TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-181b-3p
miRNA Sequence: CUCACUGAACAAUGAAUGCAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr263754 3145 3005 2897 1556 392 1859 1111 1814
NM_000176chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_000202chrX93654 3258 2564 1430 1326 1094 1077 999 382 11228 13762 --
NM_000259chr1595616 5124 5091 4710 4431 4174 4118 982 68 --23930 1810 --
NM_000267chr1733009 343 54 --21360 550 1929
NM_000368chr933006 1485 1284 11394 11750 44777 4614 4318 1878
NM_000448chr1132822 2559 347 --32894 2593 195 11059
NM_000461chr343724 3237 1358 1017 1975 43412 1515 733 696 --
NM_000555chrX87479 7283 6880 6403 4961 4807 2045 1806 25960 693 17194 --
NM_000814chr1573740 2849 830 814 611 483 218 11577 14005 --
NM_000875chr1586630 6208 4978 4811 4662 4524 2297 1684 26602 6430 --2818 110
NM_000956chr1421002 338 --1212 11072
NM_001001395chr1231086 612 395 1164 1570 12061
NM_001001419chr551307 1105 756 627 34 32079 1264 372 --11880
NM_001001420chr551307 1105 756 627 34 32079 1264 372 --11880
NM_001002811chr121373 401 --1253 2337 188
NM_001002812chr121373 401 --1253 2337 188
NM_001002812chr121373 401 --1253 2337 188
NM_001002860chr1464509 3779 3512 1098 1057 837 21133 822 --13297
NM_001002926chr722438 2319 12785 171 11825
NM_001003652chr1888320 7312 7241 5765 3079 2315 1409 189 16690 37813 6683 627 12437
NM_001003712chr1233313 3201 3181 ----2934 26
NM_001005404chr17114450 4248 3962 3496 3276 3059 1284 1093 1066 693 358 13380 14242 --
NM_001005473chr516152 26246 5257 34241 597 156 16637
NM_001008539chr885295 4062 3805 3764 742 586 355 233 --21411 212 --
NM_001008564chr1341868 901 729 224 11462 21708 1533 --
NM_001009899chr366186 4680 4552 4541 1383 411 24915 2336 14573 --
NM_001010867chr196297 6155 4588 4375 4314 2081 1894 1751 752 14263 26584 2036 --
NM_001011713chr1431271 296 122 --1499 1507
NM_001018074chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_001018075chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_001018076chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_001018077chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_001018090chr152713 76 ----21936 366
NM_001018091chr152823 186 ----22046 476
NM_001018102chr152713 76 ----21936 366
NM_001018111chr793906 2982 1545 1037 959 621 514 306 222 13859 12658 --
NM_001024094chr543691 3321 2873 861 13783 43427 3242 2831 205 2801 546
NM_001024948chr152685 2610 2332 2248 355 1378 32396 1087 776 22527 365
NM_001025580chrX43917 3559 868 650 --12899 13226
NM_001030007chr1664023 3766 2955 2905 2659 1364 13227 13476 --
NM_001030055chr1424459 448 ----23136 1243
NM_001037165chr7138500 8457 8403 8012 7034 6886 5728 5393 1497 1352 1265 1175 1109 27452 1708 27538 6435 --
NM_001037174chr232064 585 578 --1840 1892
NM_001039199chr2084944 4702 4633 3688 1480 1101 432 393 11827 14694 --
NM_001039547chr3107598 7259 6613 6534 5702 5437 2668 2275 2067 1146 12153 42494 2426 1760 314 16455
NM_001039585chr123262 3212 1616 --12568
NM_001039618chr1185220 5090 4327 3613 1806 1265 951 73 1628 13644 --
NM_001039840chrX54674 4456 526 277 51 14941 14911 11507
NM_001040214chr631834 1491 58 22232 1498 11750 22137 1809
NM_001040284chr1675787 5611 5507 4816 2207 1689 343 11026 --14607
NM_001040429chr1363285 3000 2791 2745 1044 779 ----1128
NM_001040441chr155231 4677 2191 1643 1000 45457 5333 5109 2073 11166 14106
NM_001040665chr754413 4170 1986 1834 1600 23965 1378 23862 138 13933
NM_001042492chr1733009 343 54 --21360 550 1929
NM_001042555chr1294176 3890 1910 1802 1777 1765 1390 564 419 11374 ----
NM_001042599chr226179 4810 32451 779 119 --24946 2795
NM_001042604chr3------34016 3727 289
NM_001100108chr1158118 7782 7342 6641 6269 6062 5675 5634 3176 3023 2572 2135 1812 1034 622 15511 ----
NM_001106chr3128937 8396 8064 8052 6676 6569 6203 6110 3742 2171 2066 1898 19574 26620 538 48115 6019 1269 35
NM_001117chr1872371 2292 2259 2210 2111 2062 552 11953 ----
NM_001128chr1664023 3766 2955 2905 2659 1364 13227 13476 --
NM_001173chr1424459 448 ----23136 1243
NM_001271chr1563178 2359 2319 1306 379 362 11017 ----
NM_001346chr332661 640 190 1130 22747 1877 32541 1976 1800
NM_001412chrX23320 1205 --23645 1349 11004
NM_001419chr1964453 4164 4085 3341 2965 70 --13888 14552
NM_001527chr654108 1666 1545 1301 1154 11936 1389 21060 568
NM_001918chr1108655 8261 6952 6665 3245 2578 2015 1845 1581 518 18225 16783 --
NM_002025chrX108622 8415 8250 7720 6751 2984 2724 2416 2075 729 16425 12318 --
NM_002092chr494949 4579 4205 3863 3832 3605 3341 590 439 13745 ----
NM_002264chr344377 1444 1194 916 1493 11360 23539 635
NM_002310chr595347 4500 4444 1013 893 841 563 550 187 15901 ----
NM_002351chrX21250 175 21132 1106 185 21361 350
NM_002655chr875143 3839 3545 3410 3334 349 72 1964 14373 --
NM_002709chr233412 629 357 32562 1230 676 22416 1073 --
NM_002740chr382716 2363 2261 2126 1088 841 815 601 ------
NM_002886chr354259 4168 3982 3155 1947 --21617 1523 11191
NM_003034chr1268075 7851 6745 2324 1885 800 16299 16976 --
NM_003046chr885295 4062 3805 3764 742 586 355 233 --21411 212 --
NM_003112chr732801 2663 2308 --12683 21232 633
NM_003392chr333776 1487 62 11008 --14111
NM_003583chr1243643 2804 639 254 32744 2414 1366 2695 277 13885
NM_003861chr1432015 490 248 1889 1974 167
NM_003913chr674259 1508 1502 1326 835 752 444 --14222 13181
NM_004171chr1199155 8807 8253 8187 7578 7033 5855 1991 1780 --37223 3265 159 28399 8105
NM_004612chr994354 4088 3420 3043 1879 1409 1349 1263 546 13024 --13709
NM_004760chr731700 823 551 ----2860 605
NM_004798chr2073491 2259 1062 1056 888 454 277 --1614 13275
NM_004859chr1742478 1965 476 367 --12961 11888
NM_004866chr5114883 4785 4726 4464 4407 4323 1788 1374 1029 628 193 1492 1275 1263
NM_004992chrX118008 6723 6679 6518 6508 5220 3033 890 530 411 402 47443 7348 6746 6145 26421 2307 13340
NM_004992chrX118008 6723 6679 6518 6508 5220 3033 890 530 411 402 47443 7348 6746 6145 26421 2307 13340
NM_004999chr654191 3102 1674 1286 854 23342 1645 22967 2723 --
NM_005121chr1743663 2713 1053 1011 32573 1315 952 --21283 88
NM_005188chr1178019 7813 7289 6282 5361 1217 38 32003 1149 103 1137 27387 1452
NM_005235chr226179 4810 32451 779 119 --24946 2795
NM_005339chr433544 2694 285 --34098 2716 910 1888
NM_005359chr1834341 2134 1197 --25798 1381 25764 578
NM_005397chr793906 2982 1545 1037 959 621 514 306 222 13859 12658 --
NM_005578chr384848 4445 3619 3189 685 636 629 335 11309 14595 --
NM_005746chr721831 966 22131 715 1411 22790 2679
NM_005756chrX21181 416 1290 --1602
NM_005828chr1784413 3178 1019 973 589 456 187 90 --14580 13449
NM_005840chrX87251 6737 6179 5136 2691 1773 1422 1371 21670 1491 27162 6787 --
NM_005901chr1888320 7312 7241 5765 3079 2315 1409 189 16690 37813 6683 627 12437
NM_005903chr551307 1105 756 627 34 32079 1264 372 --11880
NM_005941chr883466 3407 3266 2688 1498 1426 963 746 13371 ----
NM_006016chr61588 1670 11791 1373
NM_006106chr1153136 3094 2544 1123 752 1432 11282 1811
NM_006203chr544698 4487 3797 786 23522 1367 25061 535 14240
NM_006206chr431811 559 190 --22546 225 1830
NM_006300chr1932378 888 80 ----12347
NM_006371chr385224 5062 4631 4368 3468 1689 1603 1209 --24296 3850 --
NM_006420chr2043172 2277 2113 948 22639 2398 --12271
NM_006482chr1243643 2804 639 254 32744 2414 1366 2695 277 13885
NM_006544chr1486033 5464 4983 4667 4265 4050 1949 26 15930 --14947
NM_006599chr1696178 5855 5758 5484 2565 2142 1193 1167 223 27796 7307 23312 3237 --
NM_006620chr653811 3750 1791 1662 572 138 13502 24152 1238
NM_006654chr1294176 3890 1910 1802 1777 1765 1390 564 419 11374 ----
NM_006750chr1697212 6468 5958 2365 2015 1651 1226 1165 874 25575 1761 17116 --
NM_006895chr232070 1828 793 ----1362
NM_007039chr1421503 426 11589 --12322
NM_007050chr2066643 6580 5866 5019 3104 2994 47993 7349 4900 3170 36609 6492 716 --
NM_007249chr1368862 8160 7822 7046 2151 2105 --22274 221 21308 949
NM_012095chr1053341 3220 2870 2733 308 12603 22271 193 --
NM_012097chr232064 585 578 --1840 1892
NM_012164chr9106791 6397 5451 4716 4682 2789 2692 1596 740 253 27187 1586 21760 837 --
NM_012214chr265985 5866 5183 4823 1481 664 11358 24417 1218 --
NM_012229chr1041408 1215 954 309 11378 1531 1449
NM_012262chr185045 4566 4559 4477 3746 1538 588 174 11176 33390 839 814 --
NM_012300chr511741 1541 --2413 258
NM_012329chr1731520 1202 342 1195 --21350 1165
NM_012479chr732440 2401 1952 32614 2194 1677 22711 2638 --
NM_013995chrX32104 902 281 ----12334
NM_014048chr1673982 3761 3261 3244 1742 1227 325 2509 185 22074 530 --
NM_014089chr1341868 901 729 224 11462 21708 1533 --
NM_014423chr5104602 4145 3596 3410 2204 2142 1997 1253 1074 732 11786 25162 3426 11833
NM_014701chr1563460 2526 2478 560 350 245 32993 677 607 11295 --
NM_014705chr782015 1970 1355 461 415 397 245 76 ----11677
NM_014721chr666739 5365 4641 1987 1056 206 21598 619 45877 5415 5037 1258 --
NM_014730chr1285312 5121 4623 3805 1838 734 600 583 11987 ----
NM_014730chr1285312 5121 4623 3805 1838 734 600 583 11987 ----
NM_014774chr122491 2374 --12962 13157
NM_014838chr2222363 948 ----22802 398
NM_014839chr122279 352 --1797 1706
NM_014848chr1552029 1938 999 939 275 --11051 12730
NM_014877chr1776975 5958 5850 5471 4710 3016 914 --27251 2058 17720
NM_014897chr1763235 2517 2282 2064 947 653 --171 13040
NM_014906chr1763333 3300 3281 2685 1359 563 11029 --23456 1320
NM_014982chr1444944 4901 4114 2026 35411 1736 487 --14795
NM_015026chr1264645 3832 3652 3211 1436 1050 21230 1176 1710 --
NM_015074chr1124226 4064 3319 3195 1855 1382 1294 1084 975 743 621 84 13657 31508 949 729 14977
NM_015092chr1663077 1865 1737 1523 142 94 31612 1356 1249 14387 13692
NM_015215chr142195 2079 1248 944 ----22494 498
NM_015336chr1232118 1752 896 21656 785 --1630
NM_015365chrX43917 3559 868 650 --12899 13226
NM_015387chr231875 1815 777 11604 --11795
NM_015455chr542826 1235 1170 785 --13013 23655 3285
NM_015532chr152713 76 ----21936 366
NM_015535chr274123 3709 3615 3428 2722 556 317 --1811 13152
NM_015565chr21193 ----3861 715 689
NM_015571chr621966 954 --2361 96 2553 341
NM_015886chr885668 4819 4082 4036 3979 1094 830 143 --1554 --
NM_015906chr143232 702 505 112 24368 987 23464 3226 --
NM_016021chr633043 1042 951 ----32898 1020 541
NM_016206chr347441 2713 1545 969 28278 5991 --22049 1635
NM_016255chr652248 930 921 911 804 --22915 731 --
NM_016530chr1582959 2634 2615 2586 1438 1383 869 302 22681 1574 12595 --
NM_017447chr2174108 3475 3062 1771 1026 824 327 --23274 2923 --
NM_017650chr7106030 5974 5527 4710 4025 3818 3775 2030 528 381 --14250 15536
NM_018225chr9115191 5108 5027 4865 4562 4520 4385 3780 3699 1801 1490 12008 15255 --
NM_018246chr852235 2160 563 554 548 12668 ----
NM_018348chr162966 380 1883 --1398
NM_018364chr132589 1582 1088 32599 632 439 1544 23317 3045
NM_018370chr1231945 1783 206 ----2433 30
NM_018429chr542307 758 560 517 ----22119 161
NM_018440chr8118104 6147 5970 5957 5930 3180 2567 2533 2276 1505 38 17123 41582 1360 302 285 --
NM_018452chr6_random13609 ----23744 1331
NM_018638chr1254845 4797 4733 1810 432 25472 2174 --14632
NM_018640chr1231086 612 395 1164 1570 12061
NM_018970chr763036 2609 2463 2066 1179 293 --11994 12544
NM_019001chr3------34016 3727 289
NM_020718chr1696321 4804 4108 2406 2332 2277 2025 1251 372 34925 4770 2530 ----
NM_020727chr2173707 3521 2867 1587 937 745 339 12518 23333 1235 --
NM_020760chr21758 ----21345 663
NM_020766chrX44409 4243 1090 784 145 33063 826 472 --
NM_020772chr1768562 6797 6676 5312 2542 1086 --15438 27322 6216
NM_020774chr1854819 4186 2129 955 388 22508 887 22286 1029 --
NM_020841chr1233313 3201 3181 ----2934 26
NM_021090chr2253288 1960 1770 1655 26 11169 24668 1248 14483
NM_021255chr1442812 2689 396 173 13542 --21642 628
NM_021633chr141131 129 53 31 144 ----
NM_021813chr6125380 5261 5228 5170 4949 4700 4323 3773 1939 1837 670 232 13626 1323 --
NM_021912chr1573740 2849 830 814 611 483 218 11577 14005 --
NM_021964chr356320 5705 5458 4089 478 35185 2176 1574 ----
NM_022048chr15145512 4858 4831 4070 3948 3935 2413 1873 1796 1760 1360 1273 947 393 35780 1293 289 23906 1242 1903
NM_022459chr1366022 4497 3926 2510 1410 1321 21227 150 --11036
NM_022473chr15104195 3742 3148 2922 2869 1689 716 656 606 256 --23698 1177 --
NM_024607chr864329 4137 1803 1554 645 212 31174 1049 68 23086 2853 --
NM_024646chr172587 2453 1557 1380 667 473 248 13156 13283 1915
NM_024713chr1521156 1023 11477 --11164
NM_024761chr985156 3691 1870 1572 1417 1389 1358 131 24403 1158 15075 2953 798
NM_024770chr286644 6318 5721 5016 4898 2137 1470 866 25420 1148 11830 12350
NM_024947chr379546 7355 7272 6107 662 479 458 13746 26424 5839 39378 6196 673
NM_024989chr275279 5157 2232 1951 1364 885 50 26547 1087 26320 1331 1701
NM_030648chr453736 2171 1825 1750 1504 13553 24374 352 24581 1535
NM_030650chr244230 1199 1023 69 22732 555 1606 1197
NM_031483chr201156 --13534 23102 1091
NM_032228chr1133416 2459 381 2947 359 --1180
NM_032440chr1021106 644 12601 --22493 1933
NM_032457chr453688 2448 1456 1280 1038 13753 33474 632 155 --
NM_032466chr851668 1314 326 247 166 --11403 1643
NM_032468chr851668 1314 326 247 166 --11403 1643
NM_033020chr143232 702 505 112 24368 987 23464 3226 --
NM_033143chr4--11506 --22974 303
NM_033224chr7107597 7243 7066 6173 5784 5297 2579 2431 168 82 2992 727 12406 --
NM_033225chr842181 2034 384 57 ----22470 1223
NM_033285chr863640 3346 1779 1183 775 126 174 --1624
NM_033389chr1794268 3884 3717 3369 1608 1208 889 857 151 --13866 --
NM_033430chr433338 1034 647 33027 2824 463 14150 1801
NM_033437chr433338 1034 647 33027 2824 463 14150 1801
NM_033644chr511741 1541 --2413 258
NM_033645chr511741 1541 --2413 258
NM_052879chr1252966 2766 1337 1099 778 --1507 11354
NM_052885chr1264948 4190 1775 349 334 288 13502 54862 3466 1033 703 297 --
NM_052904chr63230 182 73 ----1984
NM_053016chr946510 1669 938 297 --12281 17730
NM_130847chr1175523 5161 3875 3772 3638 817 503 34493 3995 1713 34200 1791 1107 --
NM_133170chr2066643 6580 5866 5019 3104 2994 47993 7349 4900 3170 36609 6492 716 --
NM_133334chr4106312 5795 5008 4811 4309 2466 2403 1759 456 237 14672 159 --
NM_133646chr274573 4009 3466 3402 3380 1694 621 34591 4501 1937 ----
NM_138468chr275574 5145 4948 3942 2408 1580 1192 14826 24571 26 12039
NM_138473chr1264734 4455 3611 1341 1127 184 24642 1279 --2981 213
NM_138713chr1696178 5855 5758 5484 2565 2142 1193 1167 223 27796 7307 23312 3237 --
NM_138714chr1696178 5855 5758 5484 2565 2142 1193 1167 223 27796 7307 23312 3237 --
NM_138782chr532222 1828 868 ----22026 426
NM_139057chr1592545 2488 2193 2142 950 806 312 203 152 ----12498
NM_144571chr432796 1835 1742 11277 1355 11889
NM_144599chr1564279 3980 3814 2135 1006 660 24709 427 35406 5233 2004 --
NM_145259chr264900 4815 4689 2082 1217 531 --26891 1748 --
NM_147128chr72210 195 11340 --11416
NM_152624chr5137164 7103 5835 5382 5209 4613 4539 2776 2320 1326 1214 360 212 ----1544
NM_152756chr563538 3083 2920 1099 1069 442 33566 1016 329 --11619
NM_152903chr1342526 2264 2249 1940 11905 --12474
NM_152999chr754413 4170 1986 1834 1600 23965 1378 23862 138 13933
NM_153050chr2253288 1960 1770 1655 26 11169 24668 1248 14483
NM_153051chr2253288 1960 1770 1655 26 11169 24668 1248 14483
NM_153207chr1263577 2610 1512 1398 190 156 21464 604 1350 13160
NM_173214chr1696178 5855 5758 5484 2565 2142 1193 1167 223 27796 7307 23312 3237 --
NM_173468chr465698 5376 5140 2388 1654 227 22032 1365 15189 11166
NM_173642chr178107 6798 6708 6032 3014 2907 861 12805 16994 1567
NM_173829chr595255 5116 4699 4408 4263 1859 1247 1058 816 32006 1434 485 ----
NM_173851chr853848 3466 3200 3104 1236 12601 --22908 373
NM_175061chr72860 672 12024 --1810
NM_177538chr2198352 8280 7973 7349 7168 6914 6732 6416 5844 5571 2911 2311 2072 1738 1517 1427 1212 1022 288 --12460 --
NM_177985chr232064 585 578 --1840 1892
NM_178151chrX87479 7283 6880 6403 4961 4807 2045 1806 25960 693 17194 --
NM_178152chrX87479 7283 6880 6403 4961 4807 2045 1806 25960 693 17194 --
NM_178153chrX87479 7283 6880 6403 4961 4807 2045 1806 25960 693 17194 --
NM_178566chr941246 771 275 151 ----11754
NM_178815chr1022492 2252 --32578 1709 266 12451
NM_181358chr183461 3382 3280 1667 1583 1367 1342 172 --23691 3257 --
NM_182515chr1995709 5514 5082 4767 4469 2451 1769 1016 65 11101 ----
NM_194247chr263534 3344 3236 3148 1019 790 ----24268 3875
NM_194283chr572825 2790 1284 924 713 527 182 11161 22644 90 1857
NM_194314chr134465 4093 234 11513 23831 1202 1315
NM_198268chr183461 3382 3280 1667 1583 1367 1342 172 --23691 3257 --
NM_198269chr183461 3382 3280 1667 1583 1367 1342 172 --23691 3257 --
NM_199188chr1252966 2766 1337 1099 778 --1507 11354
NM_199190chr1252966 2766 1337 1099 778 --1507 11354
NM_199482chr231875 1815 777 11604 --11795
NM_206854chr623323 1168 --11365 23335 1703
NM_206876chr233412 629 357 32562 1230 676 22416 1073 --
NM_207012chr1053341 3220 2870 2733 308 12603 22271 193 --
NM_207325chr1941928 1881 758 472 ----11944
NM_213589chr245542 1386 802 738 14961 --15255