TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-17-3p
miRNA Sequence: ACUGCAGUGAAGGCACUUGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr872369 2297 2209 1990 1716 963 881 ----1207
NM_000038chr531973 663 527 --11276 --
NM_000052chrX41078 1038 736 579 --1538 13166
NM_000053chr1321720 145 ----2394 269
NM_000055chr31394 ------
NM_000068chr1911560 11344 ----
NM_000074chrX3900 869 158 ------
NM_000084chrX56278 1429 1024 992 369 --36310 2635 1345 --
NM_000092chr254459 4270 4246 3840 178 12962 24219 855 --
NM_000093chr982499 2436 2217 2056 1788 695 531 226 12243 ----
NM_000109chrX42594 2554 2441 2372 ----1212
NM_000125chr663672 3562 1140 887 849 42 33175 1274 1165 1553 1662
NM_000129chr61551 --1960 1121
NM_000138chr1552275 2117 2003 599 458 ------
NM_000161chr141801 ------
NM_000163chr522008 1578 --1605 --
NM_000165chr631649 1275 1193 161 ----
NM_000168chr763271 2589 2395 1254 270 22 13067 2810 565 --
NM_000176chr553796 3748 3283 1362 1245 180 13277 --
NM_000189chr22775 655 ------
NM_000208chr1934603 3926 3780 34614 3164 186 ----
NM_000214chr2031217 437 240 --11727 --
NM_000216chrX43037 1484 1138 29 23891 912 23122 2778 --
NM_000217chr1295213 1566 1479 1040 834 719 631 544 442 34951 3759 1587 --21684 745
NM_000222chr471910 1362 1315 580 198 183 118 --11432 --
NM_000245chr7112182 2065 1774 1630 1564 1436 787 591 563 218 104 ------
NM_000248chr373005 2941 2448 2415 2044 1919 534 ------
NM_000255chr61345 ------
NM_000259chr15115935 5829 4609 4009 2497 2236 2209 1969 1451 1281 1262 --25990 4728 --
NM_000260chr112435 77 --1473 --
NM_000264chr93702 648 139 ------
NM_000266chrX1190 ----142
NM_000267chr1783344 3222 3157 3098 1334 1188 253 99 ------
NM_000276chrX42250 2119 1790 385 --1674 1101
NM_000284chrX41872 1398 381 148 11353 21244 780 --
NM_000293chr163948 925 285 ------
NM_000297chr421697 631 11876 ----
NM_000299chr182815 2634 2130 901 557 405 377 32 --32753 951 532 --
NM_000301chr61171 ------
NM_000310chr111151 ------
NM_000314chr1042550 1219 1089 441 --12988 --
NM_000318chr842225 2065 514 217 --32891 2233 577 12962
NM_000319chr1211218 ------
NM_000321chr1331739 1256 68 ------
NM_000325chr42696 496 ------
NM_000329chr12803 786 1114 ----
NM_000332chr6137067 6026 5508 5145 2363 2078 1570 1254 1181 899 680 365 60 22338 1275 166 16135
NM_000346chr1742022 1473 1444 1268 ------
NM_000348chr231561 1065 69 ----11086
NM_000350chr1125 --1117 --
NM_000362chr2232593 2426 540 22274 1357 ----
NM_000367chr652188 1896 1873 659 445 22063 260 ----
NM_000368chr984591 4150 4114 3975 3952 3929 3798 869 23700 3075 44752 1063 979 433 --
NM_000378chr1121170 283 ------
NM_000389chr631422 1150 22 ------
NM_000393chr241838 1423 1335 427 1268 ----
NM_000408chr233417 3266 3139 --12792 --
NM_000421chr171106 ------
NM_000430chr1743438 2698 647 187 ------
NM_000434chr6--166 ----
NM_000435chr192659 138 ------
NM_000439chr56710 541 491 407 300 145 11797 ----
NM_000441chr751885 1862 1800 806 409 11968 12110 --
NM_000448chr1163053 2872 2390 2335 2276 2128 --32549 2169 263 --
NM_000449chr12477 218 --11179 --
NM_000451chrX1382 1480 --11971
NM_000454chr21190 160 ----
NM_000458chr171900 ------
NM_000459chr92831 191 --1885 1143
NM_000461chr354601 3469 738 506 184 11273 ----
NM_000462chr1521334 500 --21787 659 11477
NM_000478chr11111 ----1277
NM_000484chr213838 788 250 ------
NM_000489chrX3831 632 89 ----12459
NM_000492chr731514 1497 578 ------
NM_000495chrX----1363 --
NM_000503chr831816 654 369 11782 ----
NM_000527chr1932443 1846 1823 ------
NM_000533chrX41924 1713 263 147 11249 1551 --
NM_000538chr133582 439 157 1101 ----
NM_000544chr6_cox_hap142465 828 295 111 11101 ----
NM_000555chrX117301 6827 6807 6071 5910 4981 2515 1853 1706 1609 824 1349 16600 1662
NM_000572chr11831 ------
NM_000596chr71167 ------
NM_000609chr1022986 2965 --12114 --
NM_000610chr111554 ------
NM_000612chr1143545 3138 44 23 ------
NM_000615chr1142734 1867 911 650 --1623 --
NM_000617chr1231979 1719 25 ------
NM_000618chr1225367 4900 12160 16072 --
NM_000618chr1225367 4900 12160 16072 --
NM_000619chr121510 ------
NM_000633chr18105099 4861 4569 3862 3695 3612 3206 1722 1331 96 --24736 1501 11233
NM_000673chr41743 1321 ----
NM_000681chr1031128 144 134 --140 --
NM_000684chr1031137 1131 886 ------
NM_000686chrX1393 --11188 --
NM_000689chr9------1388
NM_000693chr1521695 617 11803 ----
NM_000719chr12136728 6665 5963 5640 5033 4790 1701 1630 1542 1461 945 831 743 35712 427 194 ----
NM_000724chr104775 554 218 92 ------
NM_000726chr211230 ------
NM_000739chr72181 94 ------
NM_000767chr1941390 1106 295 160 161 ----
NM_000780chr81368 11072 --149
NM_000800chr541517 1504 347 270 1164 ----
NM_000801chr2021102 1057 ------
NM_000806chr521349 374 --11484 --
NM_000807chr4------1180
NM_000810chr151534 ------
NM_000811chr52632 312 ------
NM_000812chr41150 ------
NM_000813chr545441 5003 3672 3646 14906 35566 4166 3885 11491
NM_000814chr1553849 1618 1260 963 265 --13497 --
NM_000824chr43658 293 105 ------
NM_000826chr442410 861 498 441 ----11926
NM_000827chr54403 326 242 114 ----12054
NM_000829chr1182243 2200 2003 1787 848 782 687 660 ------
NM_000831chr195630 5539 4686 4591 4552 4329 4227 2290 1784 45589 5033 2445 330 ----
NM_000836chr19----1960 --
NM_000838chr642180 2070 669 640 1708 11026 --
NM_000840chr71145 ------
NM_000859chr521649 669 --1410 --
NM_000868chrX2609 352 ------
NM_000872chr101538 21145 47 1411 --
NM_000875chr1556168 5660 4635 440 156 ----12493
NM_000876chr651425 1319 1074 1035 303 ------
NM_000877chr273077 3005 2767 715 472 449 54 32412 676 84 12072 --
NM_000879chr5121 --157 --
NM_000891chr1763643 2955 2819 426 279 155 12443 ----
NM_000899chr1274308 3165 1756 513 406 322 285 --32925 399 258 --
NM_000901chr462548 2004 1867 1755 717 690 ------
NM_000908chr5--1144 ----
NM_000912chr833559 2419 484 11113 182 --
NM_000919chr53495 120 100 ------
NM_000921chr122206 118 ----190
NM_000933chr2021208 169 21220 690 1347 --
NM_000940chr7182 ------
NM_000944chr451698 325 292 74 53 ----12330
NM_000945chr262076 1511 805 754 489 170 ------
NM_000950chrX41091 895 741 388 23277 436 32842 2777 1200 --
NM_000959chr163964 958 731 388 176 83 ------
NM_000961chr2042859 1482 1467 214 1869 ----
NM_000963chr121744 1582 --2998 806 --
NM_000965chr33441 368 276 ------
NM_001001132chr2141452 1438 1136 436 1219 --1157
NM_001001323chr1272665 2308 2218 2139 2126 876 317 ------
NM_001001331chr342137 652 423 338 1816 12586 1539
NM_001001342chr1031138 518 471 ------
NM_001001344chrX82558 2371 2166 1715 1699 818 563 514 11981 ----
NM_001001389chr111554 ------
NM_001001390chr111554 ------
NM_001001391chr111554 ------
NM_001001392chr111600 ------
NM_001001395chr1232453 410 149 ------
NM_001001419chr545043 4321 1538 964 --25049 4448 --
NM_001001420chr545043 4321 1538 964 --25049 4448 --
NM_001001433chr2062466 2314 2291 731 719 235 ----21239 321
NM_001001481chr84824 593 577 133 ------
NM_001001484chr1061823 1798 1722 516 451 314 144 ----
NM_001001521chr22108 100 ------
NM_001001557chr8158 176 ----
NM_001001664chr263871 3794 3149 2577 1242 301 ------
NM_001001665chr293301 3259 2805 2782 2375 2314 821 794 485 ------
NM_001001701chr411626 22287 158 12069 --
NM_001001870chr171790 ------
NM_001001872chr142479 215 ------
NM_001001890chr2154125 2659 740 514 156 --13627 13197
NM_001001924chr821559 53 1758 12055 --
NM_001001925chr821559 53 1758 12055 --
NM_001001928chr22168294 7452 7337 6398 5603 5423 5102 5053 2516 2183 2159 2115 832 824 809 133 11365 ----
NM_001001931chr821559 53 1758 12055 --
NM_001001974chr1052398 2382 2269 2006 1821 ------
NM_001001995chrX21809 68 --11178 --
NM_001002033chr17276 57 ------
NM_001002233chr852216 2147 2064 1414 188 1500 ----
NM_001002243chr21376 ------
NM_001002254chrX2183 59 --1963 --
NM_001002295chr106982 323 307 279 70 45 ------
NM_001002838chrX51306 661 548 389 203 2191 174 ----
NM_001002843chr152810 248 ------
NM_001002860chr1484347 4209 3383 1687 1069 992 429 371 13963 11054 --
NM_001002876chr221272 2356 38 1324 --
NM_001002909chr1761704 879 806 577 277 140 ------
NM_001002919chr2--2168 116 ----
NM_001003652chr18148326 8034 7677 7028 6766 6263 3108 2422 1900 1449 1406 1348 1127 428 27981 533 11485 --
NM_001003674chr18146972 6782 5563 5475 5059 4482 2447 2372 1714 1691 1171 910 780 161 55528 4551 1964 1637 347 16402 --
NM_001003675chr18146972 6782 5563 5475 5059 4482 2447 2372 1714 1691 1171 910 780 161 55528 4551 1964 1637 347 16402 --
NM_001003681chr2242027 586 167 96 171 ----
NM_001003694chr33493 454 171 ------
NM_001003698chr641877 1611 1533 1510 ----11925
NM_001003699chr641877 1611 1533 1510 ----11925
NM_001003712chr1213876 14008 --13239
NM_001003760chr623667 2696 --11312 --
NM_001003792chr341127 1006 953 859 ------
NM_001003793chr341127 1006 953 859 ------
NM_001003794chr353054 2735 1886 901 357 22777 603 ----
NM_001003800chr9103490 2578 1229 1213 1098 538 451 271 260 25 ------
NM_001003845chr21533 ------
NM_001004065chr973318 3289 2419 753 453 314 137 ------
NM_001004127chr131913 1237 ----
NM_001004304chr1232850 1069 512 22677 1191 1615 --
NM_001004317chr674338 4011 3991 3785 3391 3181 2772 --13069 --
NM_001004330chr121177 ------
NM_001004342chr175999 5096 4948 4411 3718 2010 1813 53957 2304 1826 1756 549 15498 25415 475
NM_001004360chr261495 1350 1312 428 410 66 ------
NM_001004419chr1273862 3745 3325 3266 3076 3014 754 11279 ----
NM_001004441chr51572 ------
NM_001004720chr22944 734 ------
NM_001004722chr241113 903 166 56 ------
NM_001005207chr17123 1257 ----
NM_001005332chrX1210 ------
NM_001005333chrX1210 ------
NM_001005337chr182815 2634 2130 901 557 405 377 32 --32753 951 532 --
NM_001005404chr1764329 3787 3393 1702 884 535 14276 --21169 1162
NM_001005417chr11679 ------
NM_001005463chr1042590 1828 791 781 12110 12141 --
NM_001005473chr535502 1176 1097 26431 4361 ----
NM_001005474chr321474 517 ------
NM_001005476chr21231 ------
NM_001005502chr12115172 4888 4703 4464 3828 3805 1668 1505 1166 623 67 14191 14639 11635
NM_001005609chrX53530 3424 1190 582 105 --1461 --
NM_001005732chr213263 200 36 ------
NM_001005733chr212200 36 ------
NM_001005739chr22574 309 ------
NM_001005746chr211230 ------
NM_001005747chr211230 ------
NM_001005781chr22435 405 ------
NM_001005782chr23884 854 268 ------
NM_001005849chr172193 75 ------
NM_001005861chr32859 756 ------
NM_001005914chr31402 ------
NM_001006115chr362597 1950 801 526 342 145 --142 --
NM_001006117chrY129 ------
NM_001006600chr551782 1744 1532 691 172 ----1802
NM_001006605chr12772 449 ------
NM_001006605chr12772 449 ------
NM_001006610chr161839 1923 ----
NM_001006626chr72181 94 ------
NM_001006627chr72181 94 ------
NM_001006628chr72181 94 ------
NM_001006629chr72181 94 ------
NM_001006630chr72181 94 ------
NM_001006631chr72181 94 ------
NM_001006632chr72181 94 ------
NM_001006634chr16--2485 78 ----
NM_001006636chr221030 28 1103 ----
NM_001006657chr242211 2190 1023 27 11094 ----
NM_001006944chr112196 80 ------
NM_001007024chr1754386 3527 2800 528 504 13603 33351 757 580 21704 634
NM_001007025chr1754386 3527 2800 528 504 13603 33351 757 580 21704 634
NM_001007027chr111203 ------
NM_001007097chr964641 4360 3981 1673 1513 1390 --34722 1742 969 --
NM_001007099chr11205 ------
NM_001007100chr11205 ------
NM_001007102chr621545 506 11186 ----
NM_001007156chr153788 767 116 1725 ----
NM_001007157chr7134 ------
NM_001007226chr171125 21196 429 ----
NM_001007227chr171125 21196 429 ----
NM_001007228chr171125 21196 429 ----
NM_001007229chr171125 21196 429 ----
NM_001007230chr171125 21196 429 ----
NM_001007231chr23578 474 160 ------
NM_001007237chr162886 2700 2300 2037 1824 926 1860 11767 --
NM_001007257chr131478 245 48 ------
NM_001007267chr24955 761 285 148 ------
NM_001007277chr113979 366 35 164 1114 --
NM_001007466chr684740 4679 3426 3208 1354 1093 756 59 25220 786 ----
NM_001007553chr11208 --1807 1291
NM_001007559chr1832063 1693 1509 ------
NM_001008239chr1813819 ------
NM_001008405chr721430 243 --11717 --
NM_001008408chr7166433 6088 6082 5857 5844 5164 3992 3917 2548 1734 1645 1593 1580 1573 1525 1092 --11123 --
NM_001008495chr84785 561 203 130 ------
NM_001008539chr885368 3784 3760 1604 666 426 367 105 --25150 2052 --
NM_001008540chr2--1387 ----
NM_001008541chr1021858 1579 ------
NM_001008541chr1021858 1579 ------
NM_001008564chr1372094 1762 1620 1439 749 726 86 --21974 429 --
NM_001008660chr1131153 520 379 11284 ----
NM_001008707chr141544 31581 1562 1543 21573 1554 11324
NM_001008723chr101411 ------
NM_001008738chr521878 869 --1319 --
NM_001008801chr1941535 1325 821 510 ------
NM_001008938chr112412 29 ------
NM_001009185chr5----1692 --
NM_001009554chr4104642 3466 1864 1669 1044 992 958 424 316 153 11293 --13746
NM_001009554chr4104642 3466 1864 1669 1044 992 958 424 316 153 11293 --13746
NM_001009555chr431784 1604 1595 ------
NM_001009566chr111340 1943 ----
NM_001009567chr101630 ------
NM_001009571chr721226 415 ------
NM_001009881chr11206 ------
NM_001009882chr11206 ------
NM_001009899chr3116259 6239 5984 5644 5537 5528 5208 4178 4140 1403 204 --26155 2050 --
NM_001009955chr11572 --140 --
NM_001009955chr11572 --140 --
NM_001009958chr71577 ------
NM_001009959chr222273 935 21876 461 --1135
NM_001009993chr283907 2872 1320 1188 924 337 241 68 14069 14561 13809
NM_001010861chr14666 319 84 27 ------
NM_001010862chrX42332 1176 1105 500 2767 47 12821 --
NM_001010867chr1176241 5348 4608 4585 2442 2056 1911 1770 1430 1379 1338 1276 1229 1099 1008 749 423 ------
NM_001010888chrX124656 4637 3635 3004 2967 1693 1292 971 873 700 487 296 11303 ----
NM_001010891chr552573 2163 255 184 42 14451 ----
NM_001010917chr1072185 1816 1515 667 486 386 60 21423 53 ----
NM_001010922chr173725 2746 2618 1632 1126 1036 559 34010 1514 184 ----
NM_001010924chr102869 129 ------
NM_001010927chr62541 70 ------
NM_001010934chr7149 ------
NM_001011537chr332301 1717 655 ------
NM_001011538chr431050 1027 686 ------
NM_001011545chr212215 106 ------
NM_001011553chr71954 ------
NM_001011658chrX62117 1756 1534 657 629 326 ------
NM_001011663chr104865 194 54 47 ------
NM_001011666chr786581 6407 4679 4114 2588 1611 692 38 --11406 --
NM_001011708chr262392 2299 2087 1861 1806 553 ------
NM_001011713chr1421482 82 --11396 --
NM_001011885chr1531748 1627 107 ------
NM_001012393chr1194723 3463 3445 3336 3282 1894 1668 1021 601 1638 --21876 68
NM_001012398chr16--1855 ----
NM_001012420chr1572930 2741 2497 2466 2197 945 771 --1371 --
NM_001012423chr1572930 2741 2466 2197 945 783 771 ------
NM_001012426chr693393 3172 2832 2616 2338 927 891 879 778 ------
NM_001012427chr693393 3172 2832 2616 2338 927 891 879 778 ------
NM_001012614chr41746 ----1104
NM_001012751chr10------1758
NM_001012753chr1921237 1214 1778 --1424
NM_001012755chrX94897 4804 1979 1971 1592 1258 1048 820 123 13458 --14795
NM_001012761chr51217 ------
NM_001012968chrX32752 2386 859 ------
NM_001012977chrX41355 1205 1010 334 ------
NM_001012989chrX------1503
NM_001013031chr1083416 2905 2427 2156 1125 1023 690 95 --1717 --
NM_001013399chr631141 976 447 ------
NM_001013406chr71321 11368 ----
NM_001013415chr421403 410 ------
NM_001013438chr31709 1674 ----
NM_001013693chr162884 2683 2601 1995 1150 396 32407 763 177 ----
NM_001013693chr162884 2683 2601 1995 1150 396 32407 763 177 ----
NM_001013743chr11122 ------
NM_001013839chr1722054 1909 1702 1588 --
NM_001013843chr153324 298 222 ------
NM_001014283chr1351741 1667 1558 1483 416 11749 160 --
NM_001014380chr13105694 5415 3603 2321 1531 835 719 337 240 137 ------
NM_001014797chr1097780 7584 7260 7222 5851 5092 2826 1855 778 26709 1812 11377 --
NM_001014809chr4--2612 353 ----
NM_001014831chr194709 609 594 308 ------
NM_001014832chr194709 609 594 308 ------
NM_001014834chr194709 609 594 308 ------
NM_001014835chr194709 609 594 308 ------
NM_001014839chr13687 322 180 1913 ----
NM_001014841chr13687 322 180 1913 ----
NM_001014972chr21240 ------
NM_001015045chr452379 799 600 480 36 1705 1231 11779
NM_001015508chr82663 494 ------
NM_001015877chrX32310 884 216 12797 12334 --
NM_001015885chr201272 1353 ----
NM_001015887chr331601 1240 1210 ------
NM_001017368chr1721967 1881 178 1104 --
NM_001017371chr21191 --11268 --
NM_001017395chr363656 3190 2805 643 329 161 23633 2438 13566 --
NM_001017405chr42929 40 1737 --1767
NM_001017424chr121591 559 --11306 1713
NM_001017425chr121591 559 --11306 1713
NM_001017440chr7157820 7321 6810 6679 6171 5492 5325 4980 3113 2481 2276 1947 1150 588 30 56228 2582 1728 1268 723 ----
NM_001017923chr1431468 542 426 ------
NM_001017926chr821392 363 --2722 178 --
NM_001017979chr45787 740 638 253 99 ------
NM_001017999chr122121 743 ------
NM_001017999chr122121 743 ------
NM_001018000chr122121 743 ------
NM_001018000chr122121 743 ------
NM_001018001chr122121 743 ------
NM_001018050chr2283320 2780 2684 2220 1007 809 681 36 --1187 --
NM_001018052chr2283320 2780 2684 2220 1007 809 681 36 --1187 --
NM_001018054chr11178 ------
NM_001018056chr91570 ------
NM_001018057chr1121367 1169 21025 488 1226 --
NM_001018065chr965799 5783 5750 4228 1823 1649 32400 1286 720 138 --
NM_001018066chr965799 5783 5750 4228 1823 1649 32400 1286 720 138 --
NM_001018067chr145189 4618 4209 4186 --14042 --
NM_001018068chr145189 4618 4209 4186 --14042 --
NM_001018069chr145189 4618 4209 4186 --14042 --
NM_001018074chr553796 3748 3283 1362 1245 180 13277 --
NM_001018075chr553796 3748 3283 1362 1245 180 13277 --
NM_001018076chr553796 3748 3283 1362 1245 180 13277 --
NM_001018077chr553796 3748 3283 1362 1245 180 13277 --
NM_001018100chr152662 239 ------
NM_001018111chr7103978 3855 3801 3305 2683 1440 1429 1042 952 303 1894 13755 --
NM_001018676chr82448 56 --1336 --
NM_001018677chr82448 56 --1336 --
NM_001020658chr111435 ------
NM_001020658chr111435 ------
NM_001023567chr1552322 2028 786 774 720 --22129 371 --
NM_001023587chr341089 903 175 97 1894 ----
NM_001024094chr553796 3748 3283 1362 1245 180 13277 --
NM_001024218chr14152 2543 307 ----
NM_001024380chr842029 1978 852 536 2587 184 11955 --
NM_001024381chr842029 1978 852 536 2587 184 11955 --
NM_001024401chr162712 426 ----12384
NM_001024463chr152988 883 --11028 --
NM_001024649chr572855 1862 1827 948 682 404 180 1210 11180 --
NM_001024660chr331183 298 70 ------
NM_001024808chr1252571 2341 1969 903 607 ------
NM_001024847chr362287 2030 1816 1722 570 506 21674 829 ----
NM_001024912chr1941476 705 338 214 --1157 --
NM_001024924chr41392 ------
NM_001024947chr561074 837 711 260 194 84 ------
NM_001024948chr132978 2279 2269 --11283 --
NM_001025068chr341730 1184 364 297 ------
NM_001025069chr341730 1184 364 297 ------
NM_001025076chr1085541 5037 4329 4111 2476 1845 769 260 --15600 --
NM_001025077chr1096899 6395 5687 5469 4685 2127 1618 1359 240 --16958 --
NM_001025079chr353789 2717 2549 1113 820 ------
NM_001025105chr531139 1119 251 ------
NM_001025107chr142645 2227 655 290 21871 612 1575 --
NM_001025107chr142645 2227 655 290 21871 612 1575 --
NM_001025108chr2104120 3800 3481 2794 2753 1671 1641 1108 605 144 1907 23750 106 --
NM_001025201chr22244 75 ------
NM_001025205chr3--1470 ----
NM_001025266chr333109 1178 701 --13985 14577
NM_001025356chr1252732 2419 2372 1883 1101 22405 739 ----
NM_001025366chr6--1334 ----
NM_001025366chr6--1334 ----
NM_001025367chr6--1334 ----
NM_001025367chr6--1334 ----
NM_001025368chr6--1334 ----
NM_001025368chr6--1334 ----
NM_001025369chr6--1350 ----
NM_001025369chr6--1350 ----
NM_001025370chr6--1334 ----
NM_001025370chr6--1334 ----
NM_001025579chr174990 458 324 219 ------
NM_001025580chrX93802 3501 3199 3173 2865 2807 2670 230 92 21589 39 ----
NM_001025595chr451688 1440 584 496 269 1471 ----
NM_001025603chr12477 218 --11179 --
NM_001025616chr41284 ------
NM_001025780chr961196 988 447 386 257 48 ------
NM_001029835chr71381 ------
NM_001029858chr663271 2253 1267 1096 847 116 ------
NM_001029859chr1142091 1609 1536 720 22340 214 --12116
NM_001029863chr633125 1255 572 --2275 54 1855
NM_001029864chr2042458 2432 1648 347 ------
NM_001029882chr11477 1147 ----
NM_001029882chr11477 1147 ----
NM_001029883chr221994 1181 21122 1035 12432 --
NM_001029884chr652708 2366 2344 2108 1026 --31898 515 185 --
NM_001029896chrX131 ----146
NM_001029989chr153927 865 247 --1951 --
NM_001029998chr451251 1242 328 291 23 ------
NM_001030001chr142472 337 ------
NM_001030006chr1742038 677 547 397 ------
NM_001030007chr1693813 3646 3372 2485 1567 792 375 339 91 --12806 13871
NM_001030055chr1494674 4289 4142 3736 3332 3116 1649 262 247 ------
NM_001030059chr10184 ------
NM_001031623chr621421 360 ------
NM_001031677chr51459 ------
NM_001031679chr12123177 3058 2647 1268 1172 1095 1072 917 894 832 363 292 ------
NM_001031684chr221305 936 11520 ----
NM_001031695chr2234810 4197 60 13628 34232 4187 4110 13636
NM_001031700chr42332 164 ------
NM_001031716chr2161 --21100 1027 --
NM_001031740chr161655 1632 1570 1057 649 137 ------
NM_001031746chr1031368 949 432 ------
NM_001031804chr1644377 3379 1737 702 11579 13794 --
NM_001031812chr542102 1540 881 75 1708 11793 --
NM_001031855chrX2216 79 ------
NM_001032288chr201156 ------
NM_001032293chr172503 214 ------
NM_001032296chr1362938 2544 2451 2143 632 170 22301 515 ----
NM_001032380chr1021935 218 ------
NM_001032393chrX1234 ------
NM_001032394chr652696 950 234 196 62 1164 ----
NM_001032395chr642563 817 101 63 131 ----
NM_001032999chr2075310 4708 4103 3928 3510 1912 1437 24542 183 13723 14407
NM_001033045chr2114412 3741 3300 3277 1458 1435 1373 922 872 780 592 23482 1638 ----
NM_001033047chr432574 2539 2475 32432 1036 377 1904 --
NM_001033057chr382071 2010 1858 1462 1392 602 574 555 1290 1441 --
NM_001033059chr611899 21436 116 ----
NM_001033085chr21228 ------
NM_001033087chr2072671 2456 1006 797 789 419 144 1166 12801 --
NM_001033112chr53754 699 625 ------
NM_001033117chr373086 1016 838 610 570 403 161 1639 ----
NM_001033503chr51446 ------
NM_001033507chr12470 187 ------
NM_001033551chr1743746 3523 671 476 12969 31315 797 205 --
NM_001033554chr171204 ------
NM_001033557chr211246 ------
NM_001033566chr171835 --1162 --
NM_001033568chr171835 --1162 --
NM_001033578chr862227 2199 1507 1484 838 815 1574 ----
NM_001033581chr1150 ------
NM_001033581chr1150 ------
NM_001033582chr1150 ------
NM_001033602chr1332464 388 342 2933 773 --1279
NM_001033756chr6--1268 ----
NM_001033756chr6--1268 ----
NM_001033925chr1022149 2134 ------
NM_001034833chr5--1279 ----
NM_001034841chr16125469 5318 5305 5144 4447 1938 1889 1793 1743 1394 730 336 23837 286 34093 4083 1459 23860 99
NM_001034845chr41316 1508 ----
NM_001034850chr54675 612 140 95 ------
NM_001034915chr831367 261 125 ------
NM_001034954chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_001034955chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_001034956chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_001034957chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_001035chr131311 846 812 --1419 --
NM_001035260chr101165 1559 11173 --
NM_001037132chr721620 286 --2733 439 --
NM_001037133chr721620 286 --2733 439 --
NM_001037172chr331016 913 169 11129 ----
NM_001037317chr14666 319 84 27 ------
NM_001037331chr183903 640 325 1237 ----
NM_001037334chr183831 413 359 --31957 1713 553 --
NM_001037339chr111764 ------
NM_001037340chr111764 ------
NM_001037341chr111764 ------
NM_001037341chr111764 ------
NM_001037494chr12----153 --
NM_001037495chr12----153 --
NM_001037582chr41583 --1279 --
NM_001037637chr5----1149 --
NM_001037954chr11113261 2908 2887 2825 2429 2168 668 620 478 403 313 ------
NM_001038640chr152853 841 ------
NM_001038702chr532026 645 245 ----1940
NM_001039029chr1232020 666 481 ----11303
NM_001039091chrX41422 1389 1340 75 ------
NM_001039111chr3--1414 ----
NM_001039366chr222345 86 ------
NM_001039538chr243413 3200 1475 287 --2445 127 --
NM_001039547chr3167910 7618 7595 7034 6751 6689 6530 5722 5699 2688 2325 2295 2272 1901 1601 1277 12567 22301 1886 15035
NM_001039570chr22124579 3896 3852 3312 1862 1855 1595 1572 1510 1003 714 208 24248 1781 33211 3030 980 --
NM_001039571chr22124579 3896 3852 3312 1862 1855 1595 1572 1510 1003 714 208 24248 1781 33211 3030 980 --
NM_001039574chr11813 ------
NM_001039577chr193989 3480 3049 2830 1729 1366 955 851 729 ------
NM_001039585chr164221 1215 988 645 433 340 1238 ----
NM_001039590chrX63894 1550 1298 967 352 178 23820 147 ----
NM_001039591chrX63894 1550 1298 967 352 178 23820 147 ----
NM_001039619chr142375 56 ------
NM_001039675chr15----1238 --
NM_001039709chr2075310 4708 4103 3928 3510 1912 1437 24542 183 13723 14407
NM_001039762chr1042338 2222 736 211 11749 11698 --
NM_001039802chr121275 931 ------
NM_001039840chrX95719 4793 4002 2380 1768 1373 1113 1063 822 ------
NM_001039937chr1353972 3947 3854 1653 664 ------
NM_001040001chr641932 1914 1883 1607 ------
NM_001040057chr71960 1426 1241 --
NM_001040092chr81321 ------
NM_001040100chr321042 31 1931 ----
NM_001040110chr741371 672 207 158 2263 62 ----
NM_001040113chr163937 882 248 ------
NM_001040114chr164796 741 326 107 ------
NM_001040142chr241978 1742 1554 567 ------
NM_001040143chr241978 1742 1554 567 ------
NM_001040151chr11114474 4281 4052 3875 3866 3673 3167 3130 1286 1073 403 ------
NM_001040152chr7115113 4574 4464 4268 3558 3521 3491 1712 1242 796 749 --14806 --
NM_001040153chr139828 784 756 652 396 216 192 166 125 ------
NM_001040157chr442816 2667 276 89 --198 --
NM_001040159chr41440 --21196 140 --
NM_001040181chr31350 --11086 --
NM_001040182chr31350 --11086 --
NM_001040183chr31350 --11086 --
NM_001040195chr12666 50 ------
NM_001040199chr31350 --11086 --
NM_001040200chr31350 --11086 --
NM_001040214chr651969 1795 943 469 350 ------
NM_001040272chr982361 2281 1958 1871 1563 874 814 738 2340 242 --1644
NM_001040284chr16105887 5809 4435 1378 1146 1022 938 732 170 122 12095 --25694 4076
NM_001040402chr472696 2603 2245 2231 907 711 197 --22053 1065 --
NM_001040409chr23346 327 167 ------
NM_001040429chr1322198 503 13217 13396 22903 1037
NM_001040436chr123614 591 519 ------
NM_001040441chr1135251 5228 4696 4674 4040 3837 3693 2094 1874 1851 1020 997 196 13973 13793 --
NM_001040446chr562730 2557 1730 1707 784 201 --1913 12747
NM_001040450chr1542889 2339 1853 248 --12866 --
NM_001040453chr1542889 2339 1853 248 --12866 --
NM_001040619chr121472 593 ----1445
NM_001040624chr842424 2026 550 356 ------
NM_001040625chr842424 2026 550 356 ------
NM_001040626chr842424 2026 550 356 ------
NM_001040627chr842424 2026 550 356 ------
NM_001040628chr842424 2026 550 356 ------
NM_001040629chr842424 2026 550 356 ------
NM_001040630chr842424 2026 550 356 ------
NM_001040661chr751121 1083 379 310 93 ------
NM_001040665chr7104712 4379 4277 3919 2006 1623 1065 791 488 250 24286 1440 --11641
NM_001040709chr152571 2360 686 674 307 ----12497
NM_001040712chr943153 2493 2444 358 2687 659 ----
NM_001040715chr163905 899 201 ------
NM_001042355chr1695191 4785 4553 4494 4413 3874 2036 1787 1757 35247 2152 2062 ----
NM_001042357chr1011504 --1266 --
NM_001042358chr1011504 --1266 --
NM_001042360chr1011504 --1266 --
NM_001042361chr1011535 --1297 --
NM_001042363chr1011504 --1266 --
NM_001042364chr1011535 --1297 --
NM_001042365chr1011535 --1297 --
NM_001042370chr1----1222 --
NM_001042387chr1011535 --1297 --
NM_001042388chr182803 772 1117 1128 --
NM_001042389chr1011504 --1266 --
NM_001042390chr1011504 --1266 --
NM_001042392chr1011504 --1266 --
NM_001042393chr1011535 --1297 --
NM_001042395chr1011504 --1266 --
NM_001042396chr1011535 --1297 --
NM_001042397chr1011535 --1297 --
NM_001042404chr121357 721 ------
NM_001042406chr621021 194 ------
NM_001042412chr1695191 4785 4553 4494 4413 3874 2036 1787 1757 35247 2152 2062 ----
NM_001042413chr9134005 3983 3556 3330 3223 2899 2872 2828 2647 943 837 778 171 1118 12503 12613
NM_001042430chr141146 2380 132 ----
NM_001042440chr521858 492 ------
NM_001042441chr521858 492 ------
NM_001042442chr521858 492 ------
NM_001042443chr521858 492 ------
NM_001042444chr521858 492 ------
NM_001042445chr521858 492 ------
NM_001042446chr521858 492 ------
NM_001042453chrX21665 1077 11555 ----
NM_001042459chr31289 ------
NM_001042479chrX51403 858 514 458 180 21420 576 11925 --
NM_001042480chrX51403 858 514 458 180 21420 576 11925 --
NM_001042481chr1452555 2331 2149 268 163 21887 1035 ----
NM_001042492chr1783344 3222 3157 3098 1334 1188 253 99 ------
NM_001042494chr1583776 3557 3177 2841 2491 2442 569 181 --13388 --
NM_001042495chr1583776 3557 3177 2841 2491 2442 569 181 --13388 --
NM_001042496chr1583776 3557 3177 2841 2491 2442 569 181 --13388 --
NM_001042497chr1583776 3557 3177 2841 2491 2442 569 181 --13388 --
NM_001042498chrX31062 935 65 ------
NM_001042506chrX41129 1094 1010 334 --11216 --
NM_001042510chr841838 1354 406 72 1660 21970 619 11608
NM_001042511chr841838 1354 406 72 1660 21970 619 11608
NM_001042537chrX21559 647 1208 ----
NM_001042555chr1234796 3997 1250 --13599 --
NM_001042599chr2137190 6769 6256 5245 5046 4754 2929 2271 2150 2106 1597 718 417 13154 ----
NM_001042601chr332338 686 651 ------
NM_001042603chr1284920 4324 4129 3636 2106 1991 972 255 --13976 --
NM_001042604chr394226 4166 3991 3743 3499 3321 3271 1572 837 12982 --23640 3572
NM_001042632chr2091031 587 467 343 269 242 206 83 70 1751 12512 1154
NM_001042633chr2091031 587 467 343 269 242 206 83 70 1751 12512 1154
NM_001042646chr331738 1460 465 ------
NM_001042669chr41284 ------
NM_001042681chr13772 515 83 1409 12483 --
NM_001042682chr13772 515 83 1409 12483 --
NM_001042682chr13772 515 83 1409 12483 --
NM_001042683chr61531 158 ----
NM_001042749chrX31682 1655 773 1817 ----
NM_001042750chrX31682 1655 773 1817 ----
NM_001042751chrX31682 1655 773 1817 ----
NM_001042762chr7132 ------
NM_001043318chr14113753 3027 2680 1223 1190 1008 961 910 428 362 291 13338 1565 --
NM_001043351chr152235 2186 1952 1470 68 ------
NM_001044305chr671311 1258 1069 1056 403 391 242 ------
NM_001044385chr253760 3524 2539 1452 767 24006 1533 ----
NM_001044722chr542102 1540 881 75 1708 11793 --
NM_001044723chr542102 1540 881 75 1708 11793 --
NM_001046chr553019 2940 1954 964 493 --22992 2160 --
NM_001048183chr1123754 2666 2484 2476 1412 946 922 536 305 283 177 104 --22461 1389 --
NM_001066chr182157 1867 1801 855 832 557 306 168 21536 431 1512 --
NM_001071775chr13292 59 --11909 --
NM_001080418chr12647 54 ------
NM_001083620chr442408 860 497 440 ----11924
NM_001092chr1762233 2164 2079 1682 79 21 ------
NM_001095chr1241804 1774 1254 631 11341 ----
NM_001096chr171608 1570 123 --
NM_001099678chr3106086 5934 5927 4978 4955 4893 4455 3895 410 242 11883 --11668
NM_001100108chr1147881 7323 7001 6289 6266 5961 5654 5631 5569 2119 2113 537 357 244 13114 25814 349 12307
NM_001106chr3129570 9070 8797 8698 8579 8006 7775 3703 3422 2134 409 220 49111 8015 3913 3597 22596 1662 17411
NM_001107chr141167 ------
NM_001111chr142645 2227 655 290 21871 612 1575 --
NM_001113490chrX11129 21368 23 11152 --
NM_001117chr1852127 2054 1944 784 472 ------
NM_001121chr1021792 44 ------
NM_001122631chr113697 547 519 ------
NM_001128chr1693813 3646 3372 2485 1567 792 375 339 91 --12806 13871
NM_001144chr164947 307 214 104 --1228 --
NM_001146chr821881 1552 --1642 --
NM_001148chr442214 1995 1471 709 2795 496 ----
NM_001149chr1031174 889 505 ------
NM_001156chr102646 236 ------
NM_001160chr1232584 515 114 12643 1947 --
NM_001167chrX136485 6231 6169 5419 5395 5334 4897 4462 4261 2160 1927 1836 1733 16374 ----
NM_001172chr142192 171 ------
NM_001173chr1494674 4289 4142 3736 3332 3116 1649 262 247 ------
NM_001177chr1262213 2082 1875 682 339 126 ------
NM_001186chr2162565 2386 2066 1058 1047 512 1386 1316 --
NM_001189chr431089 74 67 1772 ----
NM_001198chr641884 1709 948 63 11986 ----
NM_001201chr452880 1446 768 599 180 --13877 --
NM_001204chr246189 5045 4980 2792 --25671 397 --
NM_001206chr932997 2728 792 12924 12687 --
NM_001207chr5----1149 --
NM_001217chr19121 ------
NM_001222chr1021674 1667 21435 696 1462 --
NM_001233chr751517 1494 753 619 37 --21916 480 --
NM_001241chr242105 1676 958 308 12252 2435 350 --
NM_001241chr242105 1676 958 308 12252 2435 350 --
NM_001256chr1742183 709 539 152 ------
NM_001259chr752273 1881 1822 1075 370 134 25898 195 --
NM_001260chr134300 99 67 42 ------
NM_001275chr142347 303 ------
NM_001277chr1131014 345 39 ------
NM_001280chr191659 ------
NM_001282chr1742038 677 547 397 ------
NM_001284chr52432 130 ------
NM_001290chr4157 ------
NM_001299chr193429 389 198 1115 ----
NM_001300chr102367 25 ------
NM_001304chr1723799 71 ------
NM_001305chr71812 ------
NM_001310chr12--1749 11034 --
NM_001313chr4--2612 353 ----
NM_001315chr622093 594 197 21945 650 --
NM_001321chr121162 ------
NM_001328chr41746 ----1104
NM_001329chr1041255 1117 569 132 ------
NM_001331chr1132493 1814 1134 32728 795 275 ----
NM_001332chr511149 1256 ----
NM_001343chr521105 664 11158 ----
NM_001346chr352880 2547 2456 1783 387 ------
NM_001351chr321567 477 ------
NM_001356chrX72485 2438 2219 1580 596 265 222 1530 12394 --
NM_001362chr141366 --1647 --
NM_001364chr1184560 4498 2996 2925 2890 1452 147 109 1331 1202 --
NM_001386chr862099 1989 1869 1703 961 651 1714 12207 --
NM_001390chr1893415 3389 3253 3070 2910 2797 2500 661 530 ------
NM_001396chr2141001 527 362 159 2907 707 ----
NM_001397chr172331 1745 1702 1675 989 883 679 12183 22659 872 --
NM_001399chrX53530 3424 1190 582 105 --1461 --
NM_001401chr941375 1074 1042 518 11234 ----
NM_001406chr1731736 1633 1094 ------
NM_001412chrX43751 3174 2280 456 31072 799 654 ----
NM_001417chr1231527 634 166 11894 ----
NM_001418chr113283 75 57 ------
NM_001418chr113283 75 57 ------
NM_001419chr193786 608 260 ------
NM_001420chr1963011 2631 2535 2361 1929 180 21198 141 ----
NM_001422chr1131346 431 60 ------
NM_001423chr1231978 362 246 ------
NM_001427chr71390 --11781 --
NM_001429chr2211062 ------
NM_001430chr261971 1856 1744 1368 1332 365 ------
NM_001432chr473724 3650 2557 2460 1328 431 112 13424 ----
NM_001438chr152949 2765 1284 947 115 13458 12485 --
NM_001448chrX--11727 --1690
NM_001449chrX61143 1045 879 412 228 203 ------
NM_001451chr1641368 1245 523 173 --1242 --
NM_001453chr641761 1643 632 499 --21318 1146 --
NM_001457chr321445 1029 11177 1278 --
NM_001482chr151814 --195 --
NM_001493chrX----1313 --
NM_001497chr952757 2016 937 521 271 ----11933
NM_001498chr641215 1191 358 103 ------
NM_001527chr6104773 4751 4738 4128 3816 2973 1859 1716 779 113 2756 411 24465 905 --
NM_001530chr1451133 877 464 237 108 --1243 --
NM_001542chr162886 2700 2300 2037 1824 926 1860 11767 --
NM_001546chr61592 ------
NM_001560chrX3757 734 102 ------
NM_001584chr1121233 820 1467 ----
NM_001587chrX42250 2119 1790 385 --1674 1101
NM_001616chr232385 436 168 --12253 --
NM_001621chr752214 2131 1857 1015 995 22374 2194 --11200
NM_001621chr752214 2131 1857 1015 995 22374 2194 --11200
NM_001634chr611899 21436 116 ----
NM_001635chr71379 1356 1671 --
NM_001642chr112515 159 --1129 2246 153
NM_001649chrX22477 267 ------
NM_001655chr1141897 1697 1689 428 1733 ----
NM_001663chr1452595 2329 2084 840 790 32683 2544 431 12631 --
NM_001668chr122099 774 --1708 --
NM_001677chr12254 200 ------
NM_001678chr1741812 1782 1665 1578 11585 ----
NM_001679chr31788 1653 ----
NM_001681chr124699 678 567 262 124 ----
NM_001682chr1282379 2022 1932 1853 1840 1032 590 31 ------
NM_001683chr342137 652 423 338 1816 12586 1539
NM_001690chr352483 485 363 347 264 11891 1696 11627
NM_001695chr843844 1525 385 65 14094 12945 --
NM_001696chr222345 86 ------
NM_001701chr931593 542 166 ------
NM_001703chr1125 ------
NM_001704chr62561 42 --1523 --
NM_001706chr321019 63 1765 ----
NM_001707chr72157 46 ------
NM_001709chr1142406 2086 299 111 ------
NM_001742chr721737 207 ------
NM_001743chr21416 ------
NM_001746chr572855 1862 1827 948 682 404 180 1210 11180 --
NM_001750chr521858 492 ------
NM_001754chr2154125 2659 740 514 156 --13627 13197
NM_001755chr1652199 1561 1540 653 332 ------
NM_001759chr1284708 4681 4386 4003 3949 3678 1381 438 1295 14745 1732
NM_001762chr76809 692 596 590 184 38 ------
NM_001773chr131544 484 40 1982 ----
NM_001777chr353789 2717 2549 1113 820 ------
NM_001788chr71954 ------
NM_001791chr121275 931 ------
NM_001792chr183869 393 134 ------
NM_001795chr1681573 1296 1181 1034 463 349 319 44 11113 ----
NM_001822chr22244 75 ------
NM_001830chrX83390 2880 1445 1273 1105 1056 698 537 --1729 --
NM_001839chr12723 711 ------
NM_001854chr11111 1285 --1478
NM_001859chr9103955 3806 3783 3352 3032 2651 2627 1214 754 731 1935 135 --
NM_001862chr2168 ------
NM_001873chr41677 ------
NM_001874chr12115172 4888 4703 4464 3828 3805 1668 1505 1166 623 67 14191 14639 11635
NM_001892chr531139 1119 251 ------
NM_001893chr171340 ----1265
NM_001894chr22145 ------
NM_001901chr61392 ------
NM_001903chr52742 593 --2813 719 --
NM_001904chr31673 1355 ----
NM_001918chr1218675 8667 8651 8121 7753 7201 6977 5841 5689 2808 2598 2575 2515 2352 2012 1865 1780 1503 1365 538 515 39076 8844 7862 27942 7474 --
NM_001924chr12557 35 1174 ----
NM_001933chr1431319 1188 1020 1394 ----
NM_001938chr141845 1731 1500 468 ------
NM_001939chrX31403 1346 271 1327 22552 2370 --
NM_001942chr1841916 1582 549 262 11890 ----
NM_001944chr1882341 2152 1860 1593 784 641 579 83 11667 22166 665 --
NM_001945chr511042 ----174
NM_001949chr642553 2370 2162 201 32963 655 356 22859 475 --
NM_001950chr163735 520 250 1670 ----
NM_001955chr611127 ------
NM_001962chr51465 ------
NM_001967chr31578 ------
NM_001968chr43937 96 36 ------
NM_001969chr14103562 3477 3384 3110 972 932 715 518 430 39 12808 ----
NM_001980chr1232269 1992 436 ------
NM_001981chr13581 402 362 1919 ----
NM_001987chr1264035 2943 1056 990 663 345 54056 3020 848 485 143 ----
NM_001993chr13448 39 25 ------
NM_001995chr431392 391 381 1195 ----
NM_001999chr51216 152 11105 --
NM_002006chr495404 5052 4062 2133 1618 1177 1016 884 210 24139 4026 25288 2157 11697
NM_002009chr1532379 731 176 --11906 --
NM_002015chr1342207 1193 1161 801 2488 227 --1295
NM_002017chr1121313 1201 ------
NM_002023chr131715 139 124 ------
NM_002024chrX22092 1471 ----11628
NM_002025chrX118648 8228 7508 7262 7145 6718 6089 5833 2408 2072 1865 13098 --18919
NM_002027chr82448 56 --1336 --
NM_002031chr62556 85 1623 1184 --
NM_002037chr61116 ------
NM_002039chr41274 ------
NM_002040chr2132909 871 223 ------
NM_002045chr31297 ------
NM_002051chr106982 323 307 279 70 45 ------
NM_002052chr841358 1290 1034 239 ------
NM_002056chr23823 603 31 ------
NM_002061chr131942 1919 1467 ------
NM_002063chrX1188 1208 1899 --
NM_002069chr73553 199 80 166 ----
NM_002072chr9168 ----1829
NM_002074chr121737 1698 11637 ----
NM_002076chr1273259 2674 2355 1285 648 266 75 123 ----
NM_002077chr932106 157 94 11568 1101 --
NM_002080chr162756 310 ----11035
NM_002083chr14------1127
NM_002092chr4104599 4477 4054 3902 3829 3623 3602 3245 1585 1320 --11326 14850
NM_002094chr16------150
NM_002103chr1931080 916 292 1794 ----
NM_002106chr4180 ------
NM_002111chr4133858 3593 3273 2811 1340 868 705 649 387 356 317 254 200 12573 ----
NM_002126chr1743895 3718 2913 940 23181 2627 ----
NM_002128chr1371891 1816 1699 876 410 389 124 ------
NM_002129chr41112 1147 ----
NM_002130chr511372 ------
NM_002136chr121173 ------
NM_002137chr731916 1514 32 ------
NM_002140chr91361 ------
NM_002145chr17------1319
NM_002146chr1711331 21254 1009 ----
NM_002158chr233827 2637 898 ------
NM_002166chr22745 245 ------
NM_002193chr2--11224 ----
NM_002196chr2011109 ----1829
NM_002196chr2011109 ----1829
NM_002202chr53876 699 337 ------
NM_002203chr563963 3824 3207 2839 2538 1134 13997 23748 142 --
NM_002210chr233584 2518 493 11361 ----
NM_002211chr1021032 404 ------
NM_002214chr7125356 5008 4726 4544 3843 2236 2092 1595 1237 997 813 243 13470 15618 --
NM_002222chr31133 ------
NM_002223chr1273949 3595 3570 3330 3106 1072 996 --1526 --
NM_002228chr151021 396 370 307 229 1788 --1384
NM_002230chr172407 34 ------
NM_002233chr111466 ------
NM_002235chr1231187 178 22 1472 ----
NM_002240chr212619 523 ------
NM_002241chr12922 613 --13097 --
NM_002247chr103776 96 33 --1281 --
NM_002253chr42420 269 --1140 --
NM_002254chr262322 2298 1912 888 719 261 ------
NM_002264chr384140 3595 1997 1919 1853 1418 1318 1109 13633 ----
NM_002265chr1711180 ------
NM_002266chr171214 ------
NM_002267chr1392344 2309 2271 1897 1696 907 809 184 154 --1286 --
NM_002268chr331801 736 137 ----11744
NM_002270chr5145469 5189 5091 4521 4239 4091 3672 2030 1868 1480 1308 990 181 21 12208 35626 4924 1084 11942
NM_002271chr133968 423 218 52096 1720 1685 986 161 ----
NM_002285chr2104120 3800 3481 2794 2753 1671 1641 1108 605 144 1907 23750 106 --
NM_002293chr141805 1752 1697 288 22577 2288 11783 --
NM_002298chr1331186 316 185 1634 11558 --
NM_002300chr12--122 ----
NM_002310chr545891 1209 603 396 ----16102
NM_002312chr131421 --150 --
NM_002336chr1244998 3540 3423 1954 ------
NM_002350chr82503 362 ----1384
NM_002355chr1231021 516 499 ------
NM_002356chr6----1890 --
NM_002359chr1754160 3387 3272 1704 1660 32806 2608 797 ----
NM_002360chr792587 2155 2038 1935 1717 1009 552 195 154 --1160 --
NM_002373chr152950 471 ----11389
NM_002374chr243413 3200 1475 287 --2445 127 --
NM_002382chr1421220 195 ------
NM_002384chr185745 363 300 288 39 1192 124 --
NM_002387chr564998 3142 1769 1319 813 188 13851 146 --
NM_002389chr141918 1345 229 187 ------
NM_002395chr611107 ------
NM_002397chr53516 314 39 ------
NM_002398chr251427 1263 1255 960 44 ------
NM_002399chr1511172 2281 46 1575 --
NM_002401chr1772475 2436 1859 825 316 179 40 11640 ----
NM_002408chr141280 1733 ----
NM_002419chr113200 145 86 --1376 --
NM_002430chr2272384 2344 2002 1785 1048 924 263 11605 ----
NM_002438chr101630 ------
NM_002448chr41723 ------
NM_002449chr52891 169 --11291 --
NM_002451chr983820 2785 2443 1574 1551 1535 1473 387 13048 ----
NM_002465chr121296 139 ----
NM_002473chr2241316 1204 1125 189 ------
NM_002474chr164796 741 326 107 ------
NM_002479chr12515 68 ------
NM_002480chr1221024 32 11177 ----
NM_002481chr1137751 7331 6232 6120 5805 5651 5283 3035 2498 2290 2267 2205 531 37458 6770 5233 ----
NM_002489chr71274 ------
NM_002499chr1562419 2280 2207 580 339 237 1884 ----
NM_002500chr231237 1165 97 ------
NM_002501chr1934087 1669 881 ------
NM_002505chr641392 1345 1230 366 --1158 11371
NM_002514chr851071 369 318 184 38 ------
NM_002515chr1461964 1917 1776 638 534 68 177 ----
NM_002518chr26930 758 350 312 168 114 --1880 --
NM_002519chr1131511 1409 247 1216 ----
NM_002522chr1773808 3729 3169 2502 899 262 210 ----12966
NM_002523chr731027 775 276 ------
NM_002524chr1148 11041 ----
NM_002541chr711034 ------
NM_002544chr171274 ------
NM_002545chr1194723 3463 3445 3336 3282 1894 1668 1021 601 1638 --21876 68
NM_002546chr81253 ------
NM_002547chrX64138 3883 3336 1596 836 559 23694 2585 ----
NM_002556chr112563 484 ------
NM_002564chr111817 147 ----
NM_002568chr8195 ------
NM_002576chr1131214 960 176 ------
NM_002577chr373263 3174 2775 2753 2561 1463 160 ----21215 771
NM_002581chr974300 3979 3962 1726 1522 734 233 24893 478 ----
NM_002582chr16179 ------
NM_002588chr51703 ----1266
NM_002594chr2022057 589 ------
NM_002595chr1251291 740 434 377 264 --1461 --
NM_002600chr111764 ------
NM_002608chr2221503 1000 ------
NM_002609chr531337 1177 662 --21694 189 --
NM_002613chr16114984 4888 4834 4235 3581 3263 1738 1325 830 483 129 24072 1039 24540 4137 --
NM_002628chr32885 159 --1193 177
NM_002629chr101870 2122 100 ----
NM_002635chr12----1120 --
NM_002645chr1163130 2270 2162 2083 707 152 ------
NM_002646chr132087 1466 244 ------
NM_002655chr885139 4969 4809 4694 4243 3828 1375 1064 --25245 936 11762
NM_002656chr62233 156 ------
NM_002657chr201860 41471 1200 452 416 1647 --
NM_002660chr204975 482 435 220 ------
NM_002667chr63916 322 28 --1831 --
NM_002687chr1441145 466 102 36 --11170 --
NM_002698chr1932397 231 146 11107 12666 --
NM_002706chr21529 ------
NM_002709chr231210 178 72 --11273 --
NM_002711chr71751 ------
NM_002715chr51206 ----2372 292
NM_002716chr1152356 1326 1241 900 641 --43425 926 793 749 13370
NM_002717chr81278 ------
NM_002718chr342677 2163 2139 2078 1398 11045 --
NM_002719chr141980 3797 684 56 1945 --
NM_002729chr101796 ------
NM_002731chr143163 3028 1148 797 22165 636 13114 --
NM_002734chr1751986 1473 727 148 83 --11865 --
NM_002737chr1796591 5631 4753 2402 2394 1954 1451 979 497 31985 1157 240 ----
NM_002740chr352518 1795 1049 301 64 --11030 --
NM_002742chr14--178 ----
NM_002744chr1150 ------
NM_002745chr22102900 1830 1369 1009 867 722 701 553 546 236 --24417 3963 --
NM_002748chr1551080 792 416 349 339 ------
NM_002752chr51202 ------
NM_002753chr42769 127 --1317 --
NM_002755chr151315 1626 ----
NM_002760chrY135143 5105 5011 4990 4699 4636 4488 4098 4074 1150 1090 946 246 11767 2839 393 --
NM_002763chr12355 179 ------
NM_002765chrX41422 1389 1340 75 ------
NM_002775chr101163 1187 ----
NM_002776chr1931323 1315 1300 11586 ----
NM_002786chr11--197 ----
NM_002819chr195977 443 356 297 176 21435 586 ----
NM_002821chr6----1669 --
NM_002822chr1221455 1145 --3627 532 490 1578
NM_002825chr72206 60 ------
NM_002828chr184684 260 199 75 --1176 --
NM_002829chr921133 416 ------
NM_002833chr1511481 ------
NM_002835chr71518 ------
NM_002837chr1274082 3926 1187 867 828 666 447 ------
NM_002839chr943153 2493 2444 358 2687 659 ----
NM_002840chr121618 1229 21559 406 21031 420 --
NM_002841chr31461 ------
NM_002843chr1143317 2787 2381 148 --23258 2971 --
NM_002844chr621329 1135 ------
NM_002847chr741039 568 513 96 11283 ----
NM_002849chr121734 ------
NM_002850chr1931166 467 405 ------
NM_002851chr71790 ------
NM_002852chr32587 539 ------
NM_002858chr12494 287 11247 ----
NM_002859chr123697 212 52 ------
NM_002868chr121960 11836 ----
NM_002869chr1141594 1497 537 118 --171 --
NM_002874chr93799 465 246 --1774 --
NM_002886chr384885 4840 2073 1959 1887 787 683 228 11042 14459 --
NM_002890chr53951 673 289 ------
NM_002892chr1421482 390 11455 ----
NM_002897chr22630 496 ------
NM_002906chr1121997 1923 169 ----
NM_002912chr61804 ------
NM_002941chr31346 ------
NM_002942chr351138 1081 523 440 117 ------
NM_002948chr331013 906 339 2309 96 ----
NM_002955chr641877 1611 1533 1510 ----11925
NM_002956chr122381 252 ------
NM_002958chr32859 756 ------
NM_002959chr174258 4209 3896 3781 2919 1334 535 2473 454 11664 --
NM_002968chr1621080 306 ------
NM_002971chr331199 385 164 ------
NM_002973chr121159 ------
NM_002979chr11205 ------
NM_002994chr411734 ----11253
NM_002998chr841423 798 610 196 1781 ----
NM_002999chr2061905 1820 1789 1762 1517 1497 ------
NM_003010chr1722441 2203 ----11765
NM_003011chr941681 628 260 68 ------
NM_003012chr893081 2986 2898 2384 2371 2073 266 141 96 ------
NM_003016chr1762006 1765 1655 551 500 291 1167 --1330
NM_003020chr151301 1347 ----
NM_003022chrX3468 450 343 ------
NM_003028chr973870 3720 3467 3311 1180 995 133 12363 --1719
NM_003029chr121304 968 21009 956 ----
NM_003031chr161839 1923 ----
NM_003034chr1287892 7254 5989 5076 2344 2321 1710 968 13107 ----
NM_003035chr14834 606 380 306 ------
NM_003036chr14973 893 167 91 ------
NM_003042chr33674 624 402 ------
NM_003043chr364214 4160 3202 2794 2632 1059 11427 ----
NM_003045chr1394837 3468 3139 1346 1156 849 234 173 148 13925 23871 121 --
NM_003046chr885368 3784 3760 1604 666 426 367 105 --25150 2052 --
NM_003051chr121459 1368 ------
NM_003068chr831101 305 167 ------
NM_003069chrX1613 ------
NM_003070chr92669 601 ------
NM_003072chr193364 157 113 --1319 --
NM_003074chr33345 294 212 ------
NM_003099chr15116421 5976 5867 5717 5272 4951 4675 4652 4603 1798 1684 ----12193
NM_003100chr52342 295 ------
NM_003106chr33741 387 165 ------
NM_003107chr652184 2071 1980 1884 689 ------
NM_003108chr286051 2698 2146 2004 1291 728 603 387 1489 1703 --
NM_003111chr21191 --11268 --
NM_003112chr753046 902 460 328 34 ------
NM_003118chr532027 1605 735 1520 1320 --
NM_003126chr12440 407 ------
NM_003128chr252734 2188 951 918 501 ------
NM_003136chr141333 ------
NM_003137chr631447 833 475 22073 1701 11427 --
NM_003144chr641804 1611 483 167 ------
NM_003149chr34353 178 69 25 ------
NM_003150chr1792283 839 832 824 809 747 554 450 382 124 ----
NM_003155chr84817 762 661 137 12486 11883 --
NM_003156chr1131011 412 135 11314 ----
NM_003161chr1763575 2329 2300 888 798 739 ------
NM_003162chr22193 49 11095 ----
NM_003168chr172975 782 ------
NM_003174chr102559 51 ------
NM_003178chr3--1655 ----
NM_003182chr71410 ------
NM_003182chr71410 ------
NM_003185chr2021089 943 139 ----
NM_003188chr64837 748 196 134 ------
NM_003194chr61116 --1498 --
NM_003196chr1----1396 1250
NM_003199chr18145324 5257 5084 4926 4903 4559 4523 4287 4275 4183 2177 1289 832 765 15578 13956 15331
NM_003202chr551799 1666 1638 1211 352 2174 88 ----
NM_003203chr242044 1787 1511 868 ------
NM_003211chr1231390 341 34 ------
NM_003217chr1231937 1245 241 ------
NM_003221chr643069 2549 1123 715 --13276 --
NM_003234chr322293 1624 21576 778 1595 --
NM_003236chr253533 2887 2328 2181 248 ----13106
NM_003242chr362287 2030 1816 1722 570 506 21674 829 ----
NM_003244chr18169 ------
NM_003246chr1531376 694 51 21836 1647 11603 --
NM_003247chr641920 1666 1603 1439 ------
NM_003255chr1762615 2121 850 769 467 32 1381 ----
NM_003257chr1551250 1184 1097 547 190 ------
NM_003262chr354482 4165 1515 1156 1028 23754 1593 ----
NM_003274chr2132292 2160 984 --22888 2627 --
NM_003275chr951527 1456 1427 1350 64 --11500 --
NM_003286chr201344 --11155 --
NM_003291chr132320 275 ------
NM_003298chr3135992 5836 5806 5769 5063 4866 4801 4762 2231 2149 1797 1096 827 22401 772 16149 --
NM_003304chr321561 60 1209 ----
NM_003319chr23803 211 80 ------
NM_003326chr12800 81 --21854 516 --
NM_003337chr571578 1554 1493 1355 1063 205 180 1106 ----
NM_003338chr106692 676 607 433 345 37 21538 564 11528 1575
NM_003339chr541383 1353 1171 185 ------
NM_003341chr32603 573 ------
NM_003342chr1723229 140 --12068 11009
NM_003344chr721323 663 11426 ----
NM_003348chr1231526 429 325 1501 ----
NM_003349chr201156 ------
NM_003350chr81392 1884 ----
NM_003352chr23884 854 268 ------
NM_003359chr421294 175 ------
NM_003367chr191533 ------
NM_003369chr1152249 1905 1742 992 62 --1781 11811
NM_003374chr52272 41 ------
NM_003376chr6--1334 ----
NM_003376chr6--1334 ----
NM_003383chr91570 ------
NM_003385chr23300 56 25 --1829 --
NM_003387chr252348 467 341 221 62 ------
NM_003390chr113928 316 207 ------
NM_003392chr384263 3881 3345 2927 2918 1262 972 113 23017 646 31551 1480 1324 --
NM_003404chr20--11652 11573 --
NM_003406chr821939 1365 21824 530 11639 --
NM_003410chrX2782 92 12874 ----
NM_003412chr342377 2368 2021 389 11253 11130 --
NM_003413chrX21552 129 --11517 --
NM_003418chr3------1702
NM_003419chr191385 ------
NM_003423chr1962416 2205 2050 1831 1056 158 1708 ----
NM_003425chr192546 155 1509 ----
NM_003430chr1941189 128 105 43 ------
NM_003439chr7103521 3403 2895 2485 2478 2463 1272 643 399 201 1547 ----
NM_003442chr112772 113 ------
NM_003452chr91871 ------
NM_003453chr131615 ------
NM_003457chr172503 214 ------
NM_003467chr2--1387 ----
NM_003468chr264394 3959 2690 776 682 540 ------
NM_003469chr22374 97 ------
NM_003470chr1631842 605 380 --11636 --
NM_003471chr362049 1997 1887 1539 494 27 ------
NM_003473chr101348 2286 198 ----
NM_003478chr1142926 2420 2140 973 ----1800
NM_003482chr1242707 2388 2013 410 12269 ----
NM_003483chr1232735 489 376 --22764 66 --
NM_003485chr1421038 262 2285 91 1412 --
NM_003487chr171265 ------
NM_003488chr174931 847 777 758 --1129 --
NM_003489chr2163448 3387 3215 2975 2636 1133 --13397 --
NM_003498chr1672672 1847 336 306 250 123 33 --2699 207 12574
NM_003506chr811247 ------
NM_003507chr251718 468 431 371 229 1148 ----
NM_003558chr92686 239 ------
NM_003559chr1773514 3256 2915 2444 1359 1323 542 --43848 3316 2782 139 --
NM_003563chr171125 21196 429 ----
NM_003566chr1233338 712 479 23217 3044 ----
NM_003567chr11149 ------
NM_003569chr61262 1620 ----
NM_003575chr721169 113 ----11527
NM_003576chr1362938 2544 2451 2143 632 170 22301 515 ----
NM_003581chr22944 734 ------
NM_003583chr1283843 3694 3684 3125 1266 1034 528 247 --12381 12772
NM_003590chr2104063 4047 3459 2958 2570 2528 1555 1078 269 36 1208 --11580
NM_003591chr101294 ------
NM_003601chr4176 ------
NM_003603chr431871 522 516 123 ----
NM_003607chr154384 3819 2668 1668 1649 2801 788 13650 --
NM_003610chr201272 1353 ----
NM_003613chr153632 265 254 ------
NM_003615chr333430 2614 1375 1498 1662 1552
NM_003617chr173818 3277 1837 1610 1586 1078 509 ------
NM_003618chr24929 835 89 53 ------
NM_003626chr111333 11114 ----
NM_003628chr21231 ------
NM_003629chr173524 3314 3002 2160 1269 794 205 11066 12594 --
NM_003630chr61763 ------
NM_003633chr582427 2147 2052 2020 1977 1818 789 143 12328 ----
NM_003642chr21228 ------
NM_003655chr173638 601 168 ------
NM_003658chr112819 289 --1103 --
NM_003659chr23901 751 143 ------
NM_003663chr343325 687 163 138 ------
NM_003666chr14655 632 134 49 ----1215
NM_003671chr943022 2694 90 51 23310 1060 13288 --
NM_003672chr111729 --11430 --
NM_003677chr1262294 2270 2209 1564 1448 508 ----1272
NM_003679chr153239 2522 727 405 154 --11135 --
NM_003682chr113809 742 343 --1589 --
NM_003692chr91849 ------
NM_003701chr1321030 284 ------
NM_003704chr42604 47 1535 ----
NM_003713chr121635 1619 --1366 --
NM_003714chr533082 2657 2125 12017 ----
NM_003716chr32917 899 1939 ----
NM_003722chr322033 1767 2279 214 1221 1644
NM_003728chr41690 --1122 --
NM_003735chr51703 ----1266
NM_003736chr51703 ----1266
NM_003743chr242061 2020 1396 97 12249 ----
NM_003746chr12----153 --
NM_003749chr1372319 1634 955 869 750 513 94 --11969 --
NM_003758chr152614 412 --1527 --
NM_003758chr152614 412 --1527 --
NM_003759chr443868 3338 921 897 22940 1600 13717 11592
NM_003762chr12352 58 21315 448 ----
NM_003763chr2062466 2314 2291 731 719 235 ----21239 321
NM_003768chr121835 1147 11486 ----
NM_003779chr1--1170 ----
NM_003780chr11679 ------
NM_003783chr131085 801 215 ------
NM_003787chr1851620 1100 588 94 40 ------
NM_003794chr3--1979 ----
NM_003800chr652342 2129 1537 626 191 11880 1410 --
NM_003816chr81319 --1299 --
NM_003819chr11111 ------
NM_003821chr8----1146 --
NM_003822chr143099 3028 1087 206 11233 11930 --
NM_003825chr152989 500 1343 ----
NM_003829chr9151 --1113 --
NM_003850chr133627 589 149 ------
NM_003858chr142221 116 162 ----
NM_003861chr1431063 762 750 11101 ----
NM_003862chr5160 --1227 --
NM_003866chr42736 537 ------
NM_003870chr1532084 1968 306 ------
NM_003872chr212909 12294 1223 --
NM_003873chr1042511 2298 2113 952 --1534 --
NM_003876chr171318 ------
NM_003877chr12----1621 --
NM_003884chr31318 ------
NM_003887chr272217 2207 1546 825 737 697 572 --12024 --
NM_003888chr1551681 1629 1205 148 62 ------
NM_003895chr2141962 1487 792 625 ----11825
NM_003899chr132929 629 42317 1970 1649 566 21802 899 --
NM_003901chr1072566 2494 1985 971 899 842 559 12293 12392 --
NM_003902chr12650 613 ------
NM_003913chr671522 1214 1165 668 481 259 227 12933 --1203
NM_003916chrX2929 342 ----148
NM_003929chr121733 546 ------
NM_003932chr2221899 673 ------
NM_003934chr92504 344 --11031 --
NM_003938chr19194 ------
NM_003939chr1083363 3183 2827 1372 1046 982 825 174 11412 1491 --
NM_003941chr72710 497 2650 509 --1902
NM_003942chr112196 80 ------
NM_003947chr321241 27 ------
NM_003948chr442158 2050 1709 60 1697 ----
NM_003949chr1771966 1449 703 609 547 320 237 ------
NM_003958chr663002 2878 2715 1524 974 585 21079 635 ----
NM_003971chr172506 191 ------
NM_003972chr1031339 1292 182 1239 ----
NM_003980chr621224 477 ------
NM_003994chr1274308 3165 1756 513 406 322 285 --32925 399 258 --
NM_004006chrX42594 2554 2441 2372 ----1212
NM_004007chrX42594 2554 2441 2372 ----1212
NM_004009chrX42594 2554 2441 2372 ----1212
NM_004010chrX42594 2554 2441 2372 ----1212
NM_004011chrX42594 2554 2441 2372 ----1212
NM_004012chrX42594 2554 2441 2372 ----1212
NM_004013chrX42594 2554 2441 2372 ----1212
NM_004014chrX42594 2554 2441 2372 ----1212
NM_004015chrX42594 2554 2441 2372 ----1212
NM_004016chrX42508 2468 2355 2286 ----1126
NM_004017chrX42594 2554 2441 2372 ----1212
NM_004018chrX42508 2468 2355 2286 ----1126
NM_004020chrX42594 2554 2441 2372 ----1212
NM_004021chrX42508 2468 2355 2286 ----1126
NM_004022chrX42508 2468 2355 2286 ----1126
NM_004023chrX42508 2468 2355 2286 ----1126
NM_004024chr121381 502 ----1354
NM_004034chr102646 236 ------
NM_004035chr1794380 4247 3584 3495 1933 1871 1628 830 570 11654 55157 3917 3835 1962 636 14890
NM_004036chr21189 ------
NM_004067chr731441 1243 1214 1980 --1124
NM_004068chr3--1470 ----
NM_004073chr1--1311 ----
NM_004075chr12128 ------
NM_004077chr1221302 350 1340 ----
NM_004080chr731465 1415 233 ----1424
NM_004085chrX2799 260 ------
NM_004087chr331684 1438 129 ------
NM_004090chr1732190 592 89 12646 11080 --
NM_004093chr1373034 2994 2680 1085 750 527 288 1307 23197 757 --
NM_004094chr1433040 2084 802 --1516 --
NM_004097chr2----1334 1894
NM_004098chr1021053 1019 --11071 --
NM_004100chr642198 1983 1664 451 1712 ----
NM_004102chr12576 188 ------
NM_004113chr32501 286 11655 ----
NM_004117chr612133 21879 1815 --1375
NM_004124chr1433531 2773 115 ------
NM_004133chr821792 692 1474 11848 --
NM_004136chr1541322 807 558 41 ------
NM_004157chr32919 577 ------
NM_004161chr23627 94 84 1538 ----
NM_004162chr351166 1118 1095 905 891 ------
NM_004170chr931481 1471 613 21221 1188 ----
NM_004171chr11119563 9152 8720 8707 7668 7553 6840 6605 6283 3054 2011 37073 5924 3484 --27799 758
NM_004180chr21238 ------
NM_004187chrX11320 ------
NM_004200chr1133126 2728 726 ------
NM_004202chrY2650 29 1291 ----
NM_004209chr1621187 1164 ------
NM_004225chr81131 ------
NM_004229chrX41868 1784 1449 398 ------
NM_004232chr18--12872 ----
NM_004238chr2--1128 ----
NM_004241chr101576 ------
NM_004251chrX185 1258 ----
NM_004253chr91820 ------
NM_004272chr531342 164 84 ------
NM_004274chr1452315 961 519 359 57 --11994 --
NM_004302chr1252834 2412 2099 1892 637 ------
NM_004311chr1062375 1203 739 579 302 32 22095 645 31933 1143 308 12114
NM_004319chr132951 756 392 1155 11170 13095
NM_004321chr283373 3235 3106 2960 1253 1246 1035 917 42391 2169 1292 210 12535 --
NM_004326chr13859 416 280 ------
NM_004329chr1041432 1422 267 35 ----11073
NM_004330chr1521075 214 ----1890
NM_004331chr842448 2217 842 647 --12492 --
NM_004336chr2137 ------
NM_004337chr851810 1566 439 423 65 --1174 --
NM_004338chr18146972 6782 5563 5475 5059 4482 2447 2372 1714 1691 1171 910 780 161 55528 4551 1964 1637 347 16402 --
NM_004342chr732157 1627 499 1340 ----
NM_004346chr431349 490 69 1105 --1397
NM_004349chr82850 151 ------
NM_004352chr161125 ------
NM_004360chr1621325 747 1323 21905 538 --
NM_004365chr5134 ------
NM_004370chr672018 1813 1601 1514 737 662 613 22006 1545 --22144 1994
NM_004380chr162833 97 1621 ----
NM_004384chr542102 1540 881 75 1708 11793 --
NM_004385chr52672 568 ------
NM_004386chr1932240 1761 589 11839 ----
NM_004392chr1331070 256 46 ------
NM_004393chr332226 422 390 21728 84 ----
NM_004396chr17----1110 199
NM_004397chr1151711 1611 1562 1421 719 11175 2822 704 --
NM_004405chr24717 439 126 112 --1887 --
NM_004411chr74672 575 507 61 --125 --
NM_004414chr2141561 1487 380 174 ------
NM_004419chr102326 235 1942 ----
NM_004420chr1142142 2031 1903 827 12343 1890 --
NM_004422chr171373 ------
NM_004426chr1251864 1847 597 119 81 ------
NM_004427chr131118 856 480 ------
NM_004430chr822215 1711 12074 ----
NM_004432chr92788 241 --12209 --
NM_004434chr141544 31581 1562 1543 21573 1554 11324
NM_004436chr1192 2531 435 ----
NM_004437chr173433 3419 3200 2883 2629 2477 1375 13486 12745 --
NM_004438chr242673 1181 136 72 22264 1108 11326 --
NM_004440chr641984 1817 1625 38 11677 11351 --
NM_004447chr121330 --1425 --
NM_004451chr113712 680 284 1596 ----
NM_004454chr312015 11769 1921 --
NM_004457chr241564 418 232 80 --11412 --
NM_004458chrX3715 450 357 ----12593
NM_004459chr1751978 1957 1366 514 389 ------
NM_004464chr484318 4216 3961 3692 3508 1018 580 113 13458 --13498
NM_004480chr142569 194 ----176
NM_004481chr112052 1653 22340 1763 --
NM_004482chr2----171 --
NM_004485chr1104099 4083 3679 2978 2819 1753 1174 1101 977 628 2464 53 23041 1567 --
NM_004492chr15------196
NM_004494chr1----11271 --
NM_004496chr1421347 1180 1867 ----
NM_004499chr51420 ------
NM_004500chr1421317 375 11969 11915 --
NM_004501chr183941 3569 3103 2537 861 494 450 112 --21482 179 11591
NM_004504chr2112975 2404 2380 1946 1041 951 860 654 600 285 277 12689 --1256
NM_004505chr1731927 1830 1535 ------
NM_004506chr61190 1166 ----
NM_004516chr1931165 1034 265 1152 ----
NM_004520chr53614 575 45 ------
NM_004521chr102338 323 ------
NM_004525chr231482 1356 1076 ----1567
NM_004529chr91585 ------
NM_004535chr2021769 715 ------
NM_004537chr121135 11437 ----
NM_004538chrX1812 --1321 --
NM_004543chr2247 29 ------
NM_004566chr1052556 674 612 553 39 12401 ----
NM_004571chr2163386 2628 2491 2456 870 419 --11358 --
NM_004575chr431394 535 295 ----1660
NM_004576chr51346 ------
NM_004586chrX84760 4483 4268 3583 2021 1726 1703 426 13320 11297 --
NM_004588chr1193699 3265 2599 2493 1364 1335 1065 821 579 12607 ----
NM_004591chr22415 158 ------
NM_004596chr191167 ------
NM_004598chr562032 1021 850 674 476 41 1435 13304 --
NM_004600chr11265 --21403 222 --
NM_004602chr2021192 533 11083 ----
NM_004612chr964521 4000 3944 1586 1374 119 14414 13511 --
NM_004615chrX2323 252 --156 --
NM_004620chr111244 ------
NM_004622chr252075 588 573 545 106 --1734 --
NM_004630chr1131163 1095 1000 11122 ----
NM_004631chr11178 ------
NM_004634chr33493 454 171 ------
NM_004636chr31402 ------
NM_004642chr122610 173 --1280 --
NM_004643chr143585 575 267 ------
NM_004654chrY21051 145 ------
NM_004660chrY42309 2261 263 96 1533 ----
NM_004663chr1541435 1273 978 283 --21299 182 --
NM_004671chr181240 ------
NM_004685chr1342631 827 259 178 22713 2542 131 --
NM_004686chr811181 ----1263
NM_004687chr1741944 1888 1832 163 ------
NM_004703chr1742531 1786 515 188 ------
NM_004709chrX31772 1677 1127 ------
NM_004713chr143655 535 244 ------
NM_004715chr181518 2153 121 ----
NM_004719chr1232343 1013 171 11124 1990 --
NM_004721chr33312 266 144 ------
NM_004723chr13828 714 107 ------
NM_004725chr101207 --21211 252 --
NM_004726chrX43672 2300 1904 1014 --14867 22146 1186
NM_004730chr552021 1617 641 486 442 32135 1761 708 ----
NM_004734chr1352354 2262 996 715 407 13084 --32500 2439 524
NM_004736chr12493 332 ------
NM_004737chr2231316 297 38 ----1864
NM_004742chr331813 1451 1185 ------
NM_004744chr463224 2977 2563 2540 2478 388 1900 ----
NM_004745chr8126703 5043 4629 4434 4329 2457 2349 1658 1597 1444 1318 1208 26228 5644 14357 --
NM_004747chr1021181 293 --128 11451
NM_004748chr1553649 3468 3309 1581 1066 --13515 --
NM_004755chr1441215 1027 818 32 ------
NM_004762chr1731449 545 28 21527 792 12015 --
NM_004768chr13401 275 28 --11009 --
NM_004770chr81189 ------
NM_004772chr521490 1344 1362 ----
NM_004774chr1742316 2001 1162 1075 --1731 --
NM_004786chr18131 ------
NM_004788chr1142677 2562 2512 205 ------
NM_004798chr2043078 2279 2256 885 2133 73 --12367
NM_004808chr10103148 3125 2699 1200 1114 955 932 871 513 385 --23205 2150 12897
NM_004815chr134864 3872 604 ------
NM_004824chr631413 316 174 ------
NM_004831chr192679 358 139 ----
NM_004834chr273358 3318 3291 2938 1315 221 88 1918 11219 --
NM_004836chr23860 782 378 ----180
NM_004840chrX62048 1821 1777 1621 1597 804 --1660 --
NM_004841chr12394 252 --1340 --
NM_004845chrX43952 2567 753 104 1727 13039 12724
NM_004850chr271751 1728 1375 669 566 500 415 ----11163
NM_004857chr1464460 1554 877 869 854 536 24757 1189 1220 --
NM_004859chr1753077 2341 1079 318 21 12047 22547 521 --
NM_004860chr171564 ------
NM_004866chr5104343 4320 4258 1761 1556 1490 1193 372 58 37 1204 1336 11364
NM_004867chrX2508 157 ------
NM_004871chr1754386 3527 2800 528 504 13603 33351 757 580 21704 634
NM_004874chr81502 ------
NM_004884chr152376 210 11128 ----
NM_004887chr511113 165 1400 --
NM_004891chr22193 74 ------
NM_004896chr10180 1474 11088 --
NM_004898chr42952 608 12001 ----
NM_004902chr202825 196 ------
NM_004904chr786581 6407 4679 4114 2588 1611 692 38 --11406 --
NM_004906chr61508 ------
NM_004912chr71321 11368 ----
NM_004921chr141862 1811 374 333 ----1958
NM_004922chr102701 268 ------
NM_004926chr1451837 1477 1142 731 509 ------
NM_004929chr82107 38 ------
NM_004938chr91503 --1204 141
NM_004939chr2144 ------
NM_004947chr362501 624 472 411 321 286 --1349 --
NM_004948chr1861434 1413 1350 1152 459 119 1268 1956 --
NM_004953chr31109 --170 --
NM_004956chr763790 930 658 559 492 464 1603 ----
NM_004961chrX21415 372 31175 577 144 ----
NM_004962chr10--187 --2721 485
NM_004963chr12146 1437 ----
NM_004967chr41384 ------
NM_004968chr71278 1618 ----
NM_004973chr621438 76 11503 1197 --
NM_004976chr1175085 3427 3414 3247 1521 582 23 14955 34660 3994 870 --
NM_004978chr131476 1264 229 1205 ----
NM_004982chr123737 482 153 ------
NM_004985chr1254506 3586 3532 2902 1364 14078 13195 --
NM_004992chrX128016 7416 6950 6193 6076 5499 3239 3174 2970 2021 1185 21 26764 284 18005 --
NM_004992chrX128016 7416 6950 6193 6076 5499 3239 3174 2970 2021 1185 21 26764 284 18005 --
NM_004993chr1421478 515 1313 ----
NM_004996chr1631750 503 419 --134 --
NM_004998chr153825 764 362 1935 ----
NM_005006chr23967 700 171 --152 --
NM_005010chr721620 286 --2733 439 --
NM_005011chr741371 672 207 158 2263 62 ----
NM_005023chr531507 270 236 --146 --
NM_005026chr15575 557 236 94 41 11338 ----
NM_005027chr1951096 879 856 363 60 ------
NM_005036chr22168294 7452 7337 6398 5603 5423 5102 5053 2516 2183 2159 2115 832 824 809 133 11365 ----
NM_005044chrX83662 3624 3530 3509 3218 1036 746 63 11688 1210 --
NM_005045chr73929 868 392 ------
NM_005056chr1275164 4568 4373 3880 2235 1216 499 --14220 --
NM_005057chr131912 1515 663 11881 11920 --
NM_005065chr1474989 4848 4004 3644 1379 514 296 14405 ----
NM_005066chr12608 229 ------
NM_005069chr2131696 1161 51 --11213 --
NM_005078chr1511558 11322 11328 --
NM_005088chrX4784 323 287 115 ------
NM_005093chr2075310 4708 4103 3928 3510 1912 1437 24542 183 13723 14407
NM_005095chr141955 1843 1621 379 --1828 11365
NM_005097chr101226 ------
NM_005104chr61141 --1684 --
NM_005109chr322555 2221 --21996 683 --
NM_005112chr42829 152 1403 156 --
NM_005116chr20113971 3792 2850 1822 1735 1721 1141 677 295 131 48 23287 2813 13334 --
NM_005121chr1783200 3164 3090 2979 2779 730 586 58 23060 737 ----
NM_005126chr362213 1807 1643 1616 191 39 ------
NM_005134chr182803 772 1117 1128 --
NM_005135chr1583776 3557 3177 2841 2491 2442 569 181 --13388 --
NM_005149chr141320 1071 874 229 ------
NM_005151chr183831 413 359 --31957 1713 553 --
NM_005153chr161657 ----1577
NM_005154chr151420 --1184 --
NM_005156chr9104877 3880 2038 1861 1809 1784 1333 1298 1185 610 11353 ----
NM_005157chr921959 45 --1262 --
NM_005171chr1211273 ------
NM_005180chr101303 1404 ----
NM_005188chr1177738 7221 7209 5764 2187 1502 21 36881 2884 2175 25631 1465 --
NM_005190chr631141 976 447 ------
NM_005197chr1435345 5194 5074 34460 4148 4024 14766 --
NM_005202chr152294 2017 1400 911 229 --1544 --
NM_005204chr101623 ------
NM_005215chr182245 46 --1294 --
NM_005216chr13501 478 416 ------
NM_005219chr531341 1267 59 ------
NM_005220chr1721262 166 --11188 --
NM_005221chr71304 ------
NM_005225chr203932 389 51 ----1322
NM_005231chr1111352 ------
NM_005233chr342312 1642 902 501 166 ----
NM_005235chr2137190 6769 6256 5245 5046 4754 2929 2271 2150 2106 1597 718 417 13154 ----
NM_005238chr1142500 1057 645 146 12296 23536 2311 --
NM_005241chr331221 1101 105 ------
NM_005245chr4175 ------
NM_005249chr14121 ------
NM_005252chr14--1102 1532 --
NM_005254chr1541329 1301 420 62 ------
NM_005256chr11--2333 174 1861 --
NM_005257chr183963 516 93 ------
NM_005261chr81777 ------
NM_005271chr1031214 492 387 152 ----
NM_005277chr411430 --1534 --
NM_005296chrX1882 ----1140
NM_005302chr7------1133
NM_005316chr1141002 856 780 53 1726 1311 --
NM_005324chr1752102 1908 1798 1338 641 ------
NM_005328chr8124 ------
NM_005333chrX41116 259 182 79 ------
NM_005339chr454113 3583 3039 1732 958 ------
NM_005342chrX62254 733 536 494 389 208 ------
NM_005357chr192261 223 ------
NM_005358chr1341820 1257 705 408 132 ----
NM_005359chr1855511 5328 2154 1245 1131 36287 1232 329 ----
NM_005378chr23851 570 207 ------
NM_005385chr362650 2623 2448 2369 1902 1062 --12254 --
NM_005387chr111144 ------
NM_005397chr7103978 3855 3801 3305 2683 1440 1429 1042 952 303 1894 13755 --
NM_005398chr1031417 1372 1237 ------
NM_005400chr273047 2904 2021 1006 333 138 34 ------
NM_005402chr721379 142 --11185 --
NM_005406chr1841528 1334 1136 629 ----1545
NM_005407chr1431517 242 140 --1356 --
NM_005418chr11--137 ----
NM_005430chr121828 1955 1907 --
NM_005436chr1053960 3768 3677 2626 1162 32677 825 388 ----
NM_005437chr1041392 1368 1360 922 --166 --
NM_005445chr10168 ------
NM_005455chr121345 600 ----11812
NM_005458chr942431 750 598 551 32056 93 69 32205 1827 1683 1738
NM_005460chr52396 230 ------
NM_005461chr2031766 1598 1371 ------
NM_005465chr111843 ----1648
NM_005475chr1273237 3051 2565 2348 1998 736 178 ------
NM_005476chr931366 1234 1066 --1108 --
NM_005477chr1542123 1980 724 518 22485 601 ----
NM_005477chr1542123 1980 724 518 22485 601 ----
NM_005487chr2242027 586 167 96 171 ----
NM_005493chr61813 ------
NM_005497chr17116016 5710 5702 5687 5369 4620 4464 4441 1579 1546 369 1222 41687 1268 702 512 --
NM_005499chr19----1166 --
NM_005501chr171219 --11135 --
NM_005502chr973136 2761 2693 1306 935 834 123 ----12931
NM_005504chr1296234 6200 2654 2080 1466 1256 422 173 45 16585 25798 2468 11393
NM_005506chr452053 1893 897 592 83 ------
NM_005509chr521653 1540 ------
NM_005513chr32325 235 ------
NM_005517chr131139 1072 42 ------
NM_005522chr7--1157 ----
NM_005523chr731588 543 279 1272 ----
NM_005530chr1541315 1206 941 264 ------
NM_005539chr1041264 1046 89 56 11286 1549 --
NM_005542chr73706 576 116 ------
NM_005544chr22920 197 ------
NM_005561chr133777 136 28 ------
NM_005562chr141350 1192 282 173 ------
NM_005563chr15897 292 145 120 56 ------
NM_005569chr2221461 21 ------
NM_005574chr112755 532 ------
NM_005575chr51148 ------
NM_005578chr353402 3350 1724 1036 440 --11170 --
NM_005587chr151251 3357 314 218 2406 39 --
NM_005596chr9155820 5437 5350 4991 4768 4538 3988 3919 2139 2096 1992 1573 1097 623 289 14627 36391 5974 251 --
NM_005599chr131169 1018 93 ------
NM_005600chr1----1195 --
NM_005603chr183692 449 90 ----11328
NM_005604chr652405 1828 1625 530 227 ------
NM_005607chr831026 756 373 1644 ----
NM_005611chr1631300 394 286 ------
NM_005614chr721026 403 ------
NM_005626chr11493 ----1518
NM_005627chr62909 138 1318 ----
NM_005629chrX51311 1277 1034 342 284 ----11344
NM_005634chrX1148 ------
NM_005637chr1832063 1693 1509 ------
NM_005638chrX31546 1243 1155 11325 31135 695 214 --
NM_005639chr1221760 1560 ------
NM_005648chr8153 ------
NM_005650chr2211012 ------
NM_005655chr82808 78 ------
NM_005665chr174484 4111 4073 3934 3001 784 570 ----13271
NM_005668chr554466 3390 2992 1576 732 --1795 13486
NM_005669chr532220 354 272 ------
NM_005677chr351418 1325 1028 354 182 1924 ----
NM_005682chr1611275 ----11396
NM_005684chr13338 287 110 ------
NM_005686chr141479 569 294 275 1141 1210 --
NM_005688chr331132 877 227 --1460 --
NM_005690chr12------1158
NM_005704chr13251 222 29 2721 380 --11046
NM_005707chr1531111 1048 91 181 ----
NM_005708chr132458 29 1298 ----
NM_005711chr54996 773 415 78 ------
NM_005715chr642306 1893 584 561 --11809 --
NM_005721chr221016 705 --1697 --
NM_005725chr141702 962 835 24 --1398 --
NM_005730chr1232875 2285 880 1523 ----
NM_005731chr21328 1152 ----
NM_005736chr1031128 458 186 --21511 1157 --
NM_005737chr252364 1121 1103 915 394 21872 737 --12350
NM_005739chr15160 129 1638 12008
NM_005744chr151119 ------
NM_005746chr732127 743 675 ------
NM_005748chr1263284 953 841 446 210 163 ----11387
NM_005749chr171190 ------
NM_005756chrX21544 1091 ------
NM_005759chr283960 1904 1764 1316 726 716 545 339 21099 366 11346 --
NM_005766chr1341063 968 567 398 1888 ----
NM_005776chr142791 567 ------
NM_005779chr551102 969 825 352 186 --11117 --
NM_005780chr13----1243 --
NM_005786chr1861077 845 411 405 54 34 ------
NM_005789chr1711451 11395 1807 --
NM_005795chr252688 1039 830 329 71 ------
NM_005801chr17--1681 ----
NM_005807chr11238 ------
NM_005813chr252285 2186 967 96 89 11019 1143 --
NM_005819chr173342 2910 2355 1121 478 219 117 12852 ----
NM_005822chr61417 1714 11816 --
NM_005826chr1--1211 ----
NM_005832chr31519 ------
NM_005839chr11159 ------
NM_005840chrX165747 4683 3076 2982 2938 2816 2615 2233 2123 1974 1769 1599 1583 1105 785 128 ------
NM_005841chr421081 196 ------
NM_005842chr132717 236 ------
NM_005843chr221390 604 ------
NM_005845chr1321563 1277 ------
NM_005850chr1175 ------
NM_005851chr11------148
NM_005853chr16----1504 --
NM_005859chr521577 79 ------
NM_005862chr321086 145 ------
NM_005863chr1021397 564 --1186 --
NM_005870chr1331180 472 236 ------
NM_005871chr102154 31 ------
NM_005875chr32322 85 ------
NM_005877chr2252205 1970 1952 1735 483 1149 ----
NM_005882chr42929 40 1737 --1767
NM_005884chr194709 609 594 308 ------
NM_005888chr12----1120 --
NM_005892chr174305 140 127 112 --188 --
NM_005897chr141195 1171 1140 251 1424 ----
NM_005898chr1143193 1994 643 466 12427 12499 --
NM_005899chr1711396 ------
NM_005901chr18148326 8034 7677 7028 6766 6263 3108 2422 1900 1449 1406 1348 1127 428 27981 533 11485 --
NM_005902chr1533499 2799 1698 23036 1446 21244 379 --
NM_005903chr545043 4321 1538 964 --25049 4448 --
NM_005904chr181454 ------
NM_005906chr631405 663 522 ------
NM_005909chr564124 4019 3715 1437 1195 707 --11540 --
NM_005910chr1783861 3342 3269 2976 1274 878 741 668 23231 982 11138 --
NM_005911chr24932 332 168 122 --1268 --
NM_005920chr172950 2526 1428 1281 1255 643 315 ------
NM_005922chr63433 119 47 ------
NM_005923chr63615 468 100 --1640 --
NM_005924chr7--1889 ----
NM_005930chr141319 --1778 --
NM_005933chr1142562 2490 621 390 22777 1980 ----
NM_005935chr475070 4600 4465 4323 4082 1847 669 --13880 --
NM_005937chr1733992 455 411 12815 ----
NM_005938chrX--1547 11097 --
NM_005941chr853883 2675 1469 1359 33 11619 ----
NM_005943chr641669 1649 1352 651 11604 ----
NM_005955chr154137 3617 924 603 246 33539 795 672 ----
NM_005962chr1021858 1579 ------
NM_005962chr1021858 1579 ------
NM_005964chr1741406 475 237 147 167 ----
NM_005966chr232019 502 456 --11543 --
NM_005968chr191180 ------
NM_005982chr14196 --152 --
NM_005996chr1241303 1019 615 110 ------
NM_006002chr13131 ------
NM_006007chr9123933 3702 3290 1647 1424 1303 1084 1075 980 943 740 323 21392 1016 ----
NM_006011chr1574230 3423 3118 1269 1170 1159 954 ------
NM_006015chr13880 834 502 ------
NM_006016chr622276 1800 12175 ----
NM_006022chr1321053 691 ------
NM_006024chr72310 116 1266 ----
NM_006029chr144663 641 582 199 --1608 --
NM_006037chr284914 4612 3680 3474 3052 1735 1058 872 13785 ----
NM_006038chr203740 373 355 ------
NM_006039chr1711054 1367 ----
NM_006047chr2043115 2355 2203 109 ------
NM_006058chr5--2292 40 ----
NM_006060chr7104278 3939 3780 3217 3024 1317 1259 573 462 210 --24106 1415 --
NM_006076chr743170 1049 988 489 32446 2357 2092 1966 --
NM_006080chr7102919 2649 2092 2055 1964 1911 1073 392 347 271 12352 ----
NM_006089chrX11332 1474 1136 1129
NM_006094chr872391 2043 2020 1954 1922 754 362 ------
NM_006095chr454479 4317 3570 3148 178 14302 14234 --
NM_006096chr831704 91 42 ------
NM_006100chr34382 219 160 54 ------
NM_006106chr1123113 82 11104 --12131
NM_006107chr171331 ------
NM_006108chr112112 27 1223 ----
NM_006109chr142375 56 ------
NM_006133chr1162249 2149 2028 1564 1529 509 1828 ----
NM_006134chr2151293 1286 1177 568 175 ------
NM_006136chr73314 118 56 ------
NM_006141chr1622163 993 12291 --22686 1768
NM_006154chr1542899 1164 987 21 12485 12597 --
NM_006156chr141201 ------
NM_006158chr821809 1298 1200 ----
NM_006159chr121576 ------
NM_006162chr1841650 1454 1447 486 --21677 460 --
NM_006164chr22377 341 ------
NM_006166chr1232275 2193 282 ------
NM_006178chr1721580 601 ------
NM_006186chr231150 370 197 ------
NM_006190chr221110 930 ------
NM_006194chr14--1189 ----
NM_006195chr951228 940 895 254 107 ------
NM_006202chr1931728 1588 1317 --11376 1321
NM_006203chr5105352 4528 3674 3503 3443 1853 853 541 480 383 11689 --14315
NM_006206chr452380 1984 900 332 73 22165 1093 ----
NM_006209chr81321 ------
NM_006210chr1921030 310 1434 ----
NM_006212chr155378 4139 3298 917 604 1877 14398 15258
NM_006218chr3393 82 46 ------
NM_006224chr1752297 987 739 541 253 --22037 142 --
NM_006226chr221141 410 ------
NM_006241chr342451 1533 243 22 12308 ----
NM_006243chr131007 391 126 1902 1885 --
NM_006246chr1441173 920 487 134 ------
NM_006247chr19--1152 ----
NM_006251chr583266 2784 2482 2284 2189 814 568 29 --12521 1998
NM_006252chr1106005 5660 5104 5080 2603 2555 2175 728 89 29 22919 1626 15591 --
NM_006256chr132303 2181 490 1907 ----
NM_006258chr10----2464 314 --
NM_006264chr42542 448 ------
NM_006265chr82980 344 --11344 --
NM_006267chr211153 --2717 127 --
NM_006281chr831091 864 240 ------
NM_006281chr831091 864 240 ------
NM_006282chr2064005 3180 3109 1581 560 553 --14280 13588
NM_006283chr824742 4114 21927 97 ----
NM_006287chr232081 1924 1730 ------
NM_006292chr11----188 --
NM_006301chr121646 ------
NM_006306chrX85806 5655 5530 4968 3942 2335 1908 1183 25307 2258 ----
NM_006317chr51708 --1769 --
NM_006320chr431133 194 40 11126 ----
NM_006321chr3122253 2022 1936 1894 1770 1612 1509 696 476 73 66 42 --12015 --
NM_006322chr135222 93 86 78 28 ------
NM_006323chr42617 281 ------
NM_006328chr112667 226 1477 ----
NM_006330chr8198 ----11074
NM_006333chr21655 ------
NM_006335chr12986 210 ------
NM_006336chr941407 1142 1041 267 ------
NM_006350chr53137 97 47 ------
NM_006352chr162085 1607 1431 704 424 311 --1646 --
NM_006357chr2157 2350 190 ----
NM_006359chrX21559 647 1208 ----
NM_006364chr1411111 ----1319
NM_006366chr641299 1116 319 84 ------
NM_006367chr11200 --1891 --
NM_006369chr1147 ------
NM_006371chr3134536 4191 3869 3648 3207 2126 1949 1912 1649 1271 321 286 144 23538 3305 14475 --
NM_006380chr1783770 3749 3515 1683 1659 1066 956 164 2294 154 43933 3173 1369 429 --
NM_006386chr2222169 905 1428 1751 --
NM_006387chr1921157 225 --182 --
NM_006390chr1271701 1167 1138 514 407 203 37 ------
NM_006421chr81895 --1101 --
NM_006434chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_006449chr262182 1829 1622 617 564 90 2874 273 11654 1676
NM_006454chr462693 2457 1050 981 913 316 12714 12089 --
NM_006459chr1041961 600 581 434 11706 ----
NM_006463chr21222 --154 --
NM_006465chr1542273 1800 1691 1675 1488 ----
NM_006469chr121122 130 1627 ----
NM_006480chr53452 436 29 ------
NM_006482chr1283843 3694 3684 3125 1266 1034 528 247 --12381 12772
NM_006489chr1461964 1917 1776 638 534 68 177 ----
NM_006496chr121754 292 21405 1260 11955 --
NM_006504chr1012901 --12131 --
NM_006520chrX2665 393 ------
NM_006526chr2031548 857 127 2826 637 ----
NM_006534chr2052870 922 418 51 37 23092 644 ----
NM_006538chr273964 3576 3540 3349 1089 1008 435 --24071 3355 24161 2992
NM_006540chr821505 239 ------
NM_006544chr1486104 5385 5331 4547 4212 2445 2018 543 ------
NM_006546chr1732379 1728 1565 2580 117 24634 4504 14132
NM_006548chr341715 1694 460 248 1129 ----
NM_006549chr1252002 1977 534 421 57 32534 1872 242 --12787
NM_006555chr741935 1826 1807 697 1270 158 --
NM_006558chr81475 ------
NM_006559chr111216 1439 11063 --
NM_006561chr1085541 5037 4329 4111 2476 1845 769 260 --15600 --
NM_006570chr91328 ------
NM_006572chr1772195 2178 1350 816 509 328 148 --23406 927 --
NM_006575chr143159 118 82 1534 ----
NM_006577chr211310 ------
NM_006585chr21----123 --
NM_006595chr1121509 290 ----11477
NM_006597chr112188 172 ------
NM_006599chr16108275 7427 5773 2854 1164 974 930 558 170 141 --13010 --
NM_006601chr1221066 915 ------
NM_006603chrX31682 1655 773 1817 ----
NM_006609chr252988 2187 2091 1837 67 ----12473
NM_006618chr121413 263 --11340 --
NM_006621chr111555 32020 1671 154 ----
NM_006624chr1011797 11473 1659 --
NM_006625chr13936 77 63 ------
NM_006625chr13936 77 63 ------
NM_006625chr13936 77 63 ------
NM_006628chr1554492 3509 1763 1379 115 44380 1826 1636 637 --13834
NM_006636chr23346 327 167 ------
NM_006644chr131157 ------
NM_006646chr1372949 2189 1207 1201 889 871 207 1327 ----
NM_006653chr6--1106 ----
NM_006654chr1234796 3997 1250 --13599 --
NM_006660chr15------1319
NM_006667chrX4972 464 426 254 --1211 --
NM_006670chr62648 440 1460 1608 --
NM_006676chr961452 1432 1256 499 310 300 1257 ----
NM_006682chr731081 570 547 ------
NM_006690chr2021553 625 12135 --11712
NM_006698chr2011163 ----11058
NM_006699chr172565 2131 1917 1770 1740 354 282 ----11925
NM_006703chr6----1469 --
NM_006711chr162572 119 2612 162 ----
NM_006713chr51641 1747 --1113
NM_006717chr912688 ----12978
NM_006718chr62233 156 ------
NM_006722chr373005 2941 2448 2415 2044 1919 534 ------
NM_006724chr63433 119 47 ------
NM_006726chr421037 208 ------
NM_006727chr51163 ------
NM_006729chrX115551 5217 5122 4864 3991 3464 2232 1909 650 499 160 13500 14385 --
NM_006738chr1574533 4185 4165 3450 2895 1525 867 11540 --13635
NM_006749chr84986 876 470 205 2509 172 ----
NM_006750chr16108106 6607 6556 5978 5955 2624 2477 2035 446 377 ----13029
NM_006754chr72386 22 ------
NM_006756chr821320 163 ------
NM_006759chr22108 100 ------
NM_006763chr1184 1636 11847 --
NM_006766chr831080 782 384 1109 --12130
NM_006769chr11125 ----1229
NM_006771chr171305 --1215 --
NM_006772chr621490 154 ------
NM_006775chr642907 671 568 234 ------
NM_006777chrX32847 2366 1120 ------
NM_006788chr1862012 1974 1725 1306 573 59 21895 1817 1719 --
NM_006791chr15--1247 ----
NM_006800chrX2495 218 --1151 --
NM_006802chr131128 953 839 --1157 --
NM_006803chr842008 1923 1631 1285 11589 ----
NM_006805chr521158 357 11196 ----
NM_006806chr21------1292
NM_006807chr171139 1287 --1322
NM_006811chr202289 120 --2709 369 --
NM_006813chr64902 877 174 108 --1264 --
NM_006814chr2062595 660 579 467 173 86 2193 122 ----
NM_006815chr123375 256 101 ------
NM_006823chr841213 317 167 112 --1118 --
NM_006826chr221201 1045 1208 2940 140 --
NM_006832chr1421062 300 ------
NM_006852chr1722504 2379 1325 1810 --
NM_006854chr731844 1607 1516 1117 ----
NM_006861chr1271630 637 525 450 404 363 28 --21444 34 --
NM_006872chr22121 53 ------
NM_006885chr1674090 4068 3691 3355 1013 394 82 11168 ----
NM_006888chr1453537 3517 3333 3221 2300 --12439 --
NM_006892chr2041152 1062 413 166 ------
NM_006892chr2041152 1062 413 166 ------
NM_006898chr2149 1326 --1255
NM_006901chr151139 1167 ----
NM_006908chr751283 1142 544 410 337 11435 ----
NM_006912chr14959 780 564 66 1519 135 --
NM_006914chr9196 ------
NM_006920chr261999 1986 1432 1354 1286 577 --1272 --
NM_006922chr252010 1929 1759 845 166 --11912 --
NM_006924chr1754379 4268 1190 1054 121 1365 ----
NM_006927chr1682015 1992 1392 884 622 530 172 95 ------
NM_006930chr551240 724 716 161 59 ------
NM_006931chr1231939 1916 154 ------
NM_006936chr2141306 897 512 164 189 ----
NM_006937chr172193 75 ------
NM_006939chr1431094 303 265 ------
NM_006940chr1231806 1570 691 --11545 --
NM_006948chr2152489 1710 876 772 501 ------
NM_006965chr1821108 1071 --11203 --
NM_006981chr911866 2187 123 ----
NM_006986chrX1210 ------
NM_006996chr121821 1366 ------
NM_006997chr101116 ------
NM_006999chr551821 1782 1693 1584 604 140 21646 278 --
NM_007005chr921355 467 1996 1115 --
NM_007007chr1294793 4697 4126 3969 3069 1278 1009 938 551 ----11514
NM_007008chr23932 748 97 2330 300 1762 --
NM_007010chr1741880 1529 321 308 1200 ----
NM_007011chr15106876 6142 5695 5601 4850 4843 4566 2596 785 213 ------
NM_007013chr8161 ------
NM_007034chr131022 203 127 ------
NM_007035chr122730 642 ------
NM_007038chr21106074 6008 5760 5630 5382 5100 4706 4617 1543 489 15581 ----
NM_007039chr141259 --12314 --
NM_007040chr1911028 ------
NM_007042chr331056 931 204 1503 1541 --
NM_007045chr61222 ----1131
NM_007047chr662486 2125 810 416 393 331 12096 --1104
NM_007052chrX2247 144 ------
NM_007064chr331183 298 70 ------
NM_007067chr171282 ----1165
NM_007073chr623671 641 13411 24005 1420 --
NM_007075chrX131 ----146
NM_007078chr1072881 2868 2768 2745 2685 1949 436 31878 672 381 ----
NM_007084chr1321285 68 1590 ----
NM_007107chr321518 669 12390 --12300
NM_007114chr353120 2685 2297 2093 2031 12285 --33095 2771 113
NM_007118chr53804 166 122 ------
NM_007122chr11163 ----139
NM_007124chr631653 1628 1538 --11915 --
NM_007125chrY1560 1338 ----
NM_007139chr721123 200 ------
NM_007144chr1751318 1265 1007 805 437 ------
NM_007146chr1712862 ----12887
NM_007150chrX11783 12089 --1425
NM_007158chr11208 --1807 1291
NM_007159chr341608 1539 203 129 ------
NM_007166chr1131153 520 379 11284 ----
NM_007167chr13865 859 828 --1240 --
NM_007172chr2232759 294 180 ------
NM_007173chr1122026 154 ------
NM_007174chr1252059 1688 1483 227 40 ------
NM_007175chr853526 2414 1071 916 21 22801 489 1847 --
NM_007185chr11998 ------
NM_007187chr1321050 196 ------
NM_007189chr7111481 1426 1290 1203 1195 1180 961 593 303 156 107 1342 11318 --
NM_007191chr121183 ------
NM_007192chr14175 --11037 --
NM_007195chr1822692 2466 23608 3486 13048 --
NM_007200chr1574533 4185 4165 3450 2895 1525 867 11540 --13635
NM_007203chr973318 3289 2419 753 453 314 137 ------
NM_007212chr121864 188 --1458 --
NM_007214chr631359 1215 479 ----11072
NM_007217chr32341 80 ------
NM_007218chr83681 597 157 1870 ----
NM_007222chr821392 363 --2722 178 --
NM_007246chr42255 100 --2858 241 --
NM_007247chr178883 855 822 735 290 196 163 87 ------
NM_007249chr13229336 9114 9003 8929 8749 8199 8165 7722 7071 6644 5947 5883 3787 3122 3098 3034 2126 2095 1787 1457 1423 769 17502 1820 --
NM_007269chr11407 ------
NM_007271chr621428 177 11147 11788 --
NM_007276chr721080 209 ------
NM_007282chr34889 716 687 54 190 ----
NM_007283chr353054 2735 1886 901 357 22777 603 ----
NM_007292chr1794380 4247 3584 3495 1933 1871 1628 830 570 11654 55157 3917 3835 1962 636 14890
NM_007308chr41569 ------
NM_007313chr921959 45 --1262 --
NM_007315chr261432 1392 1169 1058 1046 127 ------
NM_007327chr92935 246 ------
NM_007331chr452644 2609 1095 310 57 1583 ----
NM_007345chr1842319 1729 1707 854 12160 1238 1753
NM_007347chr1542516 2301 2217 170 12894 22203 1180 12828
NM_007350chr1274406 4333 3702 1797 1710 949 284 ------
NM_007353chr742592 1889 694 528 41204 893 685 403 ----
NM_007358chr151688 704 480 45 29 ------
NM_007361chr144569 213 186 68 ------
NM_007363chrX2920 420 ------
NM_007365chr12561 241 ------
NM_007371chr91675 1210 ----
NM_007373chr1021264 115 ------
NM_007374chr141453 ------
NM_007375chr122676 538 --11914 --
NM_012062chr122915 95 ----1158
NM_012063chr12------1158
NM_012073chr51337 ----1110
NM_012081chr542960 2654 2442 627 --1865 --
NM_012082chr83893 836 319 ------
NM_012084chrX--2482 52 ----
NM_012089chr111503 154 ----
NM_012090chr121184 429 ------
NM_012095chr10113278 3240 3232 3217 2171 1278 804 671 598 305 275 --23246 534 --
NM_012096chr322992 616 1731 ----
NM_012102chr13772 515 83 1409 12483 --
NM_012111chr14182 ------
NM_012115chr6136 ------
NM_012120chr632643 773 225 ------
NM_012134chr121746 312 11849 11277 --
NM_012137chr152298 2214 2075 998 559 22679 2114 ----
NM_012141chr1353972 3947 3854 1653 664 ------
NM_012154chr81877 ----1187
NM_012156chr2033254 2584 642 1278 --1794
NM_012157chr321010 830 --1146 --
NM_012158chr1331833 1137 68 ------
NM_012161chr421085 367 1381 ----
NM_012164chr9137048 6961 6439 5372 5348 2281 2243 1169 705 654 81 69 47 22149 1899 14799 --
NM_012193chr11135404 5383 4001 3854 1542 1525 1413 938 896 637 562 338 274 1187 1782 --
NM_012199chr143060 1728 808 361 2802 370 11568 13110
NM_012207chr106919 852 710 448 366 169 ------
NM_012214chr2125945 5645 5249 5081 4655 4523 4151 2131 2095 1617 1501 1139 11629 24224 2236 1114
NM_012215chr1031963 1339 43 11951 1192 --
NM_012218chr19102979 2917 2885 2598 2262 1199 995 876 537 261 12022 ----
NM_012219chr322129 70 --1637 --
NM_012223chr241221 1054 446 345 ------
NM_012234chr352737 1360 1339 1327 1027 --11084 --
NM_012238chr1021289 1245 ------
NM_012242chr102271 199 --1187 --
NM_012243chr13939 760 173 1282 ----
NM_012247chr10----11017 --
NM_012249chr231396 702 648 ------
NM_012250chr1111312 ------
NM_012252chr764852 4830 3760 1450 837 339 --11319 15227
NM_012255chr201338 ------
NM_012257chr71710 --1843 --
NM_012259chr631382 1082 444 1513 ----
NM_012261chr201470 --1569 --
NM_012262chr175042 4012 3434 1793 968 934 533 25245 890 --13418
NM_012279chr542110 660 458 196 ------
NM_012281chr741617 930 741 643 192 ----
NM_012282chrX1241 --1795 --
NM_012287chr323042 1805 1238 11310 --
NM_012288chr675420 4229 2186 2049 1575 1175 799 44839 4267 1931 1029 1421 --
NM_012290chr231491 1076 316 21439 1186 ----
NM_012293chr231953 1608 299 32074 180 75 --182
NM_012294chr793560 3159 2918 2664 1239 849 680 648 32 --1561 --
NM_012297chr482642 2451 2320 1885 983 967 859 327 --11021 --
NM_012301chr7112197 2126 1865 1850 1840 1664 869 776 620 421 325 --11564 --
NM_012302chr16807 494 485 426 353 148 --1319 --
NM_012304chr542547 1846 882 661 --11858 --
NM_012306chr1252805 932 807 384 366 22949 2553 --12428
NM_012307chr183966 950 391 ------
NM_012308chr1131789 1632 692 --12466 --
NM_012309chr1164431 3455 3432 3410 1684 513 ------
NM_012316chr1105631 5154 4854 4831 4017 3807 3527 3411 2063 264 11022 ----
NM_012323chr2261462 1377 1057 434 156 100 ------
NM_012325chr2031113 631 60 1146 ----
NM_012327chr1841528 512 299 191 11039 11341 --
NM_012328chr731215 449 373 1432 ----
NM_012329chr1751137 565 536 102 77 --1658 --
NM_012330chr1031301 605 496 11652 ----
NM_012333chr111626 ------
NM_012334chr5104551 4316 4292 4231 3400 2938 1843 1073 886 519 --33205 3049 1552 --
NM_012338chr711196 ------
NM_012343chr53146 96 43 --1408 --
NM_012382chr544215 3530 3264 407 ----13484
NM_012399chr2271835 1606 1468 423 319 211 115 ------
NM_012402chr1151381 1357 1295 1287 916 ----1437
NM_012412chr7145 1629 --1124
NM_012414chr11751 ------
NM_012416chr91507 ------
NM_012421chr1142 ------
NM_012425chr1042345 2073 2043 257 1958 ----
NM_012428chr151878 --1659 --
NM_012433chr2------189
NM_012446chr52229 191 ------
NM_012454chr62541 70 ------
NM_012467chr161102 ------
NM_012474chr1199 ------
NM_012479chr72992 931 1245 32289 585 44 --
NM_012482chr11620 ------
NM_013229chr1232584 515 114 12643 1947 --
NM_013230chrY41804 1461 1212 477 ------
NM_013231chr1474039 3704 3160 2991 1741 1247 262 13553 13505 --
NM_013233chr241468 1438 1160 250 11047 ----
NM_013235chr51830 184 ----
NM_013253chr1121367 1169 21025 488 1226 --
NM_013257chr862227 2199 1507 1484 838 815 1574 ----
NM_013261chr483107 2940 2546 2350 1160 922 866 78 12975 23459 822 --
NM_013262chr62163 44 ------
NM_013269chr1273789 3672 3252 3193 3003 2941 681 11206 ----
NM_013275chr163802 776 127 ----1336
NM_013277chr12172 11019 ----
NM_013279chr1122078 94 --31725 1438 839 --
NM_013281chr2051087 368 255 122 81 ------
NM_013282chr1921142 1036 11189 1861 --
NM_013283chr51188 1298 ----
NM_013286chr333720 430 281 ----11386
NM_013296chr1189 ------
NM_013309chr1562319 2295 2237 1628 878 41 --12325 --
NM_013316chr72937 918 ----1395
NM_013323chr172430 279 ------
NM_013326chr18152 ------
NM_013330chr11211 ----1179
NM_013341chr262392 2299 2087 1861 1806 553 ------
NM_013354chr82388 347 ------
NM_013357chr82854 314 ------
NM_013364chrX51938 1841 558 512 263 ------
NM_013372chr1523201 422 --12648 1714
NM_013374chr351142 925 446 234 199 12537 ----
NM_013380chr194813 756 609 192 ------
NM_013381chr1231926 727 480 ------
NM_013390chr921092 692 ----11443
NM_013396chr213278 122 28 11068 --1162
NM_013433chr1941953 730 484 68 11312 ----
NM_013436chr24810 515 507 325 158 ----
NM_013437chr811170 --1271 1282
NM_013438chr941523 525 506 208 ------
NM_013444chrX1911 1902 ----
NM_013446chr741416 1172 554 297 11398 ----
NM_013448chr143750 717 502 ------
NM_013450chr2168 ------
NM_013952chr252387 2130 969 776 77 11983 ----
NM_013953chr252387 2130 969 776 77 11983 ----
NM_013992chr252387 2130 969 776 77 11983 ----
NM_013995chrX62022 723 504 475 361 94 ------
NM_013996chr71410 ------
NM_013996chr71410 ------
NM_013997chr71410 ------
NM_013997chr71410 ------
NM_013998chr71410 ------
NM_013998chr71410 ------
NM_014010chr92588 477 ------
NM_014011chr251827 1699 1689 1681 729 --12300 11046
NM_014014chr22585 433 ------
NM_014016chr331702 1396 1204 2315 255 ----
NM_014023chr1082778 2522 2302 2016 1929 1886 1078 385 12601 ----
NM_014028chr693002 2775 2408 2317 2232 2107 959 826 544 --1446 --
NM_014034chr641499 1253 1188 960 1122 ----
NM_014048chr1675200 5180 4282 4205 4008 3837 445 ----12083
NM_014089chr1372094 1762 1620 1439 749 726 86 --21974 429 --
NM_014106chr1582904 2834 2639 2614 2450 644 478 399 --12291 12372
NM_014112chr874437 4269 3875 3714 3481 1999 784 14369 34780 4468 1671 --
NM_014117chr1682706 2403 1008 793 710 456 296 70 --12616 --
NM_014141chr744739 4329 3894 783 ----15142
NM_014154chr311216 11600 ----
NM_014155chr11117466 6636 5960 5722 2366 2203 1811 1687 1620 1539 1524 12642 11323 15283
NM_014157chr1693891 3616 3190 3128 2779 2520 950 858 461 --13035 --
NM_014160chr321410 356 --184 --
NM_014191chr1251066 772 330 239 155 ------
NM_014216chr1431452 1237 1067 11209 ----
NM_014217chr121591 559 --11306 1713
NM_014233chr1761432 1343 1336 540 370 188 ------
NM_014235chrX61716 1374 472 420 76 46 ------
NM_014238chr1741628 1562 1378 1087 1577 ----
NM_014240chr394167 3916 3893 3549 3082 1523 1463 534 522 21640 513 13334 --
NM_014248chr221131 ------
NM_014250chr2242027 586 167 96 171 ----
NM_014253chrX22163 656 ----11001
NM_014260chr6----164 --
NM_014263chr1041057 1030 184 38 --159 --
NM_014278chr42379 348 1361 ----
NM_014279chr91212 --1224 --
NM_014280chr1----1832 --
NM_014283chr141521 1100 460 63 ------
NM_014284chr13687 322 180 1913 ----
NM_014289chrX41416 944 360 170 ------
NM_014294chr821386 1301 11285 ----
NM_014296chr321050 166 1428 ----
NM_014309chr2234800 4187 50 13618 34222 4177 4100 13626
NM_014314chr931291 611 360 ------
NM_014319chr1211407 ------
NM_014323chr2221062 90 1203 ----
NM_014333chr1142376 2061 1911 720 1791 --1285
NM_014335chr1521089 154 ------
NM_014342chr112592 33 ------
NM_014363chr133869 264 214 11073 --1113
NM_014372chr131949 1545 630 1137 11603 --
NM_014379chr851007 679 375 285 176 ------
NM_014382chr331508 1415 480 --140 --
NM_014393chr872320 2252 1927 1724 1542 1514 888 --22128 1690 --
NM_014399chr72771 235 1288 ----
NM_014415chr32378 303 ------
NM_014417chr193869 677 352 1885 ----
NM_014421chr452078 1685 1446 1404 600 ----130
NM_014423chr544076 3761 2139 221 15146 ----
NM_014431chr1021263 1138 31466 1383 285 ----
NM_014445chr321814 963 --1374 --
NM_014447chr451687 1439 584 496 269 1471 ----
NM_014454chr6--1833 ----
NM_014458chr121248 1113 ------
NM_014462chr8------198
NM_014470chr121668 1646 ----
NM_014480chr192649 587 ------
NM_014488chr111231 1254 ----
NM_014491chr72820 757 1355 ----
NM_014494chr1652340 2079 665 631 77 --11836 --
NM_014496chrX1192 ------
NM_014497chr21240 ------
NM_014502chr111322 ------
NM_014515chr12------180
NM_014517chr33622 326 23 ------
NM_014521chr231809 1585 1401 --1194 --
NM_014522chrX--1209 ----
NM_014562chr22339 75 ------
NM_014563chrX62117 1756 1534 657 629 326 ------
NM_014570chr2211055 2411 97 ----
NM_014572chr132656 221 ------
NM_014574chr142187 178 ------
NM_014575chr31368 ------
NM_014577chr221685 ------
NM_014584chr1421378 1079 ------
NM_014585chr211151 ----168
NM_014591chr101271 ------
NM_014600chr261457 1433 1096 499 165 133 --11640 --
NM_014603chr1731622 1056 683 ------
NM_014606chr421087 498 ------
NM_014612chr931418 1186 77 ------
NM_014613chr543010 2330 411 151 12668 1879 --
NM_014616chr363040 1304 1290 1040 966 633 --1596 --
NM_014633chr112470 462 --2516 247 --
NM_014636chr9103809 3797 3747 3620 1584 1445 919 683 331 218 ------
NM_014637chr81317 ------
NM_014646chr1882500 2251 1281 566 440 348 295 180 12156 12847 --
NM_014647chr161614 ------
NM_014655chr112321 ------
NM_014659chr152988 883 --11028 --
NM_014660chr721089 149 ------
NM_014662chr221472 ------
NM_014663chr14833 255 170 159 --1894 --
NM_014665chr8133410 3247 3232 2797 2782 2670 2507 1434 1252 913 268 165 37 12654 ----
NM_014666chr521061 826 ------
NM_014667chr352333 2011 1753 1708 1641 --1760 1718
NM_014670chr21274 ------
NM_014674chr363744 3511 2501 2490 595 507 23113 2718 --13874
NM_014676chr111435 ------
NM_014677chr821293 86 11141 ----
NM_014678chr224559 518 272 119 ------
NM_014679chr113982 875 264 ------
NM_014682chr872189 593 527 500 350 125 104 ------
NM_014683chr1721495 595 --197 --
NM_014686chr1962291 1682 1597 897 798 457 --1686 --
NM_014689chr2150 ------
NM_014701chr154822 801 154 46 12828 ----
NM_014702chr633119 799 498 12859 ----
NM_014705chr721739 671 ------
NM_014707chr742189 1539 780 420 --1604 --
NM_014712chr161575 ------
NM_014717chr192242 70 ------
NM_014720chr1051719 1487 1474 1280 392 1410 ----
NM_014721chr6146850 6801 5932 5819 5685 5249 4998 4951 4627 2263 1748 1061 1015 77 22503 1205 26392 849 --
NM_014723chr2053237 3022 1271 905 30 --1247 --
NM_014725chrX41127 1088 415 339 ------
NM_014729chr811983 --11949 2713 301
NM_014730chr1255309 5167 4110 1885 1031 --11951 --
NM_014730chr1255309 5167 4110 1885 1031 --11951 --
NM_014732chr16115853 5050 4871 4604 4440 3697 2052 1886 1646 1295 386 65096 4828 4093 1523 1082 678 15139 21867 1612
NM_014733chr572228 2182 1571 1420 825 207 29 ------
NM_014735chrX2422 141 --2194 101 --
NM_014736chr153952 890 272 --1976 --
NM_014739chr694122 3200 1609 1414 1112 857 802 434 171 1894 ----
NM_014742chr20--1166 21537 68 --
NM_014743chr422251 938 --4749 359 328 306 12541
NM_014747chr163928 3920 1067 611 526 109 11260 1156 --
NM_014751chr851864 1803 1525 787 738 11469 1723 --
NM_014752chr1141732 1641 224 202 21764 1714 ----
NM_014755chr251276 754 572 371 332 ----13955
NM_014756chr112412 29 ------
NM_014757chr552165 1918 957 843 640 ------
NM_014762chr182330 1628 987 925 865 688 412 321 11933 ----
NM_014764chr1241189 818 289 95 ------
NM_014765chr122390 285 ----12598
NM_014773chr531230 538 501 ------
NM_014774chr142980 2441 2236 385 --1105 --
NM_014776chr1253006 2414 2208 2102 807 22883 2181 11261 --
NM_014781chr84861 804 486 54 ------
NM_014782chrX148 ------
NM_014787chr132698 1035 524 31047 237 29 ----
NM_014795chr231250 304 189 1117 11024 --
NM_014802chr123938 892 828 ------
NM_014810chr163469 3428 3101 2398 1275 1250 ------
NM_014812chr121357 721 ------
NM_014819chr5--1167 ----
NM_014820chr372035 2023 1762 656 554 192 184 ------
NM_014822chr41219 ------
NM_014824chr111579 21352 1258 ----
NM_014826chr154384 3819 2668 1668 1649 2801 788 13650 --
NM_014827chr121208 646 ------
NM_014829chr532037 1743 64 ------
NM_014830chr1233481 2469 683 11220 1415 --
NM_014836chr1021935 218 ------
NM_014838chr2262550 2043 1785 415 388 345 --11892 12382
NM_014839chr121943 607 3425 263 159 ----
NM_014840chr1253447 3100 3044 2423 142 ------
NM_014841chr641293 1062 1053 885 ------
NM_014846chr81102 ------
NM_014849chr111204 --11275 --
NM_014850chr373086 1016 838 610 570 403 161 1639 ----
NM_014857chr1--1218 ----
NM_014860chr252332 2019 1630 1613 863 12006 11009 --
NM_014872chr962205 2143 565 551 526 163 ------
NM_014873chr1104727 4012 3083 3022 1627 1248 532 509 486 380 --44271 1474 1277 903 13096
NM_014877chr1787484 7086 6593 6190 5978 2659 638 549 ----11797
NM_014882chr23578 474 160 ------
NM_014883chr452379 799 600 480 36 1705 1231 11779
NM_014890chr31289 ------
NM_014892chr6----1561 --
NM_014897chr1773255 3232 2853 2537 2384 969 823 ------
NM_014899chr532977 1245 238 11143 ----
NM_014903chr1231615 289 175 ------
NM_014906chr1743236 1252 805 686 ----11173
NM_014912chr1043042 888 864 680 ----23027 202
NM_014917chr12732 235 1256 ----
NM_014918chr1521256 348 ------
NM_014920chr663453 2931 2760 2647 2314 400 1707 13390 --
NM_014923chr1332017 1956 1661 11575 ----
NM_014924chr1443210 3132 1286 687 ------
NM_014932chr3----21592 41 --
NM_014935chr163736 3630 3335 2730 2532 2494 ------
NM_014941chr22150 ------
NM_014942chr642550 2434 1724 57 --12364 1100
NM_014944chr111340 1943 ----
NM_014946chr232374 763 544 2326 25 ----
NM_014947chr163011 2424 1200 987 464 329 12187 ----
NM_014949chr14987 839 779 182 1112 ----
NM_014950chr1451612 1293 614 495 362 ----11462
NM_014951chr1042562 1923 1876 843 --1887 --
NM_014953chr1373545 3463 1597 1313 1031 793 155 --23339 1610 --
NM_014961chr411599 --22233 416 --
NM_014962chr2032848 2684 2083 --12743 12532
NM_014964chr1752433 2270 1938 1841 1572 1643 11930 --
NM_014969chr111120 1244 --1753
NM_014974chr1021205 1192 ------
NM_014978chr1021808 1698 1460 ----
NM_014982chr1455386 1754 1595 556 87 ------
NM_014988chr442171 2057 617 556 1404 ----
NM_014989chr651613 1429 1336 611 120 --11327 --
NM_014990chr1431218 1097 537 ------
NM_014991chr411170 22048 37 --23113 873
NM_014994chr1572342 1829 1806 1479 715 483 81 --2350 53 --
NM_014996chr341034 987 772 230 145 1337 --
NM_014999chr121308 ----1146
NM_015000chr1282092 1972 754 421 391 330 272 46 1506 1403 --
NM_015008chr363656 3190 2805 643 329 161 23633 2438 13566 --
NM_015009chr3----1681 --
NM_015015chr1961922 1773 1500 1492 1476 286 1821 ----
NM_015017chr1----2825 298 --
NM_015020chr1653886 3057 2610 2583 1483 --1182 --
NM_015024chr821448 69 ------
NM_015025chr262216 2117 2069 1945 935 677 22023 171 ----
NM_015026chr1243580 1505 1301 441 ----192
NM_015027chr162662 26 ------
NM_015032chr1382694 2658 2616 2608 2528 2049 828 319 ------
NM_015033chr963226 2930 2356 877 157 121 1492 --22991 830
NM_015039chr122815 1405 41537 1391 517 147 23870 985 --
NM_015040chr293403 2954 2913 1314 1290 820 738 209 104 --12214 --
NM_015045chr1011812 --11978 --
NM_015051chr953423 2732 2405 2308 990 ----12470
NM_015053chr142247 2083 1592 341 --1534 --
NM_015057chr133696 654 521 ------
NM_015059chr1552965 2929 2875 1583 168 22909 747 ----
NM_015064chr1253637 3614 2902 1378 1275 1210 32511 2423 275 --
NM_015068chr783965 3426 3316 3120 2410 1567 564 94 --23658 1116 --
NM_015069chr161434 --1630 --
NM_015071chr556197 4471 1653 1495 198 24810 4449 13977 14559
NM_015074chr184861 4084 4076 4060 3999 1314 1291 634 ------
NM_015075chrX42116 2000 1741 870 11412 ----
NM_015076chr694514 4388 4364 4019 3354 1223 860 639 327 --24345 1669 --
NM_015079chr1583232 3083 2994 2856 2056 1023 955 542 1811 23156 636 --
NM_015082chr542482 2079 558 268 --155 --
NM_015090chr1106221 6172 5685 5193 2273 2247 1659 1525 1167 797 ----173
NM_015091chr142817 131 ------
NM_015092chr1683974 3519 1757 1734 1672 1391 1009 174 1308 ----
NM_015093chr631737 1537 639 ------
NM_015094chr22124584 4206 3829 3765 3486 3440 1464 1293 867 756 452 315 ------
NM_015097chr332344 1616 711 --1768 1411
NM_015100chr131853 1376 1282 ------
NM_015113chr1732003 192 87 --1296 --
NM_015115chr472696 2603 2245 2231 907 711 197 --22053 1065 --
NM_015124chr2272412 2250 1749 1663 986 920 770 11862 ----
NM_015132chr721836 1694 ------
NM_015137chr852249 2177 1968 458 348 ------
NM_015138chr1572835 2431 2294 1923 864 778 723 --12305 --
NM_015141chr331688 998 98 --22749 584 12337
NM_015143chr441410 1028 1019 526 ------
NM_015144chr1673827 1413 1399 921 532 496 264 ----11245
NM_015147chr273098 2732 2289 2142 2119 2057 947 ----1979
NM_015149chr151997 1969 822 70 62 ----1563
NM_015153chr61686 1125 ----
NM_015155chr1083125 3039 2424 2226 1059 649 613 100 13166 22496 2350 --
NM_015156chr14103535 3510 3258 2720 1406 822 667 529 388 210 23987 979 23551 687 --
NM_015158chr91674 ------
NM_015172chr121595 1077 ----11347
NM_015176chr1------1550
NM_015180chr141588 ------
NM_015191chr1152692 2627 2448 832 384 22077 1082 12111 12231
NM_015192chr2082717 2331 2293 2061 703 529 276 29 --1598 12153
NM_015193chr841221 1120 201 88 11286 1981 --
NM_015198chr7--1860 --126
NM_015199chr342752 526 433 264 --1907 --
NM_015200chr432485 2106 354 ------
NM_015206chr1563506 3499 2783 2411 683 69 23031 2664 --1586
NM_015208chr1894048 4025 3963 3746 813 773 749 570 238 ----12704
NM_015209chr122121 743 ------
NM_015213chr113321 119 48 ------
NM_015215chr1112942 2360 2287 2278 2152 889 626 371 195 164 144 1655 ----
NM_015216chr531139 510 367 ----1319
NM_015219chr1722054 1909 1702 1588 --
NM_015233chr1332464 388 342 2933 773 --1279
NM_015239chr92558 27 ----1445
NM_015245chr682748 2590 2520 2407 1729 1718 120 87 2171 29 ----
NM_015246chr1622036 1457 21401 375 ----
NM_015247chr1695191 4785 4553 4494 4413 3874 2036 1787 1757 35247 2152 2062 ----
NM_015250chr931792 434 134 --146 --
NM_015256chr5----1692 --
NM_015260chr1911558 ------
NM_015265chr252338 2085 2076 2043 453 --2869 576 --
NM_015267chr1231764 1673 244 ------
NM_015269chr11206 ------
NM_015271chr453551 2621 1661 1537 797 13335 1229 --
NM_015272chr1642008 1989 1857 639 11714 ----
NM_015275chr1221982 1479 ----21875 1457
NM_015277chr182273 103 180 --11487
NM_015278chr683209 3102 2127 1331 1033 944 502 394 12192 13055 --
NM_015282chr252591 2509 2345 2314 1970 1155 22458 200 11176
NM_015285chr1872349 2135 925 778 343 214 26 ------
NM_015294chr17156 1457 1747 --
NM_015296chr131475 1408 ----
NM_015299chr14103835 3701 3547 3374 2559 876 815 783 700 250 ----12518
NM_015310chr8168323 7563 6877 6723 6426 5718 5369 5355 1886 1773 1301 1157 1062 813 787 297 57112 6669 5911 5376 1368 47815 7066 6133 398 --
NM_015313chr1153275 1694 1628 715 185 1941 21345 27 11320
NM_015315chr552209 1365 439 368 343 ------
NM_015317chr22497 273 11926 12168 --
NM_015326chr132390 228 120 ------
NM_015327chr141101 144 79 22 1472 ----
NM_015328chr752192 2077 1170 1080 169 --11038 --
NM_015330chr2252515 2317 2049 658 245 12563 ----
NM_015335chr1222462 161 12285 11690 --
NM_015336chr123932 740 417 ------
NM_015338chr2021193 741 21202 710 ----
NM_015339chr205895 822 131 65 34 ------
NM_015344chr842029 1902 547 524 ------
NM_015346chr1441820 1691 1521 1311 ------
NM_015347chr1262058 906 848 587 339 332 ------
NM_015349chr643087 2194 446 317 11946 22973 641 12138
NM_015353chr1772199 796 789 781 503 171 97 1204 ----
NM_015354chr92364 48 ------
NM_015355chr172504 491 --11497 --
NM_015358chr2121178 123 ------
NM_015359chr842932 2854 914 125 21134 949 ----
NM_015361chr23868 838 377 ------
NM_015365chrX93802 3501 3199 3173 2865 2807 2670 230 92 21589 39 ----
NM_015375chr1114359 4335 3880 3866 3859 3079 1977 934 911 507 319 13405 1352 --
NM_015378chr162334 2298 2193 2076 417 382 ------
NM_015379chr71224 ------
NM_015382chr142809 628 ------
NM_015385chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_015386chr16138 ------
NM_015387chr231934 428 52 ------
NM_015388chr64340 207 121 104 145 ----
NM_015393chr433825 1249 220 --23275 288 12904
NM_015396chr31297 11135 1108 --
NM_015397chr941319 1222 711 479 11764 ----
NM_015419chrX61119 1097 988 927 414 270 ------
NM_015429chr331038 1029 36 ------
NM_015435chr841460 1319 431 33 ------
NM_015441chr12339 127 ------
NM_015444chr32428 90 ------
NM_015447chr91246 --1810 --
NM_015455chr533801 593 341 23317 796 21588 1179 --
NM_015458chr8115153 4938 4598 4521 4147 4124 4062 2010 1627 904 150 14806 ----
NM_015460chr34507 310 134 83 --2559 188 --
NM_015463chr21800 ------
NM_015464chr71245 ------
NM_015470chr22874 82 --1316 --
NM_015472chr33534 450 86 ------
NM_015472chr33534 450 86 ------
NM_015481chr122900 838 ------
NM_015483chr731130 1112 442 ----1871
NM_015488chr221719 1656 --1374 --
NM_015493chr1931394 867 375 ----11881
NM_015497chr152951 883 --1800 --
NM_015507chrX2186 59 ------
NM_015509chr12--11437 ----
NM_015520chr352769 2708 2556 2160 2090 1988 ----
NM_015525chr61867 --1135 --
NM_015530chr21104 ------
NM_015535chr293941 3729 3537 3134 2749 1226 952 494 224 ------
NM_015548chr65767 621 280 246 94 2734 119 ----
NM_015550chr732573 2411 1182 ------
NM_015553chr665175 4940 4587 4109 3511 1938 1496 ----
NM_015554chr1572937 2804 2261 1998 1133 674 162 12862 ----
NM_015555chr621421 360 ------
NM_015556chr14159 1153 ----
NM_015557chr163604 2847 2620 1114 400 28 22542 1176 ----
NM_015564chr513043 22815 2683 ----
NM_015565chr2142017 1972 1410 329 ------
NM_015567chr1311186 ------
NM_015568chr2084085 3928 3355 2675 1606 1447 1337 198 23978 2706 ----
NM_015569chr152943 1806 1123 995 71 --13013 --
NM_015570chr721408 1164 --11683 --
NM_015571chr642174 1973 985 273 ------
NM_015576chr3180 --1104 --
NM_015577chr531781 688 355 11661 ----
NM_015578chr1941836 1721 1409 353 32061 727 366 11415 --
NM_015601chr102818 643 1114 ----
NM_015605chr1011535 --1297 --
NM_015609chr192883 2874 2610 2358 2225 1120 950 792 695 ------
NM_015626chr1731100 1013 131 11178 ----
NM_015630chr261011 873 860 820 795 466 --11164 --
NM_015635chr931869 1579 108 1555 --1899
NM_015640chr145189 4618 4209 4186 --14042 --
NM_015641chr731054 104 61 ------
NM_015651chr942157 1579 1514 113 ------
NM_015652chr101431 1173 ----
NM_015678chr1331673 1231 52 ------
NM_015686chrX5874 810 572 364 199 ------
NM_015691chrX52458 2391 841 580 335 1619 12082 --
NM_015695chr611325 ------
NM_015711chr193862 773 751 ------
NM_015840chr142645 2227 655 290 21871 612 1575 --
NM_015841chr142645 2227 655 290 21871 612 1575 --
NM_015844chr185745 363 300 288 39 1192 124 --
NM_015845chr184523 141 78 66 ------
NM_015846chr185745 363 300 288 39 1192 124 --
NM_015847chr185745 363 300 288 39 1192 124 --
NM_015850chr862454 2094 2039 1754 1523 1500 11580 ----
NM_015866chr131478 245 48 ------
NM_015878chr872158 2116 1903 842 542 500 36 --1479 --
NM_015879chr18128001 7469 7134 6954 6740 6614 2649 2302 2215 1945 1604 334 12925 18508 --
NM_015881chr1121367 1169 21025 488 1226 --
NM_015885chr111281 3554 214 180 ----
NM_015886chr865562 5130 3627 1713 1576 884 11414 14328 --
NM_015894chr2061541 1349 1274 625 541 192 --11148 --
NM_015902chr82811 734 ------
NM_015905chr72613 479 ------
NM_015906chr134648 4261 3290 ------
NM_015912chr842175 1570 906 785 ------
NM_015938chr3----1279 --
NM_015955chr21421 1331 ----
NM_015975chrX41830 1817 1209 114 ------
NM_015976chr11280 ------
NM_015980chr531252 506 87 1458 ----
NM_015981chr522282 322 --12413 --
NM_015986chr1731084 926 294 11072 ----
NM_015994chr14--3632 238 157 ----
NM_015995chr15105323 4536 3870 3701 3553 3485 3476 1053 759 197 21446 584 ----
NM_016009chr184860 4179 3598 3590 1616 1259 785 441 11171 ----
NM_016010chr81184 ------
NM_016018chr81212 2697 329 1662 --
NM_016019chr72833 351 11052 ----
NM_016025chr1621379 661 --2669 294 --
NM_016037chr131197 854 289 1395 1831 1825
NM_016040chr142004 1947 325 254 21825 215 ----
NM_016060chr171942 11115 ----
NM_016061chr231512 1139 271 11047 --1107
NM_016072chr1242049 1919 426 397 11767 ----
NM_016073chr1511035 ------
NM_016075chr1362904 2306 1278 1154 986 397 1324 1428 --
NM_016081chr432246 1707 404 ------
NM_016083chr663732 3537 3265 3117 2412 1177 13010 ----
NM_016090chr112325 86 ------
NM_016096chr841838 1354 406 72 1660 21970 619 11608
NM_016097chr182800 446 ------
NM_016103chr51446 ------
NM_016107chr51332 ----1500
NM_016121chr12453 349 --1871 --
NM_016125chr171576 ------
NM_016131chr231507 255 56 ------
NM_016132chr1562963 2942 2579 771 443 158 --13163 --
NM_016133chr23234 170 85 ------
NM_016141chr31784 ------
NM_016152chr33441 368 276 ------
NM_016169chr10123297 3190 3083 2993 2724 2701 2486 2259 1034 711 269 119 ----22714 1230
NM_016170chr21546 ------
NM_016185chr17276 57 ------
NM_016201chr331959 1481 684 ------
NM_016206chr3108373 7912 7319 6054 3466 2733 2725 2710 2703 30 28498 3612 ----
NM_016217chr653557 2377 2261 1455 485 ------
NM_016224chr642205 2185 1667 134 ------
NM_016226chr121109 ------
NM_016227chr141521 1100 460 63 ------
NM_016235chr1621140 271 11363 ----
NM_016242chr42573 129 193 ----
NM_016250chr141633 --1756 1815
NM_016252chr2--1863 ----
NM_016255chr653244 2367 2091 868 767 --1589 --
NM_016257chr133179 3041 3023 23302 704 ----
NM_016258chr12710 127 --124 1120
NM_016260chr2137240 6868 6789 5430 5278 5087 5006 2263 1570 600 458 61 44 17459 --27308 4925
NM_016269chr43928 400 218 ------
NM_016271chr18--1436 ----
NM_016272chr2241746 1072 967 420 11054 --11037
NM_016275chr342777 1120 224 48 ------
NM_016277chr631441 476 144 ------
NM_016281chr1221019 463 1723 ----
NM_016284chr16148 --1982 --
NM_016287chr141932 790 659 527 1346 ----
NM_016297chr2103500 2653 2630 2357 2334 1316 1298 314 293 183 --11238 --
NM_016299chr10199 ------
NM_016300chr31464 ------
NM_016312chr121161 ------
NM_016322chr952366 1092 1058 1042 347 --22185 827 --
NM_016334chr11421 ------
NM_016339chr1741769 1600 1473 314 1350 --11820
NM_016340chr551097 1081 1024 842 73 1185 ----
NM_016351chr73504 390 79 ------
NM_016357chr1241165 1147 785 301 ------
NM_016374chr151473 622 517 343 66 1284 ----
NM_016374chr151473 622 517 343 66 1284 ----
NM_016396chr1541879 1060 310 266 --1722 --
NM_016410chr91525 ------
NM_016418chr2263747 3577 3131 2821 2462 1411 2249 22 22638 911 --
NM_016422chr1162637 1184 1161 635 599 326 12181 ----
NM_016423chr141350 1380 --1422
NM_016424chr1711836 --1613 --
NM_016436chr2082604 2414 2391 1717 1660 837 171 48 ------
NM_016441chr231638 438 426 1267 1591 --
NM_016442chr542219 1668 564 214 ------
NM_016447chr7150 ------
NM_016448chr121832 1411 ------
NM_016453chr33665 432 27 ------
NM_016454chr151321 ------
NM_016467chr231135 962 73 ------
NM_016470chr202400 378 ------
NM_016472chr1421128 1115 11260 ----
NM_016475chr1451287 1249 1127 1092 353 ------
NM_016480chr53754 699 625 ------
NM_016485chr621806 709 1794 ----
NM_016505chr13604 581 237 ------
NM_016513chr663453 2931 2760 2647 2314 400 1707 13390 --
NM_016516chr22574 309 ------
NM_016520chr91310 ------
NM_016522chr1141106 444 288 281 1210 ----
NM_016530chr1573941 3838 3722 2815 2600 2575 689 33999 3148 266 23850 24 --
NM_016531chr474119 3707 3644 3086 3047 859 598 13569 --14019
NM_016542chrX21665 1077 11555 ----
NM_016556chr171622 --2219 33 --
NM_016559chr32333 297 --1532 --
NM_016562chrX31067 1057 340 ------
NM_016569chr1241303 1019 615 110 ------
NM_016575chr12125315 4849 4750 4733 3961 3452 1734 1667 1622 1326 614 25 1729 1398 --
NM_016577chr374280 4079 3561 3234 3084 2877 2779 21778 1054 1821 --
NM_016586chr141142 ------
NM_016587chr721080 209 ------
NM_016603chr512154 ------
NM_016604chr511178 --11168 --
NM_016605chr522008 407 11955 11087 --
NM_016620chr11332 ------
NM_016621chr1174386 3712 3342 2989 2859 1827 308 ------
NM_016623chr82247 79 128 ----
NM_016626chr1831482 505 498 1227 ----
NM_016628chr10277 42 --1709 --
NM_016630chr152411 398 ------
NM_016631chr212700 84 1759 ----
NM_016653chr241145 1078 500 406 ------
NM_016654chr1541329 1301 420 62 ------
NM_016733chr2221461 21 ------
NM_016824chr1021792 44 ------
NM_016834chr1783861 3342 3269 2976 1274 878 741 668 23231 982 11138 --
NM_016835chr1783861 3342 3269 2976 1274 878 741 668 23231 982 11138 --
NM_016836chr22630 496 ------
NM_016839chr22630 496 ------
NM_016841chr1783861 3342 3269 2976 1274 878 741 668 23231 982 11138 --
NM_016929chr653908 3697 3557 3018 614 132 21145 726 --
NM_016938chr113411 337 29 --1128 --
NM_016950chr41440 --21196 140 --
NM_016952chr1183412 3140 3051 1475 1262 1145 512 48 --1765 13652
NM_016953chr2115365 5229 4969 4738 3957 2298 2236 1623 1052 770 24 --14399 15019
NM_017412chr831250 983 158 --1499 11360
NM_017413chrX52202 1861 508 180 117 ----1916
NM_017415chr5124457 4407 4152 4043 3647 3125 2794 1761 1708 1680 1569 624 1598 ----
NM_017420chr1473764 3672 3561 3173 2819 2724 180 1371 1189 --
NM_017423chr452124 1730 819 180 79 12136 12017 --
NM_017426chr4149 ------
NM_017447chr2134387 4348 537 ------
NM_017450chr1721149 300 --11482 --
NM_017451chr1771045 792 776 733 366 230 29 ------
NM_017452chr2021192 533 11083 ----
NM_017453chr2021192 533 11083 ----
NM_017454chr2021192 533 11083 ----
NM_017455chr151878 --1659 --
NM_017456chr1731449 545 28 21527 792 12015 --
NM_017482chr281596 1553 1293 1283 1094 628 157 52 ------
NM_017491chr42829 152 1403 156 --
NM_017510chr52522 501 1622 ----
NM_017519chr62469 324 ------
NM_017520chr132207 117 ------
NM_017522chr11178 ------
NM_017544chrX--2723 79 ----
NM_017548chr362103 2016 565 349 273 135 11556 142 --
NM_017551chr1042680 648 535 227 ------
NM_017553chr155842 535 253 237 201 ------
NM_017575chr1721606 1354 ------
NM_017577chr31496 11323 ----
NM_017580chr1041742 1566 1551 580 11597 21888 1876 --
NM_017589chr11125 ------
NM_017590chr2252502 1800 1709 506 191 1707 1659 11682
NM_017594chr933300 2665 111 13199 12232 --
NM_017599chr1231833 394 385 --1407 --
NM_017610chr1561963 1390 709 302 260 235 1830 21695 57 --
NM_017626chr104657 555 150 89 ------
NM_017629chr141240 504 379 149 31960 642 586 ----
NM_017632chr4121 1118 ----
NM_017633chr663778 3769 3677 3121 1424 1188 23689 2390 ----
NM_017634chr831803 1246 99 11718 --21780 1737
NM_017635chr1121159 336 ------
NM_017637chr9139220 9150 8025 7476 6578 6335 2946 2710 2342 2123 1782 1396 1138 18493 15787 11810
NM_017641chr121468 ------
NM_017643chr1723043 2853 1472 1559 --
NM_017644chr364771 4464 3740 3642 1515 391 ------
NM_017649chr1011047 1383 ----
NM_017650chr7105696 5155 5107 4831 2244 2109 568 472 405 149 --24046 4022 --
NM_017651chr631048 310 262 ------
NM_017657chr21376 ------
NM_017658chr1453874 3695 1388 90 47 24423 4165 21519 936 --
NM_017661chr152810 248 ------
NM_017666chrX21595 1376 ------
NM_017667chr71437 ------
NM_017672chr15----11022 --
NM_017679chr171695 ----1237
NM_017680chr91340 --1215 --
NM_017686chr13356 193 142 ------
NM_017694chr261763 1598 1470 819 675 109 --11741 --
NM_017714chr205812 700 360 148 111 ------
NM_017719chr342001 1839 825 699 --1837 --
NM_017736chr1652121 1160 405 277 108 --13011 --
NM_017737chr131687 705 622 ------
NM_017742chr1841837 1731 1327 1298 ------
NM_017744chr152460 2277 2120 1619 1500 --1685 1203
NM_017748chr171792 ------
NM_017752chrX31992 778 48 ------
NM_017757chr1821121 874 --11048 --
NM_017758chr1731447 1429 551 21346 1068 ----
NM_017762chr1532355 2093 728 2849 630 ----
NM_017766chr12511 394 ----192
NM_017769chr1472934 2395 2252 2234 1245 742 577 ------
NM_017770chr612567 12952 ----
NM_017778chr861426 1321 1245 1064 358 332 ------
NM_017780chr8----1927 --
NM_017787chr1042204 1950 1106 1025 12549 22504 1888 --
NM_017799chr1451571 1401 1253 277 86 1630 ----
NM_017819chr3--1198 1165 1228
NM_017824chr1042161 1956 950 24 --12204 --
NM_017831chr1861736 1601 1488 928 870 39 --13759 --
NM_017847chr14900 601 577 237 ------
NM_017848chrX24304 3138 --13818 --
NM_017849chr283051 2961 2760 2350 1284 871 437 49 12850 11048 --
NM_017856chrX51403 858 514 458 180 21420 576 11925 --
NM_017866chr81844 ------
NM_017893chr104980 515 372 137 1260 ----
NM_017902chr10105070 4570 4467 4246 1461 1434 486 475 101 94 --33597 1875 1122 --
NM_017905chr132237 201 ------
NM_017919chr953883 2245 2061 1285 512 13779 13703 --
NM_017921chr1762344 850 689 552 544 204 11550 1869 1861
NM_017925chr941414 1307 652 154 --1573 --
NM_017926chr142857 311 2597 586 ----
NM_017933chr221030 331 --11370 --
NM_017938chrX22122 2034 ------
NM_017944chr112666 212 1588 43014 2911 2122 776 11160
NM_017946chr731433 1410 1348 ------
NM_017953chr121224 1213 --2396 46 1986
NM_017954chr721226 415 ------
NM_017958chr242818 990 967 63 ------
NM_017972chr142857 311 2597 586 ----
NM_017988chr123865 850 365 ------
NM_017994chr762927 2878 2754 2253 536 439 ------
NM_018003chr1541776 1753 1691 602 ------
NM_018011chr131423 ------
NM_018014chr21161 21266 138 ----
NM_018027chr1023174 2127 23213 430 --13136
NM_018030chr182932 130 ------
NM_018043chr1141404 1143 934 221 1290 ----
NM_018045chr182790 2766 2549 2430 1183 1009 727 66 ------
NM_018046chr541443 1437 604 143 11737 1720 --
NM_018054chr16--2485 78 ----
NM_018061chr14523 169 116 110 ------
NM_018064chr6------1335
NM_018067chr12550 440 ------
NM_018068chr83533 510 448 2128 68 ----
NM_018070chr11572 --140 --
NM_018084chr232742 551 469 ------
NM_018085chr1167742 7428 7261 7210 6700 6603 6320 5923 5658 5001 2052 1835 1812 1391 610 56 28009 2205 16990 15417
NM_018086chr261740 1470 1385 589 531 100 ------
NM_018092chr1631341 1176 1085 ------
NM_018103chr1151 ------
NM_018105chr82832 150 ------
NM_018113chr121146 ------
NM_018119chr161232 ------
NM_018121chr1022439 2293 ------
NM_018124chr1652182 2159 2096 1578 94 ----1502
NM_018126chr42638 198 ----1973
NM_018128chr1721356 495 ------
NM_018131chr104905 665 210 43 ------
NM_018133chr311882 1166 ----
NM_018137chr121423 503 ------
NM_018139chr141137 ------
NM_018151chr22768 753 ------
NM_018155chr331369 341 24 --1713 --
NM_018156chr162334 2298 2193 2076 417 382 ------
NM_018159chrX21339 564 ------
NM_018164chr12135 ------
NM_018169chr121353 ------
NM_018172chr11101534 1115 964 622 570 518 466 414 362 156 ------
NM_018176chr441552 1116 186 169 ------
NM_018177chr431126 1097 61 --1823 --
NM_018181chr1841439 623 560 73 11581 21557 1371 --
NM_018182chr1721664 585 --12194 --
NM_018184chr341789 1522 1408 311 1576 ----
NM_018198chr161467 1458 1050 918 399 328 --1219 --
NM_018200chr1522362 1042 22352 343 ----
NM_018201chr931737 485 81 12285 ----
NM_018202chr14967 944 111 50 ----1788
NM_018214chr62983 255 ------
NM_018227chr432736 1136 147 ----11081
NM_018237chr101228 ------
NM_018243chr473899 2815 2807 2792 2730 629 45 --13790 13210
NM_018244chr20--2920 84 ----
NM_018247chr65934 829 694 629 221 ------
NM_018254chr14626 541 309 23 ------
NM_018257chr2021827 218 ------
NM_018261chr41392 ------
NM_018270chr203925 614 331 ----1702
NM_018287chr103990 323 203 ------
NM_018293chr352973 2927 2787 2756 839 ------
NM_018298chr12878 730 ------
NM_018299chr84824 593 577 133 ------
NM_018307chr171835 --1162 --
NM_018312chr1131450 188 98 ----137
NM_018313chr362378 2351 1777 679 119 109 1780 22273 1691 --
NM_018315chr421403 410 ------
NM_018317chr41330 ------
NM_018323chr421577 286 ------
NM_018325chr91417 1593 21459 117 --
NM_018327chr2021326 607 21298 400 --1175
NM_018330chr1041673 1621 459 316 1295 21413 669 --
NM_018334chr71389 1445 160 --
NM_018335chr141148 ------
NM_018340chr1694645 4256 4048 3368 3169 1772 1749 184 69 23574 1987 13834 13667
NM_018362chr1152811 2607 1552 518 74 11079 12745 13034
NM_018364chr132506 1412 456 --11579 --
NM_018370chr1251891 1779 1718 442 110 --32211 1902 203 --
NM_018371chr831589 1317 65 ------
NM_018373chr14146318 6277 6226 6093 5887 5491 5303 4721 4099 2055 1930 1640 1526 1503 14576 ----
NM_018374chr754719 1904 1759 731 149 ------
NM_018383chr211838 ----11496
NM_018387chr91466 ------
NM_018388chrX1110 --1509 --
NM_018400chr11114474 4281 4052 3875 3866 3673 3167 3130 1286 1073 403 ------
NM_018403chr363991 3468 3365 2991 2968 630 13481 ----
NM_018413chr121221 1208 ----
NM_018416chr1222573 146 ----12400
NM_018419chr202330 28 ------
NM_018433chr23492 439 107 ------
NM_018439chr1832599 2323 566 1990 12027 12316
NM_018440chr8137417 6490 6383 6298 2746 2273 1950 1517 1381 620 331 249 189 ----11966
NM_018444chr841949 812 430 156 11555 ----
NM_018445chr151222 ------
NM_018448chr1211178 11096 11242 --
NM_018452chr6_random53167 1399 1043 971 377 ------
NM_018464chr102117 21 1352 1125 --
NM_018469chr1741448 1260 1112 204 --177 --
NM_018471chr22456 437 ----1235
NM_018475chr4197 ------
NM_018482chr862557 2455 2074 2025 1007 472 ------
NM_018489chr152332 2198 2166 1652 780 --11750 11641
NM_018490chr1111374 --21356 460 --
NM_018509chr1721402 1296 2583 121 ----
NM_018534chr23579 240 45 ------
NM_018553chr1751526 1514 1498 1257 566 1196 ----
NM_018557chr21210 ------
NM_018569chr421316 1004 ------
NM_018584chr13908 841 298 ------
NM_018593chr63753 696 77 ------
NM_018640chr1232453 410 149 ------
NM_018641chr71129 ------
NM_018645chr24439 210 140 24 ------
NM_018650chr141542 1451 191 153 --1770 --
NM_018667chr1662139 1088 573 558 433 38 ------
NM_018671chr15----1238 --
NM_018682chr73542 533 48 ------
NM_018685chr72331 82 ------
NM_018695chr551782 1744 1532 691 172 ----1802
NM_018696chr181130 --2903 775 --
NM_018698chrX71943 1805 1577 1503 1204 515 290 ------
NM_018710chr841352 1128 460 158 ------
NM_018711chr1231598 1152 1101 2362 39 1469 --
NM_018713chr13873 262 104 1317 ----
NM_018715chr122143 1863 1536 ----
NM_018717chr442744 2386 2351 654 --22658 123 12235
NM_018718chr722023 272 2509 94 1562 --
NM_018723chr16166 ------
NM_018837chr203840 238 50 ------
NM_018841chr163918 3651 3444 2547 1176 718 11065 ----
NM_018844chr731672 485 180 --11959 --
NM_018847chr9124 ------
NM_018890chr751283 1142 544 410 337 11435 ----
NM_018898chr532100 2093 354 21831 127 ----
NM_018899chr532100 2093 354 21831 127 ----
NM_018900chr532100 2093 354 21831 127 ----
NM_018901chr532100 2093 354 21831 127 ----
NM_018902chr532100 2093 354 21831 127 ----
NM_018903chr532100 2093 354 21831 127 ----
NM_018904chr532100 2093 354 21831 127 ----
NM_018905chr532100 2093 354 21831 127 ----
NM_018906chr532100 2093 354 21831 127 ----
NM_018907chr532100 2093 354 21831 127 ----
NM_018908chr532100 2093 354 21831 127 ----
NM_018909chr532100 2093 354 21831 127 ----
NM_018910chr532100 2093 354 21831 127 ----
NM_018911chr532100 2093 354 21831 127 ----
NM_018912chr51703 ----1266
NM_018913chr51703 ----1266
NM_018914chr51703 ----1266
NM_018915chr51703 ----1266
NM_018916chr51703 ----1266
NM_018917chr51703 ----1266
NM_018918chr51703 ----1266
NM_018919chr51703 ----1266
NM_018920chr51703 ----1266
NM_018921chr51703 ----1266
NM_018922chr51703 ----1266
NM_018923chr51703 ----1266
NM_018924chr51703 ----1266
NM_018925chr51703 ----1266
NM_018926chr51703 ----1266
NM_018927chr51703 ----1266
NM_018928chr51703 ----1266
NM_018929chr51703 ----1266
NM_018940chr52965 923 ----1363
NM_018945chr633546 3418 3016 1954 ----
NM_018948chr151247 956 531 320 96 ------
NM_018951chr7--11070 ----
NM_018963chr211214 ----1206
NM_018970chr762504 2299 2195 672 485 133 13095 22709 2460 --
NM_018976chr1232808 2477 2305 ------
NM_018977chrX2750 382 1742 ----
NM_018979chr1241675 859 147 101 1644 1602 --
NM_018993chr2061485 1260 1223 958 507 222 ------
NM_018999chr10114874 4827 4619 4397 4258 3392 3374 1978 798 343 175 13228 ----
NM_019000chr54675 612 140 95 ------
NM_019001chr394226 4166 3991 3743 3499 3321 3271 1572 837 12982 --23640 3572
NM_019004chr752025 1880 1705 784 762 ------
NM_019006chr151173 ------
NM_019022chr181129 22539 989 12483 --
NM_019035chr421869 144 ------
NM_019036chr621021 194 ------
NM_019042chr711118 ------
NM_019046chr103771 748 686 ------
NM_019050chr41595 ------
NM_019058chr10----1216 1655
NM_019071chr72775 612 ------
NM_019072chr573802 3600 3402 1567 1400 1187 713 12648 --13123
NM_019084chr1072540 2505 2230 1009 979 751 536 ------
NM_019087chr531642 1187 1108 1160 ----
NM_019091chr22870 757 ------
NM_019106chr2252471 2437 2265 2145 990 1586 13076 --
NM_019114chr932515 1614 844 ------
NM_019116chr1672780 2660 1379 1358 426 211 67 1983 ----
NM_019117chrX43432 2653 2330 708 12461 ----
NM_019555chr31159 11615 ----
NM_019556chrX1122 11231 11175 1171
NM_019557chr11332 ------
NM_019558chr21327 ------
NM_019590chr1031334 1155 932 ------
NM_019592chr93876 305 94 ------
NM_019593chr2052321 1147 709 662 462 ------
NM_019596chr2182581 1846 1018 712 665 642 213 101 ----12129
NM_019597chrX1234 ------
NM_019613chr1731138 399 369 1539 ----
NM_019842chr64314 148 94 54 ------
NM_019854chr12184 ------
NM_019859chr101569 21176 78 1442 --
NM_019860chr101617 21224 126 1490 123
NM_019862chr1631750 503 419 --134 --
NM_019891chr121264 1101 ----1850
NM_019895chr31350 --11086 --
NM_019898chr1631750 503 419 --134 --
NM_019899chr1631750 503 419 --134 --
NM_019900chr1631750 503 419 --134 --
NM_019903chr1021792 44 ------
NM_020039chr1241804 1774 1254 631 11341 ----
NM_020063chr12103 24 ------
NM_020066chr13948 166 34 ------
NM_020116chr441207 685 675 48 11810 1305 11247
NM_020117chr52989 966 ------
NM_020122chr2165942 5251 4938 4915 4670 4340 4275 3736 3710 2370 2168 2075 727 575 386 371 35138 4072 690 --12124
NM_020123chr1011074 ------
NM_020135chr63399 321 72 ------
NM_020141chr142333 1662 905 570 ------
NM_020144chr721656 730 11731 ----
NM_020148chr1822602 1209 22101 877 12865 --
NM_020156chr72460 43 ------
NM_020168chr1521281 293 ----1364
NM_020177chr593309 3120 2630 2235 1261 1016 677 655 504 --12638 --
NM_020178chr172927 878 ------
NM_020180chr1831249 1148 185 ----1537
NM_020184chr241716 1509 597 34 ------
NM_020190chr11453 ------
NM_020193chr1161305 1254 911 302 229 147 ------
NM_020198chr1741297 620 528 455 ------
NM_020205chr113443 2985 218 13408 --
NM_020225chr41286 ------
NM_020228chr1121616 888 ----12222
NM_020231chr33646 631 139 ------
NM_020235chr31101 --1313 --
NM_020240chr532026 645 245 ----1940
NM_020245chr674646 4585 3332 3114 1260 999 662 25126 692 ----
NM_020310chr1762711 2692 1007 800 612 183 1495 12597 12614
NM_020317chr13297 49 39 ------
NM_020336chr2063702 2892 2571 1158 632 79 12966 1925 --
NM_020337chr492688 2143 2109 1218 1002 716 438 144 122 --1269 11979
NM_020341chr2022042 1481 --22000 1343 11883
NM_020342chr252351 624 532 493 70 ------
NM_020346chr1181718 1565 1300 1213 581 537 390 57 ------
NM_020357chr33544 350 283 ------
NM_020373chr123437 241 97 ------
NM_020381chr64818 606 384 233 --11877 --
NM_020382chr121529 --1152 --
NM_020390chr354394 4142 3016 1522 993 14711 --148
NM_020403chr132439 257 ------
NM_020405chr17134003 3926 3631 3546 3024 1537 1433 1302 1202 1179 923 797 567 13609 11783 --
NM_020416chr442089 789 394 325 2589 119 ----
NM_020432chr72622 399 ------
NM_020440chr172982 2590 2341 2268 2242 1043 803 33240 2972 1313 21213 244 --
NM_020449chrX3663 275 186 ------
NM_020452chr151805 1382 665 441 172 ------
NM_020455chr652696 950 234 196 62 1164 ----
NM_020456chr1342068 1705 1488 1465 12155 ----
NM_020457chr16--1252 ----
NM_020463chr241498 1448 1125 45 ------
NM_020465chr1631532 564 147 ----11522
NM_020466chr6144802 4778 4718 4548 4145 3981 3910 3720 3173 1091 1056 541 518 456 21706 971 ----
NM_020474chr1841902 325 203 112 --11549 --
NM_020475chr882306 2234 2146 1927 1653 977 900 818 ----1144
NM_020476chr882306 2234 2146 1927 1653 977 900 818 ----1144
NM_020477chr882306 2234 2146 1927 1653 977 900 818 ----1144
NM_020478chr872369 2297 2209 1990 1716 963 881 ----1207
NM_020480chr882306 2234 2146 1927 1653 977 900 818 ----1144
NM_020482chr61232 ----1540
NM_020532chr23932 748 97 2330 300 1762 --
NM_020630chr102532 145 ------
NM_020640chr3160 ------
NM_020647chr862316 2154 1644 693 377 61 ----11488
NM_020651chr211175 --21418 1156 --
NM_020654chr32441 101 ------
NM_020655chr1631437 1322 557 --11096 --
NM_020673chr20127508 7458 7421 6723 6542 6038 5113 4885 2865 2824 2237 2139 15383 1162 --
NM_020692chr142370 33 ------
NM_020693chr111438 1486 ----
NM_020696chr31300 ------
NM_020699chr144043 2045 1740 1233 11244 1514 1508
NM_020703chr11460 ------
NM_020704chr752293 2270 1829 947 570 ----1791
NM_020706chr211124 ------
NM_020708chr2021533 278 1876 32137 869 623 --
NM_020711chr222273 935 21876 461 --1135
NM_020715chr1441823 1569 1495 860 ------
NM_020717chrX84925 4615 4317 1925 502 396 276 212 1973 24902 1645 --
NM_020718chr16116280 6265 6248 5997 4521 2419 2239 1964 1860 1260 165 25072 4168 1863 --
NM_020728chr793096 2924 2853 2830 2768 2056 1282 984 826 ------
NM_020732chr62469 324 ------
NM_020734chr1222061 663 --13393 --
NM_020739chr1553649 3468 3309 1581 1066 --13515 --
NM_020742chrX22664 1755 --11040 --
NM_020748chr172504 36 --11325 --
NM_020749chr821559 53 1758 12055 --
NM_020750chr611407 ------
NM_020752chr1052907 2528 2251 637 618 ------
NM_020760chr211457 --11865 --
NM_020764chr161891 1113 ----
NM_020766chrX83742 3212 3024 1517 1392 1120 893 600 ----21430 857
NM_020772chr1768138 7766 6688 5778 1890 34 1802 43041 1596 1300 908 11111
NM_020773chr461954 664 634 584 247 238 31688 700 220 ----
NM_020774chr1836190 2013 294 31829 1235 935 15707 --
NM_020777chr462146 1977 1956 924 391 363 2374 92 1550 --
NM_020779chr242211 2190 1023 27 11094 ----
NM_020783chr1822210 77 --11733 --
NM_020787chr1741364 1320 975 619 ------
NM_020791chr1731318 1276 341 ----11266
NM_020794chr11599 ------
NM_020795chr17--11863 ----
NM_020796chr552079 1906 913 607 111 ------
NM_020801chr52661 44 --1671 --
NM_020804chr672469 2404 2378 2098 1918 1861 172 1831 ----
NM_020805chr181439 ------
NM_020806chr14152 2543 307 ----
NM_020809chr1111831 32317 2218 294 ----
NM_020810chr1452904 2889 1217 661 434 --1787 --
NM_020815chr4129 ------
NM_020818chr141102 ------
NM_020834chr1431664 731 703 ------
NM_020839chr331181 591 401 ----11412
NM_020841chr1213876 14008 --13239
NM_020843chr15------2158 120
NM_020850chr1653152 2341 2010 1234 642 ----1723
NM_020854chr181526 ------
NM_020856chr1951173 1131 528 282 149 11425 21335 28 1113
NM_020858chr1531669 643 512 21812 1577 1173 --
NM_020860chr43905 734 455 --1740 --
NM_020861chr6----2909 77 --
NM_020866chr132827 116 ------
NM_020868chr261495 1350 1312 428 410 66 ------
NM_020871chrX12347 --21993 760 22009 565
NM_020873chr31870 ------
NM_020886chr114887 507 166 135 ----11089
NM_020899chr1732536 2316 1878 ------
NM_020909chr2134140 4050 3695 3405 3361 2532 1600 1088 844 605 436 187 112 33632 3259 1638 ----
NM_020918chr1053635 3573 3429 1005 987 23100 197 12462 --
NM_020919chr251053 881 416 178 71 ------
NM_020922chrX51306 661 548 389 203 2191 174 ----
NM_020925chr111463 ------
NM_020927chr162121 94 1921 ----
NM_020935chr273800 1615 1592 1093 1065 887 34 --23492 1621 --
NM_020940chr1072916 2716 2174 1108 485 296 224 ------
NM_020947chr1652375 1928 1486 96 65 ------
NM_020948chr142910 2696 2447 2360 23462 162 11001 --
NM_020958chr142266 138 ------
NM_020960chr9104839 4761 4523 4318 4036 3932 1646 1396 1205 993 14749 13529 13751
NM_020962chr1532046 1815 510 193 ----
NM_020964chr1894172 3849 3445 3165 3074 1893 1458 1253 85 ----24046 92
NM_020971chr191861 1324 ----
NM_020972chr46913 191 172 110 83 67 --1926 --
NM_020973chr41247 ------
NM_020977chr442214 1995 1471 709 2795 496 ----
NM_020987chr1031174 889 505 ------
NM_020988chr161473 3942 181 171 ----
NM_020993chr1252571 2341 1969 903 607 ------
NM_021003chr14----1641 --
NM_021005chr1511093 ------
NM_021007chr241978 1742 1554 567 ------
NM_021032chr32501 286 11655 ----
NM_021033chr1322146 1052 2919 85 33305 1068 116 176
NM_021035chr2051170 915 848 346 323 ------
NM_021038chr3103315 3030 2821 2405 2296 2220 962 678 188 144 1396 23348 2993 --
NM_021061chr864291 1786 1511 680 413 40 11057 1710 --
NM_021064chr641229 1110 649 529 ------
NM_021069chr431871 522 516 123 ----
NM_021072chr532570 2029 1646 11761 ----
NM_021081chr20131 ------
NM_021082chr3------1394
NM_021083chrX33600 1402 161 --1569 12658
NM_021090chr2274659 4200 3914 3865 3328 1836 294 13381 23935 3509 --
NM_021097chr242725 2307 243 223 12415 ----
NM_021109chrX2309 29 ------
NM_021109chrX2309 29 ------
NM_021116chr7179042 8550 8296 8264 6486 6478 6463 6401 6046 3427 2748 2180 1825 1721 1083 765 635 58798 8408 7637 6019 1924 28916 1098 11386
NM_021120chrX73166 2640 2414 1031 725 446 366 12546 13120 --
NM_021132chr1021116 87 --11220 --
NM_021133chr13624 285 250 145 ----
NM_021136chr142678 77 ------
NM_021140chrX21160 1053 ------
NM_021144chr91533 ------
NM_021155chr1951988 1182 1036 644 409 --11015 12079
NM_021156chr2031160 330 64 --1445 --
NM_021159chr421391 138 11097 11157 --
NM_021163chr773634 3231 3157 3005 2511 1458 768 11363 ----
NM_021180chr13667 331 317 ------
NM_021183chrX32549 2421 2273 22046 97 12366 1692
NM_021191chr1241975 1952 289 179 11832 ----
NM_021194chr1143 ------
NM_021202chr2053061 2307 2201 864 746 ------
NM_021215chr2072272 1744 1714 992 871 740 469 --12019 --
NM_021218chr93989 966 225 ------
NM_021222chr121367 280 ------
NM_021224chr9----1442 --
NM_021235chr19141 ------
NM_021238chr1271997 1986 1870 1674 1611 581 152 ------
NM_021239chr144512 361 339 254 1333 ----
NM_021240chr91634 ------
NM_021242chrX2647 110 ------
NM_021252chr1031301 192 92 12017 ----
NM_021255chr1453522 3405 3234 2834 1032 22898 1129 --22619 1383
NM_021569chr92935 246 ------
NM_021619chr941261 1226 1157 1066 1299 ----
NM_021622chr1052398 2382 2269 2006 1821 ------
NM_021627chr32833 148 ------
NM_021629chr385101 3718 3424 1958 1935 1562 431 92 ------
NM_021638chr4104826 4375 4058 3879 3206 1907 1719 178 102 35 --21976 1955 14306
NM_021639chr13726 596 324 ------
NM_021643chr211272 1319 ----
NM_021644chr106919 852 710 448 366 169 ------
NM_021647chr4104642 3466 1864 1669 1044 992 958 424 316 153 11293 --13746
NM_021648chr632086 1758 472 1816 ----
NM_021705chr641392 1345 1230 366 --1158 11371
NM_021723chr73504 390 79 ------
NM_021728chr142766 668 1940 ----
NM_021738chr102559 51 ------
NM_021785chrX2240 228 ------
NM_021809chr2062463 2235 2223 676 574 162 ------
NM_021813chr695497 5396 4242 3621 2001 1713 928 833 423 34763 4514 826 ----
NM_021814chr61325 11596 --1352
NM_021818chr1461290 1025 394 362 221 65 ------
NM_021911chr545441 5003 3672 3646 14906 35566 4166 3885 11491
NM_021912chr1553849 1618 1260 963 265 --13497 --
NM_021914chr142320 269 --1413 --
NM_021931chr205947 815 228 129 24 ------
NM_021934chr122250 61 ------
NM_021940chr671311 1258 1069 1056 403 391 242 ------
NM_021943chr642019 1658 1579 857 11456 2150 107 --
NM_021946chrX1436 11096 --191
NM_021947chr1741309 1100 938 481 ------
NM_021949chrX82853 2666 2461 2010 1994 1113 858 809 12276 ----
NM_021951chr91916 ------
NM_021954chr1363255 1385 562 506 347 322 ------
NM_021956chr621431 1073 --1416 --
NM_021961chr1177383 6646 6589 6205 2444 1005 92 47063 2891 1318 318 --26675 2845
NM_021962chr1762233 2164 2079 1682 79 21 ------
NM_021963chrX1769 ------
NM_021964chr395329 5278 5080 4412 1655 1163 1069 392 153 1822 ----
NM_021970chr41533 ------
NM_021977chr663254 2816 2672 1411 461 122 23426 71 ----
NM_021979chr14--1310 1390 --
NM_021984chrX21415 372 31175 577 144 ----
NM_021987chrX21415 372 31175 577 144 ----
NM_021988chr201156 ------
NM_021990chrX21415 372 31175 577 144 ----
NM_021998chrX21529 1119 ------
NM_021999chr132656 214 ------
NM_022037chr22675 305 ------
NM_022041chr164781 671 521 447 1234 --12363
NM_022048chr1575353 4783 2330 1391 920 637 57 46008 5006 4476 414 1612 --
NM_022051chr11182 ------
NM_022068chr182150 21 ------
NM_022075chr11628 ------
NM_022079chr102818 643 1114 ----
NM_022114chr184732 4626 4251 4053 3813 3022 1205 783 24721 4459 13701 2638 464
NM_022116chr7132 ------
NM_022117chrX195 ----1161
NM_022121chr61980 ------
NM_022130chr511384 ------
NM_022133chr82377 88 ------
NM_022143chr7--1467 ----
NM_022166chr16106273 6114 5894 5249 4813 2451 1634 1066 661 196 66247 6159 5443 2505 2063 2034 16293 --
NM_022173chr22675 305 ------
NM_022307chr71278 1618 ----
NM_022351chr853213 3036 404 98 82 23461 1009 23134 2620 --
NM_022355chr16----133 --
NM_022356chr12470 59 ------
NM_022368chrX1170 --2408 62 --
NM_022374chr22139 120 ------
NM_022442chr201156 ------
NM_022444chr751931 1875 1496 121 61 --1180 --
NM_022459chr1396148 4712 4688 4442 4342 4043 1519 1176 776 --36216 1391 879 1469
NM_022461chr331224 403 140 1108 ----
NM_022465chr1243060 3046 2983 2408 12677 ----
NM_022467chr191376 ------
NM_022469chr163016 2525 2301 898 763 319 12159 22802 1069 --
NM_022470chr341244 1221 1159 222 ------
NM_022473chr1564362 4092 3520 1514 984 911 21356 1223 23848 1491 11658
NM_022474chr1432818 2811 1026 22051 119 176 --
NM_022476chr16--1855 ----
NM_022477chr2061734 1450 1169 484 207 28 ------
NM_022484chr74475 247 215 113 ------
NM_022491chr1263150 2930 2706 2581 2476 954 23522 1404 1135 --
NM_022552chr21845 2962 413 1373 --
NM_022572chr221719 1656 --1374 --
NM_022574chr7276 31 ------
NM_022648chr254426 4037 1304 1187 250 ----24221 156
NM_022650chr53951 673 289 ------
NM_022658chr1221171 149 ------
NM_022716chr152916 2375 2167 1004 955 ------
NM_022719chr22103792 3248 3125 624 563 543 468 427 379 45 --21234 341 --
NM_022726chr611493 1577 1629 --
NM_022728chr71707 1597 ----
NM_022733chr1----11217 --
NM_022739chr171849 ------
NM_022742chr7----151 --
NM_022753chr132694 2489 616 1342 32532 2104 2085 --
NM_022755chr952635 2565 2379 1687 518 1749 ----
NM_022756chr121452 1125 135 1223 --
NM_022758chr6--32392 1109 513 --186
NM_022763chr323174 3167 ------
NM_022771chr1221014 281 ------
NM_022776chr331285 569 76 --1156 --
NM_022782chr121332 ------
NM_022802chr1041255 1117 569 132 ------
NM_022822chr111784 1882 ----
NM_022824chr521806 148 ------
NM_022826chr231041 770 458 --1331 --
NM_022832chr472525 2484 2338 2178 1859 883 208 11999 ----
NM_022841chr1582504 1987 1714 1691 883 616 518 30 2198 124 21928 500 1422
NM_022842chr3103027 2926 2836 2434 2274 2142 1084 911 801 301 ----13059
NM_022843chr1361489 1338 1134 1035 376 260 ------
NM_022844chr163937 882 248 ------
NM_022845chr1652153 1515 1494 607 286 ------
NM_022893chr272747 2605 2593 2015 485 289 91 ------
NM_022894chr221271 176 1168 ----
NM_022898chr1434024 1472 988 23953 931 23938 1433 14116
NM_022900chr721107 239 ------
NM_022902chr5198 ------
NM_022910chr1631532 564 147 ----11522
NM_022912chr242955 2399 683 584 ------
NM_022918chr1142050 2005 1696 469 --21906 229 --
NM_022977chrX3715 450 357 ----12593
NM_023000chr1421482 390 11455 ----
NM_023001chr1421482 390 11455 ----
NM_023008chr194761 323 315 238 189 ----
NM_023010chrX3768 272 264 ----1131
NM_023016chr272328 1918 1894 1832 677 483 421 ------
NM_023037chr131124 ----11048
NM_023071chr1251158 1125 937 913 434 ------
NM_023074chr1931362 935 877 ------
NM_023075chr183696 673 146 ------
NM_023076chr1632009 1171 1109 ------
NM_023079chr1731856 1180 350 ------
NM_023105chr862454 2094 2039 1754 1523 1500 11580 ----
NM_023106chr862454 2094 2039 1754 1523 1500 11580 ----
NM_023110chr862454 2094 2039 1754 1523 1500 11580 ----
NM_023111chr862454 2094 2039 1754 1523 1500 11580 ----
NM_023112chr1442381 912 385 46 --198 12764
NM_023923chr1123754 2666 2484 2476 1412 946 922 536 305 283 177 104 --22461 1389 --
NM_023929chr842217 2070 1739 31 --1131 --
NM_023940chr43989 749 323 ------
NM_024007chr543062 2950 2308 758 ----23096 126
NM_024015chr171319 1981 ----
NM_024017chr173613 600 68 1478 --11081
NM_024019chr4--1319 ----
NM_024046chr33935 368 73 ------
NM_024052chr171987 13109 --12530
NM_024054chr71332 ------
NM_024061chr71577 ------
NM_024071chr142599 406 ------
NM_024076chr19111960 1849 1752 1712 1670 1592 1475 952 841 377 317 32330 2185 454 --12275
NM_024089chr131161 ------
NM_024090chr431633 776 637 2555 518 ----
NM_024111chr152206 159 ------
NM_024294chr6--32392 1109 513 --186
NM_024295chr83763 235 72 --2752 542 --
NM_024329chr1--21381 1350 ----
NM_024345chr996054 5911 1783 1775 1354 1219 1053 813 214 15353 11493 --
NM_024408chr173284 2861 786 687 345 330 319 ------
NM_024410chr81128 ------
NM_024411chr201364 ------
NM_024415chr5----1187 --
NM_024421chr1861226 1205 1142 944 445 251 160 ----
NM_024423chr1871134 1076 941 698 666 125 24 --13713 13614
NM_024424chr1121170 283 ------
NM_024425chr1121170 283 ------
NM_024426chr1121170 283 ------
NM_024496chr143812 796 130 ------
NM_024511chr443513 3452 2166 390 1665 ----
NM_024522chr141356 730 718 622 --1109 --
NM_024523chr71967 1945 ----
NM_024524chr343090 2685 2659 2564 ------
NM_024525chr1--1514 ----
NM_024539chrX11188 ------
NM_024556chr113377 318 155 ------
NM_024567chr82521 99 ------
NM_024574chr41337 1372 ----
NM_024581chr61250 ------
NM_024582chr431112 395 369 ----1321
NM_024586chr11474 ------
NM_024595chr131218 1195 128 ------
NM_024605chr44687 573 555 91 1430 ----
NM_024624chr22648 531 ----1454
NM_024626chr131607 527 470 ------
NM_024628chr321102 230 --11173 --
NM_024639chr62765 614 1398 ----
NM_024643chr141118 2352 104 ----
NM_024646chr183860 3625 3609 3074 2975 2473 2450 353 13236 12608 --
NM_024659chr221030 28 1103 ----
NM_024665chr384694 4660 4248 2893 1518 1298 451 161 ------
NM_024670chr1041758 1735 1673 459 --11764 11500
NM_024674chr162742 2673 2650 2427 665 630 1555 23076 2163 --
NM_024680chr112484 98 ------
NM_024686chr11555 ------
NM_024692chr221696 1562 ------
NM_024704chr202911 273 ------
NM_024705chr136810 789 718 326 291 253 ------
NM_024708chr15121 ------
NM_024713chr1551541 1318 1124 260 53 ------
NM_024721chr872708 2522 2217 1055 590 341 301 --2659 74 --
NM_024725chr11--1868 ----
NM_024740chr1194049 3627 3001 1561 1525 1185 786 685 220 --13479 --
NM_024742chr16--11231 --1666
NM_024745chr1651124 1048 934 910 148 ------
NM_024749chr121942 79 1790 ----
NM_024755chr153324 298 222 ------
NM_024757chr96996 844 356 197 156 146 ------
NM_024769chr1151113 1090 1064 976 127 ------
NM_024770chr284140 2188 2134 1144 1048 886 863 58 26271 6250 15718 1418
NM_024772chr12444 425 ------
NM_024778chrX2216 79 ------
NM_024786chr52339 245 179 --1289
NM_024804chr12337 314 ------
NM_024828chr921160 1129 --21251 980 11537
NM_024834chr102710 361 21868 1630 138 --
NM_024845chr1651508 1112 389 330 137 --11644 --
NM_024887chr131983 772 699 ------
NM_024899chr182729 454 ------
NM_024911chr13700 280 191 ------
NM_024944chr211114 ------
NM_024946chr1641771 1726 1194 445 ----1206
NM_024947chr389470 8354 8339 7712 7375 2843 2274 836 --13844 --
NM_024948chr101109 ------
NM_024949chr444918 4305 3935 3893 ------
NM_024953chr1222614 1840 ----11847
NM_024956chr15154 1173 --1185
NM_024960chr202474 91 ------
NM_024963chr7145622 5234 5118 4835 4812 3931 3686 2132 2005 1959 1484 1159 1136 47 34240 2178 543 15893 --
NM_024969chr25573 189 171 130 49 ------
NM_024979chr1331343 528 44 21196 133 ----
NM_024989chr2147860 6817 6572 5531 5480 5129 2252 1449 1377 1297 824 355 345 298 38055 6942 1518 ----
NM_024991chr1073024 3008 2720 2663 2187 1031 825 --13201 --
NM_025027chr192832 771 ------
NM_025052chr2------137
NM_025054chr841698 1130 998 775 1762 ----
NM_025073chr153936 3799 3698 3556 1252 ------
NM_025076chr2------1183
NM_025079chr12577 252 --1163 --
NM_025083chr1541789 1545 679 458 1448 --1741
NM_025106chr12554 353 11524 ----
NM_025133chr24775 328 256 105 ------
NM_025134chr1652490 2314 1825 1818 310 22007 443 ----
NM_025137chr151111 1317 ----
NM_025138chr13156 --11053 --
NM_025141chr152621 487 --1414 1542
NM_025146chr321091 257 12484 ----
NM_025151chr852216 2147 2064 1414 188 1500 ----
NM_025154chr721218 195 ------
NM_025160chr11507 14190 ----
NM_025164chr1132000 1979 1769 ------
NM_025181chr21607 ------
NM_025191chr132903 765 242 ------
NM_025195chr831430 1335 101 ------
NM_025208chr1132063 610 212 ------
NM_025219chr202499 297 62440 2377 1554 1542 1534 1511 2353 71 11815
NM_025222chr3122798 2670 2495 1972 1956 1200 1162 654 610 585 381 243 ------
NM_025235chr1062229 1941 1545 810 403 311 --1475 --
NM_025236chr62531 45 --1107 --
NM_025237chr1721386 1059 ----21258 461
NM_025238chr1521545 1424 ------
NM_025248chr1743051 2804 2782 966 11225 ----
NM_025257chr63349 326 27 ------
NM_030576chr1762375 2343 2304 628 539 493 131 ----
NM_030594chr1571387 1321 1058 848 533 452 253 1285 ----
NM_030621chr1494180 4117 3536 2902 2634 1642 1540 1456 445 34171 3583 1043 13968 23390 2740
NM_030625chr1032577 2358 826 --1751 --
NM_030627chr533433 3253 180 13233 12548 13459
NM_030629chr1651950 1350 1253 663 474 ------
NM_030637chr142537 276 ------
NM_030647chr776058 5464 5132 4843 4091 762 144 35884 2027 1061 14537 --
NM_030648chr495301 4462 3639 3535 2167 1736 1494 1427 162 11908 24385 3402 11236
NM_030650chr254227 3970 3255 1547 574 1955 1632 --
NM_030660chr1421478 515 1313 ----
NM_030661chr731708 1090 415 11150 ----
NM_030664chr1061823 1798 1722 516 451 314 144 ----
NM_030665chr1731417 1302 1211 ------
NM_030674chr1255422 2077 1842 1480 836 --14940 --
NM_030755chr1462711 2689 2514 2288 2270 319 --22729 101 11919
NM_030761chr12916 773 32396 1850 309 ----
NM_030767chr952505 2318 2182 2039 735 ----11117
NM_030771chr111279 1218 ----
NM_030780chr821553 568 --11680 --
NM_030786chr121897 762 ------
NM_030790chr161217 ------
NM_030791chr143689 158 97 ------
NM_030802chr172774 317 1879 --1808
NM_030806chr1117945 7688 7630 7039 6884 6589 6054 3276 2643 1926 1451 48975 8560 3027 1516 27111 3117 --
NM_030808chr174904 372 238 133 ------
NM_030809chr1252399 2092 1991 1951 324 ----183
NM_030816chr131482 649 605 32756 2453 570 ----
NM_030820chr61928 ------
NM_030881chr2222169 905 1428 1751 --
NM_030885chr352337 1755 805 201 28 191 1473 --
NM_030911chr1331075 345 47 --21210 21 --
NM_030912chr101847 ------
NM_030915chr222085 1996 21843 137 1468 --
NM_030918chr194740 4615 3933 3658 3341 2138 1589 1581 1227 24365 3508 15294 --
NM_030927chr1071474 1245 1083 567 340 323 208 11568 ----
NM_030937chr12953 444 ------
NM_030939chr621046 236 1762 ----
NM_030940chr931439 1065 488 ----166
NM_030962chr1121107 138 ------
NM_030964chr543454 3318 1485 706 12471 33573 327 70 --
NM_030979chr13186 ------
NM_031157chr121173 ------
NM_031203chr191180 ------
NM_031216chr181620 ------
NM_031243chr731916 1514 32 ------
NM_031262chr91304 ------
NM_031263chr91361 ------
NM_031266chr51420 ------
NM_031268chr16114984 4888 4834 4235 3581 3263 1738 1325 830 483 129 24072 1039 24540 4137 --
NM_031283chr21259 --1912 --
NM_031284chr152596 111 ------
NM_031296chr462688 2302 2078 1069 858 547 12535 1532 --
NM_031305chr41284 ------
NM_031309chr852389 1952 1663 495 424 ------
NM_031314chr1421317 375 11969 11915 --
NM_031371chr151473 622 517 343 66 1284 ----
NM_031371chr151473 622 517 343 66 1284 ----
NM_031372chr42143 52 ------
NM_031411chr532100 2093 354 21831 127 ----
NM_031412chr1231211 1124 475 --11013 --
NM_031417chr1931936 1809 892 11047 ----
NM_031418chr1162754 2726 2628 2388 724 679 --2299 223 --
NM_031419chr321474 517 ------
NM_031431chr1361500 1282 680 413 71 64 ----1142
NM_031435chr1253480 3409 1152 1144 356 ----12659
NM_031442chrX83148 2882 2522 2309 2035 2026 340 227 --21112 772 --
NM_031443chr71381 ------
NM_031445chr242734 800 380 104 21042 625 ----
NM_031453chr1051796 528 473 178 119 12078 ----
NM_031461chr861609 778 545 493 83 72 ------
NM_031468chr7157820 7321 6810 6679 6171 5492 5325 4980 3113 2481 2276 1947 1150 588 30 56228 2582 1728 1268 723 ----
NM_031469chr663533 3377 2880 393 227 167 23542 490 ----
NM_031476chr1642638 2339 2126 568 11849 ----
NM_031477chr162362 143 1107 ----
NM_031483chr2063434 2745 2682 2472 2347 375 1347 ----
NM_031844chr183941 3569 3103 2537 861 494 450 112 --21482 179 11591
NM_031845chr243413 3200 1475 287 --2445 127 --
NM_031847chr243413 3200 1475 287 --2445 127 --
NM_031849chr532100 2093 354 21831 127 ----
NM_031857chr532100 2093 354 21831 127 ----
NM_031858chr1711396 ------
NM_031860chr532100 2093 354 21831 127 ----
NM_031862chr1711396 ------
NM_031886chr1992275 2111 2088 2026 1698 1690 1674 1031 384 ------
NM_031935chr11888 ------
NM_031936chr12571 52 --1515 --
NM_031940chr842029 1978 852 536 2587 184 11955 --
NM_031954chr1262893 2815 2515 2346 2153 419 --21994 590 --
NM_031990chr195977 443 356 297 176 21435 586 ----
NM_031991chr195977 443 356 297 176 21435 586 ----
NM_032013chr2061734 1450 1169 484 207 28 ------
NM_032021chr111999 --1941 --
NM_032041chr842424 2026 550 356 ------
NM_032042chr552814 2293 1047 326 211 ------
NM_032050chr2221062 90 1203 ----
NM_032052chr2221447 475 ------
NM_032088chr51703 ----1266
NM_032092chr51703 ----1266
NM_032102chr1142258 987 746 636 21939 771 12625 --
NM_032105chr1137884 7464 6365 6253 5938 5784 5416 3168 2631 2423 2400 2338 664 37591 6903 5366 ----
NM_032108chr192321 286 2706 396 ----
NM_032116chr13105694 5415 3603 2321 1531 835 719 337 240 137 ------
NM_032124chr182868 425 ------
NM_032144chr241576 1451 1354 386 ------
NM_032153chr362759 2451 2358 856 715 425 ------
NM_032154chr104865 194 54 47 ------
NM_032174chr11594 ------
NM_032177chr52332 74 ------
NM_032186chr11332 ------
NM_032189chr1353669 3590 3272 1812 511 44983 4594 3802 468 1909 --
NM_032193chr1151427 786 533 343 242 --1587 --
NM_032195chr211439 ------
NM_032199chr10113883 3816 3445 3222 2774 2421 1251 1111 675 532 130 ------
NM_032208chr262907 2681 2549 2435 574 269 ------
NM_032213chr22431 90 31151 790 262 ----
NM_032217chr41306 2129 26 ----
NM_032221chr2042021 1411 640 164 ------
NM_032228chr1132331 1371 985 ------
NM_032233chr141668 2268 99 ----
NM_032242chr382978 2799 2738 2722 2662 1274 1045 582 13239 ----
NM_032246chr152320 163 --1236 --
NM_032256chr1241060 338 232 193 ------
NM_032268chr1693097 2922 2469 2386 2098 1313 1298 1281 1019 --12775 --
NM_032281chr1963011 2631 2535 2361 1929 180 21198 141 ----
NM_032287chr22103113 3024 2688 1597 1032 817 588 569 228 30 --11024 11485
NM_032288chr332301 1717 655 ------
NM_032289chr521905 770 --11401 --
NM_032291chr131268 660 383 ------
NM_032312chr2193 --1176 --
NM_032320chr11172 --1125 --
NM_032321chr233312 940 678 ------
NM_032354chr1751095 1045 1026 885 855 1292 ----
NM_032364chr122182 50 ------
NM_032373chr1095941 4133 4110 1468 1215 1135 637 368 65 15738 14826 --
NM_032379chr111104 ------
NM_032382chr163472 461 112 ------
NM_032403chr51703 ----1266
NM_032424chr1121378 144 ------
NM_032429chr103611 468 24 155 ----
NM_032436chr131951 ------
NM_032438chr621545 506 11186 ----
NM_032439chr101257 --1423 --
NM_032440chr1072891 2874 2541 1030 430 50 27 2292 114 22189 945 --
NM_032445chr1531969 104 24 ------
NM_032446chr543710 3326 1147 313 1288 1163 1677
NM_032449chr152809 2721 2698 826 589 --21981 258 --
NM_032452chr1431539 536 374 --11282 --
NM_032456chr42682 139 ------
NM_032457chr463181 2455 1262 560 333 179 --1642 --
NM_032458chrX42640 2156 1214 546 13127 12664 --
NM_032491chr122472 225 1253 ----
NM_032499chr1531573 465 72 21277 547 ----
NM_032505chr322762 1098 --22711 136 --
NM_032509chr872489 2469 2453 2125 1855 1758 584 ------
NM_032510chr1851904 988 730 707 427 2203 65 ----
NM_032520chr161182 ------
NM_032521chr2052671 2365 947 562 372 ------
NM_032536chr9--1606 ----
NM_032539chrX1639 ------
NM_032547chr431412 1357 230 ------
NM_032552chr991385 1275 1231 516 446 422 262 199 66 1347 11705 --
NM_032557chr44805 778 771 642 ------
NM_032564chr112974 40 --1650 --
NM_032569chr1632004 714 459 11403 --11529
NM_032574chr2------140
NM_032582chr1721842 1558 ------
NM_032590chr121211 1778 ----
NM_032595chr17--1306 1978 --
NM_032632chr1421830 1479 ------
NM_032682chr393560 3332 3227 3200 2860 2258 1054 862 454 22878 395 32814 1459 337 13217
NM_032711chr1754160 3387 3272 1704 1660 32806 2608 797 ----
NM_032727chr1021631 1253 --1189 --
NM_032731chr1731394 510 60 1954 ----
NM_032765chr57993 970 883 858 761 678 77 ------
NM_032788chr261591 1568 1506 1203 1171 1141 ------
NM_032801chr1142137 2024 807 532 ------
NM_032804chr1052233 2108 983 835 799 1775 ----
NM_032808chr152706 631 ------
NM_032810chr1031291 1125 607 143