrX154 ------
NM_004087chr3----11849 11853
NM_004090chr1723304 2657 1942 22116 724 --
NM_004093chr1343033 2756 286 248 21132 915 1769 --
NM_004097chr21263 --245 38 --
NM_004100chr622114 248 ----12292
NM_004102chr12574 558 ------
NM_004103chr81616 --2251 69 --
NM_004104chr171604 1139 2769 686 --
NM_004107chr192177 55 ------
NM_004112chr1761665 1647 642 543 176 91 ------
NM_004113chr32427 192 ------
NM_004114chrX11067 --154 --
NM_004115chr132144 125 ------
NM_004116chr24432 400 152 38 --141 --
NM_004124chr1423039 2842 ----12664
NM_004130chr32698 433 198 ----
NM_004133chr842038 1979 972 469 --1662 1116
NM_004136chr1513275 1867 11107 1978
NM_004156chr81237 ------
NM_004157chr32124 115 1865 --1348
NM_004161chr231418 1078 555 --1256 --
NM_004162chr31954 ------
NM_004169chr172552 86 1325 ----
NM_004170chr921789 1218 ----11852
NM_004171chr11109160 9001 7551 6764 6617 6358 6281 3477 1485 177 --21973 247 --
NM_004176chr171134 ------
NM_004177chr112359 22 ------
NM_004181chr41107 ------
NM_004185chr11688 1102 ----
NM_004186chr31901 ------
NM_004200chr1122915 732 ------
NM_004202chrY2696 124 ------
NM_004205chr11--1487 ----
NM_004211chr111169 ------
NM_004227chr752208 2096 1972 207 114 --2210 117 --
NM_004228chr191148 ------
NM_004232chr1843561 752 658 95 11302 23564 3041 1309
NM_004235chr91546 ------
NM_004236chr152455 229 --1161 --
NM_004238chr21280 ------
NM_004240chr19139 --142 --
NM_004241chr101228 ------
NM_004261chr11368 ------
NM_004263chr241797 1392 1313 472 ------
NM_004267chr31146 ------
NM_004272chr541993 1710 1366 1314 ------
NM_004274chr1452109 1052 781 751 251 12915 ----
NM_004281chr103384 209 104 ------
NM_004291chr5----1139 --
NM_004293chr91233 ------
NM_004294chr131701 ------
NM_004302chr1232942 701 360 ------
NM_004304chr21341 ------
NM_004305chr21371 --1433 --
NM_004311chr1062701 2509 1181 524 465 113 1972 21112 70 --
NM_004319chr1123 ----22220 1065
NM_004323chr952241 875 274 94 26 ------
NM_004326chr14489 315 127 61 ------
NM_004327chr2242181 2104 615 422 --21941 425 --
NM_004329chr101560 21286 134 ----
NM_004330chr152945 167 --21121 55 --
NM_004331chr822115 722 ------
NM_004338chr18117052 5525 5473 5295 4992 4643 2588 1889 1178 966 778 --117008 6996 4614 4611 4608 4605 4602 4599 4596 4345 1310 16637
NM_004341chr2141 ------
NM_004342chr71237 ------
NM_004346chr431052 290 102 --11401 --
NM_004349chr8----21234 381 --
NM_004352chr161574 --1517 --
NM_004365chr5132 ------
NM_004370chr641696 1468 758 660 --22125 27 --
NM_004379chr221291 1195 --1671 --
NM_004380chr1622559 2168 --2977 637 --
NM_004383chr151538 ------
NM_004384chr562101 1735 879 705 680 50 ----11669
NM_004385chr52671 458 ------
NM_004386chr1922232 859 ------
NM_004388chr1------182
NM_004392chr13----2778 266 --
NM_004393chr352165 1745 915 744 662 --1509 --
NM_004397chr1163957 1659 1578 1242 1172 1071 11635 ----
NM_004405chr21258 ------
NM_004408chr93489 446 56 ------
NM_004411chr74811 506 258 106 --2592 589 --
NM_004412chr1044426 3816 2267 1137 15663 35038 3756 1140 --
NM_004414chr2121092 173 --1132 --
NM_004416chr122946 735 ------
NM_004418chr21467 1109 ----
NM_004420chr1162140 2030 1830 1755 608 143 --11535 --
NM_004423chr342127 830 534 149 --12300 --
NM_004426chr123635 596 162 ------
NM_004429chrX21374 594 11184 21456 1082 --
NM_004430chr832294 1693 459 152 1757 --
NM_004431chr12687 67 ------
NM_004432chr921896 1484 ----1454
NM_004436chr11593 ------
NM_004438chr262115 1180 538 317 308 143 ------
NM_004440chr621449 465 --1627 181
NM_004443chr31546 ------
NM_004449chr2111423 --1536 --
NM_004451chr112711 220 ------
NM_004454chr362060 2039 1986 1910 1478 568 ------
NM_004457chr211716 --1505 --
NM_004458chrX3681 559 449 --31765 1010 1007 11980
NM_004459chr1741955 689 429 404 1569 --11579
NM_004464chr434317 3960 3507 --1510 --
NM_004468chr11514 ------
NM_004469chrX162 --149 --
NM_004481chr132579 904 797 12044 ----
NM_004484chrX127 1280 ----
NM_004487chr3------1931
NM_004491chr1933440 3027 296 --23882 3152 --
NM_004494chr1----143 --
NM_004498chr151286 ------
NM_004500chr142460 363 11492 ----
NM_004501chr134066 1640 1356 1651 1312 --
NM_004502chr172519 383 --1522 --
NM_004504chr252961 1945 653 397 276 ------
NM_004508chr1041120 877 815 755 ------
NM_004514chr1772959 2802 2654 2518 2510 1051 321 ------
NM_004516chr19180 --1888 --
NM_004520chr51668 ------
NM_004524chr172195 111 ------
NM_004525chr2----21521 1460 --
NM_004529chr911231 ------
NM_004530chr161307 --11021 --
NM_004535chr20----11625 --
NM_004540chr21----2193 190 --
NM_004554chr1451742 1570 1522 298 188 11731 21481 1478 --
NM_004571chr2142777 2366 2244 416 --22997 1300 13001
NM_004575chr431448 621 290 --21624 1457 --
NM_004576chr51324 ------
NM_004582chr11421 ------
NM_004586chrX85254 4989 4495 4242 4035 3317 2140 636 1750 53405 141 138 129 126 --
NM_004588chr1123652 818 ------
NM_004593chr31683 --1158 --
NM_004596chr19--1180 ----
NM_004598chr5----1109 --
NM_004602chr20----11172 --
NM_004603chr721094 59 --1447 --
NM_004612chr954617 4409 3104 1049 312 --13978 --
NM_004616chr12----151 --
NM_004620chr111242 ------
NM_004622chr222023 713 197 21940 1884 --
NM_004631chr131178 369 145 ------
NM_004634chr3----1442 --
NM_004639chr6194 ------
NM_004643chr143318 276 226 ------
NM_004651chrX1363 ------
NM_004654chrY11373 ------
NM_004655chr171262 --1419 --
NM_004656chr31908 --1502 --
NM_004657chr221279 30 ------
NM_004660chrY11521 ----11712
NM_004663chr1511433 ------
NM_004667chr152237 59 ------
NM_004673chr11988 ------
NM_004687chr1752087 2012 1911 1732 310 --11478 --
NM_004690chr6----1739 --
NM_004694chr17----1782 --
NM_004697chr921070 50 ------
NM_004698chr11171 ------
NM_004703chr1742579 1731 456 277 ------
NM_004719chr1212842 --1635 11161
NM_004723chr11395 ------
NM_004725chr1031446 428 206 2530 414 ----
NM_004726chrX84973 4917 4790 4691 3609 1688 1334 689 --23612 272 --
NM_004729chrX62163 1955 1743 1483 578 59 ------
NM_004730chr53441 364 294 --11464 --
NM_004734chr1321147 854 --1839 2858 316
NM_004736chr12835 578 --2841 838 --
NM_004737chr2241281 883 58 36 ------
NM_004739chr111654 ------
NM_004742chr321830 1338 ------
NM_004745chr846351 5560 2090 1315 14801 12115 12556
NM_004747chr1051499 1395 477 375 292 ------
NM_004748chr1523767 2687 1136 ----
NM_004755chr1421214 294 ------
NM_004759chr13472 425 296 --2575 39 --
NM_004765chr16125 ------
NM_004768chr1172 --1251 --
NM_004776chr2082965 2586 2461 1309 977 961 769 266 --13001 22840 965
NM_004779chr5------1377
NM_004788chr1122561 1838 22499 2446 21969 388 --
NM_004796chr1421867 256 --12163 --
NM_004798chr2043077 2648 2633 1466 13292 33029 2651 165 --
NM_004799chr1139 ------
NM_004801chr231549 1477 1083 --1266 --
NM_004826chr21296 ------
NM_004831chr192867 678 ----1197
NM_004834chr211313 12774 1238 --
NM_004835chr32657 228 ----1831
NM_004835chr32657 228 ----1831
NM_004836chr21245 ------
NM_004840chrX52344 2325 1893 1776 1763 --1199 --
NM_004841chr1------195
NM_004845chrX64006 3478 3413 3385 794 363 --13000 --
NM_004850chr221302 565 ------
NM_004856chr15------1438
NM_004857chr1424459 3246 1252 ----
NM_004859chr1742537 2414 2328 681 22373 1226 1850 --
NM_004860chr17291 43 ------
NM_004865chr62170 53 ------
NM_004871chr1763747 3526 1571 511 245 185 --12719 12834
NM_004879chr112856 383 ------
NM_004884chr1521773 374 --1437 --
NM_004887chr521073 263 --1407 --
NM_004890chr17164 ----168
NM_004898chr432670 607 157 12864 22733 803 11969
NM_004904chr776447 6406 6269 6048 5204 1542 452 11120 11177 --
NM_004905chr1124 2890 117 ----
NM_004906chr6------1237
NM_004911chr7----1489 --
NM_004912chr711135 ------
NM_004926chr141627 ------
NM_004938chr9----11260 --
NM_004945chr192852 227 ------
NM_004947chr352607 2254 1765 434 165 ------
NM_004949chr1822078 118 ------
NM_004953chr31346 --1385 --
NM_004956chr742900 1390 1062 142 13323 41114 952 742 568 --
NM_004965chr211523 --1562 --
NM_004968chr71274 --188 --
NM_004973chr661663 1590 1500 1390 1324 74 --11279 --
NM_004974chr1151 ------
NM_004976chr1153978 3613 1775 1279 248 ------
NM_004978chr121731 1683 --21723 1380 --
NM_004985chr1214465 ------
NM_004992chrX157619 7397 6961 6363 5313 3186 2810 2463 2176 1945 1384 1184 307 281 52 --15570 --
NM_004992chrX157619 7397 6961 6363 5313 3186 2810 2463 2176 1945 1384 1184 307 281 52 --15570 --
NM_004998chr152702 634 ------
NM_004999chr613059 --1680 11075
NM_005010chr721713 111 ------
NM_005016chr12----137 --
NM_005025chr3----1214 --
NM_005028chr1011535 ------
NM_005032chrX31015 292 270 --1840 --
NM_005044chrX64535 4481 4307 4238 3103 544 --13788 --
NM_005045chr7----147 --
NM_005054chr21273 --11390 --
NM_005056chr1244114 4041 1779 999 14241 31284 1239 339 --
NM_005063chr1063610 3386 3123 2965 937 394 ------
NM_005065chr1435091 4055 142 --45412 5409 3718 1753 --
NM_005066chr11757 ------
NM_005067chr31277 --1213 --
NM_005069chr212247 109 --11225 --
NM_005087chr31249 ------
NM_005088chrX2735 320 ------
NM_005094chr91125 ------
NM_005095chr122063 67 ----1623
NM_005099chr111129 --176 --
NM_005105chr152114 1344 461 298 87 ------
NM_005109chr31601 1646 158 --
NM_005110chr51540 ------
NM_005116chr2084159 3896 3791 3284 1719 1312 536 148 ------
NM_005117chr117842 669 650 269 257 223 32 ------
NM_005119chr121024 249 --11202 --
NM_005120chrX2203 163 ------
NM_005121chr1743735 3229 3110 596 ------
NM_005126chr31150 ----11712
NM_005133chr111311 --1279 --
NM_005134chr183802 644 622 --1821 --
NM_005135chr1543775 2542 852 531 --23132 2962 --
NM_005139chr4----1322 --
NM_005151chr1842278 712 320 200 --3500 476 384 1867
NM_005153chr163759 739 513 --1220 --
NM_005156chr945001 4296 3306 1969 --11563 --
NM_005174chr10146 ------
NM_005180chr1021188 389 11119 --21537 551
NM_005187chr16173 ----1153
NM_005188chr11107373 6918 6412 2879 2870 2806 2478 1899 1301 424 ----1774
NM_005194chr20----2446 443 --
NM_005197chr1475622 5193 5044 4436 2463 2353 243 1955 26061 5204 1736
NM_005198chr221184 ------
NM_005201chr331060 899 126 ------
NM_005202chr171633 1543 909 751 601 562 22 ------
NM_005207chr2263452 3177 2989 2717 965 303 --31399 383 26 --
NM_005208chr171110 ------
NM_005215chr18--1266 ----
NM_005219chr551530 630 540 270 239 --31608 475 144 --
NM_005221chr7----151 --
NM_005222chr71688 ------
NM_005225chr2021202 1108 ------
NM_005233chr332437 1641 879 ------
NM_005234chr192356 24 ------
NM_005235chr255961 5551 5135 5065 287 14880 17269 16653
NM_005238chr1123052 2723 --12407 --
NM_005241chr32428 218 ------
NM_005245chr42602 67 ------
NM_005249chr141776 ------
NM_005256chr111914 ------
NM_005273chr71227 ------
NM_005277chr411317 ------
NM_005284chr63459 390 369 ------
NM_005296chrX11068 1692 1155 --
NM_005311chr721066 896 --2978 181 --
NM_005316chr112348 316 ------
NM_005318chr2211259 ------
NM_005324chr1731796 1330 97 2373 203 1184 --
NM_005328chr8----1110 --
NM_005329chr1631552 1493 96 --11442 --
NM_005334chrX31203 699 119 --1191 --
NM_005339chr473582 3468 3056 1730 1669 953 388 --11672 33855 3831 3754
NM_005340chr51176 ------
NM_005342chrX32216 598 87 --22636 288 11785
NM_005347chr941596 169 145 21 11713 ----
NM_005349chr41255 ------
NM_005357chr19----3219 216 213 --
NM_005358chr1341706 623 52 29 --155 1599
NM_005359chr1866128 6113 4222 4009 2110 135 1799 36116 5365 4664 14002
NM_005374chr1761967 1960 944 468 324 215 --1647 1816
NM_005378chr22850 273 ------
NM_005387chr113662 614 62 --1190 --
NM_005392chr921722 1437 1214 ----
NM_005397chr753800 1425 1164 950 414 --21395 227 --
NM_005398chr10----21269 1151 --
NM_005399chr144341 4290 3492 3474 --23173 2885 --
NM_005400chr232747 819 33 ------
NM_005402chr71492 ------
NM_005406chr182275 86 --1130 --
NM_005407chr14----2560 24 11051
NM_005413chr21302 ------
NM_005426chr12771 367 ------
NM_005429chr4152 ------
NM_005430chr121263 ------
NM_005433chr1812181 12698 ----
NM_005436chr1083628 2728 1290 1228 1059 822 404 263 13509 11231 23367 2707
NM_005440chr1723278 1105 --23183 573 1848
NM_005442chr32623 168 ----1459
NM_005443chr4--1504 ----
NM_005455chr121540 1344 ----1539
NM_005458chr922458 66 ------
NM_005461chr2031685 393 386 ------
NM_005488chr223303 218 91 ------
NM_005493chr6------1557
NM_005497chr1765345 4897 4050 1442 891 367 --24676 113 --
NM_005499chr192262 174 ------
NM_005502chr973042 2963 2742 1304 841 654 563 ------
NM_005503chr1511120 ------
NM_005504chr1221946 67 15414 35229 4581 2632 --
NM_005507chr111340 ------
NM_005509chr521209 219 ------
NM_005523chr721586 480 ------
NM_005536chr8132 ------
NM_005537chr133788 433 62 --1742 --
NM_005539chr1051380 1324 1276 1095 554 ------
NM_005544chr2----1381 --
NM_005546chr531840 577 535 --31684 1530 525 1638
NM_005550chr163503 209 55 --1549 --
NM_005552chr142496 100 --1177 --
NM_005562chr141704 1670 1438 1239 --1344 --
NM_005563chr12895 240 1665 ----
NM_005565chr5144 ------
NM_005573chr51194 ------
NM_005578chr334683 3978 348 13822 14853 --
NM_005581chr191368 --1484 --
NM_005586chr6----1643 --
NM_005595chr12653 321 ------
NM_005596chr946381 5262 5170 1572 15847 ----
NM_005604chr632022 2003 698 --1436 --
NM_005610chr12808 599 ------
NM_005613chr131975 1665 123 ------
NM_005614chr71745 1966 ----
NM_005618chr61239 --2111 80 --
NM_005625chr82740 106 --1364 --
NM_005626chr1195 ------
NM_005627chr61297 ----1666
NM_005634chrX3234 146 108 ------
NM_005637chr181134 11367 --12051
NM_005638chrX----1502 --
NM_005647chrX42976 2372 877 370 --33137 2754 648 --
NM_005648chr8188 ------
NM_005650chr2231309 988 241 ------
NM_005653chr12130 ------
NM_005655chr8----1331 --
NM_005667chr21394 ------
NM_005668chr544465 3406 3388 693 --13335 --
NM_005669chr522053 97 --11994 1264
NM_005678chr152647 219 --4656 653 650 403 --
NM_005686chr131461 520 186 --2613 484 --
NM_005688chr361237 1201 1161 1154 428 354 --1933 --
NM_005690chr121196 ------
NM_005708chr131295 ------
NM_005711chr51995 ------
NM_005717chr1----11252 --
NM_005722chr24711 575 488 435 --1241 1315
NM_005724chr15----272 69 --
NM_005725chr12824 115 ------
NM_005731chr22293 81 ------
NM_005734chr112751 701 ------
NM_005735chr22789 250 ------
NM_005736chr1031023 503 429 --1357 --
NM_005737chr232937 2871 323 ------
NM_005738chr741818 1770 1374 152 --11938 --
NM_005746chr712305 ------
NM_005752chr1611222 --1461 --
NM_005759chr274774 4684 3988 3137 2921 1149 1070 11445 43313 1073 889 713 21153 735
NM_005766chr133395 222 33 ------
NM_005768chr121138 ------
NM_005776chr14----1846 --
NM_005777chr3------183
NM_005778chr31341 165 --1101
NM_005779chr573138 2686 2429 1101 967 572 358 ------
NM_005785chr1221876 1617 11725 11897 --
NM_005786chr181844 --199 --
NM_005789chr1711414 11986 ----
NM_005795chr232694 2470 1995 ------
NM_005796chr163290 133 29 ------
NM_005801chr171179 ------
NM_005808chr343240 2930 978 626 22261 1037 --1999
NM_005819chr141339 476 274 116 --3795 342 339 1863
NM_005822chr642208 1702 906 336 ------
NM_005826chr11111 ------
NM_005828chr1784897 4116 3784 2000 1500 362 191 137 ----14177
NM_005832chr31147 ------
NM_005840chrX65347 2232 1972 1741 1598 378 --55272 5269 2769 2310 702 25276 1802
NM_005841chr43841 125 54 ------
NM_005842chr131714 --1126 --
NM_005843chr211886 ------
NM_005850chr1173 ------
NM_005852chr1731071 1052 76 ------
NM_005859chr521576 631 1252 11534 --
NM_005862chr321085 736 --1883 --
NM_005871chr101907 --1246 --
NM_005877chr2232203 2010 541 --11942 --
NM_005885chr541540 596 331 192 --1163 --
NM_005886chr161256 --3259 223 110 --
NM_005892chr17----1300 --
NM_005898chr111874 ----11005
NM_005899chr1731543 1072 576 --134 --
NM_005900chr41765 ------
NM_005901chr1887978 7661 5595 3058 2346 2239 1359 395 --45598 2591 2325 348 26231 1436
NM_005902chr1544375 3505 3119 1751 --44361 4358 1500 1497 --
NM_005903chr544816 3605 809 542 --25059 794 24626 3232
NM_005904chr18------162
NM_005910chr1793627 3615 3290 2664 2625 959 717 358 102 --24124 1166 --
NM_005917chr2------1175
NM_005920chr163776 3745 3501 1495 642 314 --11450 --
NM_005922chr6----1149 --
NM_005924chr721027 775 ----1796
NM_005927chr511155 ------
NM_005930chr14------167
NM_005933chr1132690 2220 641 ------
NM_005934chr1932245 2165 535 --11898 --
NM_005935chr411752 --15239 --
NM_005937chr1712968 --23362 1626 --
NM_005938chrX21329 472 --1321 --
NM_005941chr843181 2981 727 145 172 2209 79 12738
NM_005955chr1114983 4464 3917 3806 3616 1882 1529 1222 829 699 352 --2869 414 --
NM_005962chr1032174 1461 718 ------
NM_005962chr1032174 1461 718 ------
NM_005964chr1711415 ------
NM_005966chr232374 200 89 ----11733
NM_005967chr121505 ------
NM_005994chr173679 220 194 --159 --
NM_006007chr934032 2996 1024 24106 3362 ----
NM_006009chr12----126 --
NM_006010chr3----1188 --
NM_006011chr1554313 2908 1182 1006 844 ------
NM_006015chr141051 1023 116 68 ------
NM_006016chr672239 2221 1798 1610 899 512 244 11780 1247 --
NM_006017chr41810 --1742 --
NM_006022chr1331065 866 29 ------
NM_006030chr31317 --11381 --
NM_006032chr141169 ------
NM_006036chr242070 1601 798 647 12473 11604 --
NM_006037chr211946 --41752 1527 905 21 --
NM_006040chr1621226 429 11375 --1150
NM_006043chr16------1684
NM_006047chr2063456 571 544 376 186 43 --1574 13309
NM_006048chr12455 246 ----1405
NM_006054chr111659 --21479 1476 --
NM_006060chr73758 727 450 --13704 11199
NM_006062chr211095 --2380 198 --
NM_006076chr773169 2909 2634 2223 2041 1119 602 ------
NM_006077chr101622 --286 83 --
NM_006079chr61171 ------
NM_006080chr721823 915 --32972 1896 768 --
NM_006086chr162282 83 ------
NM_006089chrX21845 1293 ------
NM_006091chr1511788 ------
NM_006095chr464299 3756 3569 1354 965 701 --11148 12896
NM_006100chr3----1115 --
NM_006106chr1122447 2430 --22988 168 1172
NM_006113chr152010 1896 1761 264 113 ------
NM_006116chr222385 364 --11583 --
NM_006122chr151575 --42536 815 154 151 --
NM_006133chr1182410 2148 810 696 535 515 367 135 ------
NM_006136chr7199 ----1443
NM_006139chr21683 --1553 12777
NM_006141chr1612617 ----12476
NM_006153chr3126 --1239 --
NM_006154chr152213 189 ------
NM_006158chr82446 220 ----11558
NM_006160chr17----11069 --
NM_006162chr1821314 614 ------
NM_006166chr1252564 1693 1051 1013 504 --1250 --
NM_006178chr172368 220 --21188 567 --
NM_006180chr92501 96 --11578 --
NM_006186chr22483 368 ----1182
NM_006191chr121929 --129 --
NM_006192chr2011045 ------
NM_006194chr1421218 258 ------
NM_006195chr91473 ------
NM_006196chr21383 --138 --
NM_006197chr821533 378 11944 3481 478 475 --
NM_006201chrX21015 139 --1905 --
NM_006203chr543502 1139 925 851 --11282 --
NM_006206chr442758 2284 472 194 --1475 --
NM_006209chr8------1362
NM_006212chr184450 3847 3281 1965 1624 1064 1017 185 14884 ----
NM_006216chr21613 --1616 --
NM_006224chr1762244 1982 986 888 718 249 11904 22100 2097 --
NM_006226chr221410 331 --1420 --
NM_006228chr81394 ------
NM_006237chr1341566 829 764 175 ------
NM_006241chr32523 64 ----21592 927
NM_006243chr13390 326 165 ------
NM_006245chr61299 --1756 --
NM_006246chr141974 1402 ----
NM_006251chr533157 2340 696 --12100 --
NM_006254chr31401 --194 --
NM_006256chr13959 904 660 ------
NM_006257chr101984 --1922 --
NM_006258chr101272 --1128 --
NM_006259chr41193 1929 ----
NM_006264chr41168 ------
NM_006265chr81979 --11483 --
NM_006267chr21139 ------
NM_006268chr11140 ------
NM_006278chr112169 42 1480 ----
NM_006281chr82312 181 ------
NM_006281chr82312 181 ------
NM_006283chr884817 1827 1511 737 267 154 137 42 --31960 546 543 14680
NM_006287chr232266 2214 159 ------
NM_006290chr631528 662 622 --11494 --
NM_006293chr1521024 702 21018 998 21027 375 --
NM_006301chr12----1592 --
NM_006306chrX65904 5845 4444 3924 1733 1543 ------
NM_006307chrX1238 ------
NM_006312chr12----1750 --
NM_006313chr1211589 --31216 276 273 --
NM_006315chr484506 4393 4097 2928 1492 1361 1303 470 ----12971
NM_006320chr43192 176 96 ------
NM_006321chr371798 1769 828 695 448 423 72 ------
NM_006323chr41616 --1209 --
NM_006325chr122256 211 ----1824
NM_006330chr831624 1368 392 --1541 --
NM_006334chr92286 25 ------
NM_006352chr11443 --32032 1664 1551 --
NM_006357chr2156 --1415 --
NM_006359chrX31996 593 462 --2964 888 12285
NM_006372chr6----1508 --
NM_006373chr1731038 282 250 --1288 --
NM_006375chrX21596 211 ------
NM_006377chr9----21234 444 --
NM_006378chr921171 101 ------
NM_006380chr1733475 3145 982 21652 1444 23302 1455 11351
NM_006386chr2232349 2227 842 --12123 --
NM_006390chr122109 90 --1565 --
NM_006391chr11123 ------
NM_006393chr1054215 3517 1349 929 768 --14033 24219 234
NM_006401chr9170 ------
NM_006403chr621652 366 ------
NM_006405chr14----127 --
NM_006411chr62775 729 ------
NM_006421chr81915 ------
NM_006434chr1063247 1205 967 610 463 340 ------
NM_006454chr483069 2820 1200 1048 980 315 127 103 --22321 130 --
NM_006459chr1021789 1341 --11701 --
NM_006460chr1731381 1220 207 ------
NM_006465chr1521461 166 ------
NM_006466chr20------1129
NM_006469chr11148 --21161 1093 1101
NM_006471chr18136 ------
NM_006478chr22--1183 ----
NM_006482chr1283693 3515 2631 2516 2467 1126 732 701 --23776 830 --
NM_006489chr1431536 1381 637 ------
NM_006496chr12291 64 ------
NM_006504chr1032481 757 618 --12876 --
NM_006520chrX11738 --11571 --
NM_006526chr2041743 1412 634 333 ------
NM_006534chr2032595 530 212 --13323 --
NM_006537chr152576 397 --1213 --
NM_006538chr254148 3483 3348 2844 627 --1991 --
NM_006542chr11167 ------
NM_006545chr3132 ------
NM_006546chr1732042 2032 1619 --26662 2200 --
NM_006547chr721909 1479 ------
NM_006548chr311475 ------
NM_006549chr123734 418 54 --1638 12294
NM_006555chr731951 1490 337 --11532 --
NM_006557chr921508 611 --2614 367 1371
NM_006559chr12967 477 --178 --
NM_006561chr1085910 4482 4327 2158 2110 1361 1259 259 --35870 5468 3803 --
NM_006565chr1621272 181 ------
NM_006570chr9----1114 --
NM_006572chr1773008 2194 969 564 439 201 174 1478 22814 695 --
NM_006574chr31226 --1247 1271
NM_006589chr12204 109 --2173 160 --
NM_006591chr1121842 497 1201 1777 --
NM_006593chr21222 ------
NM_006595chr115779 624 518 357 154 ------
NM_006599chr1677701 7374 7284 5848 5725 485 168 17877 21058 162 --
NM_006601chr1231004 254 106 ------
NM_006603chrX--1250 ----
NM_006609chr212574 ------
NM_006618chr121467 1166 ------
NM_006621chr11390 ------
NM_006624chr1032099 1630 246 --21610 1468 --
NM_006625chr1162 11085 ----
NM_006625chr1162 11085 ----
NM_006625chr1162 11085 ----
NM_006628chr1533064 1761 1209 --1989 1137
NM_006634chr21177 --1227 --
NM_006640chr1721474 132 --1757 --
NM_006646chr1331218 335 206 --22965 1977 --
NM_006650chr563898 3799 3535 2859 1517 1261 --23901 3811 --
NM_006653chr6199 ------
NM_006654chr1254727 1353 1290 1061 885 --24026 606 --
NM_006675chr1252150 2108 1179 920 36 --11129 --
NM_006677chr3121 --1201 --
NM_006690chr2031575 724 624 ----1814
NM_006698chr2011463 --11210 --
NM_006699chr11826 ----1862
NM_006700chr123571 311 159 1224 ----
NM_006703chr61437 --2154 151 --
NM_006706chr5------1794
NM_006709chr6295 70 ------
NM_006711chr162517 185 --2520 171 --
NM_006717chr923138 1051 --11244 --
NM_006718chr61877 1271 ----
NM_006720chr1075059 5022 4768 4646 1787 1248 968 --11008 --
NM_006722chr312447 --12966 1701
NM_006724chr6----1149 --
NM_006726chr43861 407 197 ------
NM_006727chr5152 ------
NM_006729chrX65573 5214 4676 4159 1584 1215 11646 ----
NM_006732chr1942143 2046 1463 854 ------
NM_006734chr631079 1071 566 ------
NM_006736chr241723 1690 484 172 --3522 505 339 --
NM_006738chr1574487 4164 3960 3722 3393 1368 62 --24328 1273 --
NM_006745chr411081 ------
NM_006750chr1658121 6657 5123 2653 224 --34896 2720 458 --
NM_006751chr2------1346
NM_006754chr72271 53 1928 31206 787 134 --
NM_006755chr11----1176 --
NM_006761chr171604 --1561 --
NM_006763chr151333 586 228 187 42 1277 31553 761 643 --
NM_006766chr842010 1896 820 106 ------
NM_006769chr1------1577
NM_006772chr641611 1465 1216 218 ------
NM_006775chr622219 865 --23038 531 --
NM_006777chrX21119 758 --42378 2120 2117 2114 --
NM_006788chr1841942 1498 1463 404 --11890 --
NM_006791chr152244 206 ------
NM_006802chr111127 --2393 390 --
NM_006803chr832048 1586 1283 --21600 731 --
NM_006805chr52678 140 ------
NM_006807chr171247 ------
NM_006811chr201262 ------
NM_006813chr6194 ------
NM_006814chr2052593 2355 431 391 172 ------
NM_006815chr1231294 513 217 ------
NM_006816chr51288 ------
NM_006819chr113269 257 162 ------
NM_006823chr841287 1003 477 111 ------
NM_006826chr21205 ----1926
NM_006827chr1432515 1173 946 --12319 12178
NM_006828chr61194 ------
NM_006832chr142945 60 1952 174 --
NM_006836chr121540 ------
NM_006838chr1221477 1340 --21252 385 --
NM_006842chr111136 ------
NM_006846chr51252 ------
NM_006852chr1732784 2435 260 22235 516 ----
NM_006854chr741718 753 244 114 ------
NM_006874chr42892 827 133 ----
NM_006884chr3171 ------
NM_006885chr1633354 2862 868 ------
NM_006888chr1433242 2973 2786 --21234 807 --
NM_006892chr2021167 215 ------
NM_006892chr2021167 215 ------
NM_006908chr711140 ------
NM_006910chr161111 --1129 --
NM_006912chr152427 1923 516 252 41 ------
NM_006918chr1123788 182 15881 15750 --
NM_006920chr21576 --11829 --
NM_006922chr231758 844 206 --22057 209 --
NM_006924chr17--1893 34007 3890 789 --
NM_006925chr142514 489 ------
NM_006927chr1641657 712 114 94 --1805 --
NM_006936chr2121225 425 --31124 996 44 1479
NM_006937chr17--1489 ----
NM_006939chr1421092 228 ------
NM_006940chr1221605 329 1265 ----
NM_006941chr223928 876 240 ------
NM_006943chr2052616 2433 1300 969 42 ----11304
NM_006946chr112536 112 --1189 1101
NM_006947chr431308 1139 26 --11218 --
NM_006950chrX2845 741 ------
NM_006951chr102775 699 --1129 --
NM_006963chr1011233 ------
NM_006965chr18----11128 --
NM_006981chr952714 1865 626 589 372 12860 --12493
NM_006982chr12185 ------
NM_006990chr131849 653 260 ------
NM_006996chr121265 413 11221 11621 --
NM_006997chr10133 --163 --
NM_007005chr911354 --21161 512 21265 1165
NM_007006chr162511 337 --23337 709 --
NM_007007chr1274624 3889 1734 1593 937 696 449 --31541 951 196 --
NM_007008chr21297 1210 ----
NM_007011chr1566612 4623 2353 1493 1107 277 15130 66663 4550 4547 751 595 592 11497
NM_007013chr8183 ------
NM_007015chr13125 ------
NM_007017chr5--1743 ----
NM_007026chr171556 1532 ----
NM_007034chr11970 --1955 1806
NM_007035chr122619 41 ------
NM_007038chr2135785 5610 4657 --43683 1759 561 558 13916
NM_007040chr191432 ------
NM_007050chr20117889 7250 6921 5888 5465 5104 2865 2572 465 180 40 --47182 2433 1513 196 --
NM_007067chr1711305 --181 --
NM_007078chr1021942 40 --21227 49 --
NM_007084chr134514 471 459 307 ------
NM_007087chr163795 287 255 ------
NM_007097chr5163 195 ----
NM_007107chr332387 253 159 1324 ----
NM_007114chr311206 12563 12575 --
NM_007118chr51228 150 ----
NM_007124chr6144 --21650 416 --
NM_007125chrY2153 75 --11042 --
NM_007126chr93421 364 164 ------
NM_007135chr91174 ------
NM_007137chrX64340 4280 3963 3671 3513 3495 15317 24724 902 15101
NM_007144chr1731317 497 367 --1295 --
NM_007146chr1722751 985 ------
NM_007150chrX2526 80 ------
NM_007158chr1----2794 791 --
NM_007159chr311537 ------
NM_007166chr1121270 85 ------
NM_007172chr2232758 594 38 --244 41 12065
NM_007174chr1222265 1799 --31817 1543 818 --
NM_007175chr872991 2539 2413 2238 812 714 303 12685 ----
NM_007178chr121302 ------
NM_007184chr32546 210 --10384 381 378 375 372 369 366 363 360 357 1399
NM_007185chr12776 121 ------
NM_007191chr12----1711 --
NM_007192chr14--1251 1906 --
NM_007197chr121153 --11051 --
NM_007198chr811510 --2571 436 --
NM_007200chr1574487 4164 3960 3722 3393 1368 62 --24328 1273 --
NM_007203chr973437 2944 2926 2876 1392 469 311 --23791 3495 --
NM_007207chr1----129 --
NM_007214chr6----154 --
NM_007217chr31340 ------
NM_007219chr202789 82 --126 --
NM_007222chr811391 --11330 --
NM_007224chr12----1631 --
NM_007232chr204945 757 277 70 ------
NM_007236chr155924 775 708 623 368 --2266 117 --
NM_007246chr41274 1946 ----
NM_007249chr1347499 6299 3024 260 --11153 11699
NM_007260chr12563 213 --1488 --
NM_007269chr1----3192 189 68 --
NM_007270chr731513 1261 1230 ------
NM_007276chr72919 214 ----1822
NM_007282chr32715 204 ------
NM_007286chr542002 604 490 187 --21828 1756 11582
NM_007294chr1731258 1126 328 --21167 1129 11349
NM_007295chr1731258 1126 328 --21167 1129 11349
NM_007296chr1731258 1126 328 --21167 1129 11349
NM_007297chr1731258 1126 328 --21167 1129 11349
NM_007298chr1731258 1126 328 --21167 1129 11349
NM_007299chr1731258 1126 328 --21167 1129 11349
NM_007300chr1731258 1126 328 --21167 1129 11349
NM_007302chr1731258 1126 328 --21167 1129 11349
NM_007303chr1731258 1126 328 --21167 1129 11349
NM_007304chr1731258 1126 328 --21167 1129 11349
NM_007305chr1731258 1126 328 --21167 1129 11349
NM_007308chr41226 ------
NM_007322chr193488 392 32 --135 1528
NM_007324chr1139 ------
NM_007327chr9----1378 --
NM_007331chr422599 619 --42641 2193 822 426 12002
NM_007345chr1812150 ------
NM_007347chr1533107 2262 1101 ------
NM_007349chr72106 71 ------
NM_007358chr111479 --2753 750 --
NM_007363chrX1975 --2869 866 --
NM_007373chr1041790 1719 1125 358 --21481 1134 --
NM_007374chr14--1354 2471 410 --
NM_007375chr131112 1103 592 --1240 --
NM_009585chr32657 228 ----1831
NM_009585chr32657 228 ----1831
NM_012062chr122359 196 ------
NM_012063chr121196 ------
NM_012064chr122400 159 ------
NM_012069chrX21852 172 --22545 262 --
NM_012073chr53496 287 132 ----1486
NM_012074chr141789 1455 1792 --
NM_012081chr553643 1375 177 100 68 1814 13632 --
NM_012082chr82835 79 ----1710
NM_012084chrX1506 --1554 --
NM_012089chr1151 --11130 21120 308
NM_012090chr111059 --21084 1062 --
NM_012096chr322953 728 ------
NM_012104chr1112587 --1273 --
NM_012104chr1112587 --1273 --
NM_012120chr642857 2701 2641 1913 12405 3878 697 572 12705
NM_012124chr111916 --172 --
NM_012129chr742471 2210 2159 328 ----1150
NM_012134chr151797 1359 1295 423 102 --1670 --
NM_012141chr1311228 1900 11018 13809
NM_012156chr2053392 3319 2742 2276 699 --21346 212 --
NM_012158chr132520 66 ------
NM_012164chr987357 6016 5140 4694 1943 1847 1323 664 ----14703
NM_012175chr11--145 1727 --
NM_012193chr1144981 1620 717 184 14292 74544 3494 2142 2005 723 720 543 --
NM_012197chr931310 1061 51 --11460 --
NM_012199chr154378 4151 1030 799 596 --34154 3542 1603 --
NM_012200chr11----1153 --
NM_012207chr102268 182 ------
NM_012214chr245643 5247 2571 1788 25931 4432 24131 937 26312 998
NM_012215chr1011355 ------
NM_012218chr1942790 2019 1186 125 --12136 --
NM_012224chr41767 ------
NM_012232chr1732191 1599 355 1155 11723 --
NM_012234chr352614 1288 342 291 120 12422 2896 71 --
NM_012235chr3141 ------
NM_012236chr12799 352 --1218 --
NM_012238chr1021401 247 --11359 --
NM_012242chr101270 ------
NM_012243chr12694 279 ------
NM_012244chr1451383 1350 1220 247 230 ------
NM_012247chr101919 ------
NM_012249chr231379 997 420 ------
NM_012250chr112313 203 ------
NM_012252chr745055 3443 1866 1251 --183 --
NM_012255chr201183 --1164 --
NM_012257chr731089 1027 914 --1377 --
NM_012262chr1115199 4592 4095 3818 3779 1699 1613 1337 1317 958 531 --34679 3751 3335 13783
NM_012272chr122312 159 ------
NM_012278chrX----1142 --
NM_012286chrX--1192 ----
NM_012288chr685479 5379 4836 4332 1957 1102 740 336 --1339 --
NM_012290chr231504 1436 1359 --11559 --
NM_012293chr241850 1604 688 34 ----1138
NM_012294chr773950 3721 3158 2493 706 95 72 --11554 --
NM_012295chr221409 ------
NM_012296chr1133886 3174 668 --23530 1493 --
NM_012297chr462520 1657 961 792 600 326 ------
NM_012302chr1----2267 264 --
NM_012304chr532553 963 273 ------
NM_012308chr1122009 251 1762 1537 --
NM_012309chr1124785 4533 13711 13297 13301
NM_012316chr145663 4133 2062 115 24263 3427 14473 --
NM_012319chr182134 78 ------
NM_012320chr1661399 1296 1256 875 511 249 --3232 151 46 --
NM_012321chr192381 22 ------
NM_012325chr2031571 544 522 --11096 --
NM_012326chr23569 254 115 --1282 --
NM_012329chr1721686 1238 ------
NM_012338chr71103 --1908 --
NM_012347chr622167 269 ------
NM_012383chr91120 --139 --
NM_012395chr723340 2976 --1569 --
NM_012405chr1103675 3500 3355 3262 3093 2499 2354 2344 1308 1242 --1874 --
NM_012412chr7----1658 --
NM_012416chr9--11247 11255 2483 279
NM_012417chr17--1430 ----
NM_012428chr152362 226 1332 1236 --
NM_012429chr22--21393 449 ----
NM_012445chr42108 74 --1534 --
NM_012446chr52457 426 ------
NM_012454chr61374 --1482 --
NM_012460chr14148 ------
NM_012471chrX41491 471 352 250 ------
NM_012479chr732047 1962 928 --1707 12434
NM_012482chr11618 ------
NM_013227chr151714 ------
NM_013230chrY11710 --1561 --
NM_013231chr1453466 2927 2818 1740 251 --1346 --
NM_013233chr21920 11110 1261 --
NM_013242chr162381 108 --1136 --
NM_013253chr1141226 483 263 173 --1543 --
NM_013254chr121173 ------
NM_013255chr777645 7591 6703 6030 3407 1952 1219 --32357 408 405 --
NM_013257chr81183 1543 ----
NM_013261chr41198 ------
NM_013275chr161741 --159 --
NM_013277chr12----2685 330 --
NM_013279chr1131883 513 163 --2166 110 --
NM_013281chr2031249 348 188 11217 ----
NM_013283chr53685 359 295 --1864 --
NM_013286chr342549 674 429 247 13115 12492 --
NM_013293chr71530 1669 2156 153 --
NM_013305chr18148 --1263 --
NM_013316chr71312 ------
NM_013322chr7----11191 --
NM_013351chr171253 ------
NM_013354chr811389 11020 ----
NM_013361chr192579 189 ------
NM_013374chr3--1737 2195 192 --
NM_013381chr121275 ----1611
NM_013382chr1462208 1730 881 787 554 236 --1119 --
NM_013392chr23417 376 54 --1420 --
NM_013396chr211276 --21349 84 188
NM_013410chr13381 313 68 --1316 11048
NM_013433chr1921986 728 --1572 --
NM_013436chr22681 40 --1601 --
NM_013437chr821357 294 ------
NM_013438chr921277 438 --11541 1106
NM_013444chrX1328 --1311 --
NM_013446chr731395 272 115 --11287 --
NM_013448chr142486 72 ------
NM_013449chr1222869 83 --1512 --
NM_013958chr8----234 23 1370
NM_013959chr8----234 23 1370
NM_013960chr81672 ------
NM_013961chr8----234 23 1370
NM_013962chr8----234 23 1370
NM_013995chrX1503 --11615 12238
NM_014000chr1031632 444 85 --21211 479 1546
NM_014001chr1781639 1625 1477 1138 478 442 269 234 --1159 --
NM_014007chr921272 861 ------
NM_014011chr22893 726 ----1147
NM_014016chr341608 1513 1203 310 --11535 --
NM_014021chr123006 2840 ------
NM_014023chr1062263 2143 1815 1780 953 494 --42555 2299 2256 1829 --
NM_014030chr1731233 1038 118 --1474 --
NM_014043chr3----1411 --
NM_014048chr1654528 4384 3293 3281 96 --25118 3249 --
NM_014060chrX145 ------
NM_014071chr201192 ------
NM_014089chr1312278 ------
NM_014112chr894443 4436 4020 3918 2039 1619 994 626 431 --11962 25293 1290
NM_014117chr161379 --21877 32 --
NM_014153chr161159 1451 1630 --
NM_014154chr31201 ------
NM_014155chr1175839 2882 2397 2263 1283 1116 690 --25398 1018 26543 1785
NM_014157chr1652778 948 856 656 460 ------
NM_014159chr31201 ------
NM_014181chr231872 729 157 11074 --12886
NM_014183chr201303 ------
NM_014184chr11137 ------
NM_014188chr11344 --1389 --
NM_014189chr441321 1297 1228 1039 --1994 --
NM_014190chr461673 1649 1580 1391 1140 42 --11346 --
NM_014191chr121972 --11004 --
NM_014212chr121961 --1316 --
NM_014217chr121527 1374 11343 169 --
NM_014225chr19----1296 --
NM_014231chr12----1184 --
NM_014232chr1721586 1232 1153 ----
NM_014232chr1721586 1232 1153 ----
NM_014240chr383463 3294 3147 3110 3098 798 211 50 --53101 2933 59 56 53 --
NM_014243chr431578 471 159 --12122 21843 250
NM_014248chr22----1124 164
NM_014251chr73909 784 26 --1793 --
NM_014263chr1011135 ----11399
NM_014268chr1831001 254 132 ------
NM_014271chrX----184 188
NM_014278chr41358 --1179 --
NM_014280chr11256 --1377 --
NM_014282chr91129 21099 151 21116 103 --
NM_014283chr111325 --11328 --
NM_014284chr11685 ------
NM_014294chr821256 336 11351 --11321
NM_014309chr2245116 3846 3588 1368 21651 1513 35366 4970 2062 12066
NM_014319chr1221705 1244 --1469 --
NM_014325chr1221764 418 ------
NM_014333chr1142345 703 319 145 --2628 189 --
NM_014338chr224978 822 423 379 126 1355 1826
NM_014342chr1131466 1251 925 ------
NM_014345chr61401 ------
NM_014351chr2231378 1246 1217 ------
NM_014363chr132868 60 ----11262
NM_014365chr121262 --1820 --
NM_014372chr121947 411 --11618 --
NM_014382chr31662 ------
NM_014390chr71530 ------
NM_014392chr44474 363 273 157 --1137 --
NM_014393chr821578 207 --12273 --
NM_014399chr72375 178 ------
NM_014408chr1----1543 --
NM_014415chr321549 118 11282 ----
NM_014417chr192880 328 ------
NM_014423chr545290 4716 4344 466 35376 4091 3811 11633 1871
NM_014445chr3----22363 888 --
NM_014447chr421686 1233 ------
NM_014449chr121209 ------
NM_014454chr62840 257 --3828 748 304 1409
NM_014456chr101417 1398 2423 420 --
NM_014470chr121667 ------
NM_014482chr21104 ------
NM_014491chr7----1940 --
NM_014494chr1631648 587 511 11720 11882 --
NM_014502chr112320 302 ------
NM_014504chr71478 --1720 --
NM_014515chr123975 788 184 ------
NM_014517chr321779 312 --2443 266 --
NM_014520chr173361 131 98 ------
NM_014521chr271584 1274 1244 734 350 102 65 --125 --
NM_014554chr1251766 795 613 208 83 --1100 --
NM_014562chr21746 --4749 72 69 66 --
NM_014564chr92762 68 ----1287
NM_014572chr1331644 560 93 --1332 1336
NM_014573chr1751717 1427 384 208 48 ------
NM_014574chr1431475 1243 373 ------
NM_014577chr22----1241 --
NM_014584chr1451603 1220 1139 443 115 ------
NM_014585chr21137 11162 ----
NM_014587chr1631514 1345 139 ------
NM_014592chr53774 327 273 ------
NM_014601chr1931501 1495 28 ------
NM_014612chr921073 999 --31472 1099 1096 --
NM_014613chr562481 2285 1930 750 180 150 --1971 --
NM_014614chr21417 ------
NM_014615chr1643620 3523 3307 382 --1983 --
NM_014616chr322696 2594 --23245 295 --
NM_014618chr92330 277 ------
NM_014620chr121619 ------
NM_014621chr2176 ------
NM_014629chr851338 952 895 289 23 ------
NM_014630chr15113763 3722 3026 2997 2622 821 632 364 307 283 236 --2869 741 --
NM_014634chr2242912 2887 2519 634 --21414 1270 --
NM_014635chr22682 237 --11358 --
NM_014636chr9104293 4116 4024 3808 3590 3354 819 770 487 425 ------
NM_014646chr18113215 2731 2564 2531 2249 1243 871 528 438 271 160 --12151 --
NM_014647chr1631925 1883 1845 --22255 1886 --
NM_014655chr122315 723 1408 128 --
NM_014659chr153881 863 778 ------
NM_014665chr883425 3151 2536 1439 1430 1364 603 558 13083 12773 --
NM_014666chr521127 140 ------
NM_014667chr321573 291 ------
NM_014670chr22229 155 ----11225
NM_014671chr72502 436 --31073 976 439 --
NM_014676chr12677 113 1595 1234 --
NM_014677chr811366 ------
NM_014678chr221118 ------
NM_014686chr1982396 2349 2074 1898 1880 806 774 349 ------
NM_014690chr7112622 2563 2542 2492 2361 2003 1057 970 803 501 396 ------
NM_014699chr161392 ------
NM_014701chr1543094 2665 821 664 --13097 --
NM_014705chr752121 596 577 166 148 --42124 1843 1405 586 --
NM_014707chr711572 ------
NM_014709chr2----155 --
NM_014711chr161767 ------
NM_014713chr2166 ------
NM_014717chr191784 --1311 --
NM_014721chr6127029 5818 5684 5589 5373 5302 5077 2676 1060 1009 721 216 ----21339 1086
NM_014726chr173946 72 26 ------
NM_014729chr851525 1501 923 272 262 1111 ----
NM_014730chr1234980 3728 1001 ------
NM_014730chr1234980 3728 1001 ------
NM_014732chr16125827 5713 5418 5378 4528 3658 1703 1601 1520 829 157 125 --25421 914 --
NM_014739chr623199 1072 ------
NM_014740chr17142 ------
NM_014741chr1162063 1543 766 380 329 75 --31642 1639 769 --
NM_014742chr202408 230 21370 666 ----
NM_014743chr421965 935 1202 11968 --
NM_014746chr274249 2888 2749 901 708 648 260 --11490 11099
NM_014747chr1135731 5467 5078 4914 4819 3826 3675 3663 2209 1250 987 379 108 --14043 --
NM_014748chr21406 ------
NM_014751chr821931 1588 12066 1821 --
NM_014752chr11----1370 --
NM_014755chr291709 1646 1484 1447 1204 536 522 507 262 --21260 607 23748 1309
NM_014756chr11----1192 --
NM_014757chr541917 1822 866 633 ------
NM_014758chr1132388 1866 633 --41853 592 589 233 --
NM_014759chr841592 1523 1213 567 --11000 --
NM_014761chr16--11186 1172 --
NM_014767chr102987 309 ------
NM_014772chr1842455 2436 723 457 12270 12458 --
NM_014774chr122979 2853 --22856 2555 --
NM_014776chr1243005 2264 2156 981 --12026 --
NM_014779chr31182 1456 ----
NM_014781chr8------11155
NM_014782chrX----1254 --
NM_014784chr11724 --1161 11085
NM_014787chr132669 825 26 --11780 --
NM_014790chr52348 189 ------
NM_014795chr2282 71 ------
NM_014800chr721168 898 ----1856
NM_014807chr111817 ------
NM_014810chr122274 789 11334 --1910
NM_014822chr4127 ------
NM_014824chr1111245 11843 ----
NM_014826chr134378 479 253 11655 11696 --
NM_014827chr111206 1423 21277 603 --
NM_014828chr1442540 840 184 117 12009 ----
NM_014830chr1223809 1444 1167 12797 1346
NM_014832chr1332113 2033 634 --11740 2743 212
NM_014835chr2022088 187 ------
NM_014839chr141942 1815 978 570 ------
NM_014840chr1253023 2983 1031 556 380 --32919 2102 823 --
NM_014841chr61317 1190 --11158
NM_014846chr8190 ------
NM_014850chr3104781 4519 4431 4378 4246 4227 3509 1507 1014 747 11557 ----
NM_014860chr242584 2003 1628 804 12370 21039 854 --
NM_014862chr1584106 3346 1562 1355 737 603 182 27 --11647 --
NM_014868chr122370 77 --1853 --
NM_014871chr122477 172 ------
NM_014872chr912141 --3882 743 160 --
NM_014873chr194637 3705 1786 1565 1506 1194 530 507 316 --23658 1789 --
NM_014874chr131521 670 43 --41790 626 188 185 --
NM_014876chr2252225 607 514 368 57 --1345 --
NM_014877chr1765939 5678 5359 2486 2426 548 --26579 6576 1141
NM_014883chr442468 871 507 444 ------
NM_014887chr132772 34 1227 ----
NM_014897chr1732498 1167 1036 ------
NM_014901chr51543 12222 12272 --
NM_014903chr122815 388 11869 ----
NM_014904chr1043830 3070 2541 670 1718 13485 12937
NM_014906chr1723353 3122 ------
NM_014907chr9----1127 --
NM_014912chr1042872 885 679 559 ----1696
NM_014917chr11220 --1971 --
NM_014920chr633298 2518 1148 --23754 589 --
NM_014921chr1941039 898 454 430 --11912 12007
NM_014923chr1321572 441 ------
NM_014924chr1423130 2934 --32759 999 577 13089
NM_014932chr31566 --21803 651 1476
NM_014934chr1342875 992 399 228 --33824 3680 231 --
NM_014935chr133018 165 36 22583 1033 ----
NM_014938chr1252218 916 837 677 213 12067 12000 --
NM_014942chr61426 ------
NM_014944chr121345 47 --11135 --
NM_014946chr252559 2469 2385 882 323 ------
NM_014947chr173072 2264 1969 1917 1114 948 328 12624 33107 2969 626 --
NM_014952chr1531751 1640 1519 ------
NM_014962chr2022199 2018 11832 1534 --
NM_014965chr312194 1147 ----
NM_014969chr1----1204 --
NM_014974chr1011104 ------
NM_014975chr19178 ------
NM_014982chr1434921 3847 1652 --33655 2133 701 --
NM_014988chr41849 --11780 --
NM_014989chr611526 ------
NM_014990chr1411156 1922 ----
NM_014991chr422946 2391 --1842 --
NM_014994chr1592360 2026 1936 1542 1478 814 268 188 88 --1712 --
NM_014997chr752940 2000 1156 1120 574 --22577 735 --
NM_015000chr1242715 1156 877 316 ------
NM_015001chr11133 ----1183
NM_015002chr1221454 99 --41541 190 34 31 138
NM_015008chr373416 2642 2630 1156 1057 1008 999 13587 52597 1066 1063 1060 957 --
NM_015017chr11275 ------
NM_015020chr1673884 3733 3218 2615 702 570 372 13407 23234 705 --
NM_015023chr121511 424 1157 41807 1529 1517 1514 --
NM_015024chr841447 947 194 143 --11258 11262
NM_015025chr242727 2638 1829 252 --22331 59 --
NM_015026chr1244718 3578 1184 110 14642 ----
NM_015032chr1342657 2607 2171 1044 --11122 --
NM_015035chr20126244 5956 5039 4973 4452 2410 1402 1363 660 586 109 82 --34927 4409 2534 16585
NM_015039chr131613 1489 1266 --13596 24334 3362
NM_015040chr253173 2714 2275 412 133 --22597 2384 --
NM_015042chr1543737 3596 3406 2777 --53622 3379 3376 821 360 --
NM_015044chr1662759 2197 590 438 427 55 --22818 441 --
NM_015045chr101357 1233 1340 1344
NM_015046chr922648 1953 --1110 --
NM_015049chr232870 2077 101 --12441 --
NM_015051chr922306 2148 ------
NM_015055chr1132320 1826 541 --1417 1750
NM_015061chr9--1717 ----
NM_015062chr10--190 ----
NM_015068chr743923 2511 1597 1566 --22467 368 13974
NM_015069chr16--1141 ----
NM_015071chr5116381 6323 6206 4530 2144 1894 1754 1569 1173 1158 1035 --22281 2278 1118
NM_015074chr194904 4510 3723 3571 2001 1866 1660 1240 748 24972 4421 54327 4151 4148 3579 404 14331
NM_015075chrX1257 ------
NM_015076chr643599 3352 1368 325 --43656 2765 1804 1182 --
NM_015080chr111729 ------
NM_015091chr142740 307 ------
NM_015092chr1644166 3999 3134 2941 --23025 485 1765
NM_015093chr61454 ------
NM_015094chr2254420 4205 4180 1714 313 --33153 2873 584 1588
NM_015103chr33319 144 27 --130 --
NM_015104chr112150 32 ------
NM_015106chr3----2161 158 --
NM_015115chr453006 1006 897 191 164 --3265 92 71 --
NM_015125chr191598 ------
NM_015129chrX41283 714 484 425 11779 ----
NM_015130chr41205 --31310 1307 310 --
NM_015132chr711653 --11614 --
NM_015137chr832310 790 231 ------
NM_015138chr1552100 776 683 155 100 --11031 --
NM_015143chr42375 282 ------
NM_015144chr1653360 2593 948 920 81 --184 --
NM_015149chr122226 2138 ------
NM_015153chr61242 ------
NM_015155chr1052704 2546 2475 1058 752 13022 ----
NM_015156chr1423776 976 --13841 --
NM_015158chr9--146 2238 235 --
NM_015161chr1631356 1063 63 ------
NM_015170chr812170 ------
NM_015171chr16----136 --
NM_015172chr141471 1363 1154 167 --11366 11370
NM_015178chr841950 1935 447 345 --3348 34 31 --
NM_015180chr141856 ------
NM_015191chr1132460 2170 534 --32524 1680 163 1934
NM_015192chr2022788 2060 --2742 573 --
NM_015194chr173799 99 65 1783 21702 355 --
NM_015197chr1462913 2590 2198 959 695 39 --42417 2414 822 592 13347
NM_015198chr731223 483 184 21248 245 ----
NM_015199chr342407 2303 792 625 ----12470
NM_015200chr412484 --1634 --
NM_015206chr1522739 1268 --13277 --
NM_015208chr18----33017 1419 1318 --
NM_015209chr131656 423 24 ----1928
NM_015215chr153186 3108 2283 2276 953 --1441 --
NM_015216chr521353 509 1379 ----
NM_015221chr103365 113 31 ------
NM_015225chr932385 2208 710 --12321 --
NM_015233chr1392692 2463 2345 2121 1726 1057 978 873 386 ------
NM_015234chr621123 970 --11079 --
NM_015236chr45601 425 406 336 108 ------
NM_015245chr642277 994 554 26 21898 902 22493 557 --
NM_015246chr1651989 1728 674 512 61 --11429 --
NM_015247chr1623536 1145 --25369 3984 --
NM_015250chr92212 204 ------
NM_015252chr2------1812
NM_015260chr1931563 182 118 ------
NM_015263chr15----1342 --
NM_015265chr252112 2084 1927 1904 174 12669 22164 2115 --
NM_015267chr1231882 427 415 --1379 --
NM_015269chr1160 ------
NM_015270chr123942 899 239 11827 ----
NM_015271chr413549 --12658 --
NM_015275chr1231478 664 594 ------
NM_015277chr1831544 1317 1181 ------
NM_015278chr633087 2189 2171 --13262 --
NM_015285chr18----41751 399 300 61 --
NM_015288chr5103771 3764 3581 2772 2663 2435 2365 1182 1053 585 --52386 2368 1536 1533 650 --
NM_015291chr173310 2870 2240 1204 1068 733 428 1895 22860 434 --
NM_015292chr121238 1720 ----
NM_015294chr1741110 1053 842 54 1959 ----
NM_015296chr1311211 --1922 --
NM_015310chr8116658 6186 2902 2699 2686 2511 2455 1778 1628 1583 523 17536 --16111
NM_015315chr562979 2493 1394 1166 1045 691 12291 31196 1125 556 --
NM_015317chr221756 1152 ------
NM_015326chr113017 --32150 1906 1903 --
NM_015327chr161315 1186 941 277 189 133 ------
NM_015328chr762867 2508 2075 708 579 88 --42803 2769 2144 2005 --
NM_015332chr763476 3165 2486 1123 758 490 1197 32450 400 346 12801
NM_015339chr2041045 894 173 33 ------
NM_015344chr812079 ------
NM_015347chr1242705 1955 815 584 --1845 --
NM_015355chr171346 --11231 --
NM_015359chr831927 617 163 --12402 --
NM_015365chrX21586 289 12730 13462 --
NM_015374chr2221461 23 ------
NM_015375chr135029 4117 501 ------
NM_015378chr142878 2669 2305 898 --12789 --
NM_015382chr141749 1161 ----
NM_015385chr1063247 1205 967 610 463 340 ------
NM_015387chr211739 --11776 1276
NM_015393chr453164 2340 1369 642 525 22449 157 12480 --
NM_015396chr351447 1206 481 296 117 ------
NM_015397chr921384 380 ----1258
NM_015409chr1242649 2318 2122 979 ------
NM_015416chr121743 ------
NM_015419chrX21023 413 ------
NM_015429chr321036 1028 ------
NM_015435chr811496 ------
NM_015443chr172536 456 ------
NM_015444chr33426 165 88 ------
NM_015447chr91262 --1625 --
NM_015455chr533314 2672 885 13969 11188 --
NM_015458chr834993 3433 1625 --1796 --
NM_015459chr11------1219
NM_015460chr321839 1554 ----11456
NM_015461chr181202 ------
NM_015464chr711015 --187 --
NM_015470chr271109 1087 1046 1038 842 148 47 1351 21090 871 --
NM_015472chr31136 ------
NM_015472chr31136 ------
NM_015475chr21942 ------
NM_015477chr15----1359 --
NM_015483chr711012 --1790 --
NM_015488chr21337 --21483 1177 1341
NM_015497chr152855 232 --1982 --
NM_015508chr311413 11445 11115 --
NM_015509chr1231642 1185 548 11023 ----
NM_015527chr163610 273 145 --1834 --
NM_015530chr21252 --4643 640 637 338 --
NM_015535chr233656 3133 493 ------
NM_015537chr91137 --2789 786 1392
NM_015541chr32495 334 --21307 337 --
NM_015542chr1021257 1213 ------
NM_015553chr6104220 4070 3797 3720 3672 3546 3451 1164 493 59 --25182 3454 --
NM_015554chr1542684 541 431 36 22661 324 11972 --
NM_015557chr142249 1209 882 26 --12439 --
NM_015564chr5----21439 422 --
NM_015568chr2074282 3354 3177 3073 1501 251 197 14318 13180 --
NM_015569chr114145 14122 ----
NM_015570chr7----11736 --
NM_015575chr2113385 3343 3079 2679 2477 1426 1405 1392 1357 1008 290 ------
NM_015576chr332691 1908 987 ------
NM_015577chr531779 1658 1429 ----1720
NM_015578chr1912058 --11566 --
NM_015589chr14147 ------
NM_015601chr101817 ------
NM_015609chr122410 30 11823 ----
NM_015610chr722787 2423 ----172
NM_015626chr171353 1264 1924 --
NM_015635chr931540 387 74 12212 ----
NM_015638chr203677 465 27 --195 --
NM_015640chr165053 4836 3735 1991 1956 504 24432 593 24682 286 --
NM_015649chr19----2259 256 --
NM_015678chr13151 1195 ----
NM_015686chrX42482 851 425 343 ------
NM_015691chrX52208 2042 808 668 616 --22522 277 --
NM_015695chr651982 1946 821 748 192 1634 ----
NM_015702chr2124 ------
NM_015726chr121732 1326 ----11560
NM_015831chr71733 ------
NM_015844chr181965 ------
NM_015845chr181743 --2198 195 --
NM_015846chr181965 ------
NM_015847chr181965 ------
NM_015850chr821868 227 1753 42058 895 892 828 12417
NM_015855chr113766 191 99 ------
NM_015866chr111477 --1179 11237
NM_015872chr11275 ------
NM_015874chr41255 ------
NM_015878chr811913 ------
NM_015879chr1875666 3162 2019 1602 587 227 32 16910 17886 1246
NM_015881chr1141226 483 263 173 --1543 --
NM_015885chr11143 --146 --
NM_015892chr1041615 828 540 465 11856 --1888
NM_015898chr1932375 2073 1566 ------
NM_015899chr12144 ------
NM_015902chr83324 94 24 ------
NM_015904chr23567 529 263 --1266 --
NM_015906chr133697 3336 1091 --34591 556 91 11555
NM_015912chr862299 2210 2133 1820 938 704 ------
NM_015915chr14------1239
NM_015920chr15----1590 --
NM_015955chr2--1515 ----
NM_015975chrX11755 --11217 --
NM_015981chr562475 2154 1985 295 68 28 ------
NM_015982chr171308 ------
NM_015984chr11551 ------
NM_016003chr722787 2423 ----172
NM_016009chr164826 4384 4155 4139 3185 1688 --11023 --
NM_016018chr852123 1128 528 448 303 ------
NM_016019chr74969 870 329 72 ------
NM_016021chr643028 2982 1994 671 --12584 1647
NM_016022chr12902 740 ------
NM_016025chr1611630 --31954 1858 773 11634
NM_016032chrX31099 388 158 ------
NM_016037chr11251 ------
NM_016040chr112346 21999 1878 22731 2515 --
NM_016041chr17175 ------
NM_016045chr2021247 686 --1398 --
NM_016048chr521000 700 --1207 --
NM_016057chr122322 55 ------
NM_016060chr1721108 345 ------
NM_016061chr231664 1469 1124 1312 ----
NM_016070chr171229 ------
NM_016072chr12----12358 --
NM_016076chr152896 2641 907 776 296 --22644 2501 --
NM_016081chr431473 558 451 ------
NM_016083chr653100 3007 1176 936 786 --1939 --
NM_016087chr721378 1179 ------
NM_016096chr852169 2054 1352 541 77 --1141 --
NM_016098chr63473 170 50 --153 --
NM_016100chr201338 ------
NM_016121chr11903 1771 ----
NM_016131chr222292 55 --21971 780 11572
NM_016132chr1553080 2961 2690 1361 1351 --21129 760 --
NM_016133chr2------11668
NM_016141chr3----2617 211 --
NM_016142chr112937 154 ------
NM_016147chr1111113 ------
NM_016152chr3----184 --
NM_016162chr123613 286 117 ------
NM_016169chr1043120 2370 1112 43 ------
NM_016185chr172745 125 --1826 --
NM_016192chr2198 ------
NM_016195chr10--1264 1120 --
NM_016201chr372286 1778 1747 1667 805 595 92 ------
NM_016203chr72749 236 ------
NM_016205chr411200 --1905 1539
NM_016217chr653416 3333 2322 2310 633 --1547 --
NM_016221chr542072 789 175 71 --3181 178 74 1410
NM_016227chr111325 --11328 --
NM_016230chr61361 ------
NM_016231chr1721479 601 1254 ----
NM_016234chr10----2751 691 1212
NM_016243chr1----2593 27 --
NM_016248chr1343772 2563 2472 658 --13049 1330
NM_016250chr141702 ------
NM_016252chr2------1894
NM_016257chr123299 2529 --11011 --
NM_016260chr256801 5000 4806 1280 1154 --11655 16146
NM_016271chr18----1309 --
NM_016272chr2242091 1929 846 597 --1343 --
NM_016277chr6----11020 --
NM_016281chr122460 100 ------
NM_016287chr112029 ------
NM_016289chr232114 1851 169 --31613 175 172 2108 47
NM_016291chr3159 ------
NM_016300chr3----1119 --
NM_016303chrX------1104
NM_016306chr31244 ------
NM_016308chr132083 1574 532 157 ----
NM_016312chr12187 ----1215
NM_016319chr12----2590 587 --
NM_016320chr111127 ------
NM_016322chr942561 2028 1252 433 12777 22352 950 11172
NM_016338chr53807 442 271 ------
NM_016339chr1761709 1505 1309 694 662 443 --31712 1312 331 --
NM_016374chr1140 ------
NM_016374chr1140 ------
NM_016376chr1761573 1091 793 721 421 54 23625 1246 34036 1101 756 --
NM_016395chr1521920 1863 1421 21358 1355 --
NM_016396chr151944 --11961 --
NM_016406chr11354 ------
NM_016422chr1123173 714 --13106 127
NM_016436chr201493 --22669 1040 12119
NM_016441chr242237 1947 1832 435 1237 2864 679 --
NM_016451chr111205 ------
NM_016453chr33663 518 193 --2521 443 --
NM_016454chr151319 ----1303
NM_016467chr211122 --1145 --
NM_016470chr201398 ------
NM_016472chr141302 21199 205 11125 --
NM_016479chr351265 1237 453 133 93 --1456 --
NM_016485chr61918 --1789 --
NM_016488chr1231684 748 704 --126 --
NM_016506chr111190 --2178 175 --
NM_016507chr1733032 852 490 --11061 --
NM_016513chr633298 2518 1148 --23754 589 --
NM_016516chr21588 ------
NM_016522chr1111112 ------
NM_016525chr91337 --1384 --
NM_016529chr133471 360 48 ------
NM_016530chr1552814 2691 1224 263 99 --21425 102 --
NM_016531chr443210 3194 858 689 22620 1131 ----
NM_016538chr171163 ------
NM_016542chrX11516 ------
NM_016544chr243361 738 685 462 --1465 12997
NM_016559chr3----1598 --
NM_016561chr16----1120 --
NM_016575chr1254511 4119 3931 473 428 11717 34948 2004 83 11699
NM_016577chr373972 3919 3319 3271 1505 1481 1257 21098 193 31508 810 51 11138
NM_016578chr112191 75 ------
NM_016587chr72919 214 ----1822
NM_016588chr6--1752 1689 1657
NM_016598chr331455 272 222 ------
NM_016603chr542212 1992 721 411 ------
NM_016604chr511184 ------
NM_016605chr552593 2459 2362 1952 681 --11071 --
NM_016607chrX----1210 --
NM_016612chr82537 102 ------
NM_016620chr121148 284 ------
NM_016621chr1163687 3397 3175 3146 2900 1084 --43636 3633 3369 1699 --
NM_016623chr82637 25 ------
NM_016626chr1831727 1469 425 1158 ----
NM_016628chr10152 ----1656
NM_016630chr152397 388 ------
NM_016651chr142935 260 ----11144
NM_016824chr1011619 ------
NM_016831chr122231 1502 --22012 754 --
NM_016834chr1793627 3615 3290 2664 2625 959 717 358 102 --24124 1166 --
NM_016835chr1793627 3615 3290 2664 2625 959 717 358 102 --24124 1166 --
NM_016836chr25751 635 628 524 209 --1509 --
NM_016839chr25751 635 628 524 209 --1509 --
NM_016841chr1793627 3615 3290 2664 2625 959 717 358 102 --24124 1166 --
NM_016848chr92279 72 ------
NM_016937chrX1948 ------
NM_016946chr151423 998 856 678 430 --11149 --
NM_016953chr275691 5292 4887 4872 1584 1082 362 ------
NM_017409chr121166 ------
NM_017410chr1221087 1050 --1158 --
NM_017412chr8----134 --
NM_017413chrX21705 115 --71723 1720 1717 1714 1711 1708 1693 11697
NM_017415chr543972 1679 483 45 14448 33555 1484 110 --
NM_017420chr1433551 2818 1509 --12892 --
NM_017423chr452208 2023 1991 662 78 --1509 --
NM_017450chr17127 1480 1180 --
NM_017452chr20----11172 --
NM_017453chr20----11172 --
NM_017454chr20----11172 --
NM_017455chr152362 226 1332 1236 --
NM_017457chr191148 ------
NM_017481chr111189 ------
NM_017519chr63252 191 61 ------
NM_017522chr131178 369 145 ------
NM_017534chr17196 ------
NM_017544chrX1222 ------
NM_017548chr33574 495 348 ------
NM_017551chr105728 646 549 526 430 ------
NM_017559chr17--1230 ----
NM_017563chr376276 5615 4841 1553 1152 797 38 15297 25320 771 11237
NM_017577chr321598 600 ------
NM_017582chr131282 1223 63 --41590 1549 1242 552 1585
NM_017583chr1151705 1480 634 283 92 ----11484
NM_017590chr2232501 1798 190 ------
NM_017593chr42457 148 ------
NM_017596chr154542 4012 3778 668 83 11178 24149 1252 --
NM_017599chr121347 --2818 231 --
NM_017602chrX3763 649 221 ------
NM_017607chr192466 40 ------
NM_017610chr152505 317 --2766 700 --
NM_017629chr111403 --21923 1851 --
NM_017632chr41445 ------
NM_017633chr653767 3676 3336 829 325 --13003 12595
NM_017637chr9109049 8117 8015 7721 6436 5977 2945 1699 1385 404 26981 619 38754 5761 2621 19316
NM_017641chr12135 ----21188 856
NM_017643chr171469 22564 365 ----
NM_017645chr923068 3053 ----12775
NM_017649chr103414 337 102 ----1923
NM_017650chr755616 5311 5256 1376 812 ------
NM_017657chr2----1251 --
NM_017658chr1464363 3400 1386 499 323 172 ----13256
NM_017661chr1521271 296 11068 180 --
NM_017670chr115209 198 185 31 21 --1863 --
NM_017672chr1521261 371 --1962 --
NM_017681chrX151 ------
NM_017686chr111020 --185 --
NM_017693chr1341289 1269 1207 1173 --11272 --
NM_017694chr2----11809 --
NM_017699chr321529 1296 --3460 355 48 --
NM_017709chr131180 1019 647 --12831 --
NM_017714chr20----1144 --
NM_017715chr7----296 24 --
NM_017719chr342479 2000 1844 1837 ----1175
NM_017724chr31709 --2736 228 --
NM_017728chr1782656 2449 1994 1969 757 450 243 82 ------
NM_017730chr33250 185 128 ------
NM_017736chr1632805 1158 107 12712 4220 217 118 56 --
NM_017737chr16874 858 703 452 275 54 ------
NM_017739chr12427 388 ------
NM_017742chr1821297 299 --1781 --
NM_017745chrX1708 ------
NM_017748chr172276 50 ------
NM_017749chr112839 92 ------
NM_017753chr93375 71 25 ------
NM_017754chr665001 4306 3791 1015 673 162 ------
NM_017758chr172230 151 --1486 --
NM_017761chr1--11045 ----
NM_017762chr1582354 2325 2129 2039 1742 1588 846 627 ----12229
NM_017769chr1412427 142 ----
NM_017772chr621576 352 ------
NM_017778chr821320 1044 --11085 --
NM_017780chr82918 100 --1349 --
NM_017787chr1042865 2599 2043 411 --22046 851 --
NM_017789chr21755 ------
NM_017793chr151238 --1224 --
NM_017798chr202953 108 --1862 --
NM_017799chr1421252 739 21637 1307 ----
NM_017810chr16163 ------
NM_017811chr962220 2211 1084 672 504 415 1771 12688 --
NM_017813chr875753 5299 4994 1053 1038 869 185 --11788 14215
NM_017816chr4----158 --
NM_017824chr1042674 1856 948 102 --2332 105 --
NM_017831chr1844318 1697 1298 1282 13442 156 --
NM_017845chr41102 ------
NM_017848chrX13497 ------
NM_017849chr231213 579 333 ------
NM_017866chr81308 --1452 --
NM_017875chr35697 662 125 62 35 --165 --
NM_017880chr2----130 --
NM_017896chr2063511 3419 3243 2868 632 292 13089 13267 21317 328
NM_017913chr9187 ----1164
NM_017919chr954129 3868 3811 2012 736 --31686 60 57 --
NM_017921chr1782249 2019 1630 1547 565 499 345 66 ------
NM_017926chr141263 --2302 41 --
NM_017933chr2--1337 41570 1321 199 196 --
NM_017934chr6----187 --
NM_017938chrX41994 758 582 340 --22138 1968 --
NM_017943chr142735 342 ------
NM_017944chr111665 --12111 --
NM_017953chr1170 ------
NM_017955chr1441068 956 209 100 --1933 1475
NM_017972chr141263 --2302 41 --
NM_017987chr1011833 --2738 722 --
NM_017988chr121930 ------
NM_017994chr732926 2822 1933 12079 12611 12205
NM_018004chr3----1387 --
NM_018011chr13----1496 --
NM_018014chr221263 471 ------
NM_018027chr1053118 1051 937 694 22 --12193 --
NM_018028chr191874 ------
NM_018030chr1831061 381 281 --1284 --
NM_018032chr164967 918 786 245 ------
NM_018034chr5122 ------
NM_018036chr1474396 4012 3068 1563 592 571 241 --13981 --
NM_018046chr51458 ----1595
NM_018047chr51218 ------
NM_018048chr1221957 21 ------
NM_018061chr11474 ------
NM_018064chr62238 50 ------
NM_018067chr11501 ------
NM_018070chr11506 ------
NM_018084chr232704 801 467 --1881 --
NM_018085chr1108136 7184 6601 5921 5656 5354 5025 2923 2139 637 --36925 2115 480 16929
NM_018086chr221856 343 --21201 326 --
NM_018092chr1611262 ------
NM_018095chr111190 --2178 175 --
NM_018098chr31342 1269 1956 --
NM_018103chr11288 ------
NM_018105chr81870 ------
NM_018110chr164969 405 352 46 ------
NM_018117chr101115 1550 1754 --
NM_018120chr831036 201 131 11354 ----
NM_018121chr1021000 980 --1718 12248
NM_018124chr16----132 --
NM_018133chr31425 1645 ----
NM_018144chr102266 230 ------
NM_018150chr11867 ------
NM_018156chr142878 2669 2305 898 --12789 --
NM_018157chr1233223 2835 485 ----12839
NM_018159chrX--11117 ----
NM_018164chr12197 ------
NM_018181chr1821578 106 --21714 1404 --
NM_018182chr1721812 756 11858 --1409
NM_018184chr331620 1531 1353 ------
NM_018189chr32719 341 --2170 74 --
NM_018195chr1121889 696 ------
NM_018201chr91422 --22507 970 --
NM_018211chr121854 738 --153 --
NM_018214chr631231 138 43 ----11083
NM_018216chr11105 ------
NM_018227chr4----32269 2248 2094 --
NM_018240chr14916 796 789 59 ------
NM_018243chr423529 1492 13510 13816 --
NM_018244chr2041175 917 394 368 ------
NM_018246chr832351 1871 680 --22705 333 11834
NM_018247chr652164 1246 922 692 327 --22542 2017 12043
NM_018254chr132037 2019 1960 --22221 567 --
NM_018257chr2031603 276 61 --2401 73 --
NM_018263chr21676 --32418 2087 713 --
NM_018287chr102403 186 --1179 --
NM_018293chr332786 2455 502 --22500 505 12080
NM_018307chr171985 --1661 --
NM_018312chr11197 --121 --
NM_018313chr33665 545 297 ------
NM_018315chr421198 214 --1619 --
NM_018323chr421393 462 2482 95 --179
NM_018330chr1031704 383 106 --11071 --
NM_018334chr7----1152 --
NM_018339chr921445 714 ----11649
NM_018348chr16----167 1393
NM_018354chr20126 ----1253
NM_018360chrX1155 ------
NM_018361chr831475 1103 208 --11049 --
NM_018362chr1133199 517 368 ------
NM_018364chr1----33616 1378 369 21024 226
NM_018374chr713882 14510 35129 1236 941 --
NM_018388chrX3520 487 108 ------
NM_018403chr333478 2743 1595 1961 12548 11102
NM_018412chr71152 ------
NM_018413chr121117 ------
NM_018416chr1222572 155 ------
NM_018425chr1042590 1053 601 471 --22218 1056 --
NM_018427chr162499 355 --1358 --
NM_018429chr522606 914 ----12088
NM_018433chr22437 38 ------
NM_018440chr887629 6956 6778 6711 5677 2271 550 248 11219 55830 5631 1823 553 100 --
NM_018442chr1----1369 --
NM_018444chr82885 339 --11595 --
NM_018445chr151172 ------
NM_018452chr6_random62992 2853 2821 2680 2432 1233 23640 869 22824 2683 12857
NM_018462chr33737 636 31 ------
NM_018469chr1731457 1004 203 ------
NM_018482chr841925 1874 88 50 21702 1630 1264 192
NM_018488chr171604 --138 --
NM_018489chr13798 596 369 --1765 12231
NM_018490chr111749 2626 353 ----
NM_018509chr1721467 22 ------
NM_018534chr23622 239 55 ------
NM_018553chr1731366 662 630 21867 395 ----
NM_018557chr241429 1157 1147 24 --21467 238 --
NM_018566chr145129 4676 3968 3321 11766 --15017
NM_018569chr411253 ------
NM_018571chr2----152 --
NM_018584chr121194 437 ------
NM_018638chr1235558 4809 540 --25213 4099 14827
NM_018650chr11843 ------
NM_018667chr1631843 367 154 ------
NM_018682chr72261 226 ----1179
NM_018685chr71720 1816 ----
NM_018689chr1562573 2123 2081 1785 655 167 --21788 1083 --
NM_018691chr53846 313 145 ------
NM_018695chr532448 1908 972 ------
NM_018700chr511669 21574 1484 21210 303 --
NM_018703chr161111 --1129 --
NM_018704chr111583 ----1803
NM_018710chr811350 ----1188
NM_018712chr1111326 ----1412
NM_018717chr441774 1115 667 331 ------
NM_018844chr732027 305 269 ------
NM_018847chr921929 190 --11670 --
NM_018890chr711140 ------
NM_018896chr171251 ------
NM_018898chr531893 1736 885 ------
NM_018899chr531893 1736 885 ------
NM_018900chr531893 1736 885 ------
NM_018901chr531893 1736 885 ------
NM_018902chr531893 1736 885 ------
NM_018903chr531893 1736 885 ------
NM_018904chr531893 1736 885 ------
NM_018905chr531893 1736 885 ------
NM_018906chr531893 1736 885 ------
NM_018907chr531893 1736 885 ------
NM_018908chr531893 1736 885 ------
NM_018909chr531893 1736 885 ------
NM_018910chr531893 1736 885 ------
NM_018911chr531893 1736 885 ------
NM_018912chr521624 237 ------
NM_018913chr521624 237 ------
NM_018914chr521624 237 ------
NM_018915chr521624 237 ------
NM_018916chr521624 237 ------
NM_018917chr521624 237 ------
NM_018918chr521624 237 ------
NM_018919chr521624 237 ------
NM_018920chr521624 237 ------
NM_018921chr521624 237 ------
NM_018922chr521624 237 ------
NM_018923chr521624 237 ------
NM_018924chr521624 237 ------
NM_018925chr521624 237 ------
NM_018926chr521624 237 ------
NM_018927chr521624 237 ------
NM_018928chr521624 237 ------
NM_018929chr521624 237 ------
NM_018945chr61711 11251 ----
NM_018948chr131429 1276 1128 --1993 1160
NM_018951chr72470 298 --11239 --
NM_018953chr123743 643 568 --1792 --
NM_018972chr811929 --12398 --
NM_018976chr1211954 ------
NM_018979chr1222566 100 --1888 --
NM_018994chr11470 ------
NM_018999chr1024618 4106 13706 24084 4081 --
NM_019001chr384802 4480 4231 3996 3527 591 563 538 --34263 3548 159 --
NM_019004chr72868 749 --22121 811 22390 815
NM_019006chr153704 627 452 ------
NM_019008chr2273718 2971 2655 1307 450 324 98 ------
NM_019009chr1191853 1776 908 754 490 398 313 299 72 --12320 --
NM_019021chr112849 613 ------
NM_019022chr1842905 2740 986 383 --12276 --
NM_019027chr422535 265 ------
NM_019028chr111320 ------
NM_019045chrX1809 ------
NM_019046chr103724 256 40 ------
NM_019048chr2----171 --
NM_019057chr5123 ------
NM_019063chr22623 546 ------
NM_019074chr152772 355 --1108 --
NM_019083chr12620 118 ------
NM_019084chr1012229 11841 ----
NM_019091chr23849 755 50 --1852 --
NM_019096chr65947 916 119 67 31 ------
NM_019102chr71359 1423 ----
NM_019102chr71359 1423 ----
NM_019106chr2272289 2264 2231 2107 2099 704 313 12257 33455 1274 680 13421
NM_019114chr912147 12510 12026 --
NM_019116chr1663064 2914 1347 1123 730 697 --53067 1337 1330 662 659 --
NM_019555chr311612 ------
NM_019557chr11595 ------
NM_019558chr2156 ------
NM_019590chr10196 1196 ----
NM_019593chr2082740 2646 2034 879 860 661 555 43 --1940 --
NM_019600chr152622 231 1564 ----
NM_019606chr7144 ------
NM_019610chr111524 ------
NM_019613chr171247 --11240 --
NM_019842chr6--1440 ----
NM_019843chr221116 ------
NM_019845chr2--1268 ----
NM_019854chr122255 229 --1611 --
NM_019858chr121209 ------
NM_019895chr3----2463 427 --
NM_019903chr1011619 ------
NM_020039chr1251336 676 629 344 271 --11612 --
NM_020063chr1162 ------
NM_020116chr431440 1418 1205 --11265 --
NM_020122chr285387 5179 5031 4637 4376 726 310 37 14474 11582 --
NM_020123chr101612 ------
NM_020134chr21212 ------
NM_020141chr111962 21692 1582 ----
NM_020144chr711728 ------
NM_020148chr1842171 863 160 21 --22913 542 --
NM_020150chr1032093 1945 196 ------
NM_020151chr271729 1536 1434 1251 1213 107 66 ------
NM_020156chr7----2526 417 --
NM_020159chr411634 --11189 --
NM_020179chr11----1100 --
NM_020180chr181371 ------
NM_020182chr2043384 3324 2568 2505 ------
NM_020185chr6154 ------
NM_020193chr11----1144 --
NM_020198chr1711261 --21282 375 --
NM_020201chr171126 --1700 --
NM_020205chr183442 3368 2602 2272 972 921 799 155 ------
NM_020211chr152537 133 --31245 1125 382 --
NM_020214chr151266 ------
NM_020225chr4----1356 1131
NM_020228chr113993 734 623 --11922 --
NM_020231chr31138 ------
NM_020235chr31117 ------
NM_020238chr1141059 915 160 83 1853 1360 --
NM_020239chr122040 68 --22064 704 --
NM_020240chr551919 1723 830 774 508 --21949 462 1529
NM_020244chr12----340 37 34 --
NM_020248chr152036 1847 709 685 404 --32371 602 33 --
NM_020310chr1772725 2644 2494 2206 2147 378 182 --42115 2112 367 364 1371
NM_020311chr22501 234 ------
NM_020336chr2043645 3215 2891 1073 22475 1147 13144 --
NM_020337chr452503 1090 1001 629 481 ------
NM_020340chr641849 875 796 68 ------
NM_020341chr2011521 11561 21314 1253 --
NM_020342chr222291 2128 --12564 12132
NM_020346chr1131716 1381 119 ------
NM_020354chr103739 87 43 --146 --
NM_020362chr11137 --1317 --
NM_020374chr12----11554 --
NM_020381chr621934 567 ------
NM_020384chrX31608 1347 1315 --2239 112 --
NM_020387chr11208 ------
NM_020390chr344232 1830 1448 447 ------
NM_020403chr131619 --11266 2482 284
NM_020416chr442525 739 418 392 ------
NM_020429chr762433 2053 1959 959 731 288 1457 22078 1992 12925
NM_020432chr722170 681 ------
NM_020437chr22------1328
NM_020438chr91208 --21191 244 --
NM_020443chr186444 6124 2742 2504 2351 2320 945 162 ----12202
NM_020445chr72732 525 2808 258 1103 --
NM_020449chrX1274 --1201 --
NM_020453chr411448 ------
NM_020456chr132615 118 ------
NM_020457chr161249 ------
NM_020463chr241022 507 335 44 ------
NM_020465chr1641910 1750 562 146 --21919 1559 --
NM_020466chr664001 3756 3144 1930 768 49 11135 ----
NM_020474chr182774 373 ------
NM_020475chr842305 2143 1842 664 12248 ----
NM_020476chr842305 2143 1842 664 12248 ----
NM_020477chr842305 2143 1842 664 12248 ----
NM_020478chr842368 2206 1905 727 12311 ----
NM_020480chr842305 2143 1842 664 12248 ----
NM_020482chr6------1243
NM_020526chr121586 737 ------
NM_020532chr21297 1210 ----
NM_020630chr102676 647 --1572 --
NM_020640chr321933 345 --11764 --
NM_020647chr822234 721 --3656 583 495 --
NM_020651chr21368 --11512 11657
NM_020655chr1631397 556 226 ------
NM_020666chr5----1905 --
NM_020689chr2031687 1451 114 1300 ----
NM_020693chr112474 68 ------
NM_020697chr831173 1073 909 11042 ----
NM_020699chr1104947 3753 3472 1492 1313 1300 1232 1036 1025 202 --35324 1425 1422 --
NM_020703chr11572 ------
NM_020708chr201408 --12218 --
NM_020711chr232623 1722 653 ----12475
NM_020717chrX43220 1840 1514 275 --44577 1697 1422 1419 11701
NM_020718chr1675995 5876 5341 2237 1987 1566 958 14023 14432 11696
NM_020732chr63252 191 61 ------
NM_020734chr12----2789 82 13309
NM_020739chr1523767 2687 1136 ----
NM_020747chr52879 295 --1164 --
NM_020748chr1741982 1648 1381 35 ------
NM_020752chr1022905 1844 ------
NM_020761chr1751497 126 114 85 40 ------
NM_020762chr121260 ------
NM_020765chr1198 ------
NM_020766chrX64023 3740 2857 1390 968 540 1881 34346 3973 1159 --
NM_020769chrX2797 99 ------
NM_020772chr17148486 8033 7765 6786 6367 6176 6124 5760 5635 2844 2235 1667 1293 356 --47256 6048 2818 952 15688
NM_020774chr1854159 1826 1742 1562 1549 --26209 1398 11357
NM_020783chr18----12440 1122
NM_020791chr1731315 1275 1241 --21306 943 --
NM_020794chr111124 ----11018
NM_020795chr1721670 711 ------
NM_020796chr531905 1858 605 22640 1222 12335 --
NM_020799chr102257 174 ------
NM_020800chr31122 179 ----
NM_020801chr552524 1701 888 776 650 ------
NM_020804chr622574 2403 1752 11643 --
NM_020807chr161219 ------
NM_020808chr12815 757 --1111 11058
NM_020809chr1132290 2043 1956 ----22229 902
NM_020810chr1442597 1363 792 666 --2865 771 --
NM_020818chr14------1333
NM_020819chr6--1468 1769 --
NM_020824chr101239 ------
NM_020825chr1662779 2564 2377 572 373 141 23789 1285 1428 --
NM_020830chr22856 407 ----1754
NM_020839chr3----1525 --
NM_020844chr887046 6249 5130 5107 2992 2167 1306 497 ----32522 2486 351
NM_020845chr1252469 1752 1664 1617 838 ------
NM_020850chr1652994 2543 2340 1058 1007 22244 1160 ----
NM_020854chr182571 162 ------
NM_020856chr191181 11248 ----
NM_020858chr1531809 1733 1668 ----1837
NM_020860chr4----11047 --
NM_020861chr6----21072 401 --
NM_020868chr231300 316 80 ----1182
NM_020872chr3----11156 1562
NM_020873chr3----1294 --
NM_020899chr172434 149 ------
NM_020917chr1961205 905 662 608 578 352 ------
NM_020918chr103875 594 584 --32793 1336 393 --
NM_020920chr14136 ------
NM_020921chr1423376 2533 --12229 13126
NM_020922chrX2660 547 ----1382
NM_020925chr121108 478 ------
NM_020927chr1641760 696 143 92 --1420 --
NM_020935chr233925 625 50 --1677 12891
NM_020940chr101116 --11987 12628
NM_020947chr1621473 843 --11910 --
NM_020956chr1974648 3819 3164 1773 1426 1324 1053 ------
NM_020958chr14----1134 --
NM_020962chr1552400 1953 1829 660 129 ------
NM_020963chr1--1173 ----
NM_020964chr1834070 3247 1889 11881 260 35 --
NM_020971chr191183 ------
NM_020977chr432060 1779 384 ------
NM_020983chr123942 899 239 11827 ----
NM_020987chr1041265 1007 489 114 ----2943 283
NM_020988chr163939 484 178 --153 --
NM_020993chr1231115 1025 185 --2299 296 --
NM_021003chr14----2814 811 --
NM_021005chr151417 ------
NM_021007chr231500 566 406 ----12157
NM_021009chr12160 ------
NM_021032chr32427 192 ------
NM_021033chr1353377 3019 2762 1050 896 1583 23122 3119 --
NM_021035chr2031210 1134 914 ------
NM_021038chr373364 3286 3189 3028 2404 736 197 --12622 12103
NM_021064chr63655 480 384 ----11687
NM_021069chr431941 427 162 ------
NM_021072chr511820 --12531 --
NM_021088chr21159 1392 ----
NM_021096chr2263227 3025 2992 2928 1071 1054 1571 12115 --
NM_021097chr232011 956 949 --1390 11234
NM_021098chr161694 ------
NM_021101chr311684 12171 21860 868 12151
NM_021104chr121288 ------
NM_021109chrX2124 73 ------
NM_021109chrX2124 73 ------
NM_021111chr911325 --11266 --
NM_021120chrX83055 2790 2671 2412 981 844 724 439 --13110 1985
NM_021131chr951161 927 432 339 116 --21452 379 --
NM_021132chr101946 --1974 --
NM_021136chr142154 143 ----1246
NM_021140chrX21186 96 ------
NM_021145chr71321 --1141 1145
NM_021148chr721746 869 ------
NM_021153chr181170 ------
NM_021155chr191537 1294 12260 --
NM_021159chr421697 471 11120 1238 --
NM_021168chr1621575 209 --11478 11579
NM_021180chr1--2759 97 ----
NM_021183chrX21733 137 --22280 68 --
NM_021188chr14----1447 --
NM_021189chr11933 ------
NM_021190chr1------2329 139
NM_021198chr22306 290 --1263 --
NM_021224chr91112 ------
NM_021244chr6263 51 ------
NM_021248chr20131 ------
NM_021249chr1411463 --21594 1440 --
NM_021255chr1432833 2816 181 --41577 1574 1174 89 --
NM_021260chr142326 94 --2449 329 --
NM_021267chr1951344 1280 1230 976 865 --2979 331 --
NM_021569chr9----1378 --
NM_021574chr2242181 2104 615 422 --21941 425 --
NM_021620chr61731 ------
NM_021622chr1022268 483 --11979 11555
NM_021627chr33909 181 29 --21216 402 --
NM_021637chrX2907 231 ------
NM_021643chr231766 1404 1270 ------
NM_021644chr102268 182 ------
NM_021647chr443765 3314 707 46 14505 11007 1711
NM_021729chr111267 ------
NM_021784chr20197 ------
NM_021800chr10151 ------
NM_021807chr721027 488 1367 ----
NM_021809chr2042222 2160 2036 519 --72327 1955 1642 380 270 261 258 --
NM_021813chr6115668 4988 4819 4731 4511 4303 4021 3620 2332 1712 82 --23882 3701 --
NM_021814chr621646 85 --1265 --
NM_021825chr11228 21 ------
NM_021905chr652146 784 451 41 24 --3460 457 454 --
NM_021911chr554721 4083 1394 161 122 --1391 --
NM_021912chr1514057 12909 ----
NM_021913chr1931768 1446 321 ------
NM_021914chr1412430 1638 ----
NM_021925chr221346 1162 ----11457
NM_021932chr111289 --142 --
NM_021935chr31991 --1688 --
NM_021940chr631320 1219 259 --21323 508 --
NM_021943chr641905 1761 506 31 ------
NM_021946chrX31297 1143 220 ------
NM_021949chrX22607 742 --22548 2458 --
NM_021951chr91606 1802 ----
NM_021952chr11143 ------
NM_021954chr1343581 2741 1096 662 --1177 --
NM_021956chr62975 330 --11515 --
NM_021959chr6------1152
NM_021960chr111735 ------
NM_021961chr1146163 5038 4939 4522 --16949 15169
NM_021964chr375946 5423 4735 2308 1906 1290 84 15166 12598 --
NM_021967chr521001 390 ------
NM_021970chr4--1173 1582 --
NM_021988chr2011321 --51339 1230 1227 1224 349 --
NM_021998chrX41244 1223 1118 1030 1582 ----
NM_021999chr131542 ------
NM_022003chr113432 426 45 --11254 --
NM_022037chr22767 272 ------
NM_022041chr1661918 1713 1701 894 698 361 12431 ----
NM_022048chr1566396 5445 5158 1182 748 226 --1229 --
NM_022051chr13516 168 142 --1640 --
NM_022059chr17141 152 ----
NM_022072chr31246 ------
NM_022079chr101817 ------
NM_022080chr2052788 2734 872 304 101 --1153 --
NM_022085chr651155 1127 1094 545 97 --1560 --
NM_022114chr174718 3758 3661 3149 3063 1632 1623 ------
NM_022117chrX2411 239 ------
NM_022121chr6132 --135 --
NM_022130chr521076 238 ------
NM_022133chr831712 1429 1388 --1182 11224
NM_022137chr1441762 1472 424 339 --1396 --
NM_022166chr1634355 1509 402 13905 35393 1627 1079 --
NM_022169chr1131030 323 288 1425 11244 --
NM_022170chr73348 233 187 1152 ----
NM_022173chr22767 272 ------
NM_022307chr71274 --188 --
NM_022351chr8------13442
NM_022361chr6--1390 ----
NM_022372chr161175 --1529 --
NM_022373chr72629 316 ------
NM_022374chr23196 119 96 ------
NM_022437chr21138 ------
NM_022442chr2011321 --51339 1230 1227 1224 349 --
NM_022456chr1297459 6248 4983 4793 4667 2157 1165 934 166 --16557 2938 512
NM_022457chr1----1232 --
NM_022459chr1386256 5643 4711 4041 1932 1551 998 775 1986 --1187
NM_022463chr1711460 ------
NM_022465chr1242182 1980 1118 1076 --11129 --
NM_022474chr1442356 2081 2048 1018 --12319 --
NM_022484chr72118 76 ------
NM_022497chr332547 823 409 1186 ----
NM_022572chr21337 --21483 1177 1341
NM_022574chr742046 816 655 294 --32007 1719 1716 --
NM_022644chr172315 27 ------
NM_022648chr284612 4262 3592 3045 1342 1022 965 554 --11161 --
NM_022650chr51351 ------
NM_022652chr123351 207 76 ------
NM_022658chr12----21072 1069 --
NM_022726chr621786 1408 --21675 1513 --
NM_022735chr141854 1369 561 344 ------
NM_022737chr1941024 309 216 196 --1199 --
NM_022739chr17--1231 ----
NM_022745chr122142 404 ----12297
NM_022749chr841064 571 459 288 ------
NM_022751chr18--1246 ----
NM_022753chr132548 2361 899 --22651 77 --
NM_022754chr5--1145 ----
NM_022756chr121097 1019 1261 ----
NM_022763chr331220 981 777 ----12336
NM_022767chr1551484 1228 482 365 196 ----11908
NM_022768chr12371 272 ------
NM_022771chr122992 39 ------
NM_022781chr933016 2415 548 --3856 621 290 11298
NM_022787chr121757 92 --22536 1749 --
NM_022802chr1061593 1459 657 536 343 130 ------
NM_022817chr22358 80 --1113 11924
NM_022821chr12474 150 ------
NM_022822chr112856 840 --2877 79 --
NM_022823chr21435 1508 ----
NM_022824chr521764 331 11420 ----
NM_022826chr2----1172 --
NM_022828chr5----21759 125 --
NM_022831chr12698 487 --11675 --
NM_022833chr941004 440 333 23 --11188 --
NM_022836chr11539 --3407 404 401 --
NM_022841chr152368 121 1269 ----
NM_022844chr162936 910 ------
NM_022845chr162682 26 --12012 --
NM_022893chr252913 2584 993 484 412 --32319 431 428 --
NM_022894chr241120 638 225 174 ------
NM_022898chr1433966 3245 1880 1920 43969 3437 3332 438 11100
NM_022910chr1641910 1750 562 146 --21919 1559 --
NM_022912chr262580 2272 1888 996 936 419 --33049 1108 390 --
NM_022917chr93901 836 398 ------
NM_022918chr1111330 --2517 179 11563
NM_022965chr441193 623 257 230 11604 154 --
NM_022970chr10----1529 --
NM_022977chrX3681 559 449 --31765 1010 1007 11980
NM_022978chr521001 390 ------
NM_023000chr1441452 389 170 35 ------
NM_023001chr1441452 389 170 35 ------
NM_023009chr1148 ------
NM_023012chr121101 ----1550
NM_023037chr1361040 1007 746 728 225 44 ------
NM_023039chr51279 ------
NM_023071chr1211124 1263 ----
NM_023079chr171616 ------
NM_023105chr821868 227 1753 42058 895 892 828 12417
NM_023106chr821868 227 1753 42058 895 892 828 12417
NM_023110chr821868 227 1753 42058 895 892 828 12417
NM_023111chr821868 227 1753 42058 895 892 828 12417
NM_023929chr8130 --2792 118 --
NM_024007chr522433 2307 --22761 1933 --
NM_024015chr1741170 1128 1008 978 ------
NM_024034chr202182 47 ------
NM_024046chr331084 934 494 --1291 --
NM_024050chr191184 ------
NM_024055chr51615 ------
NM_024057chr121130 ------
NM_024069chr19199 --1704 --
NM_024082chrX1111 ------
NM_024085chr22906 693 --1756 --
NM_024090chr431864 1843 550 --1228 --
NM_024092chr114937 773 407 49 --2776 357 --
NM_024107chr172694 268 --1697 --
NM_024117chr91933 --1936 --
NM_024122chrX------1251
NM_024293chr21160 --262 59 --
NM_024312chr1221610 1155 1291 1133 --
NM_024319chr11106 --125 --
NM_024328chr141172 1469 --1690
NM_024329chr1----11181 --
NM_024408chr113511 13554 21281 50 13605
NM_024429chr72749 236 ------
NM_024494chr11688 1102 ----
NM_024496chr141628 ------
NM_024501chr22564 471 1269 ----
NM_024511chr431067 966 773 --22758 726 13208
NM_024520chr2140 ------
NM_024523chr74965 942 292 73 --1171 --
NM_024524chr332683 2563 2550 --23120 582 --
NM_024525chr11511 ------
NM_024529chr111082 ------
NM_024539chrX21215 498 --1312 --
NM_024551chr1222568 1018 ------
NM_024551chr1222568 1018 ------
NM_024554chr141586 1168 170 109 --11457 --
NM_024556chr112375 153 ------
NM_024563chr511435 --11738 --
NM_024567chr81579 1124 1262 --
NM_024569chr162605 2381 1929 1074 985 279 --1329 --
NM_024582chr4166 --1152 --
NM_024594chr541876 651 127 118 ------
NM_024595chr121144 50 ------
NM_024610chr31314 ------
NM_024612chr17----1415 1419
NM_024613chr811373 ------
NM_024615chr51249 ------
NM_024618chr11------1551
NM_024627chr2274932 4780 4754 3870 3501 231 27 13832 54793 4635 4199 746 218 --
NM_024630chr61250 --2555 513 --
NM_024636chr711960 --12017 --
NM_024645chr8----11503 --
NM_024646chr123570 369 --13297 --
NM_024652chr15------1132
NM_024659chr22961 123 ------
NM_024665chr354658 4545 4137 1786 232 11382 11318 --
NM_024681chr221262 ------
NM_024686chr1----2500 96 --
NM_024692chr221518 287 --1757 --
NM_024698chr1151337 1292 1204 1131 180 --31346 1343 1340 --
NM_024704chr20--11121 ----
NM_024721chr8----12684 --
NM_024740chr1154048 4011 1461 449 374 ------
NM_024742chr1641397 1215 101 82 --1724 --
NM_024744chr242163 2040 253 148 ------
NM_024745chr164155 83 67 49 ------
NM_024755chr15--1578 ----
NM_024757chr92436 369 ------
NM_024761chr935032 1284 37 --24316 1669 21654 188
NM_024779chr1221412 410 ------
NM_024780chr16------1392
NM_024811chr1121316 719 --31319 764 726 --
NM_024818chr341386 1119 348 263 ------
NM_024828chr921182 148 --11514 --
NM_024834chr1021696 359 --21917 284 --
NM_024837chr15--1235 1484 --
NM_024859chrX1123 1796 2344 341 --
NM_024875chr1021744 56 ------
NM_024877chr1941039 182 167 104 ------
NM_024887chr152006 1774 1658 1629 1341 --1517 --
NM_024893chr202771 80 --1975 --
NM_024900chr461936 1768 1556 848 827 473 --2874 867 --
NM_024900chr461936 1768 1556 848 827 473 --2874 867 --
NM_024915chr852231 1817 1773 1103 512 ----1116
NM_024922chr1641603 1377 725 520 ------
NM_024939chr1651536 1470 1351 1122 634 ----11481
NM_024941chr5--11226 ----
NM_024944chr211183 ------
NM_024949chr464539 3141 1842 522 336 249 14631 ----
NM_024953chr1222568 716 --42315 2312 2309 2306 --
NM_024989chr256939 5370 4993 921 470 11480 --1733
NM_024991chr1063247 1205 967 610 463 340 ------
NM_024993chr211346 --11235 --
NM_025045chr22148 ------
NM_025054chr833580 2661 180 1216 1656 --
NM_025058chr1--1723 ----
NM_025073chr133186 1740 1058 --13159 14233
NM_025074chr443013 2836 1061 808 ------
NM_025076chr22617 271 ------
NM_025083chr1531558 1313 30 11424 141 --
NM_025106chr121519 689 ------
NM_025115chr81115 1320 ----
NM_025125chr1031622 649 426 ------
NM_025126chr121293 --2517 514 --
NM_025129chr19--141 ----
NM_025133chr2----1362 --
NM_025134chr16--12368 ----
NM_025146chr3--11016 1701 12735
NM_025151chr832018 1570 441 ------
NM_025154chr71128 --11509 --
NM_025160chr153913 3458 1497 1277 641 --23001 339 --
NM_025164chr1132239 1890 123 --21682 154 --
NM_025179chr154466 3950 3666 3251 106 13357 33714 3206 308 --
NM_025181chr22729 284 ------
NM_025191chr153386 2167 772 467 166 ------
NM_025195chr841761 570 188 118 ------
NM_025202chr231026 948 83 ------
NM_025203chr241340 544 168 21 ------
NM_025211chr9175 ------
NM_025222chr31142 --1328 --
NM_025234chr15127 --1165 --
NM_025236chr6150 ------
NM_025256chr6295 70 ------
NM_025263chr641271 459 406 166 --1315 --
NM_030579chr1673491 3363 3318 2728 2683 2412 1428 --52698 2695 2692 2689 2686 --
NM_030583chr8----1380 --
NM_030594chr1521241 951 ------
NM_030621chr14134168 4123 4116 4031 3314 2845 2589 1641 1539 1142 1040 993 553 --32982 2979 996 11175
NM_030625chr1042356 1932 725 593 ----161
NM_030627chr521641 1106 --13286 --
NM_030629chr16----11872 --
NM_030634chr162272 2261 1811 500 391 85 --42127 2124 1997 1961 --
NM_030645chr11874 --1503 --
NM_030647chr755593 5070 4572 1058 143 --44510 4507 1033 1030 --
NM_030648chr454279 3787 1634 1413 97 ------
NM_030650chr243969 3316 2719 1139 13435 ----
NM_030652chr6------1292
NM_030661chr741185 1145 206 63 ------
NM_030664chr10----2656 415 --
NM_030665chr1731371 406 100 ------
NM_030667chr1221308 1184 --1832 --
NM_030668chr1221308 1184 --1832 --
NM_030669chr1221308 1184 --1832 --
NM_030670chr1222340 2216 --11864 --
NM_030671chr1222340 2216 --11864 --
NM_030674chr1225421 1286 ------
NM_030751chr10195 ------
NM_030751chr10195 ------
NM_030756chr102247 25 ------
NM_030761chr162645 2393 2107 2091 1681 804 ----12631
NM_030762chr1221610 1256 --31379 1376 1373 11383
NM_030772chr1--1104 --1457
NM_030790chr163253 223 34 ------
NM_030795chr8----1461 --
NM_030796chr731644 1581 507 1100 1198 --
NM_030799chr521893 83 --12084 --
NM_030805chr211058 --31202 1061 224 --
NM_030806chr167944 7028 6696 2248 582 242 36282 1779 518 1223 1227
NM_030808chr172903 337 ------
NM_030809chr1232493 889 93 12281 196 --
NM_030810chr651155 1127 1094 545 97 --1560 --
NM_030881chr2232349 2227 842 --12123 --
NM_030884chr372216 1995 1861 1803 749 715 687 ------
NM_030885chr332135 2064 25 ------
NM_030906chr112160 40 1514 --1591
NM_030914chr91680 ------
NM_030915chr252159 1969 888 504 245 --1286 --
NM_030916chr12676 308 --1845 --
NM_030920chr11507 ----11579
NM_030922chr15----1670 --
NM_030939chr61235 ------
NM_030945chr52740 98 ------
NM_030948chr62201 30 ------
NM_030949chr631532 1075 1058 --1572 --
NM_030953chr5--1526 11552 --
NM_030962chr112504 46 1147 11029 --
NM_030963chr62579 213 ------
NM_030964chr553443 3272 2751 1470 332 --11171 --
NM_030978chr91444 ------
NM_030981chr1161045 990 365 335 235 158 --1241 --
NM_031157chr12--1113 ----
NM_031216chr1831869 908 44 --238 30 --
NM_031243chr741915 1711 592 479 --32419 843 726 --
NM_031262chr9----1122 --
NM_031263chr9----1179 --
NM_031267chr7----1186 --
NM_031268chr16164893 4884 4590 4339 4069 3679 3311 2089 1721 1480 1203 1163 978 907 629 399 --34204 1724 1206 --
NM_031283chr21266 ------
NM_031297chr9146 ------
NM_031305chr42607 321 11878 1519 --
NM_031314chr142460 363 11492 ----
NM_031371chr1140 ------
NM_031371chr1140 ------
NM_031372chr4--11508 21465 1462 --
NM_031411chr531893 1736 885 ------
NM_031412chr122986 224 11019 2937 184 --
NM_031417chr1932465 900 643 --1423 --
NM_031418chr1142753 1729 904 835 --32715 2523 573 --
NM_031431chr1321359 523 --21849 126 --
NM_031435chr1222534 2210 --33191 2625 2328 --
NM_031439chr831934 1391 263 ------
NM_031442chrX3737 449 226 11177 22993 2443 --
NM_031445chr222801 2157 --11234 --
NM_031452chr151172 ------
NM_031468chr786234 5331 3112 2778 2275 1935 756 28 --11967 --
NM_031469chr62888 487 --1891 12491
NM_031475chr12725 220 --1245 --
NM_031476chr1622767 2087 --21787 984 --
NM_031483chr2022415 68 ------
NM_031844chr134066 1640 1356 1651 1312 --
NM_031845chr23977 882 355 --13673 --
NM_031847chr23977 882 355 --13673 --
NM_031849chr531893 1736 885 ------
NM_031850chr32657 228 ----1831
NM_031850chr32657 228 ----1831
NM_031857chr531893 1736 885 ------
NM_031858chr1731543 1072 576 --134 --
NM_031860chr531893 1736 885 ------
NM_031862chr1731543 1072 576 --134 --
NM_031890chr2252603 2263 2236 2229 805 --1824 --
NM_031899chr321008 283 --198 --
NM_031908