TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-181a-2-3p
miRNA Sequence: ACCACUGACCGUUGACUGUACC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr273973 3754 3145 2897 1556 812 392 13851 1111 --
NM_000176chr573426 3321 3241 2873 2830 544 204 ----1801
NM_000202chrX83761 3258 2564 1326 1094 1077 999 382 ------
NM_000368chr964775 4612 1876 1749 1485 1284 ----14318
NM_000555chrX57479 4961 4807 2045 1806 --17194 16405
NM_000827chr541631 364 354 68 ----21810 664
NM_000868chrX5768 632 526 380 165 11679 --1419
NM_001001419chr555038 1878 1307 1105 627 22079 1264 --136
NM_001001420chr555038 1878 1307 1105 627 22079 1264 --136
NM_001003652chr1857812 6682 5765 2315 189 12602 38321 3080 627 12437
NM_001003800chr983732 3514 2901 2786 1440 1054 805 708 --13241 --
NM_001007466chr654886 3249 2038 983 909 --21952 323 14366
NM_001008539chr875295 4956 1410 742 586 233 211 21590 1009 1356 --
NM_001018074chr573426 3321 3241 2873 2830 544 204 ----1801
NM_001018075chr573426 3321 3241 2873 2830 544 204 ----1801
NM_001018076chr573426 3321 3241 2873 2830 544 204 ----1801
NM_001018077chr573426 3321 3241 2873 2830 544 204 ----1801
NM_001018111chr751545 1418 1037 621 222 1286 22658 515 13908
NM_001024094chr573426 3321 3241 2873 2830 544 204 ----1801
NM_001024948chr162610 2525 2332 2248 775 363 --32686 2396 1087 --
NM_001037165chr7138500 8457 8403 7803 7537 7034 6434 5728 3192 1497 1352 1265 1109 21708 793 15394 --
NM_001037174chr242064 890 585 578 12071 1840 --
NM_001039618chr1155090 4327 3643 1806 1265 --174 13615
NM_001039840chrX64910 4674 4456 1505 277 51 14941 --1528
NM_001040152chr744856 1677 1214 993 1656 15150 14216
NM_001040214chr631807 1491 58 --11750 12137
NM_001040284chr1655611 4605 2207 1689 343 1544 --15509
NM_001040665chr744170 1986 1600 137 --13862 13933
NM_001042555chr1284176 3890 1910 1802 1777 1765 564 419 11374 ----
NM_001042604chr344014 3725 3386 1575 ----1289
NM_001071775chr13--1352 --21298 159
NM_001100108chr1127782 7342 6641 6062 5422 3176 2572 2158 1812 1034 799 622 23218 227 ----
NM_001106chr398052 6619 6110 6017 2171 2066 1898 1267 537 19574 --38939 8115 35
NM_001346chr322746 190 1130 21877 641 32541 1976 1800
NM_001527chr664108 1545 1301 1154 1058 566 24506 1915 21667 389 --
NM_001616chr242414 2396 717 501 ----13057
NM_001621chr732754 1985 517 11156 --12565
NM_001621chr732754 1985 517 11156 --12565
NM_001969chr1472490 1457 1420 947 615 244 192 ------
NM_002387chr533920 3807 1749 1817 24227 328 1762
NM_002834chr1233866 3534 2734 1500 21024 841 13981
NM_003046chr875295 4956 1410 742 586 233 211 21590 1009 1356 --
NM_003161chr1722481 2289 --11282 13392
NM_003583chr1273883 3824 3643 2804 694 483 254 23809 2744 1277 1641
NM_003913chr684259 4221 3179 2713 1502 1326 752 444 ------
NM_004171chr11119155 8397 8253 8187 8103 7222 7033 5855 3264 1991 158 --17579 --
NM_004229chrX41965 1658 719 237 ----11894
NM_004274chr1442840 2422 2137 1018 ----11971
NM_004612chr974354 4088 3707 3043 1879 1409 1349 13024 --11265
NM_004866chr594883 4726 4407 1788 1029 804 628 261 193 --1275 --
NM_004992chrX106723 6518 6508 3338 3033 2652 2306 530 411 402 37443 7348 6746 16421 1892
NM_004992chrX106723 6518 6508 3338 3033 2652 2306 530 411 402 37443 7348 6746 16421 1892
NM_005188chr1178019 7289 6282 2745 1450 1262 1217 --1137 27387 5363
NM_005339chr454097 3544 909 886 285 --12716 12696
NM_005397chr751545 1418 1037 621 222 1286 22658 515 13908
NM_005578chr354848 4594 4564 4445 335 ----13621
NM_005840chrX87251 7161 6786 6179 5136 2691 1773 1422 11491 ----
NM_005901chr1857812 6682 5765 2315 189 12602 38321 3080 627 12437
NM_005903chr555038 1878 1307 1105 627 22079 1264 --136
NM_006106chr1173136 3094 2544 1324 1281 1123 809 2972 432 1753 --
NM_006139chr262902 2712 2503 836 713 256 --1440 --
NM_006283chr821835 1194 11547 34434 3439 420 13535
NM_006420chr2033172 2113 948 12639 --12271
NM_006482chr1273883 3824 3643 2804 694 483 254 23809 2744 1277 1641
NM_006599chr1686178 5663 5484 3311 3013 2565 2256 1193 17307 25759 3237 --
NM_006654chr1284176 3890 1910 1802 1777 1765 564 419 11374 ----
NM_006750chr1687212 7115 6468 5744 2015 1651 1165 689 ----1876
NM_007011chr1565392 4589 2419 2196 1604 89 --15952 16078
NM_007038chr2165088 5082 4734 672 188 105 --26105 1733 --
NM_007238chr2093827 3635 1495 1426 1221 976 381 322 159 11036 13340 --
NM_007350chr1254363 3995 2898 1782 1659 1449 --13325
NM_012097chr242064 890 585 578 12071 1840 --
NM_012164chr996791 5451 5154 4716 4682 2789 1759 836 253 27187 1586 36398 2693 1597 --
NM_012218chr1952217 1947 1215 443 401 --2961 300 22369 1024
NM_012229chr1041408 954 530 309 ----1449
NM_012234chr362567 1305 1259 1087 348 113 --12832 12388
NM_012262chr1115045 4566 4559 4477 3746 3389 1538 838 813 588 174 11176 ----
NM_012325chr2041533 1481 1166 1040 ----1330
NM_012329chr1721202 342 ----21350 1165
NM_014048chr1685247 3982 3761 3261 3244 1742 1227 529 1509 12074 --
NM_014294chr851272 1213 554 457 319 ----11406
NM_014705chr761970 1675 461 415 397 76 ------
NM_014747chr1105253 4519 4291 3923 3761 2249 2117 1743 847 375 21562 148 15314 --
NM_014877chr1797718 7250 6975 5958 5471 4710 3016 2057 914 ------
NM_014897chr1773038 2517 2064 1241 947 653 70 11062 12283 --
NM_014906chr1773454 3333 3300 3218 1359 1318 563 1319 12686 --
NM_014935chr163653 2665 1181 882 271 191 4949 868 581 350 --1969
NM_014982chr1434944 2026 1587 15411 --24795 4116
NM_015074chr194975 3319 3195 1507 1084 975 948 844 743 13657 1729 --
NM_015156chr1473554 3468 3129 2914 2452 1068 899 ----13955
NM_015215chr122079 944 --11249 22494 498
NM_015886chr875668 4819 4082 4036 3979 553 143 ----11096
NM_015906chr163463 3232 3225 1216 505 112 ----1704
NM_016255chr672914 2248 930 921 911 804 730 ------
NM_017447chr2173475 3273 3062 2922 1771 1026 327 ------
NM_017637chr988673 8011 7032 6647 3151 1560 976 70 15852 27944 6544 --
NM_017650chr796030 5974 5534 5527 4249 4025 3775 2030 381 11207 13819 --
NM_017938chrX41745 742 659 163 ----159
NM_018225chr9105191 5108 4865 4562 4520 4175 3780 1801 1490 1380 12008 25255 5028 --
NM_018429chr542307 2117 758 517 ----1161
NM_018440chr8108104 7587 6147 5957 5930 3180 2567 2533 301 38 --31582 1360 285 --
NM_019001chr344014 3725 3386 1575 ----1289
NM_019022chr1832858 1978 530 12377 --12847
NM_020245chr654792 3155 1944 889 815 --21858 229 14272
NM_020718chr1674804 4108 2406 2277 2025 1251 372 14770 ----
NM_020727chr2153707 3521 3332 1587 937 --11235 1341
NM_020772chr1788562 8082 6797 6691 6214 5437 5312 2542 --16677 17322
NM_020844chr857468 7054 2957 1918 86 21937 546 ----
NM_021255chr1432812 396 173 13542 --21642 628
NM_021813chr675380 4949 4700 4323 1939 1837 670 13626 1323 --
NM_021964chr335458 4089 478 12176 --16322
NM_022048chr15115512 4858 3948 3935 2413 2263 1873 1360 1241 947 174 15780 23906 1761 21275 903
NM_024511chr463306 3291 3251 2960 2146 370 --1205 12799
NM_024551chr1242427 1934 728 137 ----21858 792
NM_024551chr1242427 1934 728 137 ----21858 792
NM_024646chr173810 2744 2698 2587 1557 473 248 13156 13283 1915
NM_024770chr235721 4898 1470 15420 11830 12350
NM_024947chr379376 7355 6194 6107 5838 662 479 13746 29547 6424 1673
NM_025191chr152445 1183 1030 655 565 1347 1683 --
NM_030648chr444373 2171 1825 1750 --1352 24581 1535
NM_030806chr1109280 9106 8919 8642 2800 2793 2072 1180 802 357 ------
NM_032217chr421149 880 --11307 11083
NM_032440chr1022943 644 ----22493 1933
NM_032466chr841402 641 326 166 ----21670 249
NM_032468chr841402 641 326 166 ----21670 249
NM_032968chrX63971 3249 3114 2756 785 516 ------
NM_032969chrX63971 3249 3114 2756 785 516 ------
NM_032973chrY63963 3244 3109 2751 785 516 ------
NM_033020chr163463 3232 3225 1216 505 112 ----1704
NM_033224chr777243 7066 6648 6173 5784 2865 2579 31322 727 91 12406 --
NM_052832chr832284 2002 243 --12733 12024
NM_052885chr1274948 4861 3465 1775 702 467 349 13502 31033 335 297 --
NM_130847chr1155523 5161 3875 3772 3638 13995 34200 1791 1107 --
NM_133334chr496312 6144 5795 5008 4811 2466 2403 237 58 14672 ----
NM_138473chr1264734 3611 1341 1330 211 184 ----21129 981
NM_138713chr1686178 5663 5484 3311 3013 2565 2256 1193 17307 25759 3237 --
NM_138714chr1686178 5663 5484 3311 3013 2565 2256 1193 17307 25759 3237 --
NM_144599chr1563814 3710 2135 2003 1006 660 14709 25406 5233 --
NM_145259chr266890 4900 4815 4689 2082 1747 ----1533
NM_152267chr2262351 1888 1882 1662 652 442 11902 1106 --
NM_152624chr5107103 5835 5209 4613 4539 2320 1326 1214 542 212 15588 ----
NM_152924chr1565392 4589 2419 2196 1604 89 --15952 16078
NM_152999chr744170 1986 1600 137 --13862 13933
NM_153207chr1263577 3242 3158 2610 349 156 ----1192
NM_173214chr1686178 5663 5484 3311 3013 2565 2256 1193 17307 25759 3237 --
NM_173468chr475698 5376 5188 5140 2388 1164 227 ------
NM_177985chr242064 890 585 578 12071 1840 --
NM_178151chrX57479 4961 4807 2045 1806 --17194 16405
NM_178152chrX57479 4961 4807 2045 1806 --17194 16405
NM_178153chrX57479 4961 4807 2045 1806 --17194 16405
NM_182758chr1513549 32466 1128 118 --1484
NM_183004chr1472490 1457 1420 947 615 244 192 ------
NM_194283chr531206 1072 89 --12644 22792 857
NM_194314chr154465 4093 3830 1201 234 11740 --1315
NM_198889chr421149 880 --11307 11083