TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-181c-3p
miRNA Sequence: AACCAUCGACCGUUGAGUGGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)