TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-181a-5p
miRNA Sequence: AACAUUCAACGCUGUCGGUGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000408chr2--13167 195 32854 2654 845
NM_000461chr354237 646 213 163 146 21399 545 --23008 1417
NM_000793chr14105100 5080 4746 4684 4245 3676 3126 3116 1148 419 ----24904 3442
NM_000809chr448326 1561 164 48 27608 2268 58377 7561 3300 1976 1570 --
NM_000899chr1244158 3561 178 155 --13032 21408 925
NM_000926chr11119082 6632 6616 6359 6311 3067 2957 2353 1553 1285 188 28198 6698 18457 12123
NM_001001419chr594969 4353 4147 3829 3693 3532 3387 2081 524 13336 --11268
NM_001001420chr594969 4353 4147 3829 3693 3532 3387 2081 524 13336 --11268
NM_001003674chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_001003675chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_001007023chr14105100 5080 4746 4684 4245 3676 3126 3116 1148 419 ----24904 3442
NM_001009554chr483545 3346 3055 1565 1460 1012 786 159 14401 24572 3285 --
NM_001009554chr483545 3346 3055 1565 1460 1012 786 159 14401 24572 3285 --
NM_001010891chr566813 6694 4889 1496 1338 540 --36153 4429 339 21693 795
NM_001011666chr786045 5927 5788 5454 2336 1952 1834 1308 --35377 2132 1784 --
NM_001014797chr1097117 6758 6196 5917 5661 5242 1125 899 673 --26447 127 11558
NM_001024647chr1297234 6322 6298 5089 1502 1428 1221 757 403 22418 335 37592 640 282 1225
NM_001030007chr1623479 2580 --13207 33950 3231 1469
NM_001037165chr798908 7419 7172 6438 6113 3059 2521 526 330 --48789 8558 7695 6482 16809
NM_001039547chr366789 6372 3229 3062 1481 1047 26366 1953 22388 2192 25265 1183
NM_001039618chr11115748 5524 5141 4020 2337 2116 1711 1158 1067 645 568 23866 465 24537 155 --
NM_001039840chrX35081 3840 664 ----24902 691
NM_001040284chr1645802 4964 4768 1405 11483 24225 2001 24482 287
NM_001042355chr16115359 3329 3307 1963 1674 1658 1198 1152 1107 1061 636 24442 351 33905 1167 102 --
NM_001042412chr16115359 3329 3307 1963 1674 1658 1198 1152 1107 1061 636 24442 351 33905 1167 102 --
NM_001042603chr1284626 4156 3584 1867 1070 336 109 91 --43952 2006 1517 244 --
NM_001106chr3138945 8478 7552 7542 7322 6821 6563 6357 6089 6027 2922 1958 270 17193 29615 1272 19698
NM_001128chr1623479 2580 --13207 33950 3231 1469
NM_001742chr71609 ----21537 727
NM_002025chrX86840 6592 3707 3324 3154 2717 2291 2248 --26742 6196 12387
NM_002203chr543673 3189 1225 66 11236 --13815
NM_002264chr374992 4824 4772 4129 3902 1826 556 14544 34968 4866 638 11684
NM_002270chr535430 4760 2016 14224 35674 1697 265 34797 4178 1459
NM_002310chr585805 5136 4970 4691 4662 4581 2364 1802 --35975 4814 1040 --
NM_003099chr15106464 5849 5371 5263 5017 4732 4411 2262 406 305 --11848 15584
NM_003958chr673591 3349 3148 3114 2884 2851 2630 --2763 611 12565
NM_003966chr5107086 6374 5903 3123 2628 2124 1377 459 215 132 26245 347 37675 705 541 --
NM_003994chr1244158 3561 178 155 --13032 21408 925
NM_004171chr11109410 9082 8916 8434 8276 7521 7448 2968 320 238 --36954 6221 3449 18812
NM_004338chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_004586chrX74753 4189 3598 2125 2083 1900 1468 45026 3787 3515 1788 14291 1643
NM_004734chr1372536 2509 2093 1196 913 440 221 --22613 380 1494
NM_004745chr8116620 6413 6329 6086 5918 5835 4758 4384 2571 2159 1952 11877 56559 4730 2486 1038 720 --
NM_004798chr2043433 2740 2625 645 23631 2891 21389 697 13144
NM_004815chr184755 3932 420 411 305 172 163 75 ------
NM_004904chr786045 5927 5788 5454 2336 1952 1834 1308 --35377 2132 1784 --
NM_004985chr1244388 4210 3482 3290 14262 23487 316 1519
NM_005056chr1294870 4400 3828 2111 1314 580 353 335 75 --44196 2250 1761 488 --
NM_005063chr1073644 3570 3051 2794 2738 1322 1146 ----23171 571
NM_005156chr964977 4173 3988 3434 1267 591 ----11542
NM_005903chr594969 4353 4147 3829 3693 3532 3387 2081 524 13336 --11268
NM_005904chr183945 338 80 --41467 433 354 348 --
NM_005935chr4134730 4153 3484 3237 1735 1693 1652 1507 1431 1325 1233 460 281 11168 14714 13986
NM_006166chr1261009 984 734 593 423 183 129 22578 2495 11877
NM_006252chr177078 6455 3024 2936 1935 1524 1031 --37405 2662 2427 --
NM_006282chr2073491 3444 1643 1088 278 131 57 --13453 24594 3517
NM_006306chrX95931 5260 5199 4664 4125 4109 3743 1109 671 --24288 690 --
NM_006420chr2062641 2191 1299 782 574 40 --33094 480 461 33356 2238 935
NM_006544chr1425070 49 15698 11384 25547 244
NM_007050chr20107331 6889 6827 6389 5875 3217 1972 1750 1277 67 1814 56509 6404 6152 1977 1141 --
NM_007114chr333035 2975 587 22878 118 1915 135
NM_007195chr1843214 2632 991 592 1962 23220 888 32933 2902 2857
NM_007249chr13109360 8036 7699 7351 7172 6511 2864 2509 1954 387 18373 18229 28771 6556
NM_012287chr343779 3122 544 113 14378 1823 24441 3467
NM_013255chr768901 8799 7674 6154 1761 1112 38863 2791 2319 35381 3404 398 --
NM_013989chr14105100 5080 4746 4684 4245 3676 3126 3116 1148 419 ----24904 3442
NM_014021chr143138 3093 876 252 22308 238 --23474 385
NM_014233chr1762061 1978 1876 1819 1536 808 11850 2814 794 --
NM_014721chr676742 6721 6014 5986 5814 5327 5234 --2647 92 16785
NM_014755chr283917 3456 3373 3292 2855 1714 273 204 43167 3149 3136 1040 12848 --
NM_014787chr162747 2720 2308 1767 651 158 --21871 164 --
NM_014923chr1332097 725 545 12334 11826 21795 332
NM_015071chr5116518 6081 5943 5314 4958 4686 2258 1578 1558 1410 816 --34765 1488 135 --
NM_015141chr342549 2206 365 212 --2439 239 22487 1772
NM_015247chr16115359 3329 3307 1963 1674 1658 1198 1152 1107 1061 636 24442 351 33905 1167 102 --
NM_015271chr444229 3895 1598 348 43915 3762 1149 807 11702 23823 140
NM_015446chr131483 1085 242 --11290 21652 1591
NM_015852chr7152712 2490 1239 1158 1074 990 906 822 654 570 486 402 318 234 66 --23578 150 --
NM_015879chr1898614 8393 7955 6839 3268 1525 756 224 88 18106 48573 6686 3336 3000 16671
NM_016018chr842573 849 223 28 --1545 1623
NM_016075chr1333124 2621 201 ----23064 2579
NM_016260chr287516 6408 5159 2685 2221 2068 1386 445 --47423 7402 5659 2285 --
NM_017628chr445292 4222 766 470 --11353 23841 183
NM_017637chr968390 3221 2875 1493 1119 845 29392 1924 33308 3296 3036 13227
NM_017650chr744943 1964 1112 683 35415 5340 3900 35253 2297 689 22182 1565
NM_017658chr1454456 4327 3274 704 418 33203 593 411 23189 975 1453
NM_017776chrX3330 256 246 --2340 172 21514 497
NM_018440chr877989 6805 6579 3317 2267 2162 1900 27960 6821 46088 1715 954 198 16463
NM_018638chr1255281 3868 1884 1770 166 15642 --22128 351
NM_018650chr111774 ----2324 64
NM_020122chr275503 5380 5142 4661 2326 1959 352 11297 11974 12347
NM_020718chr1696373 5820 5597 5296 4906 4759 4635 4393 1229 --35636 5357 2115 1138
NM_020772chr17108357 7448 6218 5802 5712 5528 2693 1604 1589 303 28169 2566 13189 --
NM_020917chr1953439 3326 2918 1438 829 --23605 1181 21118 199
NM_021083chrX73399 3186 2837 2376 655 643 321 --23424 191 13537
NM_021116chr799002 7760 7714 7158 3054 1793 1333 1058 420 11534 39059 6118 2523 19027
NM_021647chr483545 3346 3055 1565 1460 1012 786 159 14401 24572 3285 --
NM_022166chr16116094 6073 4571 2051 2022 2014 1894 1844 1361 1290 109 ----26261 4702
NM_022456chr1297234 6322 6298 5089 1502 1428 1221 757 403 22418 335 37592 640 282 1225
NM_022459chr13106346 5973 5651 4020 2403 2281 1649 1148 487 234 15473 36161 5896 1076 14636
NM_024423chr1874212 3970 3825 3270 3122 3089 1472 --13043 11669
NM_024607chr854076 3603 2944 1586 283 --34469 4238 1721 24337 4004
NM_024947chr3149535 8919 8790 8628 8099 7875 7031 6380 5913 3748 3717 3125 3051 1755 --11519 28655 1823
NM_024989chr248059 6775 1414 581 12540 38203 8070 5733 12126
NM_031427chr1435538 4041 2326 12385 45956 5390 5333 4027 25612 3874
NM_033224chr7128113 7418 7317 6383 3159 2614 2065 1597 1344 1295 960 880 --12197 26644 5744
NM_033360chr1244509 4331 3603 3411 14383 23608 437 1640
NM_033430chr442650 1356 479 379 --73992 3773 2827 1597 1140 790 159 --
NM_033437chr442650 1356 479 379 --73992 3773 2827 1597 1140 790 159 --
NM_033505chr255595 4628 1637 1282 1265 21291 227 11384 --
NM_052879chr1243640 3230 3191 148 --32754 2623 535 21643 598
NM_052886chr862027 1524 1366 563 165 159 1821 1568 --
NM_053016chr977781 5963 5456 2284 2019 1101 1005 25427 2299 --17734
NM_133170chr20107331 6889 6827 6389 5875 3217 1972 1750 1277 67 1814 56509 6404 6152 1977 1141 --
NM_144578chr1485538 5386 3867 1764 1228 217 159 62 --14830 11459
NM_145259chr286775 5630 5177 4466 2060 2008 1220 344 16628 22014 68 --
NM_148955chr15106464 5849 5371 5263 5017 4732 4411 2262 406 305 --11848 15584
NM_152283chr541025 735 252 243 166 --158
NM_152605chr193472 221 137 --2379 53 41253 297 213 45
NM_152624chr5137232 6467 6002 5785 5749 5029 4633 2842 2755 2449 985 641 55 11107 --12260
NM_152636chr1143104 3022 2147 1981 22777 419 1548 12135
NM_152734chr6105382 5327 4696 4362 4195 1652 1506 1193 1122 729 15456 23925 3441 23637 2161
NM_152774chr762448 2380 2347 985 693 495 12034 1723 1785
NM_152826chr15106464 5849 5371 5263 5017 4732 4411 2262 406 305 --11848 15584
NM_153188chr535430 4760 2016 14224 35674 1697 265 34797 4178 1459
NM_153607chr512298 12208 --2991 743
NM_153689chr242083 2055 1835 397 181 2177 57 22357 146
NM_173642chr1109211 8308 6284 5798 3264 2280 1632 960 394 60 --15930 13128
NM_175623chr1297234 6322 6298 5089 1502 1428 1221 757 403 22418 335 37592 640 282 1225
NM_175624chr1297329 6417 6393 5184 1597 1523 1316 852 498 22513 430 37687 735 377 1320
NM_175625chr1297329 6417 6393 5184 1597 1523 1316 852 498 22513 430 37687 735 377 1320
NM_175910chr19122227 2147 966 884 805 553 469 385 301 217 133 49 ------
NM_181481chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_181482chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_181483chr18116512 6285 6056 5159 5114 4661 4628 4278 2419 833 539 --12583 14654
NM_181723chr841881 669 380 121 --11657 1306
NM_181782chr642069 1930 294 272 --1797 1763
NM_182898chr786045 5927 5788 5454 2336 1952 1834 1308 --35377 2132 1784 --
NM_182899chr786045 5927 5788 5454 2336 1952 1834 1308 --35377 2132 1784 --
NM_183078chr673497 3255 3054 3020 2790 2757 2536 --2669 517 12471
NM_199188chr1243640 3230 3191 148 --32754 2623 535 21643 598
NM_199190chr1243640 3230 3191 148 --32754 2623 535 21643 598
NM_206853chr643591 3537 561 522 33775 2950 205 1713 13919
NM_206854chr644852 4798 1822 1783 35036 4211 1466 11974 15180