TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-17-5p
miRNA Sequence: CAAAGUGCUUACAGUGCAGGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52969 141 ------
NM_000038chr541980 1353 161 62 --11408 --
NM_000043chr101431 1105 ----
NM_000052chrX43420 3308 1336 72 23058 2878 ----
NM_000059chr133288 186 89 1803 ----
NM_000070chr151470 1149 1503 --
NM_000081chr141583 1451 1295 1253 ----135
NM_000084chrX116960 5919 5871 5841 5161 4561 2443 1757 1423 758 84 46589 6344 2727 1846 --12023
NM_000089chr72696 675 ------
NM_000090chr21704 --1698 --
NM_000092chr2144542 4060 3908 3823 3263 3150 3111 1574 1258 1093 1034 965 736 94 21553 508 1712 24353 1510
NM_000096chr33864 287 88 ------
NM_000103chr1551207 1015 850 811 33 11253 --2467 118
NM_000104chr253109 2152 2058 619 375 12874 --12934
NM_000109chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_000110chr11112 1431 21161 379 11231
NM_000115chr1361829 725 615 252 231 29 21861 166 1537 --
NM_000125chr6103760 3675 3374 3360 3247 1030 1000 890 368 327 168 24225 386 147
NM_000129chr631408 541 33 --11450 --
NM_000135chr1621010 726 ------
NM_000138chr1562593 2554 2389 2287 2190 189 ------
NM_000139chr1132854 2191 525 12042 ----
NM_000151chr171355 21894 325 ----
NM_000161chr1461837 1400 751 480 188 87 ----11628
NM_000163chr562274 2092 1890 1498 1464 332 --12282 --
NM_000165chr631545 682 627 --1504 --
NM_000167chrX51666 1427 713 674 359 --11682 --
NM_000168chr743095 2773 1175 860 1978 11316 12663
NM_000170chr94517 409 341 53 ------
NM_000173chr17----1408 --
NM_000176chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_000177chr91231 ------
NM_000189chr252404 2094 1587 584 563 1786 ----
NM_000194chrX------1144
NM_000196chr161502 1520 ----
NM_000208chr19104517 4319 3549 3436 2986 1804 1209 867 47 41 --34188 3145 1851 --
NM_000210chr262343 2034 2024 1867 950 862 --11722 --
NM_000214chr2031414 1220 1137 ------
NM_000216chrX63819 3145 1572 1057 1017 494 1573 1829 13639
NM_000217chr1285370 4530 4182 3944 3270 2012 332 92 55333 4745 4340 4113 104 24174 2093 --
NM_000220chr114700 431 402 205 ------
NM_000222chr461832 1821 1740 1328 821 667 1143 ----
NM_000223chr172190 121 --1480 --
NM_000227chr181160 ----1346
NM_000231chr132616 429 ------
NM_000232chr41882 32252 2172 182 --12162
NM_000237chr821891 1786 21941 1706 ----
NM_000245chr742200 464 437 35 11578 ----
NM_000248chr343075 1087 818 309 1461 ----
NM_000252chrX31388 972 67 ------
NM_000255chr61323 1126 1107 --
NM_000259chr1596037 5458 5030 1630 1193 315 163 154 87 11514 35647 4015 1078 1628
NM_000266chrX2373 233 --1249 --
NM_000267chr1783472 3453 2459 1191 582 430 212 102 ------
NM_000276chrX4570 562 478 181 --2735 420 --
NM_000277chr124693 657 573 278 ------
NM_000280chr115855 769 273 247 223 ------
NM_000282chr132262 211 ------
NM_000288chr62347 333 ------
NM_000293chr162739 640 ------
NM_000297chr431835 1626 1392 ----22054 139
NM_000301chr61217 ------
NM_000304chr172884 201 --11079 --
NM_000314chr1052712 2637 1232 1154 419 22432 2350 2661 278 --
NM_000317chr11--1322 ----
NM_000325chr41643 1269 ----
NM_000329chr1--2889 798 ----
NM_000332chr6206930 6445 6044 5551 5543 5467 5225 5113 4840 4725 4635 2786 2450 2179 1702 1481 1398 1121 1044 603 55737 1845 1672 1191 1142 22132 1391 --
NM_000333chr341094 724 417 40 ------
NM_000337chr586010 5788 5493 1704 1670 1471 493 270 26220 1715 35060 2593 2264 --
NM_000338chr1541031 936 807 225 126 --169
NM_000340chr34947 604 532 322 --11436 181
NM_000345chr42948 171 ------
NM_000346chr1731850 797 479 ------
NM_000358chr5--1105 1177 --
NM_000361chr2041904 1806 855 428 11830 ----
NM_000362chr2253613 2574 1159 858 118 22489 1171 ----
NM_000368chr964481 3955 3124 852 366 281 --24454 4425 --
NM_000378chr1141253 808 372 196 --11246 --
NM_000388chr31218 ----11253
NM_000389chr611309 11187 31154 474 231 --
NM_000393chr261931 1641 1546 1426 1407 808 --1645 --
NM_000396chr11170 --2532 68 --
NM_000397chrX52335 2321 479 469 221 --1201 --
NM_000399chr1021202 770 ----1465
NM_000401chr1131131 424 144 1825 ----
NM_000408chr2143146 3118 3077 2775 2118 1356 1329 1285 1013 826 744 570 370 235 22149 814 33252 3006 2255 21297 179
NM_000411chr2153145 3110 3090 1264 644 13000 12318 22190 960
NM_000414chr51119 ------
NM_000430chr1743250 3236 2651 697 21369 322 --12877
NM_000435chr191362 --1860 --
NM_000439chr522008 810 ------
NM_000442chr1731235 848 88 ------
NM_000444chrX3332 254 103 1297 1114 --
NM_000448chr11163235 3089 3056 3022 2973 2439 2249 2136 1194 1052 945 816 580 462 444 383 12967 ----
NM_000449chr131311 532 71 11539 ----
NM_000461chr383996 3523 3173 2818 813 595 187 172 24197 3843 24297 3041 --
NM_000462chr1531223 465 334 --11643 --
NM_000480chr1141289 464 353 234 21642 154 21141 1060 124
NM_000484chr212828 210 1370 1716 --
NM_000486chr1233062 2311 631 12653 ----
NM_000489chrX113336 3062 2261 2160 1384 1135 1088 713 450 443 139 43427 3265 2939 1256 11014 1906
NM_000492chr731010 961 227 ------
NM_000493chr61380 ------
NM_000494chr103858 824 54 ------
NM_000495chrX1236 1713 ----
NM_000503chr81436 11763 31241 636 324 --
NM_000508chr44966 869 749 227 ------
NM_000509chr42177 27 ------
NM_000522chr731111 946 908 3825 505 335 1131 --
NM_000523chr221166 1064 1373 ----
NM_000527chr1942430 2370 1512 859 --32169 1635 821 --
NM_000533chrX2345 202 ------
NM_000538chr1361804 1310 1237 297 137 114 1619 1161 --
NM_000546chr1741149 800 405 65 --11106 --
NM_000555chrX167883 7110 6751 6665 5947 5921 5825 4858 2677 2534 2453 2415 2061 1869 373 63 22181 2002 15651 12520
NM_000565chr11704 --22278 674 --
NM_000573chr192170 2029 1601 1437 818 612 473 262 134 12343 1518 --
NM_000578chr21253 ----21266 235
NM_000585chr42224 82 1216 ----
NM_000596chr71116 ------
NM_000599chr264620 4530 4494 3925 3883 785 11314 34488 1437 1144 --
NM_000609chr1053128 3094 2194 252 133 ------
NM_000610chr1193022 2920 2785 2400 2173 1203 682 632 407 ------
NM_000612chr1113512 1866 12379 --
NM_000615chr1182887 2787 2405 1015 530 473 420 64 12527 11956 --
NM_000618chr12146356 5817 4197 2630 2555 1947 1803 1618 1587 1565 1402 712 599 426 25898 4426 --1627
NM_000618chr12146356 5817 4197 2630 2555 1947 1803 1618 1587 1565 1402 712 599 426 25898 4426 --1627
NM_000624chr141733 --1869 --
NM_000627chr24882 807 372 335 ----1601
NM_000633chr1895068 5034 4864 4176 3888 2032 1323 495 374 15128 25184 3699 1752
NM_000651chr192170 2029 1601 1437 818 612 473 262 134 12343 1518 --
NM_000663chr1632827 2778 1147 --1139 --
NM_000676chr172355 124 --1492 --
NM_000684chr1021227 938 1525 ----
NM_000685chr33205 97 70 1866 ----
NM_000685chr33205 97 70 1866 ----
NM_000686chrX41464 528 431 346 ------
NM_000700chr91180 ------
NM_000701chr1174 1289 ----
NM_000702chr152253 2232 2085 1653 888 1715 12016 12097
NM_000719chr1264914 2030 1719 1065 857 724 --46669 5093 1509 1379 --
NM_000721chr132696 2112 317 ------
NM_000724chr1021775 176 ------
NM_000726chr22289 242 2556 125 11286 --
NM_000739chr71640 ----199
NM_000740chr1--1165 ----
NM_000756chr8133 ------
NM_000761chr1521456 1353 ----1135
NM_000788chr451406 1360 1071 1040 1034 31418 1338 986 11205 --
NM_000794chr5------1662
NM_000800chr521520 529 ------
NM_000801chr202268 118 1253 ----
NM_000806chr531842 712 531 ------
NM_000807chr42667 159 ------
NM_000808chrX1877 --1816 --
NM_000809chr4269076 8452 8371 8248 8141 8074 7844 7472 6959 6870 6850 6755 6539 6426 6018 3463 3078 2998 2907 2832 2641 2621 1939 1042 955 605 58191 3519 2892 1823 332 22927 2062 --
NM_000813chr565399 3602 2144 2126 639 632 25166 1148 15223 --
NM_000814chr1593708 3514 3424 3393 2727 2691 1588 1115 261 34088 3674 1643 ----
NM_000816chr5--1455 1186 --
NM_000817chr21822 1315 --1904
NM_000824chr41865 --2624 109 --
NM_000826chr462486 1949 1856 1755 1667 844 12335 12414 11888
NM_000827chr572397 2350 1890 973 902 654 167 1503 ----
NM_000829chr1152189 1917 1512 785 556 ------
NM_000831chr166141 5180 4031 906 771 674 15310 ----
NM_000833chr1621540 1426 ------
NM_000834chr1211146 ------
NM_000844chr321113 350 1181 2991 405 --
NM_000857chr42485 190 ------
NM_000859chr521718 1703 11640 ----
NM_000866chr31710 11446 11868 --
NM_000868chrX52447 2250 1904 993 348 1454 --1145
NM_000875chr15155987 5775 5733 5505 5347 5118 4991 4860 2217 2209 2153 1816 1213 1126 280 26023 572 26746 5664 --
NM_000876chr621403 1077 ----1369
NM_000877chr273080 2940 2926 2257 2031 1983 184 --22784 264 11026
NM_000879chr51233 151 ----
NM_000880chr82897 137 ------
NM_000885chr231902 1514 561 21940 508 --1852
NM_000891chr1743224 1379 844 492 33165 2470 33 --12824
NM_000899chr1244117 4011 3388 28 44394 3831 3616 3512 44318 3824 3013 2821 --
NM_000901chr442116 1919 1771 229 12576 ----
NM_000902chr343091 1175 539 448 ------
NM_000908chr52801 776 2715 131 ----
NM_000917chr102609 160 ------
NM_000921chr12----2139 122 --
NM_000922chr111278 --1178 --
NM_000933chr201172 ------
NM_000935chr341229 909 878 125 11039 ----
NM_000944chr452361 2194 1938 1477 454 --32054 1915 848 11505
NM_000945chr281357 808 786 598 564 452 126 30 ----1200
NM_000949chr52211 131 1877 ----
NM_000950chrX83448 3242 2457 1310 1212 458 184 32 33553 2726 2521 23335 2588 166
NM_000958chr521140 996 --2871 147 --
NM_000962chr962043 1111 923 749 494 92 ----12416
NM_000965chr32848 74 --11200 --
NM_000990chr1184006 3401 2697 1486 1114 336 117 39 13961 13530 --
NM_001001132chr2141387 1059 967 498 1175 ----
NM_001001323chr1242783 2550 2171 756 --12918 --
NM_001001330chr1061273 1136 945 889 496 128 ------
NM_001001331chr351833 1783 640 344 56 --11669 --
NM_001001344chrX42482 966 845 151 11965 1744 --
NM_001001389chr1193022 2920 2785 2400 2173 1203 682 632 407 ------
NM_001001390chr1193022 2920 2785 2400 2173 1203 682 632 407 ------
NM_001001391chr1193022 2920 2785 2400 2173 1203 682 632 407 ------
NM_001001392chr1183068 2966 2831 2446 2219 728 678 453 ------
NM_001001394chr21717 --1568 --
NM_001001395chr1262806 2763 2491 1095 724 382 32462 881 700 1693 1566
NM_001001396chr173786 2907 2710 1639 772 553 329 --24280 3237 --
NM_001001419chr584992 4164 3661 3609 1967 1666 1656 1020 45236 3815 746 283 64082 3688 2005 1332 854 418 --
NM_001001420chr584992 4164 3661 3609 1967 1666 1656 1020 45236 3815 746 283 64082 3688 2005 1332 854 418 --
NM_001001433chr2033115 2509 2488 1965 1723 --
NM_001001436chr163869 800 609 ------
NM_001001481chr893011 2624 2483 2435 1165 1123 1025 970 256 32987 2920 487 2137 57 --
NM_001001484chr1022083 650 11981 21931 1633 --
NM_001001521chr21295 ----187
NM_001001549chr752581 915 659 394 376 --11787 --
NM_001001550chr752581 915 659 394 376 --11787 --
NM_001001555chr752581 915 659 394 376 --11787 --
NM_001001556chr1521593 40 --21453 1163 --
NM_001001557chr832162 2036 2017 --12221 --
NM_001001664chr2104108 3933 3089 2780 2588 2568 1066 442 278 143 23675 250 23617 845 --
NM_001001668chr1963398 3264 3122 2716 977 865 23907 510 23353 596 --
NM_001001740chr1127 ------
NM_001001740chr1127 ------
NM_001001787chr13182 172 133 ------
NM_001001890chr2183740 3694 3652 2850 857 826 729 532 ------
NM_001001924chr841400 1290 805 264 --138 --
NM_001001925chr841400 1290 805 264 --138 --
NM_001001928chr22147418 7099 6995 6980 6322 5862 5321 5145 3179 3004 2613 1607 377 176 1103 42726 1975 626 422 --
NM_001001931chr841400 1290 805 264 --138 --
NM_001001933chr17617 434 229 184 167 125 112 ------
NM_001001971chr1061090 1061 1021 880 422 26 ----1108
NM_001001974chr1072247 2206 1953 1870 1633 865 529 42078 2017 1892 1576 12273 --
NM_001001994chrX2451 206 ------
NM_001001995chrX31655 254 231 2710 217 ----
NM_001001996chrX2451 206 ------
NM_001002032chr172750 706 1219 ----
NM_001002033chr172850 806 1319 --1114
NM_001002233chr861818 1718 1583 1441 459 44 --1823 22044 1612
NM_001002243chr21225 ------
NM_001002257chr2123463 3062 2935 2214 1271 1247 1142 825 773 671 295 139 13432 2546 78 --
NM_001002259chr122250 132 ------
NM_001002295chr102912 145 --165 --
NM_001002296chr84268 262 194 146 11325 11352 --
NM_001002811chr161615 1471 1319 1272 443 269 ------
NM_001002812chr161615 1471 1319 1272 443 269 ------
NM_001002812chr161615 1471 1319 1272 443 269 ------
NM_001002814chr843936 1441 459 44 --21046 823 --
NM_001002838chrX31879 583 319 1119 11854 11483
NM_001002843chr1521186 44 1128 1428 --
NM_001002857chr15--1139 1308 1294
NM_001002858chr15--1139 1308 1294
NM_001002860chr14114701 4315 3835 3814 1648 1604 1457 859 582 383 300 149 44474 1816 262 238 22871 394
NM_001002909chr1772059 2012 1742 1395 484 404 367 --22130 1750 --
NM_001002926chr751932 972 949 780 675 21772 209 12469 --
NM_001003652chr18188629 8083 8037 7951 6255 6090 5406 5330 3470 2844 2164 1678 1640 1631 1588 752 360 118 13254 27739 6601 --
NM_001003674chr18126979 6865 6731 6345 5951 5516 5320 4904 4495 940 868 442 46614 5378 5307 742 ----
NM_001003675chr18126979 6865 6731 6345 5951 5516 5320 4904 4495 940 868 442 46614 5378 5307 742 ----
NM_001003679chr152138 2068 1851 1429 82 21469 497 1569 --
NM_001003681chr2242145 2123 1415 175 ------
NM_001003688chr441233 796 776 50 --11167 1354
NM_001003712chr12113762 3651 3468 3167 3149 3039 2890 2814 1008 862 749 13428 22664 2502 --
NM_001003792chr33436 349 221 1822 1104 --
NM_001003793chr33436 349 221 1822 1104 --
NM_001003800chr953361 2466 827 757 485 --21475 1171 --
NM_001003845chr21204 1552 ----
NM_001003943chr1533777 3262 1273 --13699 --
NM_001004019chr3--1394 ----
NM_001004065chr983346 3080 2764 2565 2498 1362 771 483 23726 1578 1904 177
NM_001004303chr12279 271 3676 625 527 1765 --
NM_001004303chr12279 271 3676 625 527 1765 --
NM_001004304chr1233155 595 543 12226 ----
NM_001004308chrX2130 23 1104 21480 222 --
NM_001004317chr684548 4294 3963 3514 3340 3177 2932 1171 ------
NM_001004346chr43938 409 163 ------
NM_001004360chr241791 1263 803 150 31761 423 325 11499 --
NM_001004419chr1234613 3421 928 2676 134 24445 3282 --
NM_001004439chr152302 118 ------
NM_001004720chr2--1807 1948 --
NM_001004722chr2172 1976 11117 --
NM_001005158chr31517 --1132 --
NM_001005159chr31517 --1132 --
NM_001005242chr1241584 1573 1410 529 ------
NM_001005266chr151481 ------
NM_001005267chr151481 ------
NM_001005268chr151481 ------
NM_001005269chr151481 ------
NM_001005335chr192227 63 ------
NM_001005366chr124841 689 617 255 ------
NM_001005375chrY2527 469 157 1579 1380
NM_001005386chr262483 2105 1957 1751 453 264 22071 298 2667 473 --
NM_001005404chr1744381 4120 3247 3140 23619 3328 54369 3581 3368 3209 3043 --
NM_001005463chr1092572 2510 2339 2130 1959 1044 759 405 363 32607 2362 211 11992 --
NM_001005473chr5146289 5695 5322 5033 4904 4853 4774 4582 4133 2597 2298 1869 1556 436 26524 5329 --34217 4202 743
NM_001005474chr311484 ------
NM_001005476chr21705 --1626 --
NM_001005526chr21104 ------
NM_001005609chrX33845 3380 721 1743 ----
NM_001005739chr24859 734 234 186 1335 ----
NM_001005743chr1421267 1261 ------
NM_001005744chr1421267 1261 ------
NM_001005745chr1421267 1261 ------
NM_001005746chr22289 242 2556 125 11286 --
NM_001005747chr22289 242 2556 125 11286 --
NM_001005753chr282181 2041 1840 358 305 262 195 97 21727 54 1904 --
NM_001005781chr2----1245 1120
NM_001005782chr2----2694 272 --
NM_001005845chr81438 ----11292
NM_001005849chr17----1197 --
NM_001005909chr3123 ------
NM_001005920chr161771 ------
NM_001006600chr592097 1747 1681 1541 1535 872 694 539 442 22148 1843 21717 820 12294
NM_001006605chr12826 42 21165 26 11174 --
NM_001006605chr12826 42 21165 26 11174 --
NM_001006612chrX160 ------
NM_001006613chrX160 ------
NM_001006614chrX160 ------
NM_001006618chr91205 ------
NM_001006623chr252446 2405 2181 1626 137 32352 1937 994 1504 --
NM_001006626chr71640 ----199
NM_001006627chr71640 ----199
NM_001006628chr71640 ----199
NM_001006629chr71640 ----199
NM_001006630chr71640 ----199
NM_001006631chr71640 ----199
NM_001006632chr71640 ----199
NM_001006635chr22290 247 ------
NM_001006636chr21705 ------
NM_001006641chr941628 1158 1146 280 ------
NM_001006642chr941628 1158 1146 280 ------
NM_001006643chr941628 1158 1146 280 ------
NM_001006657chr283201 2655 1037 915 705 638 624 543 --12335 1534
NM_001006684chrX1165 182 2435 56 --
NM_001007024chr1774347 4214 3210 2944 1482 202 37 24139 3127 34377 4291 4025 --
NM_001007025chr1774347 4214 3210 2944 1482 202 37 24139 3127 34377 4291 4025 --
NM_001007067chr84959 928 813 718 31111 1041 376 ----
NM_001007068chr84959 928 813 718 31111 1041 376 ----
NM_001007069chr84959 928 813 718 31111 1041 376 ----
NM_001007070chr84959 928 813 718 31111 1041 376 ----
NM_001007075chr441116 1034 389 80 ------
NM_001007088chrX--166 ----
NM_001007097chr9135095 5077 4997 4882 4550 3857 3817 3256 1904 1889 1747 579 319 25022 1249 11396 --
NM_001007102chr661647 1507 1285 1193 653 388 --21330 336 11225
NM_001007156chr1531880 612 396 21968 606 ----
NM_001007226chr172578 298 ------
NM_001007227chr172578 298 ------
NM_001007228chr172578 298 ------
NM_001007229chr172578 298 ------
NM_001007230chr172578 298 ------
NM_001007237chr162623 1908 1860 811 615 530 22864 2151 ----
NM_001007246chr2151552 1437 1308 279 126 --11820 --
NM_001007257chr141184 1098 1047 498 11022 --11519
NM_001007277chr1131038 417 382 ------
NM_001007278chr13135230 5190 5181 5113 4621 4589 4207 3921 3702 3575 2117 894 357 44741 4341 4029 3882 24411 873 --
NM_001007466chr6124965 4711 4508 4497 4444 4014 3918 1800 1070 633 577 328 13321 14781 11693
NM_001007471chr91178 ------
NM_001007544chr1172 ------
NM_001007553chr131181 300 270 1190 1360 --
NM_001007559chr184773 684 398 355 --22044 1792 --
NM_001007565chr3----1113 --
NM_001007794chr1--1647 ----
NM_001008220chr521057 907 ------
NM_001008222chrX11191 --2873 150 --
NM_001008225chr7----2599 591 --
NM_001008239chr1883562 3082 2918 1442 887 716 490 110 13365 12387 --
NM_001008392chr353293 3081 2946 795 683 23136 729 --1218
NM_001008401chr1931509 1226 1070 --1996 --
NM_001008405chr71369 --11458 11500
NM_001008408chr7135189 4812 4477 4392 4161 4110 4026 2479 2029 1621 1454 666 410 45089 4373 1966 1263 ----
NM_001008491chr241949 1845 1535 39 1120 1185 --
NM_001008492chr241949 1845 1535 39 1120 1185 --
NM_001008495chr892194 2119 2039 2028 1991 1956 1601 803 162 11471 --1245
NM_001008540chr22398 60 ------
NM_001008541chr1022206 2169 32232 1697 1479 1890 --
NM_001008541chr1022206 2169 32232 1697 1479 1890 --
NM_001008564chr1321801 1727 --1545 12147
NM_001008566chr222385 53 1522 ----
NM_001008567chr92144 46 ----1255
NM_001008660chr1151593 1535 1437 1403 1046 --11397 --
NM_001008701chr1913013 ------
NM_001008738chr532139 247 71 22462 774 12106 --
NM_001008744chr142206 157 ------
NM_001008801chr1941944 1905 1855 1437 11975 22116 1363 --
NM_001008860chr153343 246 149 1221 1757 --
NM_001008892chr153343 246 149 1221 1757 --
NM_001008894chr153343 246 149 1221 1757 --
NM_001008895chr1351434 1108 1055 449 219 --1390 11080
NM_001008897chr6--1509 1136 1173
NM_001008925chr483565 3424 2535 2406 2299 1228 1095 548 12830 1215 --
NM_001009185chr52581 256 ------
NM_001009552chr81172 1611 ----
NM_001009554chr4114655 4536 4277 4171 3970 3458 3359 1433 1033 518 74 24124 130 --21483 751
NM_001009554chr4114655 4536 4277 4171 3970 3458 3359 1433 1033 518 74 24124 130 --21483 751
NM_001009555chr461367 1243 1087 543 443 360 31457 1307 369 ----
NM_001009567chr101653 ------
NM_001009571chr751687 1446 1292 1229 492 --2547 322 --
NM_001009880chr2274540 3556 3227 1957 1346 1293 518 --14046 --
NM_001009881chr11622 ------
NM_001009882chr11622 ------
NM_001009894chr121588 ------
NM_001009899chr3126069 6021 5872 5825 5709 5014 4805 4424 2613 2003 1760 1040 36479 4332 981 56548 4146 1503 766 215 15232
NM_001009909chr1163842 3150 1415 440 314 143 ----12884
NM_001009960chr772834 2404 2372 2229 1017 812 755 ------
NM_001009993chr253754 3008 2925 1794 1332 1547 14335 --
NM_001010000chr1851104 860 783 670 56 12632 23327 3106 13530
NM_001010844chr63189 53 26 ------
NM_001010853chr662853 1223 1042 699 317 192 --23141 893 --
NM_001010861chr13979 973 214 2527 298 --1992
NM_001010888chrX114011 4001 3910 3810 3523 3205 3189 3165 1749 1573 131 31727 1220 868 --199
NM_001010891chr576568 6556 6147 5611 4315 2284 1761 26706 2205 26100 188 35796 5015 2457
NM_001010895chr951856 1668 1529 727 135 12028 ----
NM_001010908chr102762 615 ------
NM_001010927chr63454 230 125 139 ----
NM_001010934chr731131 749 138 ------
NM_001010942chr1231163 339 175 1323 1519 --
NM_001010971chr11896 ------
NM_001010983chr32351 29 ------
NM_001010984chr182327 2073 2014 1700 973 914 650 485 ------
NM_001010986chrX52412 2377 910 349 135 ------
NM_001010989chr16--2514 421 ----
NM_001010990chr16--2514 421 ----
NM_001011513chr4144064 3835 3735 3484 3394 3061 3021 2700 2651 1642 1307 1051 205 194 13125 32990 1174 560 12924
NM_001011515chr451056 419 386 123 51 --11004 --
NM_001011516chr451056 419 386 123 51 --11004 --
NM_001011537chr342358 1927 1884 1726 11771 12305 --
NM_001011546chr201335 ------
NM_001011553chr76957 934 806 657 231 195 2777 280 ----
NM_001011663chr10195 1706 ----
NM_001011666chr7136558 6413 6322 4335 4178 2600 2272 2067 1505 653 623 221 128 26276 4818 21253 71 14684
NM_001011708chr262491 2165 1950 996 946 784 12903 12530 --
NM_001011713chr14--31622 1101 304 1157 --
NM_001011718chr202805 260 ------
NM_001011885chr1561301 1262 1139 735 391 159 11462 ----
NM_001012264chr142945 720 ------
NM_001012267chr931661 1507 1240 ------
NM_001012337chr3149 ------
NM_001012393chr1194263 4221 4118 4075 3239 1650 1622 1316 1255 --34756 4548 717 --
NM_001012398chr1611051 --2422 31 --
NM_001012420chr1572515 2013 890 611 579 503 211 22725 2664 ----
NM_001012423chr1572515 2013 890 611 579 503 211 22725 2664 ----
NM_001012478chr192647 632 ------
NM_001012514chr23970 889 449 --195 --
NM_001012516chr23970 889 449 --195 --
NM_001012642chr1552054 1936 1746 750 391 ------
NM_001012751chr1061734 1589 1582 541 244 231 --21521 1247 --
NM_001012754chr1362048 2042 1951 1854 1684 598 ----21605 865
NM_001012759chr161119 ------
NM_001012761chr532313 1677 603 12697 --1272
NM_001012762chr161150 ------
NM_001012968chrX52599 2274 2094 606 185 11929 22390 177 --
NM_001012977chrX31346 1301 446 1884 1312 --
NM_001012979chrX170 ------
NM_001012989chrX2629 70 ------
NM_001013031chr1043545 3508 2971 463 12170 22341 1175 --
NM_001013399chr621086 1008 --1722 --
NM_001013406chr751119 449 385 83 35 11086 21512 124 --
NM_001013415chr42475 239 ------
NM_001013437chr18180 1411 ----
NM_001013438chr31327 --1261 --
NM_001013439chr31173 --1107 --
NM_001013615chr121226 1013 11036 ----
NM_001013659chr1994891 4568 3557 2161 1693 1551 1134 793 68 21036 378 24271 4132 --
NM_001013691chr191722 1551 ----
NM_001013699chr125549 512 104 98 49 --125 --
NM_001013843chr15----2747 377 --
NM_001014431chr142774 98 --1657 --
NM_001014432chr142774 98 --1657 --
NM_001014434chr12818 764 1587 ----
NM_001014797chr10108224 7939 6737 5595 5517 5146 2549 2417 1893 1302 31369 1114 989 35444 3183 2633 1376
NM_001014809chr42896 661 --1994 --
NM_001014831chr19--1657 ----
NM_001014832chr19--1657 ----
NM_001014834chr19--1657 ----
NM_001014835chr19--1657 ----
NM_001015045chr431558 969 802 --1207 11827
NM_001015048chr1453202 2376 2220 554 38 22783 2209 1581 --
NM_001015049chr1453202 2376 2220 554 38 22783 2209 1581 --
NM_001015053chr1721260 245 ------
NM_001015508chr82302 91 ------
NM_001015877chrX112826 2746 2666 2613 2542 2218 1169 1117 1019 927 333 ----12007
NM_001015887chr381839 1828 1758 1725 1561 1506 1253 282 21685 1320 --11230
NM_001017369chr421017 916 1168 11092 --
NM_001017371chr241069 1053 510 151 --1210 --
NM_001017395chr383193 2949 2657 2588 2363 1364 576 219 --23649 715 12921
NM_001017396chr22785 486 --1415 1300
NM_001017405chr41179 --1244 --
NM_001017415chr13511 268 184 ------
NM_001017416chr13511 268 184 ------
NM_001017420chr841413 1370 1100 938 31352 1256 1125 ----
NM_001017424chr131610 1225 208 --31781 175 80 --
NM_001017425chr131610 1225 208 --31781 175 80 --
NM_001017440chr7127984 7098 6342 6270 5740 5697 2312 2144 1275 1199 672 167 --33173 1434 711 --
NM_001017923chr1441688 1108 610 323 11129 --11571
NM_001017926chr831338 1134 264 --11148 --
NM_001017962chr102609 160 ------
NM_001017977chr1123 ------
NM_001017979chr42559 204 1115 ----
NM_001017992chr551422 1365 412 75 31 31512 1042 984 ----
NM_001017995chr584347 3362 1729 1579 1436 898 784 778 44798 4439 3423 3171 2906 712 --
NM_001018004chr153738 225 90 ------
NM_001018006chr153738 225 90 ------
NM_001018007chr153738 225 90 ------
NM_001018009chr321193 1052 1404 ----
NM_001018020chr153738 225 90 ------
NM_001018037chr951323 1010 570 397 391 ------
NM_001018053chr161898 1852 1246 384 369 303 --21620 696 --
NM_001018054chr12399 229 11275 ----
NM_001018056chr93576 166 146 --1392 --
NM_001018057chr1131328 1035 152 --1575 --
NM_001018064chr91163 ------
NM_001018065chr9185733 5585 5293 5164 4842 4773 4742 4638 4569 4355 4283 3704 2326 1554 1371 1319 1184 715 24462 224 11384 11499
NM_001018066chr9185733 5585 5293 5164 4842 4773 4742 4638 4569 4355 4283 3704 2326 1554 1371 1319 1184 715 24462 224 11384 11499
NM_001018067chr1115167 2073 1571 1435 1119 735 719 635 554 301 274 34323 1618 760 ----
NM_001018068chr1115167 2073 1571 1435 1119 735 719 635 554 301 274 34323 1618 760 ----
NM_001018069chr1115167 2073 1571 1435 1119 735 719 635 554 301 274 34323 1618 760 ----
NM_001018074chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_001018075chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_001018076chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_001018077chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_001018089chr1553497 3475 1247 446 100 ------
NM_001018100chr152809 21 1700 ----
NM_001020658chr11527 1456 11446 --
NM_001020658chr11527 1456 11446 --
NM_001020825chr53410 395 68 ------
NM_001023567chr1572464 1768 1760 1582 893 582 506 32112 2046 912 1219 --
NM_001023587chr341158 953 792 167 --11142 --
NM_001024094chr582935 2920 2593 1160 702 563 353 198 13357 1431 --
NM_001024218chr141810 ------
NM_001024226chr13988 822 374 --1409 --
NM_001024227chr13988 822 374 --1409 --
NM_001024228chr13988 822 374 --1409 --
NM_001024372chr852268 2212 2089 1799 1488 1547 1452 --
NM_001024380chr831981 1615 125 11650 11752 12344
NM_001024381chr831981 1615 125 11650 11752 12344
NM_001024649chr582886 2228 2202 1919 1865 1099 745 737 12677 22867 928 --
NM_001024660chr311339 --11242 1644
NM_001024680chr221276 92 3670 464 359 11591 1166
NM_001024808chr1262599 1960 1820 817 409 368 ------
NM_001024847chr382429 999 917 809 608 573 473 224 11933 --1275
NM_001024916chr92312 72 3396 108 85 ----
NM_001024937chr171487 ----1501
NM_001024948chr173351 2643 789 728 514 508 172 22383 772 22553 955 21211 183
NM_001024956chr11145562 5484 5019 4954 4577 4040 3807 3677 3549 2281 1928 979 862 339 34348 1294 641 24811 1423 --
NM_001025068chr361597 1483 540 265 246 183 1667 1720 --
NM_001025069chr361597 1483 540 265 246 183 1667 1720 --
NM_001025076chr10186021 5531 5405 4402 4178 3940 2382 2116 1674 1657 1648 1568 1334 1104 997 608 578 529 2565 33 12470 --
NM_001025077chr10247379 6889 6763 5760 5536 5298 5050 4798 4722 4611 3032 3015 3006 2926 2692 2462 2355 1966 1936 1887 856 529 300 200 35112 1923 33 14807 --
NM_001025079chr373782 3602 3523 3370 2791 1469 862 13984 33913 1226 677 12610
NM_001025100chr1853648 2804 1555 1300 1245 --23080 1396 13325
NM_001025105chr551375 1255 1240 1085 50 --1255 --
NM_001025108chr283925 1653 1558 921 873 495 354 94 11302 13382 --
NM_001025201chr22738 189 2584 495 2629 541 --
NM_001025205chr31423 ------
NM_001025252chr873159 3082 2963 2745 2041 1108 1047 ------
NM_001025253chr873159 3082 2963 2745 2041 1108 1047 ------
NM_001025356chr1263029 2669 2158 883 678 92 12815 --53016 2988 2946 796 27
NM_001025366chr611232 1268 21896 183 --
NM_001025366chr611232 1268 21896 183 --
NM_001025367chr611232 1268 21896 183 --
NM_001025367chr611232 1268 21896 183 --
NM_001025368chr611232 1268 21896 183 --
NM_001025368chr611232 1268 21896 183 --
NM_001025369chr611248 1284 21912 199 --
NM_001025369chr611248 1284 21912 199 --
NM_001025370chr611232 1268 21896 183 --
NM_001025370chr611232 1268 21896 183 --
NM_001025389chr1141289 464 353 234 21642 154 21141 1060 124
NM_001025390chr1141289 464 353 234 21642 154 21141 1060 124
NM_001025579chr171993 --1328 --
NM_001025580chrX73943 3880 3857 3002 1273 562 182 51490 1126 825 747 100 23047 2609 14172
NM_001025595chr441405 1307 1046 437 1152 ----
NM_001025603chr131311 532 71 11539 ----
NM_001025616chr441203 1177 505 357 ------
NM_001029858chr663330 2977 2301 1092 425 407 2652 442 22257 1133 --
NM_001029860chr82325 294 1281 --1261
NM_001029863chr683212 2810 2783 2675 1006 786 244 82 23074 2765 1483 --
NM_001029875chr572803 2735 2674 1941 998 811 125 2961 915 12994 --
NM_001029882chr11239 ------
NM_001029882chr11239 ------
NM_001029883chr212070 ------
NM_001029884chr682646 2217 2153 865 619 567 453 129 2533 405 22211 950 22580 926
NM_001029989chr152312 83 ------
NM_001029998chr441302 535 411 77 --1911 --
NM_001030chr1150 ------
NM_001030006chr1731642 908 416 --11808 1402
NM_001030007chr1693782 3400 3092 2703 2697 2678 365 253 222 13517 33655 2620 473 11198
NM_001030055chr14124668 4610 4258 4025 3835 3673 1507 1234 1160 1057 883 121 --14301 14186
NM_001030287chr12864 434 151 ----
NM_001031665chr191390 ------
NM_001031677chr51402 ------
NM_001031679chr1253497 3317 2862 513 33 --1710 --
NM_001031681chr1742328 2246 597 155 --22176 30 --
NM_001031684chr231459 1279 1172 11272 ----
NM_001031695chr22144840 4676 4620 4392 3930 3522 2031 1559 1327 1190 1047 594 284 150 --21184 235 --
NM_001031700chr492486 2349 1989 1895 1792 1648 914 840 791 1807 21971 45 --
NM_001031711chr531523 1368 525 --11697 --
NM_001031716chr21217 --165 --
NM_001031723chr43457 347 309 ------
NM_001031732chr443630 1017 532 222 21112 902 --11425
NM_001031740chr12617 313 --11447 --
NM_001031743chr62170 56 ------
NM_001031804chr1694300 4277 3510 2729 1318 1082 906 527 474 --24000 3858 --
NM_001031812chr592123 1850 1543 1523 724 674 296 141 128 22157 811 32248 1605 1564 --
NM_001032221chr911811 ------
NM_001032279chr111268 --1397 --
NM_001032280chr631545 526 429 11372 ----
NM_001032282chr811073 1320 --11315
NM_001032283chr122285 205 --11020 --
NM_001032284chr122285 205 --11020 --
NM_001032288chr2021072 63 ------
NM_001032293chr171442 ------
NM_001032296chr1382834 2294 2219 1831 1120 589 450 245 1228 12791 --
NM_001032363chr121784 144 --12040 --
NM_001032363chr121784 144 --12040 --
NM_001032380chr1061578 1547 1355 145 136 58 1399 ----
NM_001032393chrX1609 1660 ----
NM_001032394chr672730 2717 1785 935 625 596 523 32824 2224 487 ----
NM_001032395chr672597 2584 1652 802 492 463 390 32691 2091 354 ----
NM_001032730chr1--2689 625 1134 --
NM_001032999chr2044211 1272 1232 171 25254 688 11967 --
NM_001033045chr244043 3774 1461 1386 44402 3403 2952 1781 44261 3093 1227 382 --
NM_001033047chr442517 2440 1857 1618 2941 531 ----
NM_001033049chr2142194 434 352 247 11529 11973 --
NM_001033057chr351819 704 361 224 141 1134 11408 --
NM_001033059chr64629 591 462 149 ------
NM_001033081chr1187 1554 ----
NM_001033082chr1187 1554 ----
NM_001033085chr2195 ------
NM_001033087chr2043189 2873 2290 855 12106 1148 --
NM_001033117chr331890 1677 1060 21472 1162 34549 3226 1267 --
NM_001033503chr5----1363 --
NM_001033506chr11----1413 --
NM_001033518chr782511 2279 1865 1774 536 337 289 179 ------
NM_001033519chr782511 2279 1865 1774 536 337 289 179 ------
NM_001033520chr782511 2279 1865 1774 536 337 289 179 ------
NM_001033561chr172667 196 ------
NM_001033566chr17140 1109 ----
NM_001033568chr17140 1109 ----
NM_001033578chr842067 1980 171 105 12005 31784 1511 631 --
NM_001033581chr11295 ------
NM_001033581chr11295 ------
NM_001033582chr11295 ------
NM_001033602chr1352522 2217 492 404 174 ------
NM_001033659chr1741367 1302 1037 79 11559 1490 --
NM_001033723chr84943 454 431 379 1331 42567 2495 1942 1104 --
NM_001033756chr611166 1202 21830 117 --
NM_001033756chr611166 1202 21830 117 --
NM_001033925chr1051743 705 522 325 301 ------
NM_001034837chr52637 123 ------
NM_001034838chr52637 123 ------
NM_001034841chr1664816 4709 4362 3787 1564 702 --25490 2153 1680
NM_001034845chr421195 297 ------
NM_001034850chr511076 41565 1360 1315 114 11228 --
NM_001034852chr1411915 1175 1133 --
NM_001035chr181258 1187 1178 1091 825 424 182 84 ------
NM_001035003chr441427 1039 410 75 1482 1575 --
NM_001035004chr441427 1039 410 75 1482 1575 --
NM_001035260chr1061309 1264 656 344 277 234 11341 11402 --
NM_001035511chr151853 1808 1515 1474 738 42118 1776 1454 647 ----
NM_001035512chr151960 1915 1622 1581 845 42225 1883 1561 754 ----
NM_001035513chr151960 1915 1622 1581 845 42225 1883 1561 754 ----
NM_001035521chr21522 ------
NM_001037132chr792027 1899 1879 748 740 680 371 199 55 11987 ----
NM_001037133chr792027 1899 1879 748 740 680 371 199 55 11987 ----
NM_001037164chr731666 691 544 --31907 1403 786 --
NM_001037165chr788937 8852 8763 7287 6982 1658 1607 1246 --37828 6520 2910 --
NM_001037172chr341390 1154 1143 381 --11082 1231
NM_001037174chr252185 2177 599 298 230 22253 593 11776 --
NM_001037317chr13979 973 214 2527 298 --1992
NM_001037334chr1851778 1771 447 311 229 11652 ----
NM_001037339chr141792 1304 582 420 31785 622 569 1702 --
NM_001037340chr141792 1304 582 420 31785 622 569 1702 --
NM_001037341chr141792 1304 582 420 31785 622 569 1702 --
NM_001037341chr141792 1304 582 420 31785 622 569 1702 --
NM_001037535chrX41138 1025 249 73 ----11388
NM_001037536chrX41138 1025 249 73 ----11388
NM_001037540chrX41138 1025 249 73 ----11388
NM_001037553chr2154463 3965 3899 1369 627 --14906 --
NM_001037582chr4----11603 11320
NM_001037954chr1163206 3093 3049 963 928 180 13034 12696 --
NM_001038493chr211421 --1967 --
NM_001038603chr53401 338 262 ------
NM_001038640chr152960 682 1979 1287 --
NM_001038707chr122336 1978 --11690 --
NM_001038707chr122336 1978 --11690 --
NM_001039199chr20114939 3957 3782 3499 1864 1698 889 842 361 350 152 33977 3315 175 44981 3341 1294 598 11708
NM_001039348chr241059 918 159 29 ------
NM_001039349chr241059 918 159 29 ------
NM_001039372chr71152 152 ----
NM_001039395chr972460 2332 2287 2272 2247 205 85 --1949 --
NM_001039479chr1452259 1823 639 436 202 11904 21924 625 --
NM_001039538chr253610 1402 1302 1157 609 --2664 291 --
NM_001039547chr3128086 7712 7161 6812 6403 3178 2488 2357 2051 1461 1422 273 26199 1232 47411 6671 5514 2092 13221
NM_001039569chr26937 904 491 407 344 223 22825 2171 32925 1303 1167 --
NM_001039570chr2244672 3918 3107 211 --24641 1388 --
NM_001039571chr2244672 3918 3107 211 --24641 1388 --
NM_001039574chr11816 --1656 --
NM_001039577chr143463 1569 1523 450 11204 132 --
NM_001039585chr153975 2858 1361 439 39 23121 3042 12944 --
NM_001039590chrX73962 3470 2639 2496 1513 1077 625 23886 2836 13833 --
NM_001039591chrX73962 3470 2639 2496 1513 1077 625 23886 2836 13833 --
NM_001039618chr11135974 5671 5648 5447 4877 4456 4127 3911 2308 2240 2187 1975 1700 54314 4179 2344 844 341 14531 --
NM_001039690chr1611581 ------
NM_001039693chr253739 3336 3262 1332 531 22821 35 12504 11314
NM_001039709chr2044211 1272 1232 171 25254 688 11967 --
NM_001039711chr13777 326 21 --1967 --
NM_001039712chr13777 326 21 --1967 --
NM_001039762chr105787 679 450 437 64 ------
NM_001039840chrX165917 5584 5204 5053 4796 4416 4409 4103 3924 2358 2197 1962 1663 943 872 360 24453 3686 1505 --
NM_001039885chr19--11541 ----
NM_001039888chr13690 536 320 ------
NM_001039916chr12----11053 --
NM_001039917chr12----11053 --
NM_001039918chr12----11053 --
NM_001039919chr12----11053 --
NM_001039920chr12----11053 --
NM_001039937chr13154055 3686 3559 3050 2721 2578 2569 1598 1471 1392 1091 371 218 173 85 31381 795 152 33987 3976 495 --
NM_001039938chr1341489 1180 172 35 --11161 --
NM_001039960chr1221726 307 11463 ----
NM_001040001chr671714 1686 1449 1405 1359 1307 22 1180 ----
NM_001040020chr731431 1227 638 2475 383 135 --
NM_001040057chr741353 1340 461 284 11347 ----
NM_001040097chr72183 160 ------
NM_001040098chr72183 160 ------
NM_001040099chr72183 160 ------
NM_001040101chr43435 222 190 190 1331 --
NM_001040108chr1431210 1147 848 22085 2027 --1764
NM_001040110chr7----1162 --
NM_001040113chr162971 251 ------
NM_001040142chr272484 2214 2065 1680 903 420 25 22403 1568 11665 --
NM_001040143chr272484 2214 2065 1680 903 420 25 22403 1568 11665 --
NM_001040144chr1611581 ------
NM_001040146chr1611581 ------
NM_001040152chr784739 4481 3367 3352 3147 1436 1389 1346 --13870 14638
NM_001040153chr134759 700 274 169 1808 --1868
NM_001040157chr452624 2093 1059 951 207 1665 ----
NM_001040158chr52475 104 ------
NM_001040159chr441272 1256 1181 443 21210 601 11486 --
NM_001040179chr62811 107 1879 1954 1865
NM_001040181chr331023 421 33 2190 110 ----
NM_001040182chr331023 421 33 2190 110 ----
NM_001040183chr331023 421 33 2190 110 ----
NM_001040199chr331023 421 33 2190 110 ----
NM_001040200chr331023 421 33 2190 110 ----
NM_001040202chr472493 2154 2058 1810 1730 657 521 32399 751 297 ----
NM_001040214chr632324 1826 70 11579 --12388
NM_001040272chr911566 187 12338 --
NM_001040273chr1021999 818 ------
NM_001040284chr1665890 5502 5053 4613 4393 561 55311 4651 1894 492 267 24883 820 14413
NM_001040402chr482493 2444 2210 1974 1137 915 411 353 32814 2010 389 ----
NM_001040409chr23878 330 285 4758 682 647 368 ----
NM_001040429chr1333117 2869 696 184 131 1776
NM_001040437chr6------191
NM_001040438chr6------191
NM_001040440chr51491 --1448 --
NM_001040441chr165371 3318 1553 1395 814 255 45070 3434 347 276 35042 4489 1668 14889
NM_001040446chr572506 987 903 621 515 496 343 ------
NM_001040450chr1542519 1068 940 251 1577 12681 --
NM_001040453chr1542519 1068 940 251 1577 12681 --
NM_001040455chr1111331 --1360 --
NM_001040458chr541838 123 104 48 1278 ----
NM_001040619chr121314 329 1501 191 --
NM_001040624chr822035 1005 ------
NM_001040625chr822035 1005 ------
NM_001040626chr822035 1005 ------
NM_001040627chr822035 1005 ------
NM_001040628chr822035 1005 ------
NM_001040629chr822035 1005 ------
NM_001040630chr822035 1005 ------
NM_001040653chr361984 1723 872 827 493 312 1528 12360 --
NM_001040665chr784800 4604 3995 3409 3367 701 445 382 21016 267 11627 21510 951
NM_001040697chr111104 1616 --1561
NM_001040708chr861071 781 301 269 157 112 ------
NM_001040709chr142578 2382 1880 938 1800 1774 --
NM_001040712chr941402 719 623 79 1456 23006 2200 --
NM_001040876chr471903 1628 1450 732 370 342 187 ------
NM_001042355chr16135419 5202 5194 5183 3899 3842 1995 1902 1423 1356 1315 660 395 24981 4181 44963 4847 1329 191 13960
NM_001042361chr1051480 992 601 524 263 --2512 467 --
NM_001042364chr1051480 992 601 524 263 --2512 467 --
NM_001042365chr1051480 992 601 524 263 --2512 467 --
NM_001042371chr1622050 706 --1207 --
NM_001042383chr363449 2951 905 734 226 152 12839 1165 --
NM_001042387chr1051480 992 601 524 263 --2512 467 --
NM_001042388chr181898 --1307 --
NM_001042393chr1051480 992 601 524 263 --2512 467 --
NM_001042396chr1051480 992 601 524 263 --2512 467 --
NM_001042397chr1051480 992 601 524 263 --2512 467 --
NM_001042399chr12287 78 165 ----
NM_001042403chr124385 181 81 46 4809 317 119 70 ----
NM_001042404chr141996 1983 788 755 --1778 --
NM_001042406chr62898 827 ------
NM_001042412chr16135419 5202 5194 5183 3899 3842 1995 1902 1423 1356 1315 660 395 24981 4181 44963 4847 1329 191 13960
NM_001042413chr993769 3645 3229 2724 2602 1449 1317 1281 728 13279 33469 3304 3291 1623
NM_001042414chr133295 202 60 ------
NM_001042424chr453218 3155 2222 689 533 33278 2276 1290 22156 716 --
NM_001042425chr631545 526 429 11372 ----
NM_001042437chr24739 207 159 92 ------
NM_001042453chrX2603 306 1168 ----
NM_001042459chr32263 233 2312 278 1103 --
NM_001042473chr1031658 778 531 1182 12046 --
NM_001042475chr6196 ------
NM_001042479chrX11942 21856 1741 1676 --
NM_001042480chrX11942 21856 1741 1676 --
NM_001042481chr1462686 2451 2366 2062 959 346 21868 1803 1744 2259 168
NM_001042492chr1783472 3453 2459 1191 582 430 212 102 ------
NM_001042493chr641911 1643 1541 1520 21370 564 ----
NM_001042506chrX21312 446 --1312 --
NM_001042510chr81132 21905 1487 1305 --
NM_001042511chr81132 21905 1487 1305 --
NM_001042533chr343306 3289 3124 2794 12850 21214 746 --
NM_001042537chrX52336 2251 752 533 234 21973 1861 --1910
NM_001042543chr431540 1010 340 ------
NM_001042548chr22881 631 --1852 1700
NM_001042555chr12114770 4530 4481 4193 3558 3187 1772 1157 1067 819 70 23704 730 24060 972 24042 1222
NM_001042599chr2227570 7381 7248 6462 6285 6141 5603 5283 5240 2726 2574 1633 1186 1127 1087 991 886 876 655 638 491 312 56977 2904 2074 1570 794 26786 6621 --
NM_001042601chr353240 3211 3143 3122 2303 11259 2602 352 --
NM_001042603chr12155369 4703 4446 3730 3665 3523 3465 3407 2000 1970 1399 1149 1119 479 456 1772 ----
NM_001042604chr3104662 4506 4169 4104 3709 3657 3404 3341 1240 131 33160 1727 877 33275 383 149 1190
NM_001042632chr2012167 --11651 --
NM_001042633chr2012167 --11651 --
NM_001042663chr141223 1043 943 486 --21061 155 --
NM_001042664chr141223 1043 943 486 --21061 155 --
NM_001042665chr141223 1043 943 486 --21061 155 --
NM_001042669chr441203 1177 505 357 ------
NM_001042681chr142171 1867 914 881 ------
NM_001042682chr142171 1867 914 881 ------
NM_001042682chr142171 1867 914 881 ------
NM_001042683chr62487 157 --21296 299 --
NM_001042724chr191842 1718 ----
NM_001042749chrX61736 1287 1271 633 327 37 ------
NM_001042750chrX61736 1287 1271 633 327 37 ------
NM_001042751chrX61736 1287 1271 633 327 37 ------
NM_001042762chr751061 913 794 710 114 --11125 --
NM_001042784chr4----181 --
NM_001043318chr14104125 3765 3720 3621 2581 1640 1321 881 869 673 --11467 --
NM_001043351chr142090 1850 381 285 ------
NM_001044305chr611139 1195 11365 --
NM_001044385chr294001 3788 3746 3683 3019 2675 2513 404 48 11511 --13161
NM_001044722chr592123 1850 1543 1523 724 674 296 141 128 22157 811 32248 1605 1564 --
NM_001044723chr592123 1850 1543 1523 724 674 296 141 128 22157 811 32248 1605 1564 --
NM_001045478chr1140 --1988 --
NM_001046chr542680 2535 2487 38 1436 12023 --
NM_001048183chr173704 3564 1201 1110 198 150 83 11510 31104 761 137 --
NM_001068chr3124 ------
NM_001071775chr1371948 1834 1677 1516 643 214 119 --11412 --
NM_001076chr4------1166
NM_001076chr4------1166
NM_001077628chr12653 233 ------
NM_001079874chr182123 2066 1987 1900 774 548 365 104 ------
NM_001083620chr452484 1947 1854 1666 843 12333 12412 11886
NM_001083621chr121580 1164 --24288 4072 --
NM_001094chr172827 816 1762 ----
NM_001099678chr3126251 6231 6104 5833 5536 4586 4458 2583 1070 887 845 139 26056 1179 24770 1195 24344 1321
NM_001100108chr147478 6767 3348 1338 27339 3012 47868 6087 5447 1953 13241
NM_001106chr3179534 9220 8570 8484 7826 7588 7455 7327 7161 6602 3299 2546 1692 1619 1005 891 337 57070 7018 6791 5910 1743 27759 3214 --
NM_001109977chr41768 2679 98 ----
NM_001112808chr11380 193 ----
NM_001113490chrX93644 3127 2259 2232 1023 878 704 340 52 --11077 12717
NM_001117chr1832320 827 197 ----22286 2147
NM_001121chr10--1177 ----
NM_001122679chr52969 141 ------
NM_001123chr104834 287 277 98 ------
NM_001124chr11------1540
NM_001128chr1693782 3400 3092 2703 2697 2678 365 253 222 13517 33655 2620 473 11198
NM_001140chr17--1161 ----
NM_001144chr1621127 178 ------
NM_001148chr491977 1758 1675 1583 1441 1433 721 396 135 --21851 306 11537
NM_001149chr101220 21068 180 11284 --
NM_001153chr211942 918 838 593 373 282 275 200 194 61 40 ------
NM_001156chr103591 505 473 ----1427
NM_001159chr21203 ------
NM_001160chr1232652 1810 520 12808 12664 --
NM_001163chr92985 109 ------
NM_001167chrX156460 6406 6356 4622 2682 2477 883 847 838 831 571 536 511 202 101 44931 4732 1811 1234 26540 1758 --
NM_001169chr162412 82 ------
NM_001172chr142624 253 ------
NM_001173chr14124668 4610 4258 4025 3835 3673 1507 1234 1160 1057 883 121 --14301 14186
NM_001174chrX32053 635 389 ----12128
NM_001177chr1241971 1686 485 72 21550 578 --22378 588
NM_001186chr2182145 2069 1261 1109 975 952 890 699 22250 1178 1770 --
NM_001187chr21--1524 2128 117 --
NM_001198chr652347 2143 1957 1779 1595 11829 ----
NM_001199chr81209 ------
NM_001200chr2021160 331 2257 99 ----
NM_001201chr463937 3788 3385 3068 1394 858 22409 1353 21080 103 --
NM_001204chr2227575 7379 6658 6075 5948 5811 5798 5643 5565 5541 4798 4776 2501 2329 2100 1632 1610 1600 954 678 615 593 46254 6099 3023 897 34859 1529 212 12143
NM_001206chr942652 2583 2295 1968 --2796 776 --
NM_001219chr742042 1902 812 230 11521 ----
NM_001222chr1021881 1461 ------
NM_001233chr762247 2052 1968 872 776 414 2614 287 1672 --
NM_001235chr112704 672 ------
NM_001237chr43937 409 141 ------
NM_001237chr43937 409 141 ------
NM_001238chr191506 ------
NM_001241chr282403 2368 2358 1963 1804 935 590 132 --1714 --
NM_001241chr282403 2368 2358 1963 1804 935 590 132 --1714 --
NM_001254chr1731081 1052 43 166 --1824
NM_001256chr1772805 2600 2413 2253 2170 2121 134 ------
NM_001257chr1661391 1367 542 285 173 164 ------
NM_001259chr7175781 5347 5271 5148 5087 4776 4574 4299 2235 2082 1415 1401 1328 1134 612 543 480 --65048 4588 4497 4180 1079 394 --
NM_001260chr131336 --1281 --
NM_001261chr9177 ------
NM_001269chr11956 ------
NM_001270chr53980 936 729 11081 1220 --
NM_001271chr1572822 2453 2190 1102 256 245 142 --33286 3249 203 --
NM_001280chr193246 235 109 ------
NM_001282chr1731642 908 416 --11808 1402
NM_001283chr73705 540 186 ------
NM_001288chr6135 ------
NM_001290chr41733 ------
NM_001299chr19----1481 --
NM_001304chr1763427 2997 2563 2335 571 238 1677 22638 462 11305
NM_001310chr1262332 2286 2277 902 799 77 11939 ----
NM_001313chr42896 661 --1994 --
NM_001315chr62893 377 11397 11661 --
NM_001319chr1921059 717 ------
NM_001326chr112366 80 ----1357
NM_001331chr1132327 1753 222 12435 139 --
NM_001338chr213489 383 374 11101 1290 --
NM_001343chr531241 551 173 --11696 11578
NM_001346chr342550 2084 647 228 ------
NM_001356chrX82289 1897 1808 1771 1641 1569 1544 268 ------
NM_001364chr1173786 3753 3653 3095 421 97 39 54799 4792 4060 3435 1555 21181 1022 --
NM_001365chr171575 ------
NM_001378chr21194 ------
NM_001385chr82392 321 2428 265 ----
NM_001386chr831926 1795 752 --22340 1873 --
NM_001389chr21----1582 --
NM_001390chr1853398 3331 2691 1109 536 --13325 1408
NM_001391chr1811093 31206 430 241 1152 --
NM_001396chr2152310 1825 1115 1011 889 21796 247 ----
NM_001399chrX33845 3380 721 1743 ----
NM_001400chr121334 418 51138 1050 507 500 389 21008 928 --
NM_001401chr951335 1089 1016 495 117 ------
NM_001407chr331183 1150 1065 ------
NM_001408chr11325 --1222 --
NM_001412chrX43311 3087 1316 200 12694 ----
NM_001416chr173445 130 106 1162 ----
NM_001418chr11160 ------
NM_001418chr11160 ------
NM_001419chr19124610 4536 4221 3206 1334 1177 1170 1109 1017 943 851 83 24708 4229 ----
NM_001420chr19----23168 2087 --
NM_001421chrX51266 660 414 404 92 --152 --
NM_001422chr1121165 85 2473 27 ----
NM_001423chr1231915 1859 1548 --1208 --
NM_001427chr741456 450 393 323 11490 12084 11982
NM_001429chr222970 402 1422 ----
NM_001430chr21668 2388 176 21506 767 11847
NM_001431chr641130 331 298 199 ------
NM_001432chr483675 3393 2756 2655 1354 1229 738 125 22898 66 13654 --
NM_001438chr163685 3202 2781 2357 1073 191 13329 ----
NM_001444chr8--1133 ----
NM_001447chr531439 401 234 --1891 --
NM_001448chrX41496 657 269 59 ------
NM_001449chrX3183 62 35 1139 ----
NM_001451chr1631204 969 426 --1929 --
NM_001452chr64681 670 636 458 ------
NM_001453chr641469 1438 461 224 11776 ----
NM_001457chr32979 363 168 ----
NM_001463chr22643 332 ------
NM_001489chr91108 --1255 --
NM_001493chrX1603 ------
NM_001497chr922418 90 --1908 --
NM_001498chr63980 425 260 --11287 --
NM_001511chr41696 1580 ----
NM_001521chr21522 ------
NM_001527chr684776 4741 4717 3367 1282 782 338 100 31038 896 91 33073 1450 1348 --
NM_001530chr142753 208 2417 256 1964 --
NM_001533chr192227 63 ------
NM_001539chr9133 ------
NM_001542chr162623 1908 1860 811 615 530 22864 2151 ----
NM_001546chr621233 360 11118 ----
NM_001554chr12252 214 ------
NM_001564chr4----1143 --
NM_001584chr1131146 1037 52 ------
NM_001587chrX4570 562 478 181 --2735 420 --
NM_001604chr115855 769 273 247 223 ------
NM_001608chr22960 701 2794 727 ----
NM_001609chr1064074 3733 3632 1498 432 204 54000 3903 2972 965 941 --21131 737
NM_001610chr111613 ------
NM_001614chr172550 26 ------
NM_001614chr172550 26 ------
NM_001616chr283406 3164 3148 3127 2973 2500 759 439 33350 990 570 ----
NM_001620chr112663 327 ----1771
NM_001621chr792522 2286 2009 1909 883 714 672 557 371 ------
NM_001621chr792522 2286 2009 1909 883 714 672 557 371 ------
NM_001624chr631437 506 231 4625 468 401 321 ----
NM_001634chr64629 591 462 149 ------
NM_001635chr72263 74 ------
NM_001642chr111888 11350 ----
NM_001655chr1152124 2094 1496 1419 384 --11745 --
NM_001656chr532083 1774 451 2591 521 2626 154 --
NM_001658chr13988 822 374 --1409 --
NM_001660chr31800 ------
NM_001661chr172726 565 --1622 --
NM_001663chr1492717 2255 1765 1047 990 854 826 378 91 21971 1864 --12089
NM_001664chr33854 740 717 1335 ----
NM_001665chr111507 ------
NM_001668chr12923 744 --1654 --
NM_001674chr12864 434 151 ----
NM_001676chr13------1170
NM_001677chr17885 820 810 771 367 247 141 1403 ----
NM_001678chr1721168 492 ----11594
NM_001679chr3152 --1667 --
NM_001681chr123641 526 136 ------
NM_001682chr1242497 2264 1885 470 --22632 1087 --
NM_001683chr351833 1783 640 344 56 --11669 --
NM_001684chr163503 2624 1356 489 270 46 --23997 2954 --
NM_001690chr3----32487 465 413 --
NM_001693chr831185 1008 887 ------
NM_001695chr884274 3847 3808 3470 3365 2618 892 158 13958 179 --
NM_001701chr951586 1267 1103 471 104 2426 220 11464 11615
NM_001704chr62486 386 1394 ----
NM_001706chr3--2276 71 ----
NM_001709chr1111915 1408 ----
NM_001714chr122573 189 ----1430
NM_001718chr621236 1091 ------
NM_001721chrX1246 164 153 --
NM_001726chr11151 ------
NM_001729chr42361 124 ------
NM_001730chr13--1188 ----
NM_001730chr13--1188 ----
NM_001731chr121754 1234 1953 --
NM_001735chr92140 35 1121 ----
NM_001737chr51200 ------
NM_001742chr72584 65 ------
NM_001743chr22486 398 ------
NM_001744chr5--1445 149 141
NM_001746chr582886 2228 2202 1919 1865 1099 745 737 12677 22867 928 --
NM_001748chr14294 284 277 77 11066 ----
NM_001752chr113599 526 131 ------
NM_001753chr771642 1599 1565 1551 1175 678 137 41528 715 391 264 ----
NM_001754chr2183740 3694 3652 2850 857 826 729 532 ------
NM_001755chr16102300 1937 1902 1831 1588 1564 1543 450 428 232 31868 481 354 --1551
NM_001759chr1284716 3995 2038 1786 1650 1401 882 190 --21331 974 --
NM_001777chr373782 3602 3523 3370 2791 1469 862 13984 33913 1226 677 12610
NM_001788chr76957 934 806 657 231 195 2777 280 ----
NM_001792chr182396 381 ------
NM_001797chr162642 570 ------
NM_001798chr124858 841 782 210 --11054 --
NM_001799chr5--123 ----
NM_001801chr51427 131 ----
NM_001822chr22738 189 2584 495 2629 541 --
NM_001826chr11101 1415 ----
NM_001827chr92277 249 ------
NM_001830chrX83471 2777 2600 1144 921 868 812 486 23619 3077 --1189
NM_001839chr13726 653 537 --2305 116 --
NM_001844chr12----157 --
NM_001854chr121100 62 11242 ----
NM_001858chr6104997 4887 4428 4192 3867 3755 3653 3157 497 341 21667 574 33507 1751 182 --
NM_001859chr9103873 3595 3496 3184 2978 2444 1307 1271 1079 988 --1545 --
NM_001873chr41209 --1513 --
NM_001875chr231055 285 120 2404 358 ----
NM_001884chr51132 ------
NM_001885chr11----124 --
NM_001890chr41266 1370 ----
NM_001892chr551375 1255 1240 1085 50 --1255 --
NM_001893chr171383 ------
NM_001894chr2211141 --11200 --
NM_001895chr2031197 865 345 2981 399 ----
NM_001901chr64986 975 901 63 ------
NM_001904chr32145 51 ------
NM_001923chr112479 195 ------
NM_001935chr221031 45 1935 ----
NM_001938chr161890 1746 1628 683 356 350 ------
NM_001939chrX83871 3290 3076 2811 2483 1101 1030 611 23503 3231 1764 --
NM_001944chr1822364 105 1322 32300 753 457 12103
NM_001949chr662825 2746 2685 1266 879 411 22454 150 ----
NM_001950chr162729 172 ------
NM_001951chr83553 530 138 151 --1515
NM_001954chr61756 ------
NM_001957chr472064 1776 1416 474 419 303 190 11587 --22174 2127
NM_001963chr4--1606 ----
NM_001964chr521110 1104 ----11165
NM_001967chr32625 443 --1454 --
NM_001968chr46850 713 349 179 166 99 1359 ----
NM_001969chr1443743 3034 853 779 2358 117 32990 2693 757 --
NM_001977chr471639 1171 411 344 227 195 58 31721 503 480 ----
NM_001981chr1--1773 2913 494 1955
NM_001982chr1231270 155 32 --2829 195 --
NM_001991chr1722099 26 ----12214
NM_001992chr522188 501 22114 689 21728 1536 21644 349
NM_001993chr13994 736 186 11120 --1904
NM_001995chr441523 1040 1003 220 11213 ----
NM_001998chr3--1394 ----
NM_001999chr551519 1077 980 347 59 21129 238 ----
NM_002006chr4125196 4964 4378 4282 2333 1823 1811 1513 1166 1088 873 263 24706 1317 23788 1952 --
NM_002009chr1542623 1099 734 154 22061 763 --22277 489
NM_002015chr13143219 3140 2187 2152 2060 1295 1073 1012 957 901 832 780 177 33 ------
NM_002017chr111144 ------
NM_002023chr151290 504 383 349 45 ------
NM_002024chrX61429 517 465 363 305 236 11419 12096 1663
NM_002025chrX179110 8066 7398 7047 7036 6166 6030 5991 3190 3028 1457 1125 1095 331 235 224 208 39182 5727 1424 11881 17763
NM_002028chr1421337 1242 --1132 --
NM_002031chr64650 618 562 544 ----1164
NM_002033chr1164060 3476 3070 1233 705 116 33597 2909 673 22825 2525 --
NM_002039chr4--1371 1286 --
NM_002040chr2183047 2537 2295 2141 2061 1043 720 170 42837 2165 1173 1116 --1951
NM_002044chr1521593 40 --21453 1163 --
NM_002045chr32344 278 ------
NM_002048chr931239 832 180 --1971 --
NM_002051chr102912 145 --165 --
NM_002056chr24777 339 285 181 ------
NM_002062chr621103 207 ------
NM_002063chrX21280 81 1806 ----
NM_002069chr721168 47 1682 2666 29 --
NM_002076chr1252605 720 554 447 433 22906 1083 23263 1012 1358
NM_002077chr952134 1434 704 311 41 31889 735 628 11988 --
NM_002086chr1742244 2217 1552 139 --1668 --
NM_002092chr464109 4102 3957 1000 958 44 45010 3843 3684 1856 34021 3552 1023 13290
NM_002094chr161328 ------
NM_002107chr13426 328 183 --1390 --
NM_002114chr62167 83 ------
NM_002126chr17113891 3216 2941 2717 1201 1120 1086 1017 842 556 130 23578 228 --198
NM_002128chr1352001 1744 771 536 44 11649 ----
NM_002129chr42337 158 1424 ----
NM_002130chr531547 323 159 --1393 --
NM_002131chr62944 823 ------
NM_002137chr742224 1883 957 177 ------
NM_002139chrX2560 107 ------
NM_002140chr931178 780 154 ------
NM_002141chr72620 547 ------
NM_002146chr1751400 1274 1053 952 942 2967 342 11161 --
NM_002148chr2----1430 1449
NM_002149chr22759 720 --1792 --
NM_002154chr5----1156 --
NM_002156chr2----1305 --
NM_002158chr2103376 3188 2964 2789 942 848 716 479 362 126 13016 11521 --
NM_002160chr91107 1479 1620 --
NM_002163chr164886 480 123 117 --1296 1491
NM_002165chr20--1272 ----
NM_002166chr21562 ------
NM_002167chr11484 ------
NM_002182chr342751 2290 2005 717 1462 22203 858 --
NM_002192chr72634 554 --1448 --
NM_002193chr221253 1219 1219 ----
NM_002199chr42929 641 ------
NM_002202chr52943 924 --1325 --
NM_002203chr574160 4105 2628 1516 1491 1348 439 13633 13014 11450
NM_002210chr283374 2482 2315 2185 1300 667 465 432 23106 292 2992 872 --
NM_002211chr1021121 1005 1761 1909 --
NM_002214chr7135676 5531 5216 5067 4833 4638 4488 4107 4056 3761 2239 2069 971 54690 4356 3914 767 306 32216 2096 1015 25161 238
NM_002222chr341308 1052 422 271 11153 21340 525 --
NM_002226chr141649 --1898 --
NM_002227chr141171 827 251 71 --11295 --
NM_002229chr192401 192 ------
NM_002233chr11----1379 --
NM_002234chr121159 ----1719
NM_002235chr1231247 1190 210 11064 ----
NM_002239chr221047 254 21094 1078 ----
NM_002241chr133138 2166 448 ----12228
NM_002242chr251901 1451 606 360 55 11977 ----
NM_002245chr1173 1108 ----
NM_002247chr104840 550 312 159 --11797 --
NM_002250chr192470 31 ------
NM_002253chr431376 250 99 11436 ----
NM_002254chr23846 813 538 --1440 --
NM_002264chr3124962 4296 3556 3158 3088 2000 1953 1341 1048 755 677 267 21987 1226 1471 --
NM_002267chr1332226 380 150 11641 12313 --
NM_002270chr594000 3599 2283 2183 1964 1857 1661 1018 847 25521 4854 15095 14514
NM_002271chr1321872 524 21669 841 22104 1796 --
NM_002285chr283925 1653 1558 921 873 495 354 94 11302 13382 --
NM_002291chr71115 153 ----
NM_002293chr152273 1998 1986 245 85 12674 12742 --
NM_002294chrX178 --1133 --
NM_002296chr161796 1713 1417 1239 716 335 11372 21313 110 1237
NM_002310chr5166346 6155 5881 5181 5119 4920 4768 4170 2600 2264 2094 1710 1414 1099 810 278 36406 5204 825 --11968
NM_002314chr721026 1018 --11082 --
NM_002332chr12--1136 ----
NM_002336chr1294541 4023 3994 3142 1970 1687 1632 1055 768 34109 4067 3170 14523 --
NM_002349chr281396 1218 1161 511 471 374 265 111 11323 11037 11415
NM_002351chrX41541 1418 343 100 1271 --126
NM_002354chr21372 1400 ----
NM_002355chr122495 344 --1906 --
NM_002356chr662802 2576 1843 877 317 136 ------
NM_002374chr253610 1402 1302 1157 609 --2664 291 --
NM_002375chr342239 1422 759 254 ------
NM_002381chr2146 1701 ----
NM_002382chr1421194 449 ------
NM_002387chr5165088 4936 4827 4593 4488 4349 3840 3475 1987 993 935 870 703 466 125 79 14977 14628 12007
NM_002395chr65454 384 369 282 190 21120 115 ----
NM_002397chr552061 1429 736 692 206 --1145 --
NM_002398chr221345 1201 ------
NM_002399chr1531463 453 444 ------
NM_002401chr1722263 1523 ------
NM_002406chr52135 107 ------
NM_002408chr146702 584 324 316 283 191 1807 ----
NM_002409chr2233155 2304 471 ------
NM_002422chr11------135
NM_002429chr1221021 196 --21497 208 --
NM_002430chr2222135 334 12033 1866 --
NM_002438chr101653 ------
NM_002444chrX41630 1546 561 128 11498 21953 286 --
NM_002449chr531279 1070 293 ------
NM_002467chr81396 ------
NM_002469chr122411 365 ------
NM_002473chr221173 --11152 --
NM_002480chr124420 369 154 106 11266 ----
NM_002481chr1135664 2607 2445 2405 2082 1619 1578 1459 1282 1253 320 158 41 27638 1881 47651 2960 1311 169 --
NM_002482chr12567 62 ------
NM_002486chr92444 155 --11687 --
NM_002487chr152577 235 1602 --1594
NM_002489chr71320 ------
NM_002493chr91289 ------
NM_002499chr15102494 2241 2231 2042 1936 555 370 306 300 98 --1866 --
NM_002500chr21913 ----1406
NM_002501chr1944090 2878 1244 1113 12686 ----
NM_002505chr63463 415 300 --11261 --
NM_002514chr841160 843 298 234 1944 1881 --
NM_002515chr1441792 1700 218 50 22040 274 172 --
NM_002516chr19----1311 --
NM_002519chr1121312 1299 2615 127 21229 104 --
NM_002524chr13914 799 39 ------
NM_002526chr631740 1482 1159 1658 141 --
NM_002536chrX1228 --11529 --
NM_002538chr53475 401 167 ----1156
NM_002539chr21260 ------
NM_002540chr93656 548 180 1274 ----
NM_002545chr1194263 4221 4118 4075 3239 1650 1622 1316 1255 --34756 4548 717 --
NM_002546chr8175 1653 1577 --
NM_002547chrX74170 4127 3341 3196 1558 1117 93 12784 1129 --
NM_002556chr1141761 812 703 126 --1394 --
NM_002570chr1521203 345 1881 --11019
NM_002572chr11----191 --
NM_002576chr112796 449 ------
NM_002577chr363352 2914 785 689 538 37 33018 2835 1334 11606 1293
NM_002581chr973763 1863 1655 1543 966 948 844 15663 13808 --
NM_002582chr1631009 949 706 ------
NM_002583chr122511 490 ------
NM_002586chr631049 392 244 1640 ----
NM_002588chr511678 --1628 --
NM_002589chr4--1131 ----
NM_002594chr2032281 917 317 11554 ----
NM_002595chr1221648 654 31387 725 527 21614 438 --
NM_002600chr141792 1304 582 420 31785 622 569 1702 --
NM_002605chr153920 848 373 21177 1037 ----
NM_002607chr71924 ------
NM_002612chr741817 1743 832 474 3704 570 23 21348 406 --
NM_002613chr16105064 4498 4390 3917 3714 3697 3403 3347 1347 220 --34608 4363 135 --
NM_002618chr21347 2183 37 146 --
NM_002623chr203796 518 140 ------
NM_002627chr10------180
NM_002628chr341197 478 364 260 11048 21151 356 --
NM_002629chr103561 160 145 1152 ----
NM_002633chr12489 143 ----1101
NM_002639chr185883 877 225 132 81 11129 ----
NM_002645chr1152903 2323 1236 646 155 33041 2360 1098 12478 --
NM_002647chr18--1331 ----
NM_002648chr6--1409 ----
NM_002649chr721525 108 11209 ----
NM_002655chr8145031 4972 4625 4246 3795 2131 1940 1591 1342 682 333 311 300 62 45155 3242 237 81 13633 --
NM_002657chr2073893 3128 1365 863 797 244 143 11306 23748 3091 --
NM_002662chr331692 709 623 21990 1868 ----
NM_002663chr171543 ------
NM_002670chr321239 466 21300 637 --11603
NM_002687chr1441199 1137 1100 442 --1163 --
NM_002693chr152288 118 ------
NM_002698chr1922530 1167 ------
NM_002706chr2169 ------
NM_002709chr242574 1081 764 453 13268 ----
NM_002710chr125447 352 150 130 59 1828 ----
NM_002713chr13750 301 288 ------
NM_002714chr65991 897 413 262 88 ------
NM_002715chr52415 269 1186 1902 --
NM_002716chr112996 502 --13140 --
NM_002717chr8----1225 --
NM_002718chr352285 1891 1822 1721 1079 1587 11960 --
NM_002719chr1431664 909 585 31712 884 393 ----
NM_002721chr9281 29 --195 --
NM_002725chr1137 11713 11392 --
NM_002731chr13986 791 227 22232 319 ----
NM_002734chr1752253 1832 672 544 155 11646 31730 1481 1415 --
NM_002736chr7121948 1911 1751 1597 1576 1401 845 588 470 429 393 181 --2706 91 --
NM_002737chr17116646 6368 5735 4995 4394 4130 1467 898 694 321 300 26074 796 26121 5435 --
NM_002738chr1641148 1081 705 67 ------
NM_002740chr382820 2669 2242 2166 1816 1798 1759 905 189 22383 627 --
NM_002744chr11295 ------
NM_002745chr22154556 3334 3324 3219 1824 1792 1766 1624 1075 787 677 590 480 248 110 1420 13824 1452
NM_002747chr1851817 1793 684 665 230 ------
NM_002748chr1541068 831 381 80 3939 854 180 ----
NM_002752chr5----1367 --
NM_002755chr153157 99 57 1854 ----
NM_002758chr17--1429 ----
NM_002763chr12557 161 ------
NM_002775chr102537 110 ------
NM_002786chr112213 80 ------
NM_002806chr141300 --1254 --
NM_002822chr1231693 1385 335 11821 2127 110 11834
NM_002823chr21505 ----1249
NM_002825chr73601 588 63 ------
NM_002827chr2071829 1663 1473 712 232 207 191 --21465 447 --
NM_002828chr184982 687 620 359 1717 --1933
NM_002829chr921209 1136 ----1135
NM_002830chr2------2148 90
NM_002833chr1531531 531 403 ------
NM_002837chr1283583 3383 3348 3054 1224 1161 1017 901 14406 --24570 4347
NM_002839chr941402 719 623 79 1456 23006 2200 --
NM_002840chr131533 468 281 ------
NM_002841chr33175 104 22 1147 ----
NM_002843chr1173434 3153 2165 1339 785 730 242 12357 --11020
NM_002844chr62901 348 --1362 --
NM_002845chr18------1437
NM_002848chr1251279 1222 1016 282 85 21127 1103 1938 --
NM_002849chr122921 187 1757 ----
NM_002851chr71721 ------
NM_002858chr11430 --11206 --
NM_002863chr14152 ------
NM_002865chr81211 ------
NM_002868chr1242396 2323 337 270 --2907 151 1971
NM_002869chr1162082 1816 694 304 274 263 1374 ----
NM_002873chr53460 63 43 1400 ----
NM_002874chr931957 1523 709 --21604 839 --
NM_002882chr22198 ------
NM_002886chr3135163 5157 4499 4477 4344 4247 3987 3890 3492 1469 1271 868 100 24657 1444 11849 --
NM_002890chr51101 1782 ----
NM_002892chr1471606 1176 611 483 280 242 121 11572 21652 394 --
NM_002893chrX2332 279 --1139 --
NM_002894chr181184 1212 1178 --
NM_002895chr201673 --2962 32 --
NM_002902chr152652 61 --1436 --
NM_002906chr1182168 2050 1694 1629 1560 424 247 104 41986 1683 362 340 ----
NM_002911chr1931564 597 394 11231 ----
NM_002912chr64927 676 346 158 1710 ----
NM_002922chr12663 648 ------
NM_002923chr12648 627 ------
NM_002924chr12523 50 ------
NM_002926chr41386 ------
NM_002938chr42644 76 21752 1448 ----
NM_002940chr471903 1628 1450 732 370 342 187 ------
NM_002941chr311170 41328 1138 482 148 1324 --
NM_002942chr321363 917 ------
NM_002956chr123446 384 349 11424 1453 --
NM_002959chr143820 3790 1774 410 1225 1189 --
NM_002968chr1641108 882 752 440 --11006 --
NM_002970chrX1308 ------
NM_002973chr122535 190 ------
NM_002977chr232256 1355 1201 ------
NM_002988chr172405 174 ------
NM_002994chr451870 1335 712 462 157 1558 11921 --
NM_002996chr1611978 --11750 --
NM_002998chr861884 1839 1814 875 548 376 31982 1916 582 11699 1118
NM_003001chr151960 1915 1622 1581 845 42225 1883 1561 754 ----
NM_003010chr1721984 498 1958 ----
NM_003011chr951516 644 469 446 231 --1569 --
NM_003013chr41160 2533 290 --1682
NM_003016chr1742023 1947 1768 1272 --1273 --
NM_003017chr621091 373 31261 1151 223 1106 --
NM_003022chrX11222 11178 11309 --
NM_003026chr941131 1097 962 379 ------
NM_003028chr913716 --12878 --
NM_003034chr12126764 5372 3233 2682 2644 2132 2059 1629 1079 790 718 152 37602 7064 205 57921 6894 6690 6529 3209 12215
NM_003035chr11644 --1310 --
NM_003036chr13878 347 288 --1977 --
NM_003042chr31289 --1452 12188
NM_003043chr364031 3908 990 757 404 361 --13799 --
NM_003045chr1353679 3127 1744 1598 523 24992 4884 23057 1482 --
NM_003048chr252818 2704 2535 2190 2047 12455 22786 1098 --
NM_003051chr181943 1611 1592 1526 1445 638 459 334 --21256 753 --
NM_003060chr521031 903 21150 337 ----
NM_003068chr82791 37 1719 181 --
NM_003069chrX--2504 74 ----
NM_003070chr92758 536 1545 ----
NM_003071chr32344 244 1647 ----
NM_003074chr341997 1815 332 170 ------
NM_003075chr12----1335 --
NM_003079chr172716 33 ------
NM_003081chr2051184 281 263 256 161 ------
NM_003092chr201325 178 ----
NM_003095chr122375 352 ------
NM_003096chr2186 ------
NM_003100chr5--1175 ----
NM_003105chr11----185 --
NM_003106chr321054 840 ------
NM_003107chr611682 11610 12105 --
NM_003108chr2176807 6609 6566 6557 6463 6347 5596 5423 5037 5001 4541 2069 1424 1032 917 782 248 15650 15721 --
NM_003110chr172790 310 --11062 --
NM_003111chr241069 1053 510 151 --1210 --
NM_003112chr782866 2744 2632 2375 2225 989 646 37 33075 2241 1072 1368 --
NM_003113chr2141 2875 758 ----
NM_003115chr11326 --1187 --
NM_003128chr272641 2592 2234 1738 905 802 142 1177 ----
NM_003131chr612306 ------
NM_003133chr15836 382 200 125 32 1151 --21029 85
NM_003136chr143336 297 141 ------
NM_003137chr662197 1987 1802 1557 836 519 1588 165 1824
NM_003142chr2--129 ----
NM_003144chr651930 1678 1466 338 175 --1468 --
NM_003146chr114369 363 259 27 ------
NM_003149chr311169 ------
NM_003150chr1722304 1488 12388 3629 454 164 --
NM_003152chr17----11215 --
NM_003154chr42296 104 ------
NM_003155chr832680 2558 2161 145 11977 12550
NM_003157chr31947 ------
NM_003161chr1743479 2262 1423 1218 --13345 --
NM_003162chr21909 1852 ----
NM_003168chr1731061 928 839 2154 146 ----
NM_003174chr103845 622 253 --1743 --
NM_003176chr11226 ------
NM_003176chr11226 ------
NM_003179chrX11336 ------
NM_003182chr7--1529 ----
NM_003182chr7--1529 ----
NM_003185chr2021287 1237 --21079 339 --
NM_003188chr62690 22 --2235 138 --
NM_003189chr163123 2934 2491 2263 2237 1028 --33262 3213 225 --
NM_003199chr18135704 5384 5294 5094 5039 4885 4672 4613 4577 2147 436 327 103 14130 11465 --
NM_003200chr193704 376 34 12408 1325 --
NM_003202chr521899 1302 11748 11430 --
NM_003203chr221631 776 21782 1675 ----
NM_003204chr17----21183 613 --
NM_003206chr61424 1140 ----
NM_003217chr1251902 1854 1651 1580 322 --2715 122 --
NM_003220chr631545 526 429 11372 ----
NM_003221chr673689 3536 3193 1614 1500 1325 1131 --23422 1480 --
NM_003222chr201917 ------
NM_003223chr16----2861 302 --
NM_003234chr342229 1584 376 179 11750 12289 --
NM_003242chr382429 999 917 809 608 573 473 224 11933 --1275
NM_003244chr181398 ------
NM_003246chr1562004 1951 1470 1457 616 539 12015 1364 --
NM_003247chr651992 1975 1677 1320 425 --21670 1607 --
NM_003253chr2121735 167 --21666 1241 11392
NM_003255chr1722001 329 --21967 376 --
NM_003257chr1591187 1173 1137 970 918 563 441 334 123 1407 ----
NM_003259chr191127 ------
NM_003262chr384819 4338 4322 3337 987 664 249 86 64361 4159 1524 1423 756 157 23975 272 11995
NM_003269chr641228 1185 1157 446 11103 11176 --
NM_003270chrX2789 770 ------
NM_003272chr11650 --2245 83 --
NM_003274chr2162926 2900 2701 2660 2118 1979 13013 --148
NM_003275chr91345 1409 ----
NM_003286chr2021035 782 ------
NM_003290chr195762 339 288 247 99 ------
NM_003291chr131621 --177 --
NM_003292chr151905 1752 662 313 81 2911 395 ----
NM_003295chr131202 ------
NM_003298chr396047 6029 5775 4248 3974 2029 1453 971 431 35961 5136 1928 31302 953 421 46175 4871 1847 1346
NM_003304chr351594 1479 1213 614 449 1635 21374 1024 --
NM_003305chr4------1177
NM_003314chr52439 174 ------
NM_003317chr143721 675 94 ------
NM_003319chr21618 2632 265 ----
NM_003320chr1153988 3938 3377 672 294 14402 ----
NM_003336chrX31132 1075 989 190 --1296
NM_003337chr531485 366 289 11449 31367 304 172 --
NM_003338chr1061933 1583 1495 478 202 194 41895 1233 411 127 ----
NM_003339chr541337 1174 1087 188 1461 --2996 533
NM_003340chr411377 ------
NM_003341chr32667 532 ------
NM_003345chr162367 66 ------
NM_003348chr1271662 1198 1109 1082 686 619 70 ------
NM_003349chr2021072 63 ------
NM_003350chr831055 862 839 ------
NM_003352chr2----2694 272 --
NM_003358chr91145 ------
NM_003359chr42906 47 1997 ----
NM_003367chr191152 ------
NM_003368chr13511 268 184 ------
NM_003369chr1142521 942 380 65 12594 ----
NM_003372chrX2939 320 2374 129 ----
NM_003373chr1041981 1395 653 182 11789 ----
NM_003374chr52780 529 1766 1301 --
NM_003376chr611232 1268 21896 183 --
NM_003376chr611232 1268 21896 183 --
NM_003379chr62913 804 ------
NM_003380chr101226 ------
NM_003383chr93576 166 146 --1392 --
NM_003387chr242873 2623 2460 732 ----12576
NM_003390chr1121092 87 ------
NM_003392chr374277 3892 3257 1368 1354 348 127 24368 4080 24350 548 --
NM_003399chrX--1791 ----
NM_003400chr21260 --1234 --
NM_003403chr142703 606 1695 ----
NM_003404chr2041795 1254 765 476 ------
NM_003406chr831536 1389 432 41850 1797 652 564 31819 1306 273 1417
NM_003407chr19----1686 --
NM_003409chr1841433 442 317 23 --11101 --
NM_003410chrX62986 2917 605 393 233 159 22583 58 21012 786 --
NM_003411chrY71492 1347 579 557 353 136 54 1149 ----
NM_003412chr383113 2808 2717 2606 2371 827 591 195 1956 12787 1694
NM_003413chrX41960 240 207 47 1300 1217 --
NM_003418chr31168 --1714 --
NM_003420chr31159 ------
NM_003427chr61663 ------
NM_003430chr1921575 566 ------
NM_003439chr793223 2691 2588 1405 1324 1225 784 766 414 --23578 2277 --
NM_003442chr112158 121 1145 1845 --
NM_003453chr13--1525 ----
NM_003457chr171442 ------
NM_003458chr363989 3118 2507 2490 918 366 ------
NM_003463chr662864 2120 1340 1275 644 617 32996 2244 500 ----
NM_003466chr232395 1736 434 11637 --11920
NM_003467chr22398 60 ------
NM_003468chr243346 2961 1752 1442 24008 3718 1285 --
NM_003471chr362163 1725 1589 911 877 311 1890 11843 --
NM_003473chr103988 761 362 1835 ----
NM_003474chr1041637 1631 771 187 12316 1247 12202
NM_003477chr112244 136 ------
NM_003478chr1142865 2200 1173 365 ------
NM_003482chr1211115 12798 11805 --
NM_003483chr1292551 2486 1818 850 778 754 660 536 104 --12847 --
NM_003488chr171647 ------
NM_003489chr21153345 3191 3162 3013 2520 2477 2272 2126 1260 973 710 522 515 393 119 1729 1333 1356
NM_003496chr72804 730 ------
NM_003498chr1632436 1091 897 --22108 256 --
NM_003503chr121167 56 1119 ----
NM_003505chr731714 1362 255 31956 1631 1372 ----
NM_003506chr851189 960 930 330 101 21284 1093 1485 --
NM_003507chr281987 1981 1948 1316 754 746 702 633 22028 1737 11556 --
NM_003557chr131588 1559 582 ------
NM_003559chr1733858 1575 545 ------
NM_003563chr172578 298 ------
NM_003565chr12------1482
NM_003566chr12123406 3308 3237 2753 2602 2214 2131 1120 992 486 205 60 22638 2321 12873 --
NM_003567chr1--1309 ----
NM_003569chr63569 517 119 ------
NM_003574chr18135738 5442 4690 3839 3689 3545 1914 1220 1211 1177 1010 977 105 35064 4082 1450 14038 12263
NM_003576chr1382834 2294 2219 1831 1120 589 450 245 1228 12791 --
NM_003580chr81464 --150 --
NM_003581chr2--1807 1948 --
NM_003583chr12153413 3281 3271 3184 3087 2452 1572 1253 1119 1019 837 312 204 158 129 23345 1295 12854 --
NM_003589chr1351434 1108 1055 449 219 --1390 11080
NM_003590chr273836 3480 2914 1614 1265 928 562 --23588 393 --
NM_003592chr72412 325 --1344 --
NM_003595chr222385 53 1522 ----
NM_003597chr251972 1751 1442 772 432 ----12154
NM_003603chr421681 1608 --2679 439 1527
NM_003607chr1114124 3891 3822 3490 3241 3057 1571 1408 945 244 60 54342 4061 3838 2997 268 ----
NM_003613chr154473 268 143 94 ------
NM_003615chr3113543 3310 3011 1339 1262 1140 1000 976 400 342 289 21236 955 22648 2485 --
NM_003617chr1124878 4632 4187 3633 3233 3184 3132 1891 1613 1064 796 61 14943 11082 --
NM_003618chr241181 1123 978 111 --1302 --
NM_003620chr1721103 155 ------
NM_003622chr1232242 813 265 32139 1707 1666 1973 --
NM_003626chr1181335 1129 1095 1070 386 252 74 51 --11396 --
NM_003628chr21705 --1626 --
NM_003629chr122856 2296 13360 137 --
NM_003630chr62728 41 ------
NM_003631chr101945 --1783 --
NM_003633chr572535 2515 2237 2190 939 762 352 --11866 11772
NM_003642chr2195 ------
NM_003651chr122524 427 ------
NM_003659chr231239 1199 983 1217 ----
NM_003663chr353480 3348 2781 904 75 4980 832 745 595 1813 --
NM_003664chr52439 179 ------
NM_003670chr311084 --1422 --
NM_003672chr121381 226 11797 ----
NM_003677chr1222001 1610 --2797 294 --
NM_003679chr142972 2802 2453 2397 21077 524 1409 1179
NM_003692chr93708 379 104 1693 ----
NM_003701chr132432 50 ------
NM_003702chr83779 245 189 --1806 --
NM_003705chr24844 715 596 277 ------
NM_003711chr51246 ------
NM_003713chr121677 697 ------
NM_003716chr3--1135 1903 --
NM_003718chr7130 --1513 --
NM_003722chr362640 2132 2013 1773 441 429 11677 12672 --
NM_003725chr12----1419 --
NM_003735chr511678 --1628 --
NM_003736chr511678 --1628 --
NM_003743chr232165 1866 120 ------
NM_003744chr1421267 1261 ------
NM_003749chr1362147 2061 1687 1673 860 735 11766 ----
NM_003750chr103675 334 203 ----1760
NM_003759chr484283 4004 3972 3409 2656 1273 1265 1099 --14024 1691
NM_003762chr12947 926 ------
NM_003763chr2033115 2509 2488 1965 1723 --
NM_003764chr62660 609 ------
NM_003766chr172495 169 1141 ----
NM_003768chr1--1251 1365 --
NM_003772chr1121228 243 --1333 --
NM_003774chr12102731 2493 2287 1317 1302 1075 781 575 383 144 --32993 769 661 --
NM_003783chr11955 31040 383 364 11210 --
NM_003787chr184537 531 193 59 21139 204 11450 11239
NM_003794chr341045 965 806 784 ------
NM_003796chr191114 2433 182 --1444
NM_003799chr18124239 4196 3985 3651 3620 3126 3014 2850 1319 1123 974 799 23689 611 51558 908 562 432 391 --
NM_003800chr631979 615 65 1570 --12020
NM_003822chr122878 966 1670 ----
NM_003825chr1511254 11007 ----
NM_003829chr91185 21152 1111 21205 204 --
NM_003831chr1831734 1638 1335 11855 ----
NM_003850chr131152 ------
NM_003858chr142586 481 1279 ----
NM_003861chr1462308 2097 1852 683 628 346 11940 1407 --
NM_003867chr81552 ------
NM_003872chr252396 1159 611 430 66 22357 666 ----
NM_003873chr1032569 466 442 12316 ----
NM_003877chr122913 187 ------
NM_003884chr34409 381 354 193 --21705 126 --
NM_003885chr1742562 2413 2115 238 --32208 167 42 --
NM_003887chr262343 2199 1671 1504 700 209 --32044 1437 547 --
NM_003888chr1521758 377 ------
NM_003895chr2161495 769 744 499 255 29 2536 263 11527 --
NM_003896chr24739 207 159 92 ------
NM_003899chr1321743 357 --12330 --
NM_003901chr1072660 2624 2437 2043 1822 1800 851 12400 ----
NM_003902chr13585 317 311 --1296 --
NM_003908chr2051337 1101 923 437 419 1187 ----
NM_003909chr8103025 2749 2450 2309 1038 1015 965 678 295 98 1830 183 11093
NM_003913chr6103402 2992 1575 1305 1294 955 814 777 730 344 23617 3273 --14307
NM_003916chrX61435 1332 1103 1092 413 35 1936 ----
NM_003919chr71182 --1192 --
NM_003921chr151493 652 618 346 129 --31588 247 204 --
NM_003922chr152305 72 --1284 --
NM_003927chr181301 2972 418 ----
NM_003932chr2271826 1762 1512 690 566 311 238 --31537 766 458 1167
NM_003934chr921102 190 11284 1508 --
NM_003939chr1043208 2693 1092 1049 ------
NM_003941chr752456 2347 1729 361 55 11890 2928 915 --
NM_003947chr351354 1310 1272 998 301 ------
NM_003953chr13961 511 420 1626 1262 --
NM_003958chr693890 3356 3097 3067 1582 1408 757 235 22 --12874 12676
NM_003966chr5147793 7688 7170 6716 6012 5461 4954 4800 2289 2019 2013 1369 1282 116 66322 6146 2616 2085 2032 1025 36678 5711 386 --
NM_003968chr3278 45 --1190 --
NM_003971chr171527 1516 1121 --
NM_003972chr1021297 319 ----1347
NM_003980chr631067 575 122 21140 225 11101 --
NM_003983chr1684248 4012 3731 3451 3285 1280 1114 785 1748 13169 --
NM_003994chr1244117 4011 3388 28 44394 3831 3616 3512 44318 3824 3013 2821 --
NM_003998chr41677 2631 455 1595 --
NM_004004chr133517 323 91 --21332 294 --
NM_004006chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004007chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004009chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004010chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004011chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004012chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004013chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004014chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004015chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004016chrX21859 673 32121 1645 833 32512 2044 273 12291
NM_004017chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004018chrX21859 673 32121 1645 833 32512 2044 273 12291
NM_004019chrX2321 162 ------
NM_004020chrX21945 759 32207 1731 919 32598 2130 359 12377
NM_004021chrX21859 673 32121 1645 833 32512 2044 273 12291
NM_004022chrX21859 673 32121 1645 833 32512 2044 273 12291
NM_004023chrX21859 673 32121 1645 833 32512 2044 273 12291
NM_004024chr121223 238 1410 191 --
NM_004034chr103591 505 473 ----1427
NM_004039chr15--1139 1308 1294
NM_004040chr221238 321 ------
NM_004050chr1442596 2430 2394 777 ------
NM_004056chr83874 834 776 2820 427 ----
NM_004061chr52557 238 ------
NM_004067chr751530 1470 518 370 352 ------
NM_004068chr31423 ------
NM_004071chr22265 103 ------
NM_004074chr11173 ------
NM_004078chr11752 --141 --
NM_004079chr162704 2448 1946 875 460 176 --22416 45 --
NM_004080chr7----11317 --
NM_004081chrY2527 469 157 1579 1380
NM_004087chr351754 568 518 208 42 ------
NM_004093chr1352426 2069 2011 1169 412 11148 1831 12114
NM_004094chr1493001 2995 2596 2486 2348 2214 1908 200 46 --32926 806 209 1462
NM_004097chr21301 ------
NM_004100chr642131 1788 674 28 1217 ----
NM_004105chr241059 918 159 29 ------
NM_004113chr321650 734 21728 352 ----
NM_004114chrX1276 ----1219
NM_004117chr631620 1437 867 --22208 499 --
NM_004124chr1452879 2515 871 578 228 22791 734 12720 11391
NM_004133chr842518 2316 1919 612 22583 949 22105 76 --
NM_004134chr52597 229 ------
NM_004136chr1573119 2879 2830 2547 2515 1009 282 --1965 --
NM_004156chr81172 1611 ----
NM_004157chr33872 197 138 1717 1562 --
NM_004161chr271636 1431 1229 604 403 370 195 ----11334
NM_004162chr32932 71 21142 503 ----
NM_004170chr951812 1438 1395 758 433 ------
NM_004171chr11109493 7830 7385 6880 6675 6334 6051 6024 3096 1829 23298 996 18064 --
NM_004172chr522023 21 1354 ----
NM_004200chr1122222 345 163 1222 --
NM_004208chrX----170 --
NM_004210chr1022136 98 ------
NM_004225chr811208 --1963 --
NM_004226chr2----1109 --
NM_004227chr762817 2756 2579 800 579 296 1867 12291 --
NM_004229chrX62082 2037 1496 447 387 149 --11872 --
NM_004232chr1893848 3719 3484 3298 2880 2462 929 593 423 21559 511 32848 862 29 --
NM_004235chr93829 553 58 --1637 --
NM_004236chr151167 --1460 --
NM_004240chr191255 ----179
NM_004241chr103796 625 590 ------
NM_004242chr6--1141 ----
NM_004244chr12--1433 197 --
NM_004247chr17156 ------
NM_004249chr4----1107 --
NM_004267chr31169 ------
NM_004268chr1121032 375 1160 1144 --
NM_004272chr531524 1259 675 2735 723 ----
NM_004274chr1452097 693 687 615 418 22186 580 ----
NM_004277chr661536 1223 542 472 363 273 21433 1413 2575 244 1142
NM_004279chr74942 329 208 116 1428 ----
NM_004281chr10168 2503 391 ----
NM_004286chr2232631 247 145 ----1603
NM_004293chr983788 3507 3161 2598 2494 2380 592 576 33721 824 246 22973 2354 1783
NM_004296chr141438 ------
NM_004301chr31105 ------
NM_004302chr1252797 1796 647 535 331 22856 2819 1473 --
NM_004311chr1032233 2127 196 ------
NM_004326chr12267 84 1496 ----
NM_004330chr1531149 283 75 2770 262 --1972
NM_004331chr862689 2387 1706 1032 873 596 21986 213 12635 1177
NM_004338chr18126979 6865 6731 6345 5951 5516 5320 4904 4495 940 868 442 46614 5378 5307 742 ----
NM_004341chr21232 ------
NM_004342chr732219 552 464 1674 11942 1417
NM_004346chr441544 1421 545 84 --1494 1115
NM_004349chr82920 128 2972 497 ----
NM_004354chr43738 297 256 3859 705 343 1824 2229 214
NM_004360chr1631833 778 350 1160 12009 --
NM_004364chr1911144 21030 356 ----
NM_004365chr52309 293 ------
NM_004370chr641585 1551 576 222 1340 12197 --
NM_004374chr81136 ------
NM_004378chr152207 24 ------
NM_004379chr231376 1233 704 31394 1309 80 11546 --
NM_004381chr63429 363 134 ------
NM_004384chr592123 1850 1543 1523 724 674 296 141 128 22157 811 32248 1605 1564 --
NM_004385chr52223 126 1153 ----
NM_004386chr1942288 1901 1649 1502 22301 1511 --1594
NM_004388chr12423 90 --169 --
NM_004389chr22723 69 ------
NM_004392chr1351970 1031 632 581 343 12325 ----
NM_004393chr331812 1563 265 --11608 --
NM_004397chr1193594 3429 1703 1592 1486 903 666 390 135 --33697 3384 1159 --
NM_004404chr241949 1845 1535 39 1120 1185 --
NM_004405chr22678 230 ------
NM_004411chr72274 201 ----1715
NM_004414chr2131452 1304 293 ------
NM_004415chr61546 157 --1644
NM_004419chr104964 800 388 238 ------
NM_004423chr352137 1673 1666 318 82 12606 11736 --
NM_004426chr1241839 1767 321 192 1209 21975 1646 --
NM_004429chrX2409 390 --11154 --
NM_004430chr882467 2097 1984 1878 1847 807 266 26 11832 12655 --
NM_004431chr12786 229 --1590 --
NM_004432chr982277 2069 1575 1503 890 831 730 491 12256 22414 2048 --
NM_004436chr1--1562 ----
NM_004437chr153328 3256 1244 939 866 --23204 839 --
NM_004438chr233308 2217 447 11306 2236 76 158
NM_004439chr4----144 --
NM_004440chr611429 21871 606 1782 --
NM_004441chr331233 382 117 ------
NM_004444chr7143 --1103 --
NM_004447chr122888 92 2845 235 ----
NM_004449chr2131473 1396 1201 1422 21403 1084 --
NM_004454chr322236 722 ----11700
NM_004456chr71231 ------
NM_004457chr261391 1370 531 235 196 134 1217 ----
NM_004458chrX52137 1058 1040 841 748 1168 12570 12202
NM_004459chr1721796 418 11852 ----
NM_004464chr4104248 4205 3390 3342 1516 1495 1278 566 466 353 53606 1369 943 640 503 1584 --
NM_004469chrX134 1105 ----
NM_004472chr53665 582 123 --1470 --
NM_004481chr142659 953 559 422 12605 12595 --
NM_004482chr22648 616 --2708 124 --
NM_004485chr174359 3347 2842 1460 485 187 172 --24374 408 --
NM_004487chr32924 386 ------
NM_004491chr1954306 3905 1130 1089 57 --11236 11523
NM_004496chr141134 21055 176 11099 --
NM_004499chr5----1424 --
NM_004500chr1441901 1584 177 53 --11321 --
NM_004501chr11170 43706 1542 1062 258 34143 3381 736 --
NM_004503chr12------1582
NM_004504chr292821 2765 2754 2668 2255 1993 1163 813 386 22914 433 --12997
NM_004506chr61253 --179 --
NM_004514chr1731131 795 466 12817 ----
NM_004516chr19--1340 --1369
NM_004520chr53588 568 249 --2754 219 --
NM_004525chr251490 1313 475 460 39 ----191
NM_004529chr931120 549 471 --11391 --
NM_004535chr2031483 1464 1179 ------
NM_004537chr1231492 1323 391 ------
NM_004566chr1052256 2036 1594 946 788 --1814 --
NM_004569chr143670 625 284 1216 1643 --
NM_004571chr2133303 2143 320 21022 52 33235 3096 104 1875
NM_004575chr451142 1124 527 399 77 ------
NM_004583chr173283 222 78 ------
NM_004586chrX115029 4545 4369 4145 4043 3945 3603 874 822 449 394 35302 4104 166 45041 4450 1517 842 --
NM_004593chr33872 172 137 ------
NM_004598chr5113348 3322 3015 2938 2720 2498 2456 2442 2339 935 64 22086 606 1480 --
NM_004600chr141024 955 624 507 ------
NM_004602chr201928 ------
NM_004607chr5--2196 51 ----
NM_004612chr954338 3448 1324 1084 955 --14040 2995 932
NM_004614chr1682459 2443 1715 1702 850 677 648 611 ------
NM_004615chrX2311 207 ------
NM_004622chr252183 1759 1495 651 156 ----1111
NM_004626chr111540 ------
NM_004627chr211694 --1668 --
NM_004631chr12399 229 11275 ----
NM_004637chr321281 984 ------
NM_004642chr122595 492 ----1194
NM_004650chrX81703 1579 1420 1267 1245 1209 507 230 --11901 1174
NM_004654chrY21085 558 11207 11037 --
NM_004655chr1731295 1009 86 ------
NM_004660chrY71828 1738 1703 1423 638 337 266 ------
NM_004663chr1571525 1446 1264 1134 377 259 87 11469 1600 --
NM_004666chr651297 1283 1249 439 345 11018 ----
NM_004684chr42352 325 ------
NM_004685chr1382948 2804 2685 2535 2214 1194 679 181 32986 1960 172 1391 --
NM_004687chr1771835 1594 1524 1496 1469 1286 662 ----11770
NM_004689chr141351 1331 ----
NM_004690chr64660 601 266 257 ------
NM_004694chr173761 158 103 2632 118 ----
NM_004696chr12835 792 ------
NM_004703chr171945 21922 539 2720 32 --
NM_004709chrX2363 312 11276 11141 11707
NM_004713chr142549 258 ------
NM_004717chr731490 1335 1321 21376 1164 ----
NM_004718chr22449 105 ----1600
NM_004719chr1262708 2514 2124 1903 1757 374 12170 22135 806 --
NM_004721chr32304 45 1297 192 --
NM_004726chrX94941 4394 3989 1486 1308 817 579 250 151 35378 4372 2311 1396 22209 1349
NM_004730chr571878 1417 672 445 270 235 180 21448 356 21438 576 --
NM_004731chr1261681 1513 1431 1248 395 61 1603 21530 1423 --
NM_004734chr1333112 2276 424 13141 ----
NM_004736chr162244 1740 1502 538 489 117 11471 --12156
NM_004738chr2022407 1990 1297 1606 --
NM_004742chr311601 ------
NM_004744chr453583 1312 1054 1000 398 23422 732 11263 1579
NM_004745chr8136832 6503 6165 6103 6065 5732 5677 5463 4315 1752 1507 337 39 --21964 1548 22073 1574
NM_004747chr1031596 1102 418 21277 1249 1616 --
NM_004748chr1594255 4208 1303 606 549 526 327 234 170 23699 1044 23461 24 11350
NM_004755chr1441218 878 841 810 1849 11139 1755
NM_004756chr19----21425 1068 --
NM_004757chr42532 96 ------
NM_004760chr751857 1584 432 424 308 11917 12096 --
NM_004762chr1711582 --21621 1273 --
NM_004768chr121097 928 ----1908
NM_004770chr8----1193 --
NM_004772chr541476 1347 1152 1090 ------
NM_004773chr171253 ------
NM_004774chr17103091 3076 2915 2838 2319 1231 893 514 438 353 1378 11067 --
NM_004775chr1872225 2120 2019 1997 1852 1786 441 --1919 --
NM_004776chr2093311 3257 3221 3039 2701 2262 1119 775 507 ------
NM_004779chr541163 910 537 65 ----11222
NM_004781chr131735 487 196 1352 ----
NM_004781chr131735 487 196 1352 ----
NM_004787chr41155 ------
NM_004788chr1132374 1687 374 42482 1725 901 799 ----
NM_004789chr93440 356 338 1110 ----
NM_004791chr13--3765 706 572 ----
NM_004795chr132125 29 21861 1448 ----
NM_004796chr1422212 1598 --12414 --
NM_004798chr2041322 971 525 37 21291 795 12976 --
NM_004799chr1------172
NM_004800chr132263 192 ------
NM_004801chr241101 971 530 77 147 1416 --
NM_004805chr231220 902 361 ------
NM_004808chr1073370 3310 2852 2387 2255 2070 388 --32940 750 632 --
NM_004817chr93597 529 300 ------
NM_004822chr1783726 3639 3403 2553 1599 1108 610 300 ------
NM_004831chr191326 --1435 --
NM_004834chr23913 698 649 --1802 --
NM_004835chr33205 97 70 1866 ----
NM_004835chr33205 97 70 1866 ----
NM_004836chr22792 124 --1610 --
NM_004840chrX72446 2065 919 494 227 193 185 32121 2085 956 1864 --
NM_004842chr641347 1310 364 133 2593 374 11774 --
NM_004844chr321193 1052 1404 ----
NM_004846chr2------1121
NM_004849chr641668 680 643 175 11536 1654 11110
NM_004850chr231274 1106 583 1527 11544 11172
NM_004856chr152568 31 1530 --1464
NM_004857chr14104692 4230 4101 4043 3486 3418 1020 472 310 69 11805 31834 669 540 23500 1433
NM_004859chr1752336 2287 2056 1198 408 22885 192 12323 --
NM_004865chr62368 328 ------
NM_004866chr5124974 3743 3663 3457 1949 1889 1470 1152 1099 852 322 304 23674 167 44132 3466 1058 509 13279
NM_004867chrX4573 470 228 103 ------
NM_004871chr1774347 4214 3210 2944 1482 202 37 24139 3127 34377 4291 4025 --
NM_004873chr1453202 2376 2220 554 38 22783 2209 1581 --
NM_004874chr81408 ------
NM_004879chr113916 295 260 ------
NM_004883chr5--1154 ----
NM_004884chr1561751 1362 656 619 288 113 ------
NM_004887chr5--1192 1165 --
NM_004888chr93688 385 136 --1709 136
NM_004893chr52475 104 ------
NM_004896chr1061224 1179 571 259 192 149 11256 11317 --
NM_004897chr101625 ------
NM_004898chr482890 2073 2027 1988 759 728 598 508 --11075 --
NM_004902chr201622 ------
NM_004904chr7136558 6413 6322 4335 4178 2600 2272 2067 1505 653 623 221 128 26276 4818 21253 71 14684
NM_004906chr64249 226 201 76 --1557 --
NM_004912chr751119 449 385 83 35 11086 21512 124 --
NM_004915chr215743 669 608 574 515 1550 ----
NM_004921chr192555 2261 2238 969 364 215 147 106 65 --22379 425 12250
NM_004932chr521522 166 ------
NM_004936chr972886 2806 2291 1203 912 403 176 12439 1937 1558
NM_004937chr1742693 2611 962 520 --32541 1699 395 --
NM_004938chr951002 770 427 350 232 ------
NM_004946chr51430 ----1424
NM_004947chr332092 1946 337 ------
NM_004949chr1862099 1999 1967 862 831 757 22109 1623 ----
NM_004956chr7124470 4273 3889 2851 1807 1753 1517 1194 1045 885 562 266 --34237 438 36 1177
NM_004958chr12339 265 ----151
NM_004964chr12545 406 ------
NM_004965chr213620 149 116 ------
NM_004966chr103226 97 36 1677 ----
NM_004967chr4155 ------
NM_004973chr651724 1485 354 177 69 --11597 --
NM_004976chr1143556 2034 1233 908 --13815 --
NM_004978chr111479 --11319 --
NM_004979chrX3756 204 38 ------
NM_004982chr123761 553 485 1108 1147 --
NM_004985chr1274306 4191 3697 1374 1225 758 78 12811 24199 3249 --
NM_004992chrX118202 7403 7236 6196 5517 3306 2933 2288 1534 1121 943 28302 2947 1248 --
NM_004992chrX118202 7403 7236 6196 5517 3306 2933 2288 1534 1121 943 28302 2947 1248 --
NM_004993chr1451298 1197 457 74 34 11487 1294 --
NM_004999chr694270 3650 3096 2906 2818 492 482 350 46 23666 3405 13865 1472
NM_005006chr22784 355 ------
NM_005010chr792027 1899 1879 748 740 680 371 199 55 11987 ----
NM_005011chr7----1162 --
NM_005014chr9--1769 ----
NM_005020chr71453 2439 416 ----
NM_005022chr17--178 ----
NM_005026chr132018 1684 510 ------
NM_005028chr101785 32288 1796 164 22219 1473 1270
NM_005032chrX31102 854 119 1248 ----
NM_005036chr22147418 7099 6995 6980 6322 5862 5321 5145 3179 3004 2613 1607 377 176 1103 42726 1975 626 422 --
NM_005037chr31171 ------
NM_005044chrX43890 3160 2810 119 21827 466 1827 23748 578
NM_005045chr73788 343 151 1681 ----
NM_005052chr17--1351 ----
NM_005054chr251700 1677 1598 462 145 11530 11340 --
NM_005056chr12155613 4947 4690 3974 3909 3767 3709 3651 2244 2214 1643 1393 1363 723 700 11016 ----
NM_005057chr141810 1791 348 33 1469 11331 --
NM_005063chr1033225 1450 1021 2772 246 13514 --
NM_005065chr14105027 4669 1996 1970 1191 941 935 912 893 66 34327 4189 1332 11831 --
NM_005066chr12761 752 ----177
NM_005069chr2141680 1102 622 366 --11219 --
NM_005078chr15----11562 --
NM_005079chr873159 3082 2963 2745 2041 1108 1047 ------
NM_005080chr221334 --1628 --
NM_005087chr31173 --1107 --
NM_005088chrX3642 207 200 --1890 --
NM_005093chr2044211 1272 1232 171 25254 688 11967 --
NM_005095chr1102201 2123 1831 1604 1566 1519 1469 888 647 391 ------
NM_005097chr101348 --1292 --
NM_005102chr22881 631 --1852 1700
NM_005105chr152224 2133 716 175 150 ----12007
NM_005109chr322570 1966 ------
NM_005110chr51635 --1720 --
NM_005112chr42988 975 ----1998
NM_005113chr141435 --1505 --
NM_005114chr43535 120 84 --1193 --
NM_005116chr2064177 3120 2933 1028 771 140 13476 12799 --
NM_005119chr121215 1131 ------
NM_005121chr1743796 2833 1326 235 23628 2563 11406 21139 805
NM_005124chr6----2688 71 --
NM_005126chr352259 1659 302 225 45 21638 1433 12175 --
NM_005128chr212506 115 --1169 143
NM_005133chr111268 --1397 --
NM_005134chr181898 --1307 --
NM_005141chr42353 45 ------
NM_005151chr1851778 1771 447 311 229 11652 ----
NM_005156chr975300 5022 4777 4237 1697 1674 852 23465 1555 64867 4727 4720 3782 1136 369 --
NM_005157chr92518 363 --11904 11558
NM_005160chr22136771 5445 5379 5278 5145 4301 2694 1569 1495 1061 538 458 226 14854 24513 1425 15578
NM_005163chr142774 98 --1657 --
NM_005164chr1272563 2497 1671 975 544 366 237 2821 682 --21022 895
NM_005168chr271751 1353 1265 1232 1171 465 372 11541 31681 1482 327 --
NM_005171chr1221131 360 ------
NM_005178chr19----1390 --
NM_005180chr1031520 653 518 ----11134
NM_005181chr83732 173 101 --1251 --
NM_005184chr1921520 336 ------
NM_005188chr1188194 5809 3023 2775 2712 2061 1619 214 38212 8201 5950 12086 17226
NM_005190chr621086 1008 --1722 --
NM_005194chr202570 117 ------
NM_005197chr1466153 5717 5210 4697 4655 1690 --16086 --
NM_005201chr341152 964 955 33 ------
NM_005204chr103946 799 100 2616 385 1292 --
NM_005207chr2242466 2398 1210 1118 13250 173 11151
NM_005215chr18----1238 --
NM_005219chr541691 1676 1537 1366 1715 ----
NM_005222chr71943 ------
NM_005229chrX2819 350 ------
NM_005230chr122545 398 --1119 1157
NM_005231chr1141405 1115 1100 163 --11275 --
NM_005233chr332063 1929 570 32497 2209 2170 ----
NM_005235chr2227570 7381 7248 6462 6285 6141 5603 5283 5240 2726 2574 1633 1186 1127 1087 991 886 876 655 638 491 312 56977 2904 2074 1570 794 26786 6621 --
NM_005238chr11103510 3231 2967 2857 2594 2431 1347 1197 307 112 ------
NM_005241chr321285 550 1857 11312 --
NM_005242chr511266 --1600 --
NM_005243chr22------1128
NM_005244chr201708 ------
NM_005245chr42625 512 ------
NM_005249chr142741 698 ------
NM_005254chr1551343 1182 1081 505 31 1171 --1900
NM_005256chr112736 390 --2793 611 --
NM_005257chr182994 204 1974 21427 329 --
NM_005259chr261547 1421 1384 1005 948 173 11172 ----
NM_005261chr81986 2976 919 1856 --
NM_005264chr102910 133 ------
NM_005271chr1031205 837 231 ------
NM_005277chr481961 1788 1640 1594 1433 1357 389 161 --21953 635 --
NM_005278chrX2451 206 ------
NM_005284chr61396 ----2357 178
NM_005292chr131151 1130 ----
NM_005296chrX4885 852 807 268 ------
NM_005302chr71417 1457 ----
NM_005308chr101367 ----1455
NM_005311chr752581 915 659 394 376 --11787 --
NM_005313chr153932 476 22 11081 ----
NM_005316chr113433 371 154 --1860 --
NM_005318chr2241196 1113 222 166 ------
NM_005324chr1791975 1698 676 644 550 513 107 101 49 ------
NM_005328chr81565 --1243 --
NM_005329chr1672358 2149 1984 1850 1468 949 932 --12231 --
NM_005339chr494286 4249 3863 3358 2904 1028 717 504 458 41269 497 282 213 ----
NM_005342chrX62822 2106 850 763 305 237 12716 2325 282 --
NM_005349chr41420 ------
NM_005358chr1341321 732 708 411 11613 --11724
NM_005359chr18106480 5921 5075 4520 4480 2572 1631 1038 741 89 22396 1980 24360 1363 --
NM_005370chr1911292 ------
NM_005375chr661150 984 898 797 386 145 --1847 --
NM_005376chr121106 145 1347 ----
NM_005378chr24690 96 43 34 2683 598 1865 --
NM_005380chr1------11080
NM_005381chr21276 ------
NM_005382chr83459 370 116 ------
NM_005384chr9263 28 ------
NM_005385chr352661 2526 1058 877 238 1206 12324 --
NM_005386chr203694 567 123 ------
NM_005387chr112711 219 ------
NM_005388chr941694 1641 1289 1167 --21503 398 --
NM_005398chr1041408 1040 1028 248 11463 ----
NM_005399chr1134215 4165 3572 3089 1452 1423 1399 1309 872 810 733 153 52 21732 1215 23885 987 --
NM_005400chr262964 2590 2584 2191 1029 723 ------
NM_005402chr741679 1194 438 100 3371 163 93 ----
NM_005407chr1411307 --11000 --
NM_005409chr441070 957 951 348 --1830 --
NM_005414chr3----2304 210 --
NM_005433chr1842579 2047 465 151 22431 1920 1965 1853
NM_005435chr71567 ------
NM_005436chr1073255 2664 2520 1511 1158 874 567 --23533 1240 --
NM_005440chr1753056 2983 2856 2630 823 --1973 --
NM_005443chr42121 75 ------
NM_005455chr12673 398 31417 1371 36 1375 1284
NM_005458chr912218 12371 12342 1897
NM_005460chr53584 525 87 1380 ----
NM_005465chr12567 399 ----11999
NM_005466chr141118 --1177 186
NM_005474chr1721260 245 ------
NM_005475chr1212006 1574 ----
NM_005476chr91138 1225 2875 433 --
NM_005487chr2242145 2123 1415 175 ------
NM_005494chr72199 70 --1241 --
NM_005497chr17125766 5622 5503 4467 4187 4107 3889 3758 1954 1285 437 378 14044 55161 5058 4259 3730 317 11407
NM_005499chr191141 ------
NM_005502chr953182 2869 2420 550 308 22319 2185 11038 23086 2099
NM_005504chr12126070 5955 5882 4252 2399 2174 1775 1621 755 600 296 71 35614 5532 2168 12270 --
NM_005509chr541822 1466 735 294 ----11365
NM_005513chr3--11496 ----
NM_005517chr161283 1186 1050 543 101 30 ------
NM_005519chr101157 1543 ----
NM_005520chr51542 ------
NM_005521chr101793 2821 269 ----
NM_005522chr73523 490 225 ------
NM_005530chr1521397 114 1289 ----
NM_005537chr131703 1366 --1214
NM_005542chr731946 1939 1244 ----11626
NM_005544chr2--1164 1358 --
NM_005545chr152718 113 ------
NM_005561chr134686 366 141 84 --1795 --
NM_005563chr12701 669 174 ----
NM_005570chr1821074 21 21174 174 ----
NM_005574chr112631 545 --184 --
NM_005575chr53262 66 23 1837 1870 --
NM_005578chr3154859 4830 4413 3661 3430 3256 1472 1405 1213 1180 1084 1022 869 307 235 --1751 --
NM_005584chr134787 764 626 535 --1582 --
NM_005585chr151318 ------
NM_005587chr153873 272 190 --126 --
NM_005593chr121191 1144 1552 --
NM_005595chr13685 657 301 1158 ----
NM_005596chr9145742 5297 5163 4662 4319 4083 2521 2433 2092 1603 1576 1400 1080 256 36029 1588 573 36271 6045 4929 --
NM_005598chr111155 --11289 --
NM_005602chr381152 1133 1108 1066 942 924 377 222 --1140 11296
NM_005604chr652476 2335 1900 1710 931 21009 854 ----
NM_005605chr81112 ------
NM_005607chr851036 795 185 169 101 ------
NM_005610chr11861 ------
NM_005611chr1621340 131 1178 ----
NM_005613chr152038 1856 1359 630 573 --1879 --
NM_005618chr61527 ------
NM_005625chr84959 928 813 718 31111 1041 376 ----
NM_005626chr13428 356 102 ------
NM_005627chr61203 1899 ----
NM_005629chrX41369 1160 168 100 ------
NM_005632chr16------160
NM_005637chr184773 684 398 355 --22044 1792 --
NM_005638chrX71296 1246 1223 1194 568 287 126 21768 1290 ----
NM_005639chr1241206 126 89 26 11799 11674 --
NM_005644chr1----1374 --
NM_005647chrX32725 819 525 --33314 3103 904 --
NM_005648chr81199 ------
NM_005649chr5------1398
NM_005650chr2221104 167 11384 ----
NM_005655chr811073 1320 1812 11315
NM_005662chr81338 ------
NM_005665chr154865 3958 3746 1648 1620 34954 3235 1086 11607 --
NM_005668chr583362 3266 2822 1543 1165 959 640 30 44204 4144 3044 1265 21756 1326 --
NM_005669chr531612 158 111 1604 1346 31651 322 187
NM_005686chr13446 136 95 --1453 --
NM_005688chr33474 413 150 --1950 --
NM_005707chr1531329 1256 922 ------
NM_005708chr131412 ----134
NM_005715chr692731 2525 2495 2465 2347 2077 1947 1751 1054 32548 1865 1745 22324 718 --
NM_005716chr191497 ------
NM_005717chr131279 1059 846 ------
NM_005719chr121214 --146 --
NM_005721chr23967 398 389 ----11082
NM_005722chr262483 2105 1957 1751 453 264 22071 298 2667 473 --
NM_005734chr113665 614 152 ------
NM_005737chr232298 904 463 --12290 --
NM_005738chr731666 691 544 --31907 1403 786 --
NM_005739chr1552284 1734 1726 471 393 ----1111
NM_005742chr24765 270 126 29 ----1832
NM_005746chr762356 2239 1854 974 178 132 ------
NM_005748chr12103104 2647 2634 2397 1227 796 494 278 199 79 --22709 1160 --
NM_005749chr171148 ------
NM_005751chr71507 --1345 --
NM_005754chr541030 911 278 131 11094 11131 --
NM_005756chrX1448 2222 98 ----
NM_005759chr2134743 4546 4301 4166 3946 3570 3384 1694 968 568 504 240 122 33322 3130 2984 24605 1807 --
NM_005765chrX3821 726 703 196 ----
NM_005766chr133512 491 478 ----1403
NM_005767chr131214 1117 ----
NM_005776chr143683 271 155 1117 ----
NM_005779chr573337 3034 2951 2602 1263 928 23 ----11397
NM_005786chr1841237 1203 468 414 21015 946 ----
NM_005788chr113715 586 215 ------
NM_005789chr1742041 1925 1375 539 --11650 21456 332
NM_005795chr232734 2610 2446 32582 2036 853 --12525
NM_005797chr1151202 724 520 395 277 11538 11750 --
NM_005798chr13135230 5190 5181 5113 4621 4589 4207 3921 3702 3575 2117 894 357 44741 4341 4029 3882 24411 873 --
NM_005802chr92808 627 2737 607 1205 --
NM_005807chr11480 170 ----
NM_005808chr353293 3081 2946 795 683 23136 729 --1218
NM_005813chr222473 2391 32660 274 38 ----
NM_005819chr152834 1369 607 563 483 12733 13450 --
NM_005822chr632254 1982 492 ------
NM_005826chr1--1263 1106 --
NM_005828chr1775073 4249 4235 3887 1861 1802 412 ------
NM_005832chr331170 562 549 --2492 250 --
NM_005836chr81193 141 ----
NM_005840chrX117202 6492 5951 5809 5767 5655 3013 2077 1880 1399 560 16716 36962 5311 3069 25686 2370
NM_005841chr42781 211 ------
NM_005842chr131292 ------
NM_005843chr271931 1814 1633 750 616 552 254 1522 11249 --
NM_005857chr161222 1153 1080 1040 980 434 1146 ----
NM_005859chr531063 978 528 1222 --11427
NM_005862chr351026 936 721 422 89 1751 2811 785 --
NM_005863chr101114 2578 96 ----
NM_005871chr104944 430 259 157 --1317 --
NM_005877chr2292575 2333 2307 2066 886 552 368 329 35 32378 906 897 ----
NM_005880chr162223 195 11602 ----
NM_005881chr161294 ------
NM_005882chr41179 --1244 --
NM_005884chr19--1657 ----
NM_005885chr511069 21585 316 ----
NM_005891chr61185 1145 ----
NM_005895chr1263452 3224 1419 1050 579 428 ------
NM_005896chr24638 532 277 63 ------
NM_005898chr1163172 2535 1256 1250 741 469 22978 284 1687 --
NM_005899chr1731564 634 296 1195 ----
NM_005900chr441233 796 776 50 --11167 1354
NM_005901chr18188629 8083 8037 7951 6255 6090 5406 5330 3470 2844 2164 1678 1640 1631 1588 752 360 118 13254 27739 6601 --
NM_005902chr1563047 1617 1134 852 717 225 13634 --11485
NM_005903chr584992 4164 3661 3609 1967 1666 1656 1020 45236 3815 746 283 64082 3688 2005 1332 854 418 --
NM_005904chr18155 --11372 --
NM_005906chr661693 1382 542 501 390 126 --1177 --
NM_005908chr43164 125 46 ------
NM_005909chr5134078 4007 3912 3774 3524 3348 3226 2708 1658 981 821 570 309 --1521 --
NM_005910chr1753989 3438 2979 977 806 13301 ----
NM_005911chr21388 ------
NM_005920chr143103 292 247 199 ------
NM_005923chr6----1275 1105
NM_005924chr72779 125 ------
NM_005927chr53197 186 81 --1170 --
NM_005930chr144799 585 85 46 ------
NM_005933chr1132565 1911 920 11074 ----
NM_005937chr1764154 3856 3796 2619 366 220 23294 448 ----
NM_005941chr893299 2881 1604 1561 1513 759 709 647 588 33615 3135 1406 ----
NM_005943chr621194 1128 1126 156 --
NM_005955chr195447 5352 4860 4835 4646 4550 3717 3653 260 24366 166 21583 928 25471 3587
NM_005962chr1022206 2169 32232 1697 1479 1890 --
NM_005962chr1022206 2169 32232 1697 1479 1890 --
NM_005963chr17173 ------
NM_005964chr1721037 478 1272 ----
NM_005966chr242397 2237 1898 410 32335 1585 252 --11603
NM_005968chr19--167 ----
NM_005977chr131373 --1281 --
NM_005982chr142217 91 --1225 --
NM_005985chr203752 717 162 ------
NM_005986chr1391936 1782 802 615 608 472 439 374 348 12416 ----
NM_005989chr7--11526 11115 --
NM_005994chr171897 1729 ----
NM_005999chr151226 1198 1154 319 123 --1578 --
NM_006005chr4------1309
NM_006007chr953079 1643 1327 1040 85 23534 1567 ----
NM_006011chr1554205 4167 3273 1207 1196 ----14144
NM_006016chr652061 1719 1543 1474 886 ------
NM_006022chr1341069 927 843 361 ------
NM_006029chr143490 258 47 ------
NM_006033chr1842074 2031 1612 603 ------
NM_006035chr1441285 1232 1127 107 ------
NM_006036chr2102445 2390 2288 2033 2013 1973 1923 1809 909 539 2927 550 11828 1404
NM_006037chr284370 4304 4229 3955 3371 1671 1593 1223 24259 1435 23884 1428 13176
NM_006038chr2041343 239 222 105 ------
NM_006040chr1621290 1103 --1467 --
NM_006043chr16----1694 --
NM_006047chr2063140 2779 2631 2211 850 468 23350 2198 ----
NM_006048chr121189 398 ------
NM_006060chr7104281 3762 3529 3181 2706 1709 1668 1596 816 576 23391 1028 ----
NM_006063chr21197 ------
NM_006067chr161332 --1801 --
NM_006070chr3----1113 --
NM_006076chr741037 991 479 86 ----1592
NM_006079chr66809 711 588 297 177 91 ------
NM_006080chr722922 479 32627 784 237 12215 11039
NM_006084chr14------1312
NM_006088chr9----1144 --
NM_006089chrX41708 1599 1212 233 2702 55 --11734
NM_006090chr1--1647 ----
NM_006094chr842413 2270 927 151 21776 355 2953 692 11969
NM_006095chr4144494 4171 4162 4011 3666 3564 2838 1700 1400 1300 1175 896 678 499 34151 3074 1769 --13575
NM_006099chr12870 133 ------
NM_006106chr1163399 3147 1040 541 388 263 33281 341 133 21030 702 --
NM_006107chr171408 ------
NM_006108chr1162095 1791 1594 951 934 107 22271 1922 11485 12352
NM_006113chr182123 2066 1987 1900 774 548 365 104 ------
NM_006114chr192415 186 1471 ----
NM_006116chr2241608 1484 1368 1196 ------
NM_006133chr1112378 ------
NM_006134chr2151334 1154 1112 123 23 1299 21371 362 --
NM_006135chr13410 401 377 1307 11371 --
NM_006136chr731256 918 175 129 1514 --
NM_006139chr282521 2365 2200 2146 734 617 252 165 2796 373 22294 861 --
NM_006141chr1642061 829 568 306 12283 22499 1981 12517
NM_006148chr1712850 --12668 --
NM_006154chr15112923 2818 2722 2618 2222 893 787 637 193 174 138 22906 469 42265 2009 996 431 --
NM_006155chr241949 1845 1535 39 1120 1185 --
NM_006158chr831355 1146 560 ------
NM_006159chr121579 ------
NM_006161chr52655 24 --1247 1568
NM_006164chr2--188 2397 362 --
NM_006166chr12102568 2096 1939 1772 1671 725 562 499 418 343 1889 12069 --
NM_006178chr1741348 1274 292 224 ------
NM_006180chr91163 ------
NM_006186chr21817 --21070 219 --
NM_006191chr121646 1223 ----
NM_006194chr141935 1882 ----
NM_006195chr921134 1046 ----1213
NM_006202chr1941936 1239 346 268 1698 ----
NM_006203chr5145496 4352 4206 3730 3652 3506 2104 2002 1918 1228 979 887 596 557 14635 1894 13541
NM_006204chr101212 137 ----
NM_006206chr462478 2383 2043 636 509 445 21833 68 32763 2273 543 --
NM_006216chr2140 --1665 --
NM_006223chrX136 ------
NM_006224chr1752458 2418 1689 334 87 11946 124 --
NM_006226chr241180 885 404 366 ------
NM_006237chr1341957 1862 544 115 --152 --
NM_006241chr362417 2388 2250 2226 1995 250 --1528 1205
NM_006243chr111064 ------
NM_006251chr572734 2485 2197 2059 1190 524 191 22444 863 ----
NM_006252chr1167477 7395 7296 7244 7150 6106 6087 5462 5373 5258 4840 2904 2796 2558 825 71 12751 26043 4896 --
NM_006254chr31155 ------
NM_006255chr141788 11027 11136 --
NM_006256chr1101991 1922 1900 1088 1073 1034 717 316 272 188 22415 1098 32728 2478 2207 --
NM_006257chr101283 1968 ----
NM_006258chr10--11531 11059 --
NM_006264chr43571 501 26 1186 ----
NM_006265chr831462 1213 137 ------
NM_006267chr231740 218 147 21215 640 ----
NM_006275chr2052447 1002 836 748 39 11755 1969 --
NM_006277chr21268 1519 ----
NM_006279chr11328 ------
NM_006281chr821062 435 ------
NM_006281chr821062 435 ------
NM_006282chr2042918 1903 563 86 24131 1893 23389 232 --
NM_006283chr8104634 4412 3667 3409 3276 1728 1677 319 149 35 23870 1664 34118 1922 1200 --
NM_006284chr11122 ------
NM_006287chr272090 1899 1818 777 638 559 130 --11883 --
NM_006292chr11----1174 --
NM_006298chr632956 2632 821 33393 2753 2188 32725 629 541 --
NM_006310chr1711288 1984 1381 --
NM_006313chr1291670 1499 1476 1448 1205 1084 687 155 33 1635 1511 --
NM_006315chr4124328 4278 3843 2869 2835 2754 1722 1239 1132 793 639 65 --23697 2800 --
NM_006320chr4--11151 ----
NM_006321chr331957 859 174 ------
NM_006322chr132602 191 1322 ----
NM_006323chr42484 93 ------
NM_006330chr821529 1046 21203 1146 ----
NM_006333chr22447 147 1466 --1544
NM_006334chr9----2221 98 --
NM_006335chr151034 879 863 434 213 --1138 --
NM_006345chr431050 888 254 11199 1313 --
NM_006346chr132397 348 1182 2355 97 --
NM_006352chr121720 1508 --11478 1135
NM_006353chr641150 918 295 28 1534 ----
NM_006359chrX52336 2251 752 533 234 21973 1861 --1910
NM_006363chr204642 557 213 83 1119 ----
NM_006364chr1491312 1167 1023 894 488 478 465 425 57 ------
NM_006366chr641290 1177 392 330 --1168 --
NM_006367chr111074 ----1285
NM_006372chr61483 ------
NM_006373chr1721008 81 ------
NM_006379chr762189 2006 1997 1670 738 488 11440 1158 --
NM_006380chr17124375 4023 3658 3398 3268 1686 1128 795 693 643 289 229 24087 974 11620 --
NM_006386chr2241655 578 501 224 2665 45 ----
NM_006389chr1111207 --11357 --
NM_006390chr121674 --21142 141 2482 42
NM_006393chr1094302 3094 2793 1269 1241 901 758 362 75 21757 1714 1183 14235
NM_006401chr92381 339 1447 1333 --
NM_006403chr621772 309 1129 21370 371 --
NM_006413chr1031026 559 313 ----1220
NM_006416chr61695 --1703 --
NM_006420chr2083311 3278 2765 2473 2337 2199 1123 249 --12977 12120
NM_006421chr82921 28 ------
NM_006424chr421793 1662 --21558 181 --
NM_006430chr22409 130 ------
NM_006431chr121174 ------
NM_006449chr241379 810 374 231 32168 2135 688 ----
NM_006451chr551038 848 837 729 321 1413 ----
NM_006457chr4144064 3835 3735 3484 3394 3061 3021 2700 2651 1642 1307 1051 205 194 13125 32990 1174 560 12924
NM_006459chr1031860 1589 1560 11495 ----
NM_006460chr1721487 1322 1350 2449 278 --
NM_006464chr284534 4188 3149 1520 1423 977 573 508 11448 23300 235 --
NM_006466chr204664 425 245 29 ------
NM_006467chr552072 1535 918 147 95 31907 768 756 --1417
NM_006469chr12232 157 11435 21118 209 --
NM_006471chr183122 95 42 ------
NM_006472chr151171 913 515 268 69 --11199 1803
NM_006482chr12153413 3281 3271 3184 3087 2452 1572 1253 1119 1019 837 312 204 158 129 23345 1295 12854 --
NM_006489chr1441792 1700 218 50 22040 274 172 --
NM_006494chr191134 ------
NM_006497chr172812 527 ------
NM_006504chr1072941 2730 2682 2648 2471 2187 1087 1531 31009 440 402 --
NM_006516chr121501 1100 ------
NM_006517chrX5776 277 115 72 65 ------
NM_006519chr61326 1320 1109 --
NM_006520chrX3554 472 435 ------
NM_006526chr2021949 1397 --21655 817 1674
NM_006527chr44563 230 147 84 1643 ----
NM_006529chr431531 667 331 11627 ----
NM_006534chr2063421 2859 2711 2629 1043 317 --11302 21265 721
NM_006536chr12376 192 ------
NM_006537chr151623 --196 --
NM_006538chr294062 3892 3579 1661 1292 1217 884 738 39 14130 --11173
NM_006539chr162147 102 ------
NM_006540chr831587 1336 994 ------
NM_006544chr14135805 5754 4913 4876 4524 4194 3942 3830 2139 1464 1070 537 116 55317 4936 4816 1796 1638 35371 1314 349 11532
NM_006546chr17126656 6066 5749 5683 5559 5168 5110 4758 2640 2393 1186 693 --24056 248 11465
NM_006547chr762108 1996 1983 1913 1647 272 2630 176 1552 --
NM_006548chr3----21384 1160 --
NM_006549chr1242395 2227 860 424 11057 22859 262 --
NM_006554chr22290 247 ------
NM_006557chr941737 1564 1443 392 11727 21656 299 --
NM_006558chr81139 1329 ----
NM_006559chr121140 1093 ------
NM_006561chr10186021 5531 5405 4402 4178 3940 2382 2116 1674 1657 1648 1568 1334 1104 997 608 578 529 2565 33 12470 --
NM_006565chr1641169 1097 840 793 1110 11163 --
NM_006570chr91374 ------
NM_006571chr8130 1111 ----
NM_006572chr1753137 2926 2331 2174 307 --1140 --
NM_006574chr3----1296 --
NM_006575chr1441209 1132 1019 423 1359 --1134
NM_006577chr231225 1013 246 1301 ----
NM_006595chr1171857 1802 1313 809 605 493 206 --11284 --
NM_006597chr11------1177
NM_006599chr16158086 7993 7060 5489 5447 5118 5061 2501 2082 1949 1581 1432 1038 867 370 107422 7265 7135 6348 6049 6033 2531 947 886 79 26579 5378 26774 5820
NM_006601chr121129 1120 11062 --
NM_006602chr202573 155 1526 2340 272 --
NM_006603chrX61736 1287 1271 633 327 37 ------
NM_006609chr222029 1159 12564 171 41898 1886 1875 272
NM_006614chr343297 680 253 184 22585 1450 1157 --
NM_006618chr151605 518 478 196 143 ------
NM_006620chr661597 1176 1141 847 813 253 13796 12949 --
NM_006621chr161977 1706 1613 1490 1351 626 ------
NM_006622chr5--1566 ----
NM_006624chr1051821 426 272 121 100 --22089 251 --
NM_006625chr131141 395 205 11165 --1173
NM_006625chr131141 395 205 11165 --1173
NM_006625chr131141 395 205 11165 --1173
NM_006626chr93601 512 74 2520 432 22336 2133 --
NM_006628chr15104504 4005 3988 3981 3912 3115 1027 717 706 69 11646 13608 --
NM_006636chr23878 330 285 4758 682 647 368 ----
NM_006640chr1731775 1617 378 179 ----
NM_006646chr1363074 2761 2421 739 657 432 ----22142 981
NM_006648chr9----1118 --
NM_006650chr521057 907 ------
NM_006654chr12114770 4530 4481 4193 3558 3187 1772 1157 1067 819 70 23704 730 24060 972 24042 1222
NM_006658chr72860 91 ------
NM_006662chr161264 ------
NM_006667chrX1109 ------
NM_006670chr62597 81 1532 ----
NM_006675chr1253156 2403 2280 1135 334 --13336 --
NM_006681chr4162 ------
NM_006682chr792712 2460 2287 2242 1935 1928 1143 767 141 12226 32253 793 362 2170 65
NM_006690chr2042310 1753 1668 712 12329 --11766
NM_006698chr2041222 547 503 496 ------
NM_006699chr162568 2501 2349 2342 1026 449 3912 461 179 12530 --
NM_006700chr124805 583 137 54 ------
NM_006706chr53332 154 127 ------
NM_006710chr24921 746 208 162 ------
NM_006711chr162328 62 --1792 1770
NM_006713chr52201 136 ------
NM_006717chr963311 3257 2857 2283 801 302 33214 2378 825 22416 178 --
NM_006721chr104834 287 277 98 ------
NM_006722chr343075 1087 818 309 1461 ----
NM_006727chr5--1193 188 --
NM_006729chrX125270 5143 4448 3798 3532 1253 1064 657 635 513 146 105 54608 811 778 765 226 24120 55 --
NM_006731chr9165714 5257 4803 4587 4511 3780 3608 2141 1840 1771 1457 830 753 536 456 432 34869 1234 887 ----
NM_006734chr691441 1167 631 514 493 257 130 43 35 --2280 220 --
NM_006738chr1543425 3205 3054 2978 1640 --12951
NM_006743chrX1877 1369 ----
NM_006745chr421017 916 1168 11092 --
NM_006746chrX41138 1025 249 73 ----11388
NM_006749chr841281 1269 1259 1059 ------
NM_006750chr1697741 7474 6946 6690 2965 2947 2583 834 327 16806 25769 2573 --
NM_006751chr22900 300 --183 --
NM_006754chr721121 238 ------
NM_006756chr851491 1456 1329 1128 384 31507 1228 1199 11354 --
NM_006759chr21295 ----187
NM_006763chr131781 1729 1526 22143 1956 ----
NM_006765chr82237 27 ------
NM_006766chr862723 2209 492 403 302 181 52692 1745 1664 1087 221 32670 2529 967 --
NM_006769chr11158 ------
NM_006772chr61448 ------
NM_006775chr652980 2227 999 932 122 12353 --33017 2914 993
NM_006777chrX32896 1180 494 22615 670 12686 1373
NM_006783chr131238 --1282 --
NM_006788chr1832032 1797 1751 11490 ----
NM_006790chr5162 ------
NM_006791chr15146 ----1493
NM_006800chrX3596 505 214 ------
NM_006803chr851739 1383 745 607 37 1269 ----
NM_006805chr55632 547 494 398 224 ------
NM_006806chr21--1332 --1174
NM_006807chr172994 482 11139 2383 242 --
NM_006811chr202403 233 ------
NM_006814chr2042627 2389 1995 405 --2893 345 --
NM_006815chr1241015 536 424 85 --1528 1361
NM_006818chr11832 3683 626 82 ----
NM_006822chr171555 1275 ----
NM_006823chr82237 68 --11171 --
NM_006826chr231204 1082 514 21303 1012 1838 --
NM_006827chr1473205 3107 3070 1320 1220 1214 295 1608 ----
NM_006828chr63649 476 248 ------
NM_006831chr111266 1406 ----
NM_006832chr14--1105 1711 11075
NM_006837chr8------122
NM_006838chr124430 410 302 115 ------
NM_006851chr1282704 2449 2266 2105 837 643 289 83 22119 1010 ----
NM_006852chr1742761 2413 2183 1954 22804 2136 ----
NM_006854chr712020 21549 622 ----
NM_006856chr1241018 797 729 336 ------
NM_006861chr1232057 1563 147 ------
NM_006870chr201335 ------
NM_006874chr43880 862 104 ----1396
NM_006875chrX1266 ------
NM_006885chr1683862 3724 1309 1090 1063 847 732 522 13773 11447 --
NM_006888chr1483404 3094 2927 2835 2685 1338 1192 555 --11102 --
NM_006892chr2041264 1155 494 243 ------
NM_006892chr2041264 1155 494 243 ------
NM_006910chr162382 115 ------
NM_006912chr162534 1656 1594 898 764 615 --21699 963 --
NM_006914chr931090 345 118 ----1333
NM_006915chrX62058 580 548 461 368 73 2226 181 ----
NM_006916chr23498 353 188 --21106 948 --
NM_006918chr11145562 5484 5019 4954 4577 4040 3807 3677 3549 2281 1928 979 862 339 34348 1294 641 24811 1423 --
NM_006920chr272077 1923 1525 1516 580 386 362 31445 1321 332 11541 11293
NM_006922chr262013 2002 1646 837 579 384 ------
NM_006924chr17134415 4240 3933 3855 3157 2780 1371 973 902 706 672 573 74 33296 598 432 ----
NM_006930chr531530 638 96 180 --31738 316 166
NM_006937chr17----1197 --
NM_006939chr14--21011 840 192 --
NM_006940chr1261851 1481 1356 766 753 494 2578 108 ----
NM_006947chr441716 698 597 234 31791 1133 396 ----
NM_006948chr2142485 1601 775 308 ------
NM_006951chr10----2780 266 --
NM_006962chrX--166 ----
NM_006965chr1831040 1025 482 1426 ----
NM_006980chr73751 225 130 --1741 --
NM_006981chr922497 2251 13016 1290 --
NM_006990chr11193 --12464 --
NM_006991chr3----21006 176 1723
NM_006993chr102278 260 ------
NM_006996chr131438 1189 104 11534 11861 --
NM_006997chr102399 98 ------
NM_006999chr52444 296 --1608 11883
NM_007005chr911536 11302 146 --
NM_007006chr1672832 2731 2543 2192 308 224 206 23174 550 ----
NM_007007chr12124742 4720 4201 4087 4073 3300 3042 1691 1550 529 389 180 34677 4448 1245 23073 1716 --
NM_007011chr15146820 6551 6244 6232 5993 4323 4270 2451 1994 1843 1454 615 586 386 26803 1542 25417 1478 11953
NM_007013chr84951 890 740 35 1174 1791 --
NM_007017chr52699 631 1856 ----
NM_007019chr20----1173 --
NM_007023chr241018 978 758 346 --1894 --
NM_007026chr172212 197 ------
NM_007033chr131698 1651 172 ----11640
NM_007034chr141025 1003 743 722 ----1872
NM_007038chr21126050 5614 4867 2206 2062 2052 1891 1296 1036 905 623 350 23863 417 ----
NM_007039chr1491889 1860 1648 625 536 275 264 79 63 --1856 --
NM_007040chr1921031 446 --1185 --
NM_007042chr352523 2302 2289 780 320 12659 32444 919 210 --
NM_007043chr1272015 1858 1687 860 570 354 285 11374 ----
NM_007045chr62116 57 1158 ----
NM_007050chr2047801 5916 5043 1215 23008 2647 47590 2389 1611 1344 --
NM_007052chrX1546 189 132 --
NM_007064chr311339 --11242 1644
NM_007073chr643713 3691 1541 1484 54176 3298 3044 1179 891 169 12854
NM_007078chr1073057 2471 1971 1221 1068 244 170 --12561 --
NM_007084chr1371550 1403 1193 1181 1018 294 233 11300 ----
NM_007087chr16--140 ----
NM_007106chr1352419 1719 1063 301 179 ------
NM_007107chr311877 11542 1913 12283
NM_007114chr373170 3014 2696 2569 2211 241 42 33212 1004 275 21233 981 11141
NM_007115chr23478 359 332 ------
NM_007118chr51624 1872 ----
NM_007124chr63732 446 398 31780 1427 392 --1759
NM_007125chrY2362 192 ------
NM_007137chrX95520 5049 4670 4307 3967 1859 615 501 442 ------
NM_007144chr1741324 264 85 53 ------
NM_007145chr192451 239 11347 11236 --
NM_007146chr1731808 1155 505 2352 200 2863 136 1523
NM_007157chrX62791 2374 2252 1894 837 37 1550 32648 1972 437 --
NM_007158chr131181 300 270 1190 1360 --
NM_007159chr351647 1530 493 366 80 11415 ----
NM_007166chr1151593 1535 1437 1403 1046 --11397 --
NM_007170chr12925 270 ------
NM_007172chr2272955 2906 2289 2186 1049 855 523 23220 2748 1620 --
NM_007173chr1162414 2316 689 549 516 232 ----1901
NM_007174chr1262159 2123 1951 826 778 496 1367 22145 244 --
NM_007175chr883561 3358 3282 3176 2836 2316 1220 610 ------
NM_007176chr1431561 1152 116 --1678 --
NM_007185chr12885 333 ----11003
NM_007187chr133966 892 354 ------
NM_007190chr1061107 1043 955 929 757 733 --21159 25 --
NM_007191chr122555 445 1678 ----
NM_007195chr1843535 1136 352 232 1223 ----
NM_007197chr123926 745 179 ------
NM_007198chr8--1371 21522 1277 --
NM_007200chr1543425 3205 3054 2978 1640 --12951
NM_007202chr171718 1640 ----
NM_007203chr983346 3080 2764 2565 2498 1362 771 483 23726 1578 1904 177
NM_007204chr14648 191 149 99 ------
NM_007207chr11791 2357 142 ----
NM_007212chr142289 2106 289 78 32166 1500 558 --1870
NM_007214chr631325 900 475 11310 ----
NM_007217chr3127 1320 ----
NM_007218chr82973 248 ------
NM_007220chrX73841 3653 771 554 407 116 92 1833 23159 885 --
NM_007222chr831338 1134 264 --11148 --
NM_007231chrX42095 2045 573 540 12411 1287 1886
NM_007235chr121512 ------
NM_007236chr15----11648 12347
NM_007240chr1--1187 ----
NM_007245chr161914 ------
NM_007246chr42839 83 21031 676 --1105
NM_007249chr13219425 9343 8990 8242 8129 7769 7277 7018 6948 6876 5792 3761 3636 3455 2692 2669 2593 1820 1413 319 300 26505 5702 59388 7618 3695 3474 2554 26933 1107
NM_007259chr12522 206 ------
NM_007269chr11167 ------
NM_007270chr721412 1253 21452 422 ----
NM_007276chr71182 11094 ----
NM_007279chr192647 632 ------
NM_007285chr163324 109 63 ------
NM_007286chr532142 1938 744 ------
NM_007287chr343091 1175 539 448 ------
NM_007288chr343091 1175 539 448 ------
NM_007289chr343091 1175 539 448 ------
NM_007308chr42499 171 1601 ----
NM_007313chr92518 363 --11904 11558
NM_007324chr1------172
NM_007331chr492612 2499 1984 1946 1859 956 723 513 479 32695 2316 2013 22288 191 11748
NM_007332chr841346 583 293 101 ------
NM_007345chr1832029 1477 65 12111 21770 504 --
NM_007347chr1563160 2060 1984 962 897 88 23169 717 ----
NM_007349chr7177 1437 2451 378 --
NM_007350chr12134638 4201 3413 1679 1653 1527 1011 995 865 555 510 373 178 --22993 492 --
NM_007358chr141816 1563 1432 723 11320 ----
NM_007359chr1741469 622 610 396 ------
NM_007361chr142514 133 --1557 --
NM_007362chr361466 1083 974 475 303 90 --11277 --
NM_007363chrX1749 21082 770 1982 --
NM_007373chr1031539 1203 322 --11150 --
NM_007375chr182729 2460 2283 2195 1725 691 574 151 --12160 12454
NM_009585chr33205 97 70 1866 ----
NM_009585chr33205 97 70 1866 ----
NM_012069chrX22714 2137 22325 1813 --11764
NM_012074chr1421075 819 --11052 --
NM_012081chr583392 2988 2963 2639 937 914 167 134 22998 149 13481 --
NM_012082chr83657 385 186 1724 --1364
NM_012083chr102422 110 --11187 --
NM_012089chr151506 1385 1232 428 292 ------
NM_012090chr141274 1164 826 35 ------
NM_012093chr121249 255 ------
NM_012095chr1042179 817 601 106 22466 1301 13032 --
NM_012096chr373680 3409 2799 1284 619 419 398 53600 1372 1039 793 136 1583 1683
NM_012097chr252185 2177 599 298 230 22253 593 11776 --
NM_012099chr191335 --1185 --
NM_012102chr142171 1867 914 881 ------
NM_012104chr1163363 3351 3337 2677 2531 58 ----13027
NM_012104chr1163363 3351 3337 2677 2531 58 ----13027
NM_012108chr42506 66 1428 ----
NM_012110chr41265 ------
NM_012120chr682955 2557 2131 2040 1937 520 424 233 12546 1885 --
NM_012124chr112332 114 1682 ----
NM_012129chr742511 2260 533 87 22432 1868 11690 --
NM_012137chr132131 1170 481 12734 --12789
NM_012141chr13154055 3686 3559 3050 2721 2578 2569 1598 1471 1392 1091 371 218 173 85 31381 795 152 33987 3976 495 --
NM_012153chr1152235 2046 1695 892 90 1718 ----
NM_012154chr82647 318 1684 ----
NM_012156chr2093143 3120 2883 2432 2322 705 619 557 25 ------
NM_012158chr1381862 1816 1786 1749 1445 1208 742 357 31795 1199 384 1449 --
NM_012161chr45925 791 432 245 191 1767 21105 1089 162
NM_012164chr9117487 7392 6103 5664 5351 5330 2722 2576 2514 1209 236 45417 2904 2199 1826 36382 6238 269 16815
NM_012176chr51232 ------
NM_012183chr11427 ------
NM_012193chr1184562 4415 3542 1812 1747 1528 820 31 42085 735 409 263 24464 54 --
NM_012197chr91651 --1517 --
NM_012199chr1114513 4503 4382 4338 4050 3680 1815 1119 921 720 650 24428 403 43994 3235 1130 1004 --
NM_012207chr102236 189 ------
NM_012214chr2166267 6089 5974 5501 5341 4327 3958 2566 2537 1974 1967 1871 593 509 215 24 44765 964 747 334 65825 5611 1294 1236 650 349 15298
NM_012215chr1041915 1273 621 155 --41706 1606 765 601 --
NM_012218chr19136 1683 ----
NM_012223chr231095 986 21 11110 ----
NM_012224chr43432 161 42 1236 ----
NM_012229chr101287 11396 11025 --
NM_012233chr21836 ------
NM_012234chr383707 3471 3129 1354 952 767 266 195 13700 22339 2317 12654
NM_012238chr1071318 1301 694 621 427 344 178 11279 1519 --
NM_012242chr103817 602 223 ------
NM_012247chr104977 866 703 258 1366 1963 --
NM_012249chr253379 3068 2875 865 651 53086 2916 2533 681 219 ----
NM_012250chr1131144 988 866 21326 279 ----
NM_012252chr7105255 4498 3952 3739 3419 2150 1213 1172 1159 947 24057 633 --15313
NM_012255chr201429 --1106 --
NM_012257chr71836 1205 --1861
NM_012259chr651405 1356 1286 1085 948 1520 ----
NM_012262chr1145190 5088 5038 4693 4543 4365 4283 4107 3757 3198 3178 1449 1232 937 11714 51373 880 459 346 194 23553 1802
NM_012281chr752001 1734 579 364 176 --1798 --
NM_012286chrX248 25 1244 ----
NM_012288chr685738 5672 5431 5065 4782 4327 631 154 12123 11393 11168
NM_012290chr231514 466 69 1676 ----
NM_012294chr793590 3011 2735 1422 1396 1218 1010 615 395 --2921 38 --
NM_012297chr492647 2342 2044 2013 1988 1974 1923 1714 333 1665 --1588
NM_012300chr531944 859 460 11619 1376 --
NM_012301chr731469 705 664 ------
NM_012302chr131009 789 360 1313 ----
NM_012307chr181835 --1254 --
NM_012308chr1122038 695 --22219 1752 --
NM_012309chr1194514 4249 4075 3305 1155 980 535 504 295 33982 3105 3015 13366 14330
NM_012316chr163580 3435 2084 2019 581 444 --34961 4648 4287 --
NM_012322chr74401 295 145 75 ------
NM_012323chr22--11170 11255 --
NM_012325chr2021603 1126 21641 1588 1141 --
NM_012327chr182629 251 11316 11261 --
NM_012328chr711160 1106 1946 --
NM_012329chr1741192 434 389 49 ------
NM_012330chr1061756 1335 1245 693 412 228 11216 1485 --
NM_012333chr131433 567 514 ------
NM_012334chr563561 3527 3417 3387 1209 950 2731 624 14402 14510
NM_012342chr10------173
NM_012343chr51781 1280 --1422
NM_012345chr1341449 1365 616 394 31849 1629 1318 11292 --
NM_012347chr632277 1201 28 --42985 2929 2660 1169 22552 426
NM_012382chr5104259 3306 1433 1358 918 830 742 569 484 410 21308 278 21674 757 --
NM_012383chr91446 ------
NM_012384chr2021561 830 --22458 753 --
NM_012388chr1563016 3005 2915 2503 1018 428 12309 --1722
NM_012394chr1----121 --
NM_012397chr1851720 1624 1580 1182 108 21754 1496 1601 --
NM_012398chr1922700 246 ------
NM_012412chr73605 558 261 ------
NM_012419chr62149 24 --2638 444 --
NM_012428chr154963 862 380 313 1175 ----
NM_012433chr21239 ------
NM_012434chr62384 109 1216 ----
NM_012443chr102801 777 1151 2861 259 --
NM_012446chr5--1410 ----
NM_012449chr7122 ------
NM_012454chr63454 230 125 139 ----
NM_012463chr1261642 1465 1288 1279 1251 1193 --1494 --
NM_012464chr462161 1932 1896 1042 1021 633 1625 22417 514 12876
NM_012465chr1062187 1228 1140 908 862 469 12859 ----
NM_012471chrX61951 1896 393 338 181 158 ------
NM_012479chr742168 1981 1837 158 --2643 410 --
NM_013229chr1232652 1810 520 12808 12664 --
NM_013230chrY61754 1391 1339 1170 584 507 ------
NM_013231chr14124351 4116 4049 3379 1594 1452 1406 1268 861 340 120 112 23652 1278 23618 2758 --
NM_013233chr231288 1131 267 1429 ----
NM_013235chr5--2868 644 ----
NM_013237chr5------171
NM_013243chr151465 ------
NM_013246chr11149 --1802 --
NM_013253chr1131328 1035 152 --1575 --
NM_013254chr121603 1571 ----
NM_013255chr7178876 8780 8385 7816 7215 7146 7100 7037 5831 5814 5460 3198 2730 2686 1081 446 228 57181 2543 2127 1477 268 25564 1432 22738 1923
NM_013257chr842067 1980 171 105 12005 31784 1511 631 --
NM_013261chr443545 3021 1454 853 23582 107 ----
NM_013262chr661348 1325 1304 1264 457 411 11242 11136 --
NM_013263chr16139 ------
NM_013269chr1234540 3348 855 2603 61 24372 3209 --
NM_013272chr153390 256 48 ------
NM_013275chr162812 130 --2735 629 --
NM_013277chr122898 95 --2911 201 --
NM_013281chr2061241 1108 596 414 407 294 ------
NM_013282chr1921007 173 --21307 442 --
NM_013283chr52583 210 --158 196
NM_013286chr363634 3478 1077 822 491 84 23823 3077 ----
NM_013293chr73204 137 30 1170 ----
NM_013296chr12421 58 ------
NM_013300chr121212 ------
NM_013302chr1694708 3861 3122 1349 839 766 608 589 139 --63481 1578 1301 859 463 102 --
NM_013305chr181138 ------
NM_013309chr1592661 2597 2118 1717 838 714 640 350 339 31923 587 364 ----
NM_013316chr71212 ------
NM_013322chr761732 1546 1252 1090 692 338 ------
NM_013323chr1711189 --1444 --
NM_013336chr32402 153 ------
NM_013341chr262491 2165 1950 996 946 784 12903 12530 --
NM_013354chr8--1122 --1433
NM_013357chr81766 1638 ----
NM_013372chr1522582 587 ------
NM_013374chr352796 2669 2292 552 303 22915 656 1843 --
NM_013381chr1251798 1734 620 580 57 21592 649 ----
NM_013386chr131498 1414 1174 2612 229 51516 1343 1152 603 106 11313
NM_013390chr951739 1385 299 255 101 ----169
NM_013396chr2121075 287 31142 954 200 ----
NM_013423chrX11015 ----11090
NM_013427chrX11015 ----11090
NM_013436chr21742 --134 --
NM_013437chr82991 317 21314 922 21432 1298 --
NM_013438chr941602 509 226 82 --1423 1133
NM_013444chrX41085 357 97 91 --21026 441 1144
NM_013446chr741188 522 324 300 11373 31440 1045 1012 --
NM_013448chr142768 254 ------
NM_013449chr1242559 1152 1127 67 ------
NM_013450chr251177 923 390 382 154 ----1792
NM_013943chr193040 2978 2892 2131 2109 1215 633 618 52 22264 270 --1726
NM_013951chr232395 1736 434 11637 --11920
NM_013952chr232472 1813 511 11714 --11997
NM_013953chr232472 1813 511 11714 --11997
NM_013975chr173557 507 421 1435 ----
NM_013981chr5--1154 ----
NM_013982chr5--1154 ----
NM_013983chr5--1154 ----
NM_013986chr22------1128
NM_013992chr232472 1813 511 11714 --11997
NM_013993chr61756 ------
NM_013994chr61756 ------
NM_013995chrX72530 2499 972 763 752 492 404 1292 21037 818 --
NM_013996chr7--1529 ----
NM_013996chr7--1529 ----
NM_013997chr7--1529 ----
NM_013997chr7--1529 ----
NM_013998chr7--1529 ----
NM_013998chr7--1529 ----
NM_014000chr1041981 1395 653 182 11789 ----
NM_014011chr252615 2257 294 227 39 22495 2060 ----
NM_014016chr341543 1356 433 74 1674 ----
NM_014021chr182990 2950 2705 2449 2380 2311 1089 728 --1306 --
NM_014023chr1052706 2066 1842 190 85 --1969 1733
NM_014031chr5----1303 --
NM_014034chr641549 1294 587 282 1430 11257 --
NM_014048chr16155323 5166 4598 4566 4323 4132 4011 3819 3231 1670 886 856 455 448 230 34965 1146 372 35299 4681 3589 1625
NM_014057chr9101574 1567 1492 1387 1305 1296 996 645 393 110 ------
NM_014079chr331066 177 57 ------
NM_014089chr1321801 1727 --1545 12147
NM_014106chr1572755 2617 2442 1891 315 254 117 32995 2519 2212 22073 74 1234
NM_014109chr861236 1177 862 776 298 53 --1342 --
NM_014110chr13750 301 288 ------
NM_014112chr8145006 4882 4791 4375 3947 3807 2197 2191 2019 2007 1816 973 734 228 2797 756 34898 2205 1834 --
NM_014117chr16102684 2198 2179 2171 2079 1772 1689 920 647 451 21736 914 1762 --
NM_014142chr10125 ------
NM_014154chr351433 1254 1099 1058 208 11037 11444 --
NM_014155chr11137204 6605 6339 5968 5177 4986 4709 2972 2360 2085 1849 1418 413 47083 6318 6233 4883 36790 799 139 12993
NM_014157chr1663308 3167 1340 1236 759 246 11488 13758 --
NM_014171chr23652 138 42 1304 1264 --
NM_014175chr82139 114 ------
NM_014181chr252855 2686 2585 763 363 --12798 --
NM_014188chr12266 51 ------
NM_014190chr411761 --11180 --
NM_014191chr121979 2388 357 ----
NM_014211chr52453 311 ------
NM_014217chr131610 1225 208 --31781 175 80 --
NM_014223chr12579 206 1770 1294 --
NM_014233chr172290 114 --21984 1885 --
NM_014240chr373216 2865 2820 1361 1148 738 219 11544 13709 --
NM_014243chr431847 1606 150 2378 113 11504 11785
NM_014245chr3----1162 --
NM_014246chr2242007 903 602 471 ------
NM_014249chr15------1520
NM_014250chr2242145 2123 1415 175 ------
NM_014253chrX42369 2292 1851 276 --22451 1591 --
NM_014258chr201626 126 1480 --
NM_014263chr1051365 1256 1194 81 70 --21144 523 --
NM_014264chr42594 488 ----1503
NM_014267chr113921 185 161 1877 ----
NM_014268chr1861442 1380 1260 560 164 152 --1390 --
NM_014271chrX2255 210 ------
NM_014278chr42158 105 1343 ----
NM_014280chr14647 594 295 121 --1707 --
NM_014282chr941231 1127 871 465 --1134 --
NM_014283chr1--1227 11228 --
NM_014289chrX71382 1367 1337 1178 1136 1127 457 ------
NM_014290chr91196 ------
NM_014293chr2253534 2773 2602 1073 41 13599 11455 --
NM_014294chr851485 1267 1108 270 151 1579 1137 --
NM_014299chr1942226 709 679 78 12141 ----
NM_014309chr22144830 4666 4610 4382 3920 3512 2021 1549 1317 1180 1037 584 274 140 --21174 225 --
NM_014313chr14481 422 188 88 ------
NM_014317chr10170 1106 ----
NM_014319chr121560 21210 661 2763 272 11739
NM_014322chr1149 1973 1330 --
NM_014331chr4137794 6943 6829 6609 5881 5247 4878 2810 2472 1981 1725 728 69 47784 6769 6236 1053 42817 1381 1039 563 27356 870
NM_014333chr1182770 2537 2519 2242 2003 1748 465 400 --22746 1783 11975
NM_014342chr1151441 1240 1094 948 421 --2288 92 --
NM_014344chr112799 636 ----1778
NM_014345chr64825 776 704 280 ------
NM_014350chr551122 1032 994 765 378 --1404 --
NM_014363chr1341280 1184 437 64 31221 1140 1055 --1269
NM_014372chr12418 40 1449 11578 12045
NM_014381chr1431210 1147 848 22085 2027 --1764
NM_014382chr331126 531 294 ----11713
NM_014388chr1125307 4971 4866 4619 3827 1653 1481 1401 999 777 765 723 22385 878 11153 13786
NM_014391chr101289 1740 144 --
NM_014392chr43435 222 190 190 1331 --
NM_014393chr832181 225 170 --1248 --
NM_014394chr1021145 215 1306 ----
NM_014395chr421968 567 11375 ----
NM_014399chr7148 --2775 278 --
NM_014405chr1722389 914 ------
NM_014410chr181364 ------
NM_014415chr361458 595 478 367 361 145 21396 350 1338 --
NM_014423chr575358 5248 3954 3639 793 747 413 54788 4214 3522 1541 1389 25317 2266 --
NM_014445chr322044 1575 21798 915 1934 1428
NM_014447chr441404 1306 1045 437 1152 ----
NM_014452chr62481 303 11014 1858 1342
NM_014454chr6--1897 11024 --
NM_014456chr1041298 677 118 98 31859 1345 129 11467 --
NM_014458chr131251 304 147 1545 11117 11030
NM_014462chr82116 82 ------
NM_014469chr112777 145 ------
NM_014470chr121731 ------
NM_014472chr10--1730 ----
NM_014488chr11----1525 --
NM_014489chr11--1860 ----
NM_014494chr1672380 886 736 716 362 125 118 11780 1698 --
NM_014502chr111315 ------
NM_014504chr7--1551 1112 1491
NM_014515chr122798 689 ------
NM_014516chr192241 219 ------
NM_014517chr361932 1230 1201 766 738 367 21501 1342 --1748
NM_014521chr251152 717 455 449 255 --11192 --
NM_014547chr152595 195 2713 667 1127 --
NM_014547chr152595 195 2713 667 1127 --
NM_014548chr152279 208 2606 85 ----
NM_014554chr1221500 786 --12096 --
NM_014572chr1371723 1172 368 288 268 193 168 1482 11196 --
NM_014573chr1731354 175 102 ------
NM_014574chr1421552 979 11580 ----
NM_014575chr31465 ----1199
NM_014577chr223817 788 252 --3921 717 635 1855
NM_014584chr1451326 1102 639 365 156 2211 103 ----
NM_014586chr2174738 4670 4546 4446 4426 3882 1303 24190 3768 34031 3269 1845 --
NM_014587chr1631375 1366 299 --11357 --
NM_014588chr202786 597 --157 2710 218
NM_014591chr10----11313 --
NM_014592chr52637 123 ------
NM_014600chr231647 1527 1140 1624 ----
NM_014602chr32344 66 ------
NM_014607chr231547 745 336 ----1407
NM_014612chr971261 1003 379 250 237 169 90 --11296 --
NM_014613chr542516 2441 2336 1178 12177 --23057 2062
NM_014614chr251189 1080 585 221 117 ------
NM_014615chr1653550 2543 2530 1078 863 32927 835 520 ----
NM_014616chr331307 283 230 13185 ----
NM_014618chr91399 ------
NM_014620chr121280 1504 ----
NM_014629chr82409 207 ----11229
NM_014630chr1543520 3268 2853 2456 24010 2511 ----
NM_014635chr231678 1570 426 11502 11308 --
NM_014636chr964372 3236 1725 1663 1142 578 64347 4091 3884 3053 3004 1281 33751 2973 540 --
NM_014637chr831212 1170 569 1324 ----
NM_014647chr1662234 2221 1567 790 661 237 ------
NM_014660chr721092 282 ------
NM_014663chr12389 372 ------
NM_014666chr53355 214 189 ------
NM_014667chr362446 1919 1775 362 165 67 1988 1321 1741
NM_014670chr251600 1425 1306 1271 1207 1316 1587 --
NM_014671chr721288 1261 1244 1489 11053
NM_014674chr342957 2931 2713 334 12810 33748 1573 844 --
NM_014676chr11527 1456 11446 --
NM_014679chr1161089 1040 545 464 403 182 --1268 --
NM_014682chr872125 2119 1897 1883 1872 302 107 --22233 354 --
NM_014683chr1741653 1365 840 769 11791 ----
NM_014685chr16--2514 421 ----
NM_014686chr1972545 2400 2282 2248 1979 992 399 ------
NM_014689chr22628 165 ------
NM_014700chr1611379 ------
NM_014701chr1563008 2925 2309 825 305 78 13055 ----
NM_014702chr6123391 3368 3113 3098 3078 2854 2669 2520 2174 2148 1041 494 32789 2444 2214 22456 169 --
NM_014705chr741993 1362 762 280 32084 1564 1309 --21714 87
NM_014707chr721875 1567 31936 652 614 ----
NM_014709chr22612 24 1246 ----
NM_014711chr1672077 2032 2013 553 477 305 105 21521 437 11808 --
NM_014712chr161610 ------
NM_014713chr21125 1200 2365 341 --
NM_014720chr1031400 1333 1142 --21480 1284 --
NM_014721chr6217024 6899 6444 6326 5967 5735 5625 5346 5311 5054 4927 4763 4692 2305 2266 2180 2057 1587 1561 1417 761 32894 2115 1659 37310 5253 1065 --
NM_014727chr19----1258 --
NM_014729chr83737 553 118 191 ----
NM_014730chr1264227 3278 2111 1786 1635 724 --14670 --
NM_014730chr1264227 3278 2111 1786 1635 724 --14670 --
NM_014731chr20----123 --
NM_014732chr1654395 4314 2228 1587 1103 15088 25718 3617 25182 2203
NM_014733chr572137 1826 1758 1425 307 268 201 ----12030
NM_014735chrX72138 2068 2018 1348 1341 742 119 ------
NM_014736chr152337 108 ------
NM_014739chr643942 3037 1401 49 12940 12999 192
NM_014741chr1122116 805 --12185 --
NM_014743chr452254 1252 985 835 407 11246 22676 2202 --
NM_014746chr2124214 3747 3607 3142 1545 1515 1478 1058 1038 845 712 469 24077 3588 13104 1570
NM_014750chr142190 25 ------
NM_014751chr8--21608 230 ----
NM_014752chr1161864 1575 1541 772 656 551 --11939 3587 336 304
NM_014755chr284268 3771 3239 2730 683 511 196 185 --43364 1061 690 439 11703
NM_014757chr542360 2178 1555 78 ------
NM_014758chr1192486 2456 2344 1837 1801 1682 889 736 653 1751 ----
NM_014764chr1241247 940 870 52 --2202 149 --
NM_014772chr1832711 2401 1413 12429 ----
NM_014774chr173146 2116 2044 836 779 350 115 33266 236 181 --1390
NM_014776chr1292814 2686 2446 2314 1079 990 846 518 369 --23071 1934 12672
NM_014779chr341067 887 790 384 176 --1260
NM_014781chr86926 502 380 271 144 35 1162 ----
NM_014790chr51193 2418 365 ----
NM_014795chr241273 1124 508 267 4992 974 366 275 2879 479 --
NM_014802chr121174 ------
NM_014803chr1092727 2374 1933 1085 1024 901 851 458 83 3989 304 118 ----
NM_014807chr112647 274 ------
NM_014810chr173538 1000 857 757 536 378 110 33674 3363 1172 ----
NM_014812chr141996 1983 788 755 --1778 --
NM_014813chr14613 389 93 53 ------
NM_014819chr562470 2255 2198 517 215 183 --11919 --
NM_014820chr351889 1410 1403 576 451 11386 21766 1568 --
NM_014822chr46529 453 256 137 106 31 ------
NM_014824chr111197 ------
NM_014826chr1114124 3891 3822 3490 3241 3057 1571 1408 945 244 60 54342 4061 3838 2997 268 ----
NM_014827chr141624 1193 384 194 2184 22 ----
NM_014828chr141207 1404 ----
NM_014829chr572296 2283 2188 823 659 609 140 22212 351 22219 362 --
NM_014830chr1242884 2377 1088 819 12748 12759 --
NM_014832chr1311415 21814 672 11370 --
NM_014835chr2052189 1939 1577 1513 586 --11422 --
NM_014836chr1061578 1547 1355 145 136 58 1399 ----
NM_014838chr2242141 2076 1080 576 32453 1089 337 ----
NM_014839chr162312 2010 1949 1599 753 420 1550 1725 --
NM_014840chr1273405 3221 2686 1004 711 325 229 --12943 --
NM_014841chr61512 1900 ----
NM_014844chr1443802 3552 2919 138 14216 ----
NM_014846chr81236 --1106 --
NM_014848chr1552159 2012 584 476 305 --1919 21010 766
NM_014849chr1--11179 ----
NM_014850chr331890 1677 1060 21472 1162 34549 3226 1267 --
NM_014857chr1286 21 ------
NM_014860chr281994 1645 848 808 703 556 452 334 11980 --1165
NM_014862chr1534066 2977 1130 ----13535
NM_014864chr134320 2803 399 23210 3104 1991 --
NM_014870chr121580 1164 --24288 4072 --
NM_014871chr121606 ------
NM_014872chr972148 1614 705 627 408 347 166 --1569 --
NM_014873chr1134780 4626 4573 4538 4192 3387 3348 3299 3086 1550 951 929 684 --24846 730 14495
NM_014874chr12222 140 ----11782
NM_014876chr2251991 1971 1759 377 214 --11639 --
NM_014877chr17177653 6882 6390 5709 5498 5379 5328 5294 5082 4976 3004 2631 2442 1511 1479 1348 372 1936 1188 17228
NM_014883chr431558 969 802 --1207 11827
NM_014888chr731431 1227 638 2475 383 135 --
NM_014890chr32263 233 2312 278 1103 --
NM_014891chr731075 581 232 --11272 --
NM_014893chrY32093 1606 398 11540 1172 --
NM_014897chr1743097 2346 1158 77 --1239 --
NM_014899chr542241 1042 759 389 22720 585 --13041
NM_014900chr23260 68 27 21050 732 ----
NM_014901chr552134 2023 1714 177 119 12008 12202 --
NM_014903chr1262464 2341 2250 2121 1817 353 12235 1211 --
NM_014905chr251842 1737 1537 462 338 11288 ----
NM_014906chr1764031 3527 3126 2940 993 904 23512 1610 23240 2955 23742 751
NM_014912chr1063382 3076 2601 978 776 396 23223 1341 21157 229 --
NM_014913chr1821474 1037 ------
NM_014915chr1041448 1387 360 40 31393 1379 272 ----
NM_014916chr71619 --1794 --
NM_014917chr1--1821 ----
NM_014918chr1521595 1294 21492 654 11583 --
NM_014920chr683237 2934 2374 766 632 622 501 49 42970 2343 671 114 1259 1288
NM_014921chr1913013 ------
NM_014923chr1372296 1456 739 632 134 125 92 21674 36 --21439 170
NM_014924chr1452959 2516 2236 922 72 22874 387 1787 22599 1140
NM_014926chr31738 --21019 948 --
NM_014932chr331522 1461 226 ------
NM_014933chr43308 123 36 ------
NM_014935chr143881 3359 3176 474 ------
NM_014936chr672764 1111 917 901 168 138 94 11849 ----
NM_014937chr1051284 1267 868 465 268 --1233 --
NM_014938chr1242465 2434 2410 1960 --12527 --
NM_014939chr1831178 137 124 ------
NM_014942chr621014 896 2859 523 22438 1739 --
NM_014945chr541887 1365 174 29 ------
NM_014946chr231071 954 424 133 13058 --
NM_014947chr153136 2742 2609 1219 126 2825 104 --12305
NM_014949chr13983 965 60 ------
NM_014950chr143461 190 179 --11731 --
NM_014952chr1532058 1311 78 --11958 --
NM_014959chr1973567 2921 2389 2328 2179 1227 824 23284 511 1184 11119
NM_014961chr462159 1653 858 543 504 285 ------
NM_014962chr2072427 2051 1943 1080 1045 632 183 32358 2271 1067 12383 --
NM_014964chr17--1761 ----
NM_014969chr11446 11042 21135 815 --
NM_014974chr1021568 1224 ------
NM_014978chr1021536 1171 1251 ----
NM_014982chr14185445 5274 4949 4641 4587 4511 4006 3641 3556 1993 1983 1757 1499 1422 727 707 238 97 21862 1765 11350 --
NM_014988chr462229 2009 1927 470 207 100 1381 ----
NM_014989chr682084 1932 1609 1594 1534 1439 1380 39 1680 21263 759 --
NM_014991chr463274 2853 2282 2127 323 238 --12796 --
NM_014992chr141284 ------
NM_014994chr1542321 2303 1928 463 --11617 --
NM_014996chr331081 978 356 1422 1743 --
NM_014997chr752935 2705 1905 1080 176 12738 ----
NM_014999chr1221266 1140 31563 1461 1071 21387 197 --
NM_015000chr1292871 2666 2479 2276 2199 2163 2083 1051 971 --12106 --
NM_015002chr1251803 1424 814 401 357 22168 802 --12080
NM_015008chr383193 2949 2657 2588 2363 1364 576 219 --23649 715 12921
NM_015009chr32584 311 --1247 --
NM_015017chr12812 38 --11027 --
NM_015020chr1653698 3594 3496 3328 622 11494 1881 12778
NM_015023chr121853 737 ------
NM_015024chr831147 352 339 --11242 --
NM_015025chr282653 2194 1717 863 505 462 445 197 22604 1018 1762 11931
NM_015026chr12174751 4699 4538 4462 4436 4132 3079 3062 2924 1876 1745 1688 1216 1162 1059 620 539 13820 54706 3782 3317 1712 330 --
NM_015027chr1611802 1251 ----
NM_015032chr1352931 2512 2160 475 137 42436 2084 797 663 ----
NM_015037chr101245 ------
NM_015039chr154207 3678 3426 3265 1696 24231 3792 ----
NM_015040chr273328 3301 2672 1105 741 528 401 22902 2302 1179 --
NM_015042chr1544273 4241 3715 220 12811 ----
NM_015045chr1072280 2028 1985 1623 661 267 167 --22125 1816 12020
NM_015049chr263026 2469 2263 2234 760 690 33009 2591 2020 12625 --
NM_015051chr932618 693 567 32755 1160 241 ----
NM_015052chr751209 1084 503 433 26 ------
NM_015057chr132702 101 ------
NM_015059chr1553829 1091 573 318 81 ------
NM_015061chr94914 731 591 572 ------
NM_015064chr1232787 920 28 12486 ----
NM_015068chr783591 3333 1583 1088 985 288 241 198 --12722 13490
NM_015071chr5126231 6138 6127 6031 5379 4434 1664 807 782 478 298 231 45985 5593 4941 2303 15878 16247
NM_015072chr14176 --1387 --
NM_015073chr1911848 --1607 --
NM_015074chr174805 4543 3711 1108 1020 596 442 1475 2348 138 --
NM_015075chrX21521 648 ----11799
NM_015076chr684517 4303 3507 3147 1646 1326 288 270 --24197 1551 1538
NM_015087chr13102481 2412 2325 2283 2263 994 857 756 573 382 ------
NM_015090chr154164 2199 564 373 30 --11573 --
NM_015091chr14190 1633 ----
NM_015092chr16154632 4425 4343 4256 4003 3551 3412 3205 2851 1872 1837 1394 1310 1177 720 --21548 965 33512 1849 1226
NM_015093chr611433 --11625 --
NM_015094chr2241796 1586 1114 900 14129 ----
NM_015097chr32433 391 --1285 21878 1851
NM_015100chr12783 560 11744 ----
NM_015102chr12166 131 ------
NM_015107chrX41514 734 398 182 ------
NM_015110chr952074 1734 1544 369 269 11827 12295 1824
NM_015115chr482493 2444 2210 1974 1137 915 411 353 32814 2010 389 ----
NM_015116chr1361739 1639 1391 1140 1115 484 ------
NM_015120chr22280 69 ------
NM_015124chr2232449 828 557 ------
NM_015125chr19----2485 422 --
NM_015130chr4--21059 487 11126 --
NM_015132chr731976 1312 31 11251 1462 --
NM_015135chr71183 160 ----
NM_015137chr832377 1900 881 42510 1816 626 265 1184 --
NM_015138chr1552312 1849 1050 706 633 22867 1835 12660 --
NM_015141chr362011 1918 1803 1743 502 386 22397 2070 3753 597 544 11930
NM_015143chr431328 1205 134 1424 1258 152
NM_015144chr16133976 3950 3793 3241 3196 3050 2898 2562 2553 1596 672 255 120 ------
NM_015149chr13655 600 386 12086 21749 1418 --
NM_015151chr2141030 1014 966 158 --2656 331 --
NM_015153chr62618 612 ------
NM_015155chr1082952 2861 2739 2394 1062 747 560 275 11211 --22827 2082
NM_015156chr1473996 1428 1312 1292 498 415 398 13196 ----
NM_015157chr1121173 457 ------
NM_015161chr1631541 1507 1437 2974 954 ----
NM_015163chr1411667 11680 ----
NM_015170chr832308 594 342 ------
NM_015176chr131628 402 198 11274 11102 --
NM_015180chr14----1290 --
NM_015185chrX72909 2383 927 859 809 526 298 ------
NM_015186chr92132 105 1456 ----
NM_015191chr1121799 912 ------
NM_015192chr2082947 2792 2774 2325 2303 1999 911 495 32677 2263 2171 22065 2007 --
NM_015196chr4----1108 --
NM_015198chr721082 103 11173 ----
NM_015199chr372873 2532 1886 1112 978 664 478 --168 11866
NM_015200chr441674 1032 851 558 3780 718 417 ----
NM_015203chr11195 --124 --
NM_015206chr1553800 992 624 325 118 13074 22817 217 12895
NM_015208chr1821437 828 21344 150 43838 3386 1514 1125 12826
NM_015215chr182721 2710 2691 2516 2250 2108 819 198 --1205 1801
NM_015216chr541533 977 349 71 ------
NM_015225chr9112646 2359 2116 2095 2005 1199 1072 925 658 289 99 --1187 --
NM_015226chr1663232 2743 2467 576 454 188 ------
NM_015231chr112951 320 1979 ----
NM_015233chr1352522 2217 492 404 174 ------
NM_015234chr641018 914 315 309 ------
NM_015236chr421439 1254 ------
NM_015239chr91179 ----1208
NM_015245chr642637 2126 2119 953 ------
NM_015247chr16135419 5202 5194 5183 3899 3842 1995 1902 1423 1356 1315 660 395 24981 4181 44963 4847 1329 191 13960
NM_015250chr921663 768 --1349 --
NM_015251chr161147 1365 21477 765 1675
NM_015252chr24904 778 343 98 3133 122 35 ----
NM_015256chr52581 256 ------
NM_015263chr152821 246 --1749 --
NM_015264chr2274540 3556 3227 1957 1346 1293 518 --14046 --
NM_015265chr282246 1960 1750 1009 969 884 556 327 1258 11970 12367
NM_015267chr1272057 2020 1915 1825 1772 203 56 --11584 --
NM_015269chr11622 ------
NM_015270chr1241969 1860 1777 509 ------
NM_015271chr4113831 3042 3028 2918 2615 1613 1330 696 520 487 458 13576 11485 --
NM_015272chr1651783 389 333 301 160 1540 2567 292 --
NM_015275chr1231536 1429 180 21326 617 ----
NM_015277chr185499 470 431 367 60 1538 3588 448 53 --
NM_015278chr652740 2437 2161 559 237 22550 1221 13213 --
NM_015282chr232968 2084 398 12725 1351 --
NM_015285chr1811795 11846 21925 366 --
NM_015288chr563411 3387 3196 2976 1512 1258 ------
NM_015291chr152607 2353 2343 1141 1125 --13389 --
NM_015294chr1731127 944 720 --11149 --
NM_015296chr131868 1944 --11104
NM_015308chr111153 1799 1766 --
NM_015310chr8178326 6867 6716 6639 6120 5973 5808 5100 3139 3098 3068 2616 1829 1678 1499 701 559 28101 3048 46810 5751 3260 3082 --
NM_015313chr11114501 4493 3767 3401 3378 1678 920 892 769 309 251 34652 3649 377 14679 14471
NM_015316chr1421053 256 1116 1200 --
NM_015317chr282582 2526 2226 2193 2068 2038 1050 963 12237 ----
NM_015321chr1944303 1620 1437 940 --1405 --
NM_015323chr61505 21148 396 137 --
NM_015326chr153001 2133 1033 904 888 32018 481 445 ----
NM_015327chr11314 ------
NM_015328chr742776 2426 2051 925 1628 12605 --
NM_015329chr1911068 --32102 1830 528 --
NM_015331chr1----1580 --
NM_015335chr1272660 2650 2128 1830 880 862 595 12607 12458 --
NM_015336chr1292527 2398 2027 1844 1696 961 830 683 151 --12012 11791
NM_015344chr84732 550 326 136 ------
NM_015346chr1421730 318 ----21666 360
NM_015347chr1292781 2677 2538 2272 2175 2095 1853 952 776 31922 1078 404 21903 690 22347 1155
NM_015349chr672918 2702 2678 2623 2404 1914 426 11901 32006 1042 285 1928
NM_015355chr1771921 767 610 374 356 333 193 146 --1224
NM_015358chr2111126 ------
NM_015359chr832493 2412 494 12782 ----
NM_015360chr51180 ------
NM_015361chr24871 784 698 173 ------
NM_015365chrX73943 3880 3857 3002 1273 562 182 51490 1126 825 747 100 23047 2609 14172
NM_015381chr2251786 1566 825 752 461 1739 ----
NM_015382chr141702 1227 ----
NM_015387chr232115 1857 154 2745 64 ----
NM_015396chr33305 265 170 ------
NM_015397chr931922 1440 139 11797 ----
NM_015409chr1262716 2710 2694 1922 1860 728 2144 62 ----
NM_015415chr11214 ------
NM_015423chr1151686 1588 1409 1280 629 ------
NM_015429chr361106 1067 368 350 315 226 2860 189 ----
NM_015435chr841337 570 495 129 ------
NM_015436chr483384 3243 2354 2225 2118 1047 914 367 12649 134 --
NM_015443chr1741112 618 211 137 ------
NM_015446chr161659 1507 1336 1176 525 340 --21569 435 --
NM_015455chr574040 3385 3170 3088 1379 1106 655 43413 2714 1400 395 13049 --
NM_015457chr112300 105 11117 ----
NM_015458chr874689 1757 1616 1475 518 212 79 45099 1257 297 242 23940 3376 --
NM_015463chr22265 49 ------
NM_015464chr72920 225 ------
NM_015466chr31208 ------
NM_015475chr23692 132 21 ------
NM_015477chr153933 387 367 --1964 --
NM_015483chr73745 445 48 ------
NM_015484chr14797 239 184 127 --1311 --
NM_015488chr221645 564 11399 11621 --
NM_015497chr1531152 463 313 ------
NM_015508chr331357 125 49 --1112 --
NM_015509chr1241395 1374 1352 1147 --11221 --
NM_015516chr1141287 1278 1204 927 11169 ----
NM_015520chr362517 1776 1059 922 839 319 1832 12106 --
NM_015523chr111235 ------
NM_015525chr6------127
NM_015530chr26925 841 790 625 399 209 ------
NM_015534chr111032 ------
NM_015535chr264049 2958 2680 1521 497 134 --22695 411 1231
NM_015542chr10----11126 --
NM_015548chr64988 709 360 37 1940 ----
NM_015549chr14----1551 --
NM_015550chr763407 3340 2530 1425 1146 629 12302 13484 1545
NM_015553chr675165 4408 4033 1859 1235 1113 74 1647 13249 --
NM_015554chr15102452 2181 1136 935 545 451 345 246 200 23 22927 83 12265 --
NM_015564chr593577 3387 3381 2892 2705 2581 2543 1154 775 ------
NM_015565chr2142302 2114 1584 103 21964 1405 ----
NM_015567chr1351136 821 305 216 33 --2931 853 --
NM_015569chr1124703 4595 3826 3810 3680 3449 3300 3092 1112 870 843 259 --24724 1810 --
NM_015570chr751318 709 460 229 153 ------
NM_015571chr672631 2257 2121 1778 903 204 29 --31922 822 687 --
NM_015575chr283575 3472 3225 1260 927 840 361 174 13635 ----
NM_015576chr362604 2464 2156 1895 361 297 --42954 1088 656 317 --
NM_015577chr541844 1684 1612 1533 11280 ----
NM_015578chr1961529 1449 1284 795 276 176 32034 1463 697 ----
NM_015602chr131821 1169 54 11254 ----
NM_015605chr1051480 992 601 524 263 --2512 467 --
NM_015607chr12165 146 ------
NM_015609chr1------12969
NM_015610chr782511 2279 1865 1774 536 337 289 179 ------
NM_015626chr17----1135 --
NM_015627chr121374 366 ----1615
NM_015630chr22370 259 2844 782 ----
NM_015635chr931983 1365 261 21846 863 --1125
NM_015640chr1115167 2073 1571 1435 1119 735 719 635 554 301 274 34323 1618 760 ----
NM_015641chr781299 1220 1057 939 257 197 145 53 ------
NM_015642chr32112 106 ------
NM_015646chr1231163 339 175 1323 1519 --
NM_015649chr191343 ------
NM_015652chr10--1540 ----
NM_015657chr23807 305 47 194 ----
NM_015660chr72268 226 ------
NM_015675chr192564 474 ------
NM_015678chr1351196 1108 657 464 428 1158 21370 680 --
NM_015686chrX12290 --11849 --
NM_015691chrX62386 1970 1847 1147 523 115 --2427 358 --
NM_015695chr631902 1835 1434 ------
NM_015714chr12361 294 --1368 --
NM_015716chr171487 ----1501
NM_015726chr151738 1492 619 600 571 11212 21248 99 --
NM_015833chr2142194 434 352 247 11529 11973 --
NM_015850chr822235 821 ------
NM_015866chr141184 1098 1047 498 11022 --11519
NM_015869chr31171 ------
NM_015872chr121715 1628 ------
NM_015874chr41420 ------
NM_015878chr842221 1485 1427 1361 --1699 --
NM_015879chr18278558 8219 8004 7986 7550 7448 7401 6982 6944 6674 6231 5963 2842 2807 2585 2498 2125 2030 1870 1520 1349 1259 597 591 572 305 231 58240 7082 2863 2373 2153 27301 1417 18014
NM_015881chr1131328 1035 152 --1575 --
NM_015885chr112616 165 1153 1357 --
NM_015886chr895063 4696 4573 4532 2171 1738 1579 1510 1425 25570 688 15048 --
NM_015888chr1113126 3000 2724 2637 2365 2326 2097 1081 1061 826 804 --22116 1097 --
NM_015891chr641436 768 173 34 --12080 11419
NM_015902chr85928 888 850 737 668 --2799 632 --
NM_015905chr71583 ------
NM_015906chr184014 3092 1876 1503 1409 966 758 547 44356 1939 1854 496 23904 3031 13833
NM_015907chr42349 259 ------
NM_015912chr852116 1984 1747 894 411 ------
NM_015938chr31370 1895 1424 --
NM_015939chr203246 224 174 --1605 --
NM_015955chr22424 354 ------
NM_015975chrX121833 1333 1173 741 673 566 498 456 296 267 205 27 2723 375 ----
NM_015976chr1142 1327 ----
NM_015980chr5----1622 11566
NM_015982chr17--1373 ----
NM_015986chr1731286 297 136 ----11061
NM_015990chr441116 1034 389 80 ------
NM_015994chr143698 233 151 149 2718 454 --
NM_015995chr1545572 4599 4498 1183 --1950 --
NM_015999chr11147 --1268 --
NM_016002chr11740 1638 ----
NM_016003chr782511 2279 1865 1774 536 337 289 179 ------
NM_016004chr201197 ------
NM_016009chr174744 4587 4375 3768 1451 504 259 14889 23391 1461 13166
NM_016018chr832728 2671 391 11832 152 12007
NM_016019chr73946 878 730 --1365 --
NM_016021chr662892 2761 2718 2156 635 297 32422 2318 1979 22941 624 12569
NM_016022chr121045 226 ------
NM_016023chr851992 1477 849 822 744 21920 1662 1875 --
NM_016025chr16--21360 1235 1549 11791
NM_016032chrX11191 --2873 150 --
NM_016037chr121091 769 ------
NM_016038chr71107 --1252 --
NM_016040chr172619 2493 2367 754 647 188 154 --2620 258 --
NM_016041chr173382 276 92 ----1129
NM_016057chr1231316 910 298 ------
NM_016059chr63717 210 92 1160 ----
NM_016061chr221659 1515 1390 21143 1093 --
NM_016072chr1261735 1586 1580 1572 517 374 2972 470 12444 12219
NM_016073chr151377 2735 181 ----
NM_016076chr1113235 3164 2686 2301 2081 2067 2053 999 804 798 430 ------
NM_016078chr171885 1830 1342 --
NM_016079chr282181 2041 1840 358 305 262 195 97 21727 54 1904 --
NM_016083chr6133835 3763 3666 2876 2810 2790 2617 2609 2415 2402 1492 1019 393 --43056 1411 749 557 12829
NM_016087chr751751 1597 1382 560 404 ------
NM_016090chr1131067 841 770 4431 262 253 39 ----
NM_016096chr81132 21905 1487 1305 --
NM_016098chr62403 337 ------
NM_016099chr84268 262 194 146 11325 11352 --
NM_016100chr20--1103 ----
NM_016103chr5----1363 --
NM_016107chr531365 1271 427 --1896 --
NM_016121chr121038 181 1244 ----
NM_016122chr12287 78 165 ----
NM_016123chr12154 --21099 475 --
NM_016124chr131322 1276 70 ------
NM_016129chr4176 --1377 --
NM_016131chr25472 258 239 228 79 --22158 1511 11694
NM_016132chr1592837 2804 2407 2148 1262 1100 968 256 64 12253 ----
NM_016133chr211373 11655 ----
NM_016141chr32225 157 ------
NM_016147chr1121139 813 ------
NM_016151chr16------146
NM_016152chr32848 74 --11200 --
NM_016162chr121661 ------
NM_016185chr172850 806 1319 --1114
NM_016192chr21107 ------
NM_016200chr7--2282 150 2271 243 --
NM_016201chr321676 1467 --11998 --
NM_016205chr4------1967
NM_016206chr3239008 8947 8743 8477 8416 8234 7876 7806 7144 6909 6433 6416 6260 6159 5890 5832 1975 1880 1645 1600 1055 942 294 25689 5634 35493 1836 194 --
NM_016211chr43308 123 36 ------
NM_016217chr663087 2632 1396 579 222 117 42970 1372 1336 48 13561 --
NM_016224chr661702 1364 751 414 246 137 --21745 1689 --
NM_016226chr123387 345 94 ------
NM_016227chr1--1227 11228 --
NM_016230chr62490 78 ------
NM_016231chr1751689 1678 1574 1270 404 ------
NM_016248chr13143934 3717 3474 3451 3354 3348 2957 2575 1564 1479 1439 975 511 176 33537 3265 3019 33441 2433 143 1736
NM_016252chr21929 ------
NM_016255chr641226 1165 969 257 22421 2304 32681 309 277 --
NM_016258chr11549 --1691 --
NM_016260chr2227475 7039 6879 6871 6847 6628 5868 5862 5368 5090 2526 2206 2083 1920 1873 1420 1362 1252 958 851 748 64 46905 5389 1622 949 12459 1724
NM_016262chr6269 24 ------
NM_016269chr451198 1084 981 403 341 1998 11168 --
NM_016271chr1831494 905 675 42064 1650 343 120 11687 1265
NM_016275chr322586 2233 32631 860 467 ----
NM_016277chr641488 1160 1066 430 11647 11224 --
NM_016281chr1221124 1032 188 --11104
NM_016282chr961714 1414 589 283 118 58 21330 657 ----
NM_016284chr162360 234 --1189 --
NM_016287chr141908 1812 156 67 21821 207 11628 --
NM_016289chr262118 1954 1720 740 693 40 31451 707 129 12284 --
NM_016291chr3123 ------
NM_016297chr253541 3364 1034 317 186 --12445 23153 480
NM_016298chr362758 2378 1245 1009 760 519 1771 1401 --
NM_016299chr10185 ------
NM_016303chrX160 ------
NM_016306chr31373 ------
NM_016308chr121796 1285 1344 --1502
NM_016315chr231368 326 210 31737 475 72 --11634
NM_016322chr923169 2485 21099 623 43070 1195 519 62 12973
NM_016329chr31517 --1132 --
NM_016333chr16----1480 --
NM_016338chr531034 845 127 --11076 --
NM_016340chr551263 1186 1107 954 237 ------
NM_016351chr73632 584 165 ------
NM_016357chr1221245 1168 1221 --1423
NM_016374chr141129 142 52 30 --41395 1269 153 24 11224
NM_016374chr141129 142 52 30 --41395 1269 153 24 11224
NM_016376chr1764020 3877 3767 3154 1447 1183 --33833 798 782 13393
NM_016377chr641347 1310 364 133 2593 374 11774 --
NM_016395chr1531321 1291 175 1559 ----
NM_016396chr1562222 692 655 542 489 399 32433 1905 411 197 --
NM_016410chr91412 ------
NM_016418chr2253716 3119 2662 2423 1104 13153 ----
NM_016422chr1152742 2732 2689 602 104 --1980 --
NM_016424chr1771913 1774 1517 1474 467 188 56 ------
NM_016436chr2052549 1094 553 450 163 2993 985 22183 753 --
NM_016441chr292422 2325 2257 1899 832 671 631 182 81 --11677 --
NM_016448chr131231 276 130 --21806 256 --
NM_016472chr1431529 1248 378 ------
NM_016475chr1441173 1119 1002 379 1321 ----
NM_016485chr651919 1524 911 614 379 ------
NM_016486chr1--1459 2421 198 --
NM_016487chr6173 ------
NM_016507chr17122772 2420 2159 1114 924 872 662 620 591 572 314 108 ------
NM_016513chr683237 2934 2374 766 632 622 501 49 42970 2343 671 114 1259 1288
NM_016516chr24859 734 234 186 1335 ----
NM_016522chr1121327 164 21071 606 1451 --
NM_016525chr91238 --1245 --
NM_016529chr1311055 ------
NM_016530chr15143725 3569 2890 2844 2537 1658 1352 1142 715 692 487 407 352 291 33762 3180 654 --12605
NM_016531chr483672 3583 3372 2611 1068 790 223 82 24156 98 24125 3354 13462
NM_016532chr1721008 928 ------
NM_016538chr172125 111 --132 --
NM_016542chrX2603 306 1168 ----
NM_016546chr121421 ------
NM_016548chr921553 640 --31519 195 145 --
NM_016559chr341365 1344 1155 1070 1987 ----
NM_016577chr354377 3905 1286 864 324 ----1238
NM_016584chr12----1278 --
NM_016587chr71182 11094 ----
NM_016588chr61287 ------
NM_016603chr592223 2135 2059 1731 1532 122 116 79 68 11977 ----
NM_016604chr541259 1247 1204 952 ------
NM_016605chr582761 2285 2221 2202 2127 652 438 350 12356 ----
NM_016607chrX61554 1322 1314 1202 306 51 ------
NM_016613chr482486 2349 1989 1895 1792 914 840 791 22782 807 21971 45 --
NM_016617chr1342101 1536 522 82 12082 1660 --
NM_016618chr23203 182 84 ------
NM_016620chr11484 11293 ----
NM_016621chr1123189 1462 24622 1040 13960 --
NM_016623chr82667 496 --1522 --
NM_016626chr181390 1370 ----
NM_016628chr103613 80 68 --1665 --
NM_016631chr214770 670 348 220 ------
NM_016644chr51549 --170 --
NM_016651chr1421023 83 197 ----
NM_016653chr241254 482 452 250 ------
NM_016654chr1551343 1182 1081 505 31 1171 --1900
NM_016818chr215743 669 608 574 515 1550 ----
NM_016824chr10--1177 ----
NM_016830chr121517 ------
NM_016834chr1753989 3438 2979 977 806 13301 ----
NM_016835chr1753989 3438 2979 977 806 13301 ----
NM_016841chr1753989 3438 2979 977 806 13301 ----
NM_016930chr4168 ------
NM_016936chr1652094 1866 366 146 136 ------
NM_016950chr441272 1256 1181 443 21210 601 11486 --
NM_016952chr1142714 1289 1119 751 ------
NM_016953chr2106011 5736 5636 5455 4832 4778 3837 1520 226 52 26113 5894 35534 4748 1722 --
NM_017412chr821003 899 1285 1266 --
NM_017415chr5134260 4230 4148 4017 4008 3301 3055 2909 2823 1747 1591 1434 941 11016 11172 21348 575
NM_017420chr1473438 3008 2952 1181 807 406 76 33484 3459 1249 2913 510 --
NM_017423chr442078 1811 872 633 22090 1692 21902 1468 11778
NM_017426chr46700 631 619 501 427 276 1230 ----
NM_017437chr1462334 824 648 465 345 159 22449 739 ----
NM_017440chr122665 106 --1487 --
NM_017444chr851457 755 650 517 86 ------
NM_017447chr21114128 3830 3433 3093 2875 2741 2671 1583 1312 963 190 64234 3873 2996 2857 291 279 1443 1542
NM_017452chr201928 ------
NM_017453chr201928 ------
NM_017454chr201928 ------
NM_017455chr154963 862 380 313 1175 ----
NM_017456chr1711582 --21621 1273 --
NM_017491chr42988 975 ----1998
NM_017510chr51645 ------
NM_017516chr1151107 1081 401 295 245 ------
NM_017519chr61277 --1328 --
NM_017522chr12399 229 11275 ----
NM_017544chrX1401 1299 ----
NM_017545chr20----1599 --
NM_017548chr3----21910 1899 --
NM_017549chr731134 1030 241 ----11436
NM_017551chr1032697 762 127 12652 ----
NM_017563chr355050 2176 1827 1060 138 21624 32 45728 4996 2261 419 --
NM_017567chr2------1121
NM_017569chr132109 52 ------
NM_017580chr1051920 1682 1543 441 369 --12339 --
NM_017582chr131236 667 105 --1578 --
NM_017590chr2232505 1926 702 12580 12716 --
NM_017593chr4175 1504 ----
NM_017594chr9102607 2480 2408 2077 1102 1031 1011 978 493 114 2629 487 12918 --
NM_017610chr1562121 1900 1331 712 263 216 1230 --1427
NM_017626chr1021300 542 ------
NM_017628chr4145198 5148 4685 4542 4416 4212 3797 3737 3272 2057 2013 965 489 56 23770 712 11406 --
NM_017629chr141468 1279 184 145 1567 ----
NM_017633chr673201 2772 2645 2477 1563 1388 669 32778 1069 1056 13566 --
NM_017634chr851870 587 572 354 56 ------
NM_017635chr112618 94 21334 37 31471 1284 191 --
NM_017637chr9249320 9135 8508 8455 7577 6854 6654 6099 3684 3177 3121 3091 2755 2589 2019 1940 1460 1444 1210 1080 685 120 85 77 25950 2296 37339 2439 821 --
NM_017640chr62822 248 ------
NM_017641chr123285 243 78 ------
NM_017643chr1743031 1149 649 98 1568 11243 1553
NM_017644chr3104875 4316 3472 3223 1824 1708 1310 1209 1117 827 54340 4308 3383 1677 1362 --11904
NM_017650chr7165894 5817 5281 4997 4300 4244 3929 3886 3673 2159 2057 1671 1406 918 825 456 31479 1199 1097 55302 3763 2248 1048 153 --
NM_017657chr21225 ------
NM_017658chr1494088 3797 1809 1502 1346 1251 1154 562 468 --41021 516 256 147 23965 1485
NM_017661chr1521186 44 1128 1428 --
NM_017666chrX62100 1752 1616 874 789 383 11742 ----
NM_017672chr152972 62 ------
NM_017676chr531805 1210 220 --1662 --
NM_017680chr91310 ----1734
NM_017686chr151053 959 791 374 239 1202 ----
NM_017693chr1341665 1542 1461 479 ------
NM_017694chr241856 1580 1473 443 11620 ----
NM_017700chr4--157 1544 --
NM_017709chr163652 3402 3144 990 813 87 13865 11261 21354 1035
NM_017714chr204666 370 157 37 ------
NM_017719chr372330 1866 1596 672 316 294 183 11971 ----
NM_017721chr19------1327
NM_017730chr3180 1549 ----
NM_017734chr1152 --1243 --
NM_017737chr152060 1352 553 255 159 ------
NM_017741chr421054 969 --22763 206 --
NM_017742chr1861892 1561 1535 1362 506 419 ----11806
NM_017744chr162480 2271 2192 2149 1725 444 --2302 123 --
NM_017745chrX1221 1624 ----
NM_017752chrX41771 467 343 267 11891 21813 180 --
NM_017753chr93917 875 136 1353 ----
NM_017754chr684716 4634 3965 3823 3611 3580 3061 656 --11848 --
NM_017757chr181869 ------
NM_017758chr1731506 1297 449 ------
NM_017761chr141511 600 504 180 ----1473
NM_017762chr1591932 963 698 622 447 382 283 267 24 21642 1555 11779 --
NM_017768chr14984 780 303 190 --1376 --
NM_017769chr14112735 2621 2528 2261 2191 2011 787 503 335 220 86 32945 933 410 ----
NM_017770chr642882 2718 2227 827 12400 ----
NM_017778chr831327 1248 453 --2464 130 --
NM_017787chr1022855 1824 --1147 --
NM_017798chr2031103 391 156 1478 1167 --
NM_017799chr1451675 659 470 414 311 ------
NM_017811chr941984 1024 763 745 --12595 --
NM_017812chr7156 --1288 --
NM_017813chr8155814 5569 5267 5177 4741 4233 4057 3861 1724 1530 962 845 732 708 310 23768 1494 33644 1156 345 --
NM_017819chr31216 ------
NM_017824chr1062291 2002 623 214 138 79 ------
NM_017831chr1841471 1286 1277 148 11101 44637 4027 3558 569 --
NM_017842chr121624 1698 ----
NM_017845chr43778 750 656 1645 ----
NM_017847chr121759 201 ------
NM_017848chrX94173 3929 3318 3259 1802 1391 1181 372 51 14152 24022 1266 --
NM_017849chr242864 2190 1999 822 --22965 2635 1522
NM_017855chr4128 ------
NM_017856chrX11942 21856 1741 1676 --
NM_017857chr111701 ------
NM_017860chr13842 293 259 1619 ----
NM_017869chr162627 588 ------
NM_017873chr932652 739 307 11086 12691 --
NM_017890chr81377 1733 2199 176 1680
NM_017893chr1011020 --11168 --
NM_017896chr2083555 2586 2521 2511 2479 2421 2363 1323 12559 1118 --
NM_017902chr1045754 4852 3577 104 --14842 --
NM_017910chr2----192 1371
NM_017913chr9175 1436 --193
NM_017918chr4184 ------
NM_017919chr9135475 5304 5091 5012 4244 3774 3696 2217 1804 1729 1531 1412 1393 45700 5335 4367 1851 ----
NM_017922chr145659 638 501 271 208 ------
NM_017925chr931474 1367 256 --1454 --
NM_017933chr231429 1305 1033 ------
NM_017935chr44595 284 256 42 1246 ----
NM_017938chrX--21857 324 12038 --
NM_017943chr14--11027 1140 --
NM_017944chr1142992 693 581 78 ----22725 2238
NM_017945chr34461 238 79 49 11034 ----
NM_017948chr94439 431 349 173 ------
NM_017952chr253893 2798 1106 882 223 --32910 1699 1502 13099
NM_017953chr12236 220 ------
NM_017954chr751687 1446 1292 1229 492 --2547 322 --
NM_017958chr242928 993 482 70 42768 2101 637 450 32596 783 288 12580
NM_017969chr2183 --1172 --
NM_017974chr231314 1179 1028 1455 --11043
NM_017975chr151826 1331 ----
NM_017988chr122725 92 --1869 --
NM_017994chr772605 2531 1899 719 528 463 442 22346 625 11143 --
NM_018010chr361471 1438 1039 486 263 205 --11288 --
NM_018011chr131583 ------
NM_018013chr672933 2593 2028 1940 1168 673 609 12050 1569 --
NM_018014chr22977 486 1171 ----
NM_018015chrX3852 458 65 21023 828 1310 --
NM_018017chr1052828 2720 2007 626 86 42304 2172 2154 803 11032 --
NM_018027chr1083283 2714 2281 2201 1249 1233 1163 540 12112 23319 220 --
NM_018028chr19--11300 ----
NM_018030chr184907 881 215 133 ------
NM_018034chr5193 ------
NM_018043chr1131450 147 132 11200 ----
NM_018045chr152605 2220 2190 922 201 --22270 70 --
NM_018046chr551655 1645 616 487 160 --11875 --
NM_018047chr52328 43 1582 ----
NM_018061chr121411 1255 11751 31470 229 120 --
NM_018063chr102351 135 ------
NM_018064chr61233 ------
NM_018078chr411073 --1179 --
NM_018079chr21136 1436 ----
NM_018084chr2133269 3262 3079 2993 2809 2394 2388 2281 2224 1284 1053 565 118 12910 31033 937 856 --
NM_018085chr1137168 5457 5382 5349 5244 5203 2916 2613 1746 1626 1529 1280 52 36037 3268 2936 46135 2635 1204 82 --
NM_018086chr251903 1547 1496 1369 774 2720 494 11607 11873
NM_018092chr1651072 1038 608 513 462 --11089 --
NM_018094chrX1309 ----1297
NM_018098chr33177 90 77 11183 11037 --
NM_018103chr11347 ----190
NM_018105chr841211 959 912 783 1196 ----
NM_018117chr103675 283 249 --1493 1697
NM_018120chr83554 345 135 2309 156 ----
NM_018121chr10103052 2606 2597 2452 2314 2130 1952 1942 984 962 --32776 2659 562 --
NM_018126chr451087 601 408 149 56 ------
NM_018128chr1731171 1019 119 --11420 --
NM_018133chr342175 1491 872 686 ----11983
NM_018137chr13515 273 243 ------
NM_018142chr81197 ------
NM_018150chr11894 ------
NM_018151chr22809 680 1292 ----
NM_018155chr373410 3381 3175 1375 858 762 255 21232 980 22852 2558 --
NM_018157chr1242827 2235 2229 1055 22598 912 23270 2051 --
NM_018159chrX31695 1101 89 11365 ----
NM_018164chr121118 --170 --
NM_018169chr122534 121 ------
NM_018177chr4152 --1912 --
NM_018178chr151699 1509 813 252 95 21715 1520 ----
NM_018181chr1861778 1644 701 510 365 56 --21761 1266 --
NM_018182chr172900 588 --11414 --
NM_018184chr351889 1858 1411 1396 777 --11978 120