TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-182-3p
miRNA Sequence: UGGUUCUAGACUUGCCAACUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX72642 1932 1873 1224 1185 1021 715 41783 1393 1245 979 16442 --
NM_000138chr1552405 2325 2114 1737 641 2769 79 --22015 57
NM_000176chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_000208chr1964457 4203 1718 978 914 405 44685 4351 3113 1766 ----
NM_000214chr2051722 1654 1528 700 657 1447 2581 101 --
NM_000216chrX73893 3314 2868 2858 957 305 140 13252 ----
NM_000242chr1052050 1989 1665 1003 932 ----12491
NM_000259chr15105293 4918 4897 4310 2328 1331 1235 401 149 53 25087 3943 26162 5061 --
NM_000264chr973000 2726 2209 2171 866 83 69 --22138 928 --
NM_000267chr1732363 1251 1184 1530 --11395
NM_000332chr686877 6740 5899 2415 2288 2279 1522 533 46789 6649 6388 1413 ----
NM_000337chr5106598 5516 5195 4145 2101 1567 995 945 375 84 46074 1221 348 239 26592 6489 --
NM_000367chr642327 2204 912 691 52078 1846 873 835 704 ----
NM_000368chr9104818 4339 4178 3666 3543 3518 3470 1940 1340 1293 14470 --12976
NM_000390chrX82628 2579 2474 2413 2365 1112 930 322 1374 1901 13104
NM_000393chr23615 575 63 --1854 1399
NM_000439chr541992 1900 990 294 22373 1947 1308 --
NM_000529chr1842339 2220 922 239 --126 11829
NM_000555chrX107424 7405 6814 5321 3000 2258 2151 1925 1800 470 27255 2247 --11169
NM_000584chr41365 132 --11011
NM_000618chr1295253 5243 5084 4673 4645 4639 2181 828 82 1304 25849 2225 --
NM_000618chr1295253 5243 5084 4673 4645 4639 2181 828 82 1304 25849 2225 --
NM_000719chr1295828 5630 4996 4852 2593 2512 1973 465 330 15189 --1415
NM_000793chr1443825 628 86 64 21841 1826 13999 --
NM_000809chr4169120 9105 8708 8332 7605 7190 6723 3639 3063 2785 1117 805 719 271 232 211 55812 2633 1138 1130 828 --11813
NM_000814chr1563780 3360 3123 3065 2758 1626 11182 --13948
NM_000831chr185271 4720 4644 1811 1601 1145 792 383 55454 5037 4666 2409 1790 ----
NM_000875chr15136326 6292 6039 5962 5794 5032 4500 4363 2106 1141 885 247 121 45642 5206 4974 288 --11967
NM_000899chr1252703 1657 961 224 171 --21283 280 13582
NM_001001331chr362729 2267 2071 1925 1699 583 21965 1949 1575 --
NM_001001419chr595200 4967 4738 4496 3252 1772 1181 816 269 21488 1116 13438 --
NM_001001420chr595200 4967 4738 4496 3252 1772 1181 816 269 21488 1116 13438 --
NM_001001664chr283405 3301 3182 2899 1198 1168 678 498 ----13458
NM_001001669chr582623 2107 1923 1855 969 886 421 233 ----22479 2288
NM_001001974chr1051969 1843 1710 635 152 ----12089
NM_001002257chr283442 3328 2854 2840 2806 2411 347 33 12528 22395 516 12403
NM_001002814chr863835 3705 3046 2450 1300 715 1426 12739 13657
NM_001002838chrX31622 1383 197 --11453 1579
NM_001003652chr18148215 7845 7748 7078 6978 6077 5808 3461 3399 3105 2961 2469 1935 994 15431 26587 2860 --
NM_001003674chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_001003675chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_001003712chr1263857 3739 1519 944 858 644 43580 2830 1579 1502 11321 13542
NM_001003800chr983569 3179 2536 1157 966 812 373 256 12974 --13763
NM_001005473chr585782 5057 4363 2618 2256 1532 1228 288 --26036 4680 26194 4811
NM_001005609chrX103546 3439 3172 3081 1453 1163 1122 668 236 65 22840 2329 32351 1443 821 --
NM_001007023chr1443825 628 86 64 21841 1826 13999 --
NM_001007094chr1084056 3539 3458 2951 2857 693 449 111 13524 12863 --
NM_001007097chr974480 4263 3953 3853 1729 1191 965 23583 1381 14071 --
NM_001008392chr362681 2486 1288 881 379 183 23184 1198 2521 41 --
NM_001008408chr7105690 4595 2334 2276 1309 1129 812 729 239 80 --11639 --
NM_001008539chr825333 1917 24902 1476 23857 3340 --
NM_001008564chr1342238 1573 911 26 1699 --1390
NM_001008925chr463524 2916 1138 637 206 162 23322 2816 23142 542 --
NM_001009554chr464500 4345 3697 968 540 338 34518 3229 1353 --11527
NM_001009554chr464500 4345 3697 968 540 338 34518 3229 1353 --11527
NM_001009555chr441632 1219 130 36 1668 --11175
NM_001009959chr262618 1833 1671 988 972 137 11808 --11880
NM_001010891chr556139 2497 2209 1281 266 25748 477 --21952 1213
NM_001011666chr7106170 6059 5950 5873 5763 4401 4052 1982 1299 77 34930 4016 2172 35734 4639 1165 12452
NM_001012393chr1174103 3751 3653 1743 1410 1380 1235 13728 1729 --
NM_001012755chrX44482 3461 722 389 51964 893 591 407 238 14549 --
NM_001012968chrX62565 2537 2379 2304 2263 264 ----12286
NM_001012977chrX1545 2442 34 --21333 362
NM_001013659chr1985157 4766 4576 3322 3316 1298 1113 1010 24429 3715 13853 14699
NM_001013746chr731935 937 218 ----11856
NM_001014797chr1097777 7133 5813 5659 5632 4963 3071 2563 1900 66896 6524 5619 1816 914 150 27543 6861 11612
NM_001015048chr1443172 2641 2133 333 31212 1107 698 --1341
NM_001015049chr1443172 2641 2133 333 31212 1107 698 --1341
NM_001017440chr798058 6462 3270 2199 1833 1293 728 643 138 27654 3043 42021 717 692 123 --
NM_001017926chr841812 330 208 147 129 1424 11130
NM_001018065chr9105713 5504 4711 3853 3748 1541 1337 1224 1150 627 36046 4152 2378 14325 --
NM_001018066chr9105713 5504 4711 3853 3748 1541 1337 1224 1150 627 36046 4152 2378 14325 --
NM_001018067chr155266 4648 3652 1327 1132 14159 --15222
NM_001018068chr155266 4648 3652 1327 1132 14159 --15222
NM_001018069chr155266 4648 3652 1327 1132 14159 --15222
NM_001018074chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_001018075chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_001018076chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_001018077chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_001024094chr562925 2911 2480 1509 1002 847 13226 22564 1242 --
NM_001024649chr551948 1069 299 197 71 22643 2599 2510 308 --
NM_001025076chr1065756 1826 1706 1116 856 46 ----1604
NM_001025077chr1067114 5016 4820 4620 2474 2214 194 1963 11962
NM_001025252chr832895 2500 2466 52711 2441 2037 900 490 21095 650 --
NM_001025253chr832895 2500 2466 52711 2441 2037 900 490 21095 650 --
NM_001030007chr1683976 3641 3511 3505 1392 1122 639 119 23187 285 13442 --
NM_001031695chr22115114 4918 4826 4315 3984 3327 1883 1858 1226 1094 1086 25217 5103 21532 909 --
NM_001031804chr16104231 4081 3848 3282 3176 2989 1279 1195 1118 533 14390 11140 185
NM_001032999chr20104459 4433 4409 3317 3295 2129 1686 1029 941 865 --25228 75 --
NM_001033047chr441901 1769 1642 1071 --1917 11825
NM_001033659chr1731633 1351 360 2513 237 --1434
NM_001034841chr1615242 1330 --21621 896
NM_001034845chr451255 209 187 175 157 11349 --1419
NM_001037172chr321210 255 1132 21132 28 1342
NM_001037954chr1132935 2410 1300 12542 132 21108 743
NM_001039547chr368050 7114 7059 6787 5841 1187 17307 --21444 1342
NM_001039577chr193585 3216 3160 1750 1425 794 732 704 617 24546 4448 13440 --
NM_001039580chr431911 1757 508 --41821 1737 1403 541 13273
NM_001039585chr1104101 4043 3783 3702 1049 875 842 292 268 120 23349 1187 12908 --
NM_001039590chrX93676 3262 2998 2575 1470 1453 1066 768 443 --11344 --
NM_001039591chrX93676 3262 2998 2575 1470 1453 1066 768 443 --11344 --
NM_001039618chr11105956 5570 5139 4464 3727 3681 3622 2379 2335 1099 24417 944 15707 --
NM_001039709chr20104459 4433 4409 3317 3295 2129 1686 1029 941 865 --25228 75 --
NM_001039840chrX115870 5353 5323 4496 4403 4238 4098 4043 2029 1324 118 25200 1098 34338 4117 4037 --
NM_001040102chr1092673 2597 2417 2349 2331 1847 857 128 39 31869 1792 484 --11769
NM_001040103chr1092673 2597 2417 2349 2331 1847 857 128 39 31869 1792 484 --11769
NM_001040108chr1493280 3140 2758 2740 2697 2525 2118 1033 621 23093 2197 ----
NM_001040152chr774929 4827 4696 4688 4545 4458 3138 44470 4118 844 198 ----
NM_001040284chr1644288 4004 1989 1480 24468 2160 1716 --
NM_001040424chr2162264 2186 2002 995 407 31 1291 --1836
NM_001040429chr1353575 3290 3031 343 220 12268 --13594
NM_001040441chr1105316 4945 4788 4646 4306 3976 3419 2085 2033 969 34807 438 213 ----
NM_001040450chr1552910 2838 2027 1987 1925 ----2887 25
NM_001040453chr1552910 2838 2027 1987 1925 ----2887 25
NM_001040712chr922913 216 22305 303 22478 662 12667
NM_001042355chr1655296 5115 1887 1292 864 24804 1122 1931 22050 993
NM_001042412chr1655296 5115 1887 1292 864 24804 1122 1931 22050 993
NM_001042492chr1732363 1251 1184 1530 --11395
NM_001042599chr2107756 7303 6536 6122 5002 3071 2418 1243 525 475 43158 2718 266 204 25841 5467 21821 1613
NM_001042601chr341248 1235 1209 1144 12423 --11291
NM_001042604chr363477 3422 1842 1133 636 85 33104 1257 723 --1669
NM_001071775chr1341580 1504 1261 528 1181 21290 355 --
NM_001099678chr3106302 5986 5288 5272 4927 1689 1471 1160 404 67 45332 1174 794 521 --12033
NM_001100108chr1157974 7841 7175 6665 6610 5317 2828 2442 2309 2254 2171 1912 1790 1367 534 12771 ----
NM_001106chr3189257 7865 7708 7436 7001 6690 6446 6339 6198 6098 3444 2404 1821 757 668 428 361 296 27353 278 13168 39761 8814 929
NM_001116chr1673008 2847 2758 2724 2388 760 337 22381 1165 12986 --
NM_001128chr1683976 3641 3511 3505 1392 1122 639 119 23187 285 13442 --
NM_001167chrX96185 4949 4802 4685 4210 1638 1420 723 595 11598 16672 --
NM_001201chr453052 997 716 697 177 --33121 429 283 --
NM_001204chr297389 5411 5256 5014 2819 2171 1938 974 858 --15477 --
NM_001399chrX103546 3439 3172 3081 1453 1163 1122 668 236 65 22840 2329 32351 1443 821 --
NM_001497chr962754 1101 348 319 300 268 ----12250
NM_001527chr621930 701 --23278 750 14653
NM_001616chr232958 2676 2597 12290 --12935
NM_001650chr1884022 3424 3236 3046 2882 1351 990 321 --141 --
NM_001683chr362729 2267 2071 1925 1699 583 21965 1949 1575 --
NM_001746chr551948 1069 299 197 71 22643 2599 2510 308 --
NM_001858chr694409 3913 3433 3374 3238 1381 1311 1000 566 14525 ----
NM_001859chr943755 3278 1315 476 21207 704 1929 1285
NM_001918chr1109314 8129 7642 7381 6476 5880 5686 2618 2548 487 49123 8848 7743 7439 --15854
NM_002009chr1542367 2359 1796 607 124 --12140
NM_002025chrX118856 6126 6041 3064 2794 2246 1972 1339 453 389 75 58713 7986 3585 3501 1356 ----
NM_002040chr2152445 2075 1943 188 49 12862 --1431
NM_002092chr454739 4369 1604 1574 922 23136 1130 14873 --
NM_002214chr795667 5383 4912 4523 4216 3906 3472 2139 273 11080 13490 --
NM_002267chr1341719 668 526 301 --1221 11778
NM_002270chr555529 5428 4947 4369 3880 33476 531 355 12211 --
NM_002310chr586387 5969 5058 4840 4596 4312 4136 196 11788 ----
NM_002349chr241245 314 220 197 21607 1077 199 --
NM_002356chr631991 86 33 ----1718
NM_002387chr5115107 4749 4724 3871 3407 3177 1977 1331 819 789 264 33721 1615 1299 34672 3215 405 --
NM_002545chr1174103 3751 3653 1743 1410 1380 1235 13728 1729 --
NM_002547chrX93597 2716 2666 1465 1412 682 576 499 36 23764 1109 ----
NM_002577chr383874 3702 3472 3012 2896 2839 1275 590 1832 13800 1556
NM_002581chr994215 3492 1310 1268 1136 795 544 257 42 23972 1906 21080 619 1892
NM_002610chr242993 2117 809 124 41113 926 514 72 32887 2208 862 --
NM_002613chr16135026 4880 4721 4570 4505 3974 3842 3706 3639 1272 1110 999 457 23613 3465 --12130
NM_002645chr1152700 2676 2200 241 127 33032 1146 511 12712 --
NM_002655chr855327 3589 3479 931 395 34332 3836 1163 11613 31950 922 174
NM_002731chr163090 2775 2594 2322 871 66 12990 12168 --
NM_002737chr1796252 6082 6039 5645 5483 5448 5406 2486 2136 24085 2323 1534 11161
NM_002745chr2233684 3545 910 24397 2815 --13901
NM_002839chr922913 216 22305 303 22478 662 12667
NM_002886chr3104930 4557 4448 3800 3587 3519 3446 1783 1748 1108 24585 502 ----
NM_002892chr1421457 269 --1496 11068
NM_002956chr1261235 1184 1116 181 92 21 ------
NM_002959chr1104247 3671 3027 1670 1287 1092 942 782 178 143 11173 13035 21048 40
NM_002977chr272946 2588 2577 756 744 210 199 1574 13214 --
NM_003034chr1296810 5557 3086 1990 1906 1506 738 413 343 35705 1242 330 57221 5899 2293 2250 440 13098
NM_003046chr825333 1917 24902 1476 23857 3340 --
NM_003108chr2106746 6067 6014 4610 2549 1583 1303 567 558 494 16730 25074 429 --
NM_003114chr83824 535 150 1210 1229 --
NM_003137chr641450 880 708 287 21743 684 21973 1845 --
NM_003189chr142142 1364 1352 1175 22778 2454 --11083
NM_003236chr242227 1053 245 166 12436 13320 22717 798
NM_003262chr355152 5110 3189 2123 163 23827 1123 ----
NM_003298chr375827 4291 715 333 230 46 35 24988 4378 1785 --
NM_003342chr1762206 2125 358 351 175 131 22449 785 12774 --
NM_003392chr3124203 4152 3674 3290 2811 2674 1531 1232 1117 273 151 37 33469 208 123 ----
NM_003413chrX41972 1873 1816 31 11406 --1779
NM_003421chr1084056 3539 3458 2951 2857 693 449 111 13524 12863 --
NM_003474chr1071726 1598 797 684 666 612 125 32333 2069 485 1445 12193
NM_003489chr2122941 1025 11099 --1961
NM_003590chr252978 2718 1582 1404 592 13315 --12789
NM_003617chr174925 3561 3317 3299 1289 1232 811 43172 1900 1350 266 ----
NM_003622chr1242033 792 418 387 1407 22203 538 --
NM_003671chr9103444 3251 2617 2432 2387 2333 1088 761 583 40 ------
NM_003681chr2165723 5078 4692 3844 1976 1311 44508 1822 1712 803 25923 1545 187
NM_003759chr474123 3550 2626 1679 593 551 78 14013 284 49 13907
NM_003861chr1462747 2527 2210 1846 782 391 32624 2492 1019 ----
NM_003885chr1762235 2085 1979 1841 633 156 21058 214 12362 --
NM_003948chr452380 2355 2338 2317 1767 21845 711 21833 953 --
NM_003994chr1252703 1657 961 224 171 --21283 280 13582
NM_004028chr1884022 3424 3236 3046 2882 1351 990 321 --141 --
NM_004090chr1793454 3176 2777 2694 2297 2252 1189 717 659 12627 12435 --
NM_004171chr11169075 8785 8479 8446 7210 7161 7133 7117 7028 6123 5918 3387 2906 2474 1140 633 39055 3134 1159 21635 1559 27701 7649
NM_004302chr12102446 2419 2214 2159 2015 1977 789 350 242 140 2432 42 12074 1883
NM_004331chr842185 1910 671 217 --1742 12434
NM_004338chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_004392chr1352415 1658 1015 759 40 12619 12442 12018
NM_004412chr1055978 1783 1691 1182 305 25825 2364 25061 4642 --
NM_004432chr941847 707 629 592 11789 --1861
NM_004440chr652000 1310 580 531 74 ----11738
NM_004458chrX71913 1827 624 336 240 89 62 12385 1886 --
NM_004501chr183482 3339 3202 2560 2494 1178 612 204 ----23080 1595
NM_004586chrX85428 5400 4621 4425 4160 1675 904 629 14131 14796 --
NM_004612chr9104676 3579 3367 3259 3166 1851 1805 1294 1143 685 --14428 --
NM_004703chr1782406 2265 1780 1018 598 561 409 56 1592 ----
NM_004726chrX105287 5263 5180 4847 4051 3505 1474 1458 369 317 15373 --14083
NM_004734chr1373047 2822 2502 612 577 448 229 ------
NM_004744chr473333 3220 2968 2842 1564 249 60 11349 11136 --
NM_004745chr875776 5221 5060 5022 4613 2541 646 --1324 16337
NM_004748chr15103742 3247 2911 1578 1320 1203 1079 1069 1004 146 ------
NM_004798chr2082944 2738 2686 2623 2611 1428 1159 98 32229 421 400 43149 2440 1137 480 --
NM_004808chr10143320 3098 2833 2762 2535 2121 2091 1318 1140 1015 905 707 174 64 22901 2212 22645 24 --
NM_004822chr1753967 3358 2809 437 375 ----23997 942
NM_004824chr641437 957 410 402 11034 11280 --
NM_004834chr282672 2209 1320 1288 1105 819 688 55 --12517 --
NM_004845chrX103983 3536 2718 1537 1530 1258 1237 659 536 22 11579 --11432
NM_004857chr1424393 3560 34446 1208 940 33986 3738 110 --
NM_004859chr174925 301 272 196 22280 1116 --13021
NM_004866chr5105013 4750 4682 3875 3811 1756 1236 560 497 353 --12027 --
NM_004873chr1443172 2641 2133 333 31212 1107 698 --1341
NM_004904chr7106170 6059 5950 5873 5763 4401 4052 1982 1299 77 34930 4016 2172 35734 4639 1165 12452
NM_004976chr11114751 4656 3191 1813 1248 1034 673 526 504 167 154 44922 4567 4539 2030 ----
NM_004992chrX96767 6087 6065 5605 2614 1753 1358 972 797 46452 6106 2317 1094 ----
NM_004992chrX96767 6087 6065 5605 2614 1753 1358 972 797 46452 6106 2317 1094 ----
NM_004999chr6114522 3789 3445 3409 2919 2785 1202 870 592 579 327 24022 3083 ----
NM_005044chrX114410 4403 3377 3117 2874 709 473 174 154 60 52 ------
NM_005065chr1464825 4743 3991 1456 797 510 21692 1051 45226 460 149 77 11542
NM_005076chr163547 2948 1358 1246 523 422 22871 582 1182 34135 3371 1105
NM_005079chr832895 2500 2466 52711 2441 2037 900 490 21095 650 --
NM_005093chr20104459 4433 4409 3317 3295 2129 1686 1029 941 865 --25228 75 --
NM_005116chr20114182 3979 3944 3877 3665 3437 3289 3127 1270 1258 648 11022 ----
NM_005188chr1177975 7230 6045 5610 1774 595 302 66865 5819 2118 1851 1541 34 ----
NM_005197chr1475369 4518 4077 2475 1911 1047 505 25960 4158 1223 11810
NM_005233chr362280 1968 1822 1670 1624 1028 1277 --1368
NM_005235chr2107756 7303 6536 6122 5002 3071 2418 1243 525 475 43158 2718 266 204 25841 5467 21821 1613
NM_005238chr1133388 377 106 23130 494 12902 12378
NM_005338chr773935 3920 3106 2826 2550 1337 1248 63909 3768 3636 1497 1397 311 ----
NM_005339chr454050 931 868 795 561 11552 --11341
NM_005358chr1331428 1254 272 1452 --1169
NM_005359chr18106531 6290 6012 4623 4469 4431 2013 1644 664 193 36405 5118 2506 1316 --
NM_005436chr1083851 3080 1597 1364 1168 801 550 499 43916 3391 3351 1464 1254 --
NM_005455chr121564 701 ----1645
NM_005497chr1755930 2297 1540 338 225 44414 3852 2392 2205 ----
NM_005502chr942977 2337 2131 1091 32843 811 87 21108 277 --
NM_005504chr1276642 6510 5476 1197 973 942 812 16494 16172 --
NM_005546chr582278 2054 2006 1930 751 570 98 71 1769 --11512
NM_005578chr374660 4186 3985 1688 1268 621 582 --11281 11891
NM_005596chr996072 5938 5776 4489 4064 1151 1116 84 30 1557 15872 --
NM_005647chrX83045 2715 2363 1324 1268 1101 990 226 23445 1362 1540 --
NM_005665chr164815 3323 3315 1688 1468 1432 43493 3205 1970 314 --13424
NM_005725chr13728 647 352 21885 1576 --1581
NM_005746chr762206 1738 840 613 586 277 11987 22628 2298 --
NM_005748chr1262522 2492 2335 1325 1201 145 12745 ----
NM_005759chr284789 4331 4248 3603 1582 1488 369 92 1476 --13820
NM_005779chr593284 2277 1414 1113 919 909 667 577 208 42384 1220 136 85 --12518
NM_005808chr362681 2486 1288 881 379 183 23184 1198 2521 41 --
NM_005840chrX167326 6806 6633 6476 6434 5182 2969 2474 2268 2163 2130 1733 1704 1650 1153 427 36944 5553 1409 14680 --
NM_005901chr18148215 7845 7748 7078 6978 6077 5808 3461 3399 3105 2961 2469 1935 994 15431 26587 2860 --
NM_005903chr595200 4967 4738 4496 3252 1772 1181 816 269 21488 1116 13438 --
NM_005977chr13--2905 313 140 1229
NM_006011chr1581681 1335 1068 938 813 713 243 89 21731 704 ----
NM_006033chr182647 82 --21892 687 21813 1477
NM_006047chr2063111 2379 1042 763 613 136 32539 2315 1245 2350 89 --
NM_006060chr764343 3789 3094 1424 1145 228 --33120 686 294 --
NM_006089chrX2692 132 11638 11558 1370
NM_006203chr585079 4121 3845 3567 2115 648 589 248 25313 1567 ----
NM_006212chr1115413 4740 3603 3495 2034 1798 1720 1653 799 244 172 13333 24157 1291 --
NM_006252chr1126871 5881 5799 5295 2956 2898 2881 2327 2321 891 715 689 45560 2379 2209 462 26988 2552 --
NM_006282chr2074703 4193 3730 2923 1309 1217 482 14205 --23537 1512
NM_006300chr1952433 952 778 207 199 12143 --1298
NM_006371chr394723 4532 3698 3540 3483 2013 1448 1388 94 44889 4186 1721 1517 ----
NM_006517chrX62340 2283 1891 1882 816 525 22054 245 22015 263 --
NM_006526chr2061520 1423 828 290 231 222 11822 1742 11754
NM_006534chr2052686 2314 937 871 397 52240 1294 820 383 108 ----
NM_006544chr14116021 5773 5695 5028 4967 4726 1944 1536 1371 781 135 21585 796 --25172 2057
NM_006546chr1794952 4725 4283 2651 1991 1984 1969 565 162 14255 35264 2023 1120 --
NM_006549chr1292601 2591 2177 2035 1969 917 891 592 490 22696 324 2963 109 --
NM_006561chr1065756 1826 1706 1116 856 46 ----1604
NM_006599chr1678236 5970 5894 5191 2988 1327 235 36954 6362 899 ----
NM_006614chr363522 3179 2644 992 394 73 --13577 --
NM_006624chr1041664 387 360 86 21359 380 ----
NM_006628chr15114519 4126 2835 1831 1497 1121 1018 887 645 546 207 --11692 --
NM_006731chr975354 5275 1862 1451 1219 949 288 45204 4846 1912 97 24497 2218 --
NM_006750chr16127769 7397 5927 5396 5251 1674 1291 1249 639 159 117 24 22704 1031 27831 647 12938
NM_006766chr862680 2434 2369 804 295 50 --21834 231 12134
NM_006924chr1763786 3290 2785 1703 886 737 --24126 28 --
NM_007006chr1673436 2915 1033 878 663 519 69 1166 ----
NM_007011chr1596540 5370 4689 4433 4201 2114 2027 1505 481 26336 1517 ----
NM_007038chr2164296 3708 551 324 292 140 11631 --14143
NM_007039chr1442019 2007 1547 578 22289 1441 --11960
NM_007043chr1211429 2847 537 11757 128
NM_007050chr20157363 7090 6915 6345 5792 5148 5002 4911 2693 2547 2438 1922 1353 1115 729 47344 4994 1296 1240 36881 4893 1375 11948
NM_007137chrX94986 4148 3367 2222 2191 2146 922 517 30 35186 1084 845 14555 --
NM_007146chr1782544 2265 2250 1973 948 868 447 372 --1298 --
NM_007174chr122545 65 11466 1351 12044
NM_007222chr841812 330 208 147 129 1424 11130
NM_007249chr13199397 8382 7803 7288 7060 7040 6132 3714 3408 3195 2883 2473 1703 1431 1296 785 457 366 192 87692 5814 5788 2539 2413 1920 1367 878 27002 2961 13077
NM_007345chr1822316 792 1141 12023 12331
NM_012096chr383666 3619 3604 3396 2690 2590 1078 521 12829 2671 502 --
NM_012164chr987150 7126 5469 5168 4736 2823 1902 777 1476 22121 1753 11920
NM_012193chr1185227 4748 4533 4229 3896 1191 1176 769 44867 3737 3417 2080 2586 550 --
NM_012214chr244714 4695 4361 4113 14398 13974 25810 5115
NM_012249chr283524 2380 2252 1310 1070 1045 364 318 --1959 11027
NM_012252chr785300 5229 5031 4867 1617 1427 1315 328 1846 ----
NM_012281chr771970 1865 1785 1773 488 280 52 1827 ----
NM_012287chr373830 3158 2876 2870 1735 975 184 --23385 196 1536
NM_012300chr53998 883 228 21627 622 2916 309 --
NM_012309chr1164641 3868 1642 1631 1262 1235 23949 1557 11924 --
NM_012316chr1105126 4572 4315 4223 3953 2227 1625 1406 1220 920 34804 613 186 11366 13944
NM_012333chr141313 1082 490 198 --21655 96 1149
NM_012347chr692582 2477 2332 2070 2059 888 882 477 156 1620 12245 --
NM_012382chr543578 3489 3097 2759 22989 2897 23434 1222 --
NM_013231chr1464197 3661 3429 856 641 283 1612 12957 --
NM_013233chr241171 1022 903 327 11124 --11368
NM_013255chr7128826 7412 7323 6573 5776 2999 2949 2139 1853 785 605 531 37924 899 798 --26663 640
NM_013261chr453490 3446 2948 2634 2480 22716 658 21024 461 1733
NM_013313chr22103223 3209 3076 3036 2737 2561 1422 1129 1004 946 42993 820 715 552 ----
NM_013372chr1553348 2496 786 356 107 22122 1100 1976 --
NM_013381chr1221658 1611 31605 1599 284 ----
NM_013386chr1----11213 1441
NM_013989chr1443825 628 86 64 21841 1826 13999 --
NM_014011chr262042 1670 998 653 194 179 --11931 --
NM_014089chr1342238 1573 911 26 1699 --1390
NM_014112chr855336 4706 962 348 308 24086 3391 34479 1174 105 --
NM_014141chr765260 4551 1629 538 368 360 23781 692 --23716 883
NM_014155chr1177073 6883 6297 6289 5754 5264 516 47121 2703 2295 904 12162 --
NM_014157chr1673948 3661 3356 3074 930 652 186 3729 310 206 ----
NM_014253chrX51871 524 377 320 88 11016 22118 239 --
NM_014309chr22115104 4908 4816 4305 3974 3317 1873 1848 1216 1084 1076 25207 5093 21522 899 --
NM_014331chr4176994 6655 6644 6248 6187 5849 5459 5326 2600 2456 2253 1930 1757 1283 811 777 327 15345 26373 6261 17390
NM_014381chr1493280 3140 2758 2740 2697 2525 2118 1033 621 23093 2197 ----
NM_014613chr562947 2778 1962 1901 1144 857 21057 604 12785 11115
NM_014616chr353054 2153 1086 1029 434 32993 2676 573 ----
NM_014630chr1593931 3811 3575 3291 3196 1371 1355 1245 190 2697 576 1650 --
NM_014707chr722155 400 --21419 872 12119
NM_014721chr697053 6797 6366 2965 2526 2439 1722 1199 495 55086 2863 1713 1639 1254 26568 4782 15546
NM_014730chr12135180 4708 4593 4013 3856 3618 3488 1643 1537 1391 1231 957 487 24880 3580 13362 --
NM_014730chr12135180 4708 4593 4013 3856 3618 3488 1643 1537 1391 1231 957 487 24880 3580 13362 --
NM_014732chr16105584 5471 5125 5073 4520 4156 4064 1212 566 150 21118 115 15228 1135
NM_014743chr442450 814 547 428 ----13012
NM_014766chr753066 3005 2823 2471 950 33606 3315 550 1711 --
NM_014787chr111985 41087 921 548 241 --11896
NM_014810chr182691 2572 2428 2333 1343 1128 995 145 3815 799 714 ----
NM_014828chr1462513 1903 1888 851 323 57 11602 22250 2219 --
NM_014832chr1351499 697 306 59 40 --1816 21926 104
NM_014838chr2262788 2677 2161 1832 619 312 ------
NM_014839chr17837 582 428 364 198 139 121 --12151 --
NM_014860chr232634 1962 473 32264 2137 328 168 --
NM_014877chr17117666 6740 6693 6346 5760 5524 2599 1417 1109 224 57 25373 2654 --15010
NM_014904chr1073289 3230 2873 1144 1073 545 250 --13555 --
NM_014924chr1443110 437 260 100 22791 497 32854 2487 655 --
NM_014932chr351570 1244 727 293 133 1312 --11676
NM_014934chr1393744 3721 3198 1460 1420 1316 1244 1196 663 --13030 1463
NM_014945chr531958 1700 479 1745 11450 21905 800
NM_014947chr133116 646 72 1904 --12358
NM_014949chr13771 729 416 196 1194 1216
NM_014982chr1494907 4678 4672 4419 4155 1820 1747 395 128 1813 1771 --
NM_014999chr1221203 110 11470 --11638
NM_015000chr1282101 1132 885 796 582 508 477 34 ------
NM_015020chr1663480 2506 2472 1420 1118 975 33176 2522 468 --22405 838
NM_015026chr1244012 3417 1465 420 ----24654 3058
NM_015035chr20156483 6438 5796 5784 4774 4761 4599 2352 2234 1269 992 967 654 155 135 45647 5459 307 64 2527 241 14437
NM_015039chr184338 3937 3830 3589 3493 3199 1394 600 41598 1093 933 153 23410 520 12875
NM_015049chr252944 2503 1171 811 372 12324 --13063
NM_015064chr1293586 3433 3001 2507 646 618 444 333 271 2681 422 161 12547
NM_015068chr783781 3679 3548 3540 3397 3310 1294 1051 23322 2970 ----
NM_015071chr556350 4220 2556 2256 671 75745 5603 5248 4404 4023 2546 2244 26314 5229 --
NM_015076chr684382 3512 1681 1420 1211 705 665 609 2967 74 --1693
NM_015077chr17114735 4375 3892 3468 3394 3107 3056 2968 1377 1040 904 21791 1335 1223 --
NM_015092chr16114262 3840 3810 3167 2958 1860 1487 1450 1230 607 348 43924 3408 2863 55 13214 --
NM_015144chr16103982 3169 3055 1516 1160 975 786 630 364 207 ------
NM_015172chr151350 1249 1176 1068 476 ----11015
NM_015199chr332433 2241 713 2681 442 22004 190 12869
NM_015200chr422531 1788 22325 2071 --1423
NM_015247chr1655296 5115 1887 1292 864 24804 1122 1931 22050 993
NM_015251chr1622191 1985 ----12005
NM_015271chr494070 3930 3786 3158 1146 936 920 587 367 23075 945 22807 1658 --
NM_015310chr8117764 7648 7590 7149 7105 6851 2161 1883 1411 624 470 87058 6383 6243 5487 5417 1577 1486 501 ----
NM_015313chr11114775 4088 3865 3715 3643 3272 3221 1902 1436 1232 281 13956 13286 --
NM_015336chr1251957 1854 1063 799 758 ----12321
NM_015349chr622348 2141 11237 --22596 848
NM_015359chr822079 538 11829 1253 2367 318
NM_015375chr194897 4790 4460 3648 1243 1109 990 883 92 11927 23749 134 1608
NM_015393chr473338 2531 894 630 308 292 65 53369 2388 1415 906 188 ----
NM_015436chr453343 2735 957 456 25 23141 2635 22961 361 --
NM_015458chr8115075 4809 4476 4394 3748 3730 3528 1385 822 344 29 ----14578
NM_015564chr542788 1432 609 508 63013 2935 2728 2441 1138 1075 ----
NM_015571chr662241 2141 2032 1899 1710 75 ------
NM_015575chr232543 1085 117 13005 1892 22336 836
NM_015640chr155266 4648 3652 1327 1132 14159 --15222
NM_015691chrX32442 966 441 --12268 21126 1032
NM_015713chr853164 3067 2891 815 542 32375 1344 1097 --1806
NM_015879chr18127563 6829 6638 6052 5337 5268 3282 2417 2188 1758 388 320 57282 6892 5819 2705 1175 25704 77 --
NM_016009chr1124365 4018 3942 3753 3664 3619 1523 1314 699 471 283 187 34701 4174 3548 --14188
NM_016025chr1641711 1376 734 91 1234 --1342
NM_016040chr13691 526 364 --11082 11063
NM_016076chr173072 2664 1997 1063 637 186 28 32337 1257 523 32985 955 569 --
NM_016133chr221571 1349 ----11596
NM_016206chr3148653 7975 7755 7168 6983 5732 3295 3254 2790 2471 2412 1196 499 91 18504 27011 3191 22883 906
NM_016220chr731935 937 218 ----11856
NM_016260chr2106559 2066 1648 1596 1488 1395 1384 491 394 41 11231 11964 11945
NM_016376chr1782915 2769 2714 1224 953 807 397 123 33759 3285 135 ----
NM_016422chr1162419 2222 2184 1947 592 434 13063 12866 --
NM_016441chr242182 1912 530 71 ----2509 219
NM_016485chr641821 1598 1447 796 ----1610
NM_016530chr1563559 3057 1631 1276 1066 229 31199 517 84 23750 1241 --
NM_016531chr464114 3858 3846 3820 2977 2970 12829 --1852
NM_016544chr262665 2410 1482 426 349 93 ----11511
NM_016577chr384018 3568 2786 1637 1344 1322 377 86 63889 3217 1790 1428 1273 1058 11088 --
NM_016603chr582253 2109 2034 1981 702 535 318 109 ------
NM_016620chr141115 947 568 439 1346 11056 --
NM_016652chr2071698 1637 1425 1293 636 568 54 --11260 --
NM_016953chr2135394 5300 4950 4879 4033 3990 2279 616 531 506 462 293 218 34106 1480 827 14051 --
NM_017415chr594248 3910 1598 1269 1156 724 647 119 68 13999 11408 --
NM_017420chr1452761 2616 1109 975 308 12597 23425 177 --
NM_017563chr3106381 6260 5884 4235 1758 1195 1025 706 509 275 11813 --14256
NM_017583chr1131313 666 224 21524 698 --21607 1456
NM_017628chr455303 4913 4709 3482 96 24379 1516 23804 2131 --
NM_017633chr673584 3144 2742 2627 1578 1108 620 32911 1237 727 11401 --
NM_017637chr998498 8306 7591 6862 6522 3330 2925 2563 495 29123 6823 27446 2802 28856 1130
NM_017644chr374088 3553 2086 1949 1681 1095 599 --11734 --
NM_017654chr731698 375 311 21227 502 11528 11481
NM_017709chr193772 3657 3637 3589 1157 756 738 195 33 13692 34276 1169 1141 --
NM_017724chr3------2259 216
NM_017736chr1692786 2682 2478 2449 2416 1974 974 935 627 1576 --1593
NM_017754chr684257 3480 3465 3221 2003 1521 492 65 2587 408 24971 4767 --
NM_018036chr1463516 3303 1403 1301 1212 1051 1377 11527 142
NM_018046chr541337 1220 587 46 2528 79 21543 441 1314
NM_018085chr1147611 7549 6783 6575 5854 5777 2503 1784 1584 1363 1062 884 412 190 28013 2825 57409 5696 3226 280 238 --
NM_018157chr1241061 459 257 135 22623 2327 1713 --
NM_018191chr1352142 2093 1581 805 249 21842 1378 31604 797 753 --
NM_018243chr473212 1485 1262 1148 883 778 180 22513 1049 23742 1244 --
NM_018247chr663148 2914 2062 1907 1265 703 --23083 284 12902
NM_018318chr122385 109 ----1152
NM_018361chr883819 3365 2831 1349 1303 898 719 135 21325 1092 --13435
NM_018364chr184078 3460 3266 3010 2780 2744 1167 712 --11594 --
NM_018373chr14115968 4697 4460 4354 4121 2149 2089 1484 1469 248 219 65683 5388 4480 4450 1772 1061 26271 4319 14061
NM_018403chr353430 2821 990 95 30 22941 874 --23547 496
NM_018440chr887827 6925 6601 6562 2793 2540 873 851 66981 6950 6333 5711 2529 345 16966 --
NM_018452chr6_random52549 1489 1185 432 407 12961 13757 13691
NM_018590chr1041580 1196 1135 476 11626 1637 1554
NM_018638chr1234292 1858 637 --33488 1969 1751 11776
NM_018947chr7104433 4321 3618 3314 3258 3066 1299 1088 1041 1026 24957 3513 33864 3085 747 23266 396
NM_018976chr1242763 2321 1895 836 ----1363
NM_018979chr1242300 1814 408 319 --1510 12143
NM_019001chr363477 3422 1842 1133 636 85 33104 1257 723 --1669
NM_019063chr211460 190 --1692
NM_019084chr1062205 1938 997 938 699 110 22269 2263 ----
NM_019094chr1273646 3386 2850 2776 1129 1074 1007 --33525 2408 828 --
NM_019610chr131879 1433 605 12054 12145 11598
NM_020119chr773869 3430 3333 3266 2654 1250 385 33674 1326 58 11433 1155
NM_020122chr2125934 5754 5292 5140 5092 4600 4334 3682 2252 2162 1514 1307 14778 ----
NM_020150chr103731 627 83 1611 --12037
NM_020337chr453071 2300 2225 2029 664 ----11935
NM_020347chr321721 1596 ----1136
NM_020348chr1072039 1068 811 376 229 189 57 22523 984 1679 --
NM_020390chr354269 3495 3241 1640 1597 14694 13522 --
NM_020443chr1116834 6229 6172 5671 5513 4953 2566 2013 1102 994 175 36901 5503 631 16131 --
NM_020466chr694353 3035 1816 1808 1273 1195 1160 683 620 1491 --13646
NM_020474chr1831454 458 322 31362 548 477 21985 416 1465
NM_020546chr582522 2320 2198 2124 2111 1281 1020 815 1258 --1580
NM_020699chr184767 4618 4141 3869 2077 716 540 304 34335 4233 1248 23298 1292 --
NM_020711chr262618 1833 1671 988 972 137 11808 --11880
NM_020717chrX74381 4203 3816 1858 1761 1079 319 53200 1355 1320 585 286 --1234
NM_020718chr1686428 5501 5388 4686 1279 1208 869 309 25129 5086 153 14946
NM_020739chr15103742 3247 2911 1578 1320 1203 1079 1069 1004 146 ------
NM_020766chrX41691 1683 1149 1111 24448 4144 --13128
NM_020772chr17107889 7728 7644 7535 7324 6609 2713 1192 772 458 1105 18244 2117 45
NM_020774chr1885230 4386 2271 2223 1777 1666 1492 589 --14274 --
NM_020782chr1254671 3009 1835 1470 1132 23017 1340 13496 14836
NM_020783chr1872288 2156 1939 1803 325 293 22 1724 ----
NM_020841chr1263857 3739 1519 944 858 644 43580 2830 1579 1502 11321 13542
NM_020922chrX31622 1383 197 --11453 1579
NM_020927chr16102334 2143 1871 1801 1671 690 390 372 278 50 11611 ----
NM_020940chr1041103 813 553 141 32599 132 35 12429 12124
NM_021033chr13102931 2925 2346 1203 677 632 604 458 112 79 ------
NM_021090chr2274233 3690 3641 3452 2010 1903 469 34111 3262 372 --21011 109
NM_021116chr7158325 8292 8067 7443 7093 6922 6026 3264 3141 3040 2846 2595 2274 2214 343 86981 5802 3107 1014 685 506 375 85 --27641 3486
NM_021151chr7------2249 152
NM_021163chr753137 2442 2353 1118 156 23788 3170 12422 --
NM_021191chr1252442 2174 920 507 245 2755 742 1594 1954
NM_021202chr2022370 1883 22389 2249 32721 2137 513 22897 989
NM_021622chr1051969 1843 1710 635 152 ----12089
NM_021629chr384888 4427 4302 4221 3771 1603 816 287 2401 205 14682 11640
NM_021647chr464500 4345 3697 968 540 338 34518 3229 1353 --11527
NM_021813chr645274 4516 1642 1231 45305 5075 4219 3818 11350 1587
NM_021814chr651547 1099 1050 636 125 --31189 1170 1058 11347
NM_021912chr1563780 3360 3123 3065 2758 1626 11182 --13948
NM_021914chr1441620 783 772 314 --1209 12206
NM_021960chr182427 2220 2151 2105 2000 904 801 353 12130 --22729 446
NM_021961chr1185330 5225 4559 2756 1645 1031 494 321 12151 36968 2974 2205 --
NM_021964chr3146431 6227 5966 5733 5579 5230 2223 2153 2046 1675 1065 922 667 40 --26474 932 15149
NM_022459chr1355816 5052 3931 352 119 --16119 --
NM_022469chr163214 2450 2224 1328 771 299 12163 12191 12646
NM_022977chrX71913 1827 624 336 240 89 62 12385 1886 --
NM_023000chr1421457 269 --1496 11068
NM_023001chr1421457 269 --1496 11068
NM_023037chr1331142 195 152 1181 --1901
NM_024007chr593083 2729 2282 2241 2155 1144 879 858 83 --12707 --
NM_024551chr1252290 1789 1766 1031 564 12595 --11612
NM_024551chr1252290 1789 1766 1031 564 12595 --11612
NM_024596chr8155419 5331 4957 4516 4198 4042 3642 2092 1769 1115 610 542 528 479 152 33780 1759 1610 35147 4259 1426 --
NM_024607chr884154 3907 3775 3394 1376 1296 1151 99 11773 --14343
NM_024770chr275304 4949 4521 2534 2528 1788 550 44694 4248 2560 2107 --14182
NM_024798chr1552293 769 446 182 150 12568 32232 2050 200 --
NM_024817chr1575716 5157 4658 4209 3869 1860 1610 54740 4264 4101 3819 1110 25567 4756 24258 4010
NM_024854chr12------21488 345
NM_024947chr3169501 8986 8007 7813 7648 6965 6284 6013 3139 1897 1433 1279 657 465 326 83 27884 7759 28412 8400 13400
NM_024949chr464050 3759 1881 1476 1224 128 14089 11591 1979
NM_024989chr287850 5621 5318 5077 5057 3148 2026 573 16932 15980 --
NM_025054chr8124154 4116 4050 4007 3606 2679 2615 1525 1314 1266 945 567 ------
NM_025073chr184672 4268 3021 1736 1481 1409 576 137 43758 1330 880 462 ----
NM_025074chr492581 2284 2150 2111 2039 1907 655 572 182 1173 ----
NM_025083chr1521732 135 12017 --2745 452
NM_025160chr184281 4264 4206 3358 2810 1619 251 203 1125 14069 --
NM_025219chr2042443 2272 2136 506 12170 12426 42361 947 932 61
NM_030579chr1642518 1322 1031 181 33380 2809 2273 23000 850 13716
NM_030647chr746332 4222 1511 794 --22429 219 25244 2416
NM_030650chr273351 3019 1462 968 557 437 345 --23501 571 --
NM_030674chr12115464 4917 4662 4469 3911 3751 3667 3650 2039 1477 428 65513 3846 1876 1755 1228 986 65798 5147 2183 1663 829 315 --
NM_030806chr188999 8155 7666 6637 6201 2977 2209 895 19148 28230 5954 17287
NM_030816chr143370 3315 2615 929 33635 3189 3049 1745 --
NM_030817chr1272996 2849 2731 529 518 471 463 --13460 --
NM_030885chr31633 --12227 1787
NM_030918chr185392 4927 3782 3585 1764 1597 1149 344 44241 3543 2159 406 21709 1317 15130
NM_031268chr16135026 4880 4721 4570 4505 3974 3842 3706 3639 1272 1110 999 457 23613 3465 --12130
NM_031296chr452640 2537 1946 646 344 --1251 1610
NM_031427chr1455803 5037 3781 1787 1151 55400 5115 1716 1377 506 12354 15820
NM_031435chr1263346 2969 1385 1050 722 204 32648 2472 1320 ----
NM_031453chr1062279 2006 1995 824 486 368 21979 258 11039 12590
NM_031468chr798058 6462 3270 2199 1833 1293 728 643 138 27654 3043 42021 717 692 123 --
NM_031483chr2062799 2570 916 910 207 35 12450 ----
NM_031844chr183482 3339 3202 2560 2494 1178 612 204 ----23080 1595
NM_032160chr1843555 3340 3136 1743 1553 --1920
NM_032174chr191461 1280 1249 1144 1106 1072 380 152 84 1136 2110 36 --
NM_032182chr105510 437 138 87 69 1203 11380 --
NM_032186chr141115 947 568 439 1346 11056 --
NM_032199chr1051343 1142 817 309 300 23305 1038 ----
NM_032208chr273475 2977 2514 1444 1229 444 53 12990 21150 959 --
NM_032291chr131538 1514 45 --11390 1468
NM_032373chr10105486 5330 4225 4082 3854 2175 1893 1068 964 584 ----35089 2338 1086
NM_032446chr5123178 2951 2638 2611 2459 1518 970 961 647 626 291 44 13282 23166 32 1233
NM_032486chr1672302 2070 939 885 520 265 137 22705 274 --2921 822
NM_032510chr18112391 2172 1884 1860 1741 1582 1536 679 184 170 59 ------
NM_032521chr2042618 1997 348 284 21182 260 --1759
NM_032859chr1372650 2595 2521 2445 1486 889 745 --11106 13638
NM_032873chr1163898 3602 2858 1036 776 626 11199 13057 1455
NM_032932chr17105946 5632 4762 4063 3981 2512 2396 1696 1001 308 11503 25667 34 15019
NM_032961chr42983 202 --1155 21257 961
NM_032983chr743370 2648 1075 102 1465 22587 877 11025
NM_033133chr17113601 3467 3408 3361 3170 1318 899 477 380 287 232 21008 451 ----
NM_033143chr433290 1390 204 --2597 67 13115
NM_033207chr1092673 2597 2417 2349 2331 1847 857 128 39 31869 1792 484 --11769
NM_033211chr571789 1538 1458 1312 822 201 125 --21711 450 --
NM_033224chr7108001 7721 7298 6458 6450 6355 5887 2007 1348 1246 31951 967 630 37497 755 672 --
NM_033331chr9103444 3251 2617 2432 2387 2333 1088 761 583 40 ------
NM_033425chr1132935 2410 1300 12542 132 21108 743
NM_033480chr692582 2477 2332 2070 2059 888 882 477 156 1620 12245 --
NM_033481chr692582 2477 2332 2070 2059 888 882 477 156 1620 12245 --
NM_033505chr296438 5847 4928 4818 4467 2280 1887 598 391 25205 4569 ----
NM_033644chr53998 883 228 21627 622 2916 309 --
NM_033645chr53998 883 228 21627 622 2916 309 --
NM_033656chr2145996 3918 1776 541 11754 24507 3746 22086 720
NM_052937chr872517 2219 964 861 778 758 172 11099 12435 --
NM_053016chr9127638 7448 7312 6519 5651 4984 4843 3182 2296 1312 625 207 57417 7385 2906 2445 2334 12304 --
NM_053043chr7105690 4595 2334 2276 1309 1129 812 729 239 80 --11639 --
NM_053064chr1492586 2402 1933 1228 1002 976 907 394 25 23012 112 ----
NM_057175chr472470 2253 2187 2112 2088 1646 886 3784 719 679 ----
NM_080743chr682557 2426 874 655 592 519 405 284 ------
NM_080759chr1352415 1658 1015 759 40 12619 12442 12018
NM_080760chr1352415 1658 1015 759 40 12619 12442 12018
NM_080872chr874033 3298 2720 2673 1485 829 528 --1536 11240
NM_130391chr922913 216 22305 303 22478 662 12667
NM_130392chr922913 216 22305 303 22478 662 12667
NM_130393chr922913 216 22305 303 22478 662 12667
NM_130830chr3123679 3539 3524 3449 3392 3315 2570 1568 814 667 588 46 14028 13478 13031
NM_133170chr20157363 7090 6915 6345 5792 5148 5002 4911 2693 2547 2438 1922 1353 1115 729 47344 4994 1296 1240 36881 4893 1375 11948
NM_133367chr693196 2665 2139 2128 1103 1097 1040 998 450 2766 274 ----
NM_133493chr694370 3817 3707 3389 2870 1859 536 299 250 34241 3927 936 23093 999 --
NM_138288chr141139 31879 1819 502 --11625
NM_138444chr1371508 644 376 238 228 168 67 13575 2967 578 --
NM_138638chr1441620 783 772 314 --1209 12206
NM_138694chr643556 3178 2770 589 23281 797 13622 --
NM_138713chr1678236 5970 5894 5191 2988 1327 235 36954 6362 899 ----
NM_138714chr1678236 5970 5894 5191 2988 1327 235 36954 6362 899 ----
NM_138731chr1454020 3264 2996 2986 1129 24067 1383 23452 1037 --
NM_139321chr2034203 4099 3539 34164 290 55 --1278
NM_144571chr4106873 5276 5227 4998 4623 4464 4383 2785 2071 790 15345 --35881 4939 187
NM_144949chr262042 1670 998 653 194 179 --11931 --
NM_144963chr862359 2027 1057 858 748 413 11922 11881 --
NM_144973chr1295208 5089 4787 4776 4317 3496 2052 835 122 13533 ----
NM_145117chr1181178 1113 985 521 480 347 209 112 32418 1266 962 ----
NM_145207chr485206 4989 4328 3703 3618 1852 304 124 --14162 15139
NM_145259chr2156873 6121 5888 5624 4680 4600 4364 2732 2694 2623 2217 1900 1408 717 413 36542 893 864 37122 5405 1619 --
NM_145307chr1063899 3357 1311 1155 566 70 11329 1443 --
NM_145686chr282672 2209 1320 1288 1105 819 688 55 --12517 --
NM_145687chr282672 2209 1320 1288 1105 819 688 55 --12517 --
NM_147189chr852360 2305 378 227 184 1855 --1482
NM_152263chr174601 4582 4341 2354 1152 689 54 35953 5338 4333 11947 13974
NM_152271chr84777 410 276 188 ----1938
NM_152282chr321210 255 1132 21132 28 1342
NM_152622chr543045 2926 1116 602 --11040 1134
NM_152624chr597230 7037 6986 6091 5317 2817 2107 1597 1581 12023 24522 2827 --
NM_152641chr1272884 2118 840 633 222 102 88 11816 1907 12505
NM_152707chr104896 411 205 164 1115 --1273
NM_152754chr723379 2525 31442 1056 428 12800 --
NM_152756chr5123797 3611 3543 3022 2897 1550 1490 1208 777 583 331 152 2961 267 ----
NM_152838chr2063111 2379 1042 763 613 136 32539 2315 1245 2350 89 --
NM_152924chr1596540 5370 4689 4433 4201 2114 2027 1505 481 26336 1517 ----
NM_153035chr1103185 2776 2708 2353 2185 2179 927 585 451 154 32684 2537 501 ----
NM_153050chr2274233 3690 3641 3452 2010 1903 469 34111 3262 372 --21011 109
NM_153051chr2274233 3690 3641 3452 2010 1903 469 34111 3262 372 --21011 109
NM_153188chr555529 5428 4947 4369 3880 33476 531 355 12211 --
NM_153207chr12114118 4099 3833 3644 3375 1574 1374 1357 1078 561 281 13310 ----
NM_153367chr10103953 3854 2998 2882 2789 1476 1291 1271 426 324 127 ----
NM_153456chr1332369 335 316 55617 5134 4001 2069 266 46290 5840 4264 4164 15054
NM_153499chr1292699 2689 2275 2133 2067 1015 989 690 588 22794 422 21061 207 --
NM_153500chr1292699 2689 2275 2133 2067 1015 989 690 588 22794 422 21061 207 --
NM_153810chr1074556 4463 4364 4239 1960 1342 817 --34070 1820 562 --
NM_170665chr1254260 4132 3579 1549 938 23264 219 --11170
NM_170706chr184338 3937 3830 3589 3493 3199 1394 600 41598 1093 933 153 23410 520 12875
NM_170751chr641437 957 410 402 11034 11280 --
NM_170752chr641437 957 410 402 11034 11280 --
NM_171998chrX42257 859 654 88 22314 1002 167 --
NM_172071chr197176 7047 6679 6532 5575 5464 5402 2828 704 11088 --11000
NM_172216chr1292601 2591 2177 2035 1969 917 891 592 490 22696 324 2963 109 --
NM_172218chr83824 535 150 1210 1229 --
NM_172226chr1292699 2689 2275 2133 2067 1015 989 690 588 22794 422 21061 207 --
NM_172373chr132516 339 ----1502
NM_173214chr1678236 5970 5894 5191 2988 1327 235 36954 6362 899 ----
NM_173463chr483784 3465 904 850 683 435 142 81 11750 --24261 829
NM_173468chr4105580 4496 4351 2314 2144 1649 1611 1408 992 584 1189 24064 427 14943
NM_173510chr2252918 2830 2221 2084 42 ----12781
NM_173511chr293771 3506 2988 2911 2695 1257 1141 841 42 1401 23961 2598 12440
NM_173582chr11116065 5406 4712 2194 2133 1944 1162 917 551 58 42 56009 5519 5287 4851 1677 ----
NM_173602chr1292863 2656 2596 2567 1294 1160 904 441 317 43059 924 810 41 12798 --
NM_173642chr1129004 8934 8751 8498 8033 8012 7724 7605 6501 2645 2083 1287 27673 3612 2801 314 12486
NM_173808chr134225 3244 136 24106 2939 13994 --
NM_173822chr21811 --11890 1423
NM_173826chr361737 1698 1320 1147 574 425 ----11599
NM_174911chr873561 3196 3072 2652 2467 1300 403 --12971 --
NM_175736chr12167216 7006 6570 5966 5737 5092 4976 2679 2592 2511 2221 2021 2015 1972 1028 1011 27280 5208 47170 6175 2990 318 --
NM_175921chr554095 3064 3012 2823 799 ----11324
NM_176081chr1055978 1783 1691 1182 305 25825 2364 25061 4642 --
NM_176083chr1055978 1783 1691 1182 305 25825 2364 25061 4642 --
NM_178011chr1053156 3135 1241 565 252 --11101 12470
NM_178037chr1293586 3433 3001 2507 646 618 444 333 271 2681 422 161 12547
NM_178038chr1293586 3433 3001 2507 646 618 444 333 271 2681 422 161 12547
NM_178151chrX107424 7405 6814 5321 3000 2258 2151 1925 1800 470 27255 2247 --11169
NM_178152chrX107424 7405 6814 5321 3000 2258 2151 1925 1800 470 27255 2247 --11169
NM_178153chrX107424 7405 6814 5321 3000 2258 2151 1925 1800 470 27255 2247 --11169
NM_178505chr1043576 2416 1176 536 --132 13001
NM_178509chr1774147 3955 3847 3365 3271 2619 1154 34111 3518 1169 --13217
NM_178566chr961840 1769 1634 1336 1269 759 ----172
NM_181457chr251265 1062 462 297 193 11191 --11146
NM_181458chr261398 1195 595 430 326 67 11324 --11279
NM_181459chr251164 961 361 196 92 11090 --11045
NM_181460chr251211 1008 408 243 139 11137 --11092
NM_181481chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_181482chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_181483chr18126495 6434 5801 5105 5039 4750 4300 2685 2252 1461 1230 461 44884 4505 2050 429 ----
NM_181659chr2052686 2314 937 871 397 52240 1294 820 383 108 ----
NM_181659chr2052686 2314 937 871 397 52240 1294 820 383 108 ----
NM_181706chr1141944 1624 1611 252 --1425 --
NM_182485chr473548 2861 2409 2290 1443 777 723 --13405 --
NM_182515chr1976208 6004 5379 4736 2077 1332 159 2985 35 ----
NM_182551chr283442 3328 2854 2840 2806 2411 347 33 12528 22395 516 12403
NM_182646chr473548 2861 2409 2290 1443 777 723 --13405 --
NM_182763chr182416 2209 2140 2094 1989 893 790 342 12119 --22718 435
NM_182798chr551361 365 295 47 31 31184 573 153 11033 --
NM_182799chr551361 365 295 47 31 31184 573 153 11033 --
NM_182801chr551361 365 295 47 31 31184 573 153 11033 --
NM_182898chr7106170 6059 5950 5873 5763 4401 4052 1982 1299 77 34930 4016 2172 35734 4639 1165 12452
NM_182899chr7106170 6059 5950 5873 5763 4401 4052 1982 1299 77 34930 4016 2172 35734 4639 1165 12452
NM_182948chr163090 2775 2594 2322 871 66 12990 12168 --
NM_182964chr1181178 1113 985 521 480 347 209 112 32418 1266 962 ----
NM_182970chr20113642 3521 2699 1404 1125 1044 912 806 734 509 373 33325 3044 362 31634 994 791 --
NM_183043chr13--2905 313 140 1229
NM_183044chr13--2905 313 140 1229
NM_183397chr20125085 4871 4397 3648 3273 1901 1349 1277 1230 1177 788 210 23450 2027 ----
NM_194283chr5154121 4068 4010 3967 3921 3864 3757 3607 3373 3105 3036 2583 977 956 893 ------
NM_194285chr1172897 2574 1252 568 516 497 32 --12906 --
NM_194286chr12136009 5904 5834 4982 4224 4201 3986 2454 2347 2004 1910 1496 712 34816 1960 238 --14919
NM_194314chr155018 4426 2219 954 637 1389 --11048
NM_198181chr1562594 2522 2187 1058 692 332 12243 --191
NM_198240chr1261235 1184 1116 181 92 21 ------
NM_198270chrX23384 546 33159 2617 441 12208 13223
NM_198465chrX2787 689 22692 443 --11858
NM_198503chr161870 1729 1657 594 529 200 1513 ----
NM_198581chr2126870 5939 5269 2842 2789 2589 1529 1413 1251 997 644 430 1132 32368 1962 406 --
NM_198834chr1751663 865 575 177 51 1915 11996 1658
NM_198836chr1751663 865 575 177 51 1915 11996 1658
NM_198837chr1751663 865 575 177 51 1915 11996 1658
NM_198838chr1751663 865 575 177 51 1915 11996 1658
NM_198839chr1751663 865 575 177 51 1915 11996 1658
NM_198859chr394874 3706 3624 1233 1205 1024 739 489 383 33748 3611 3190 1346 --
NM_198900chr12167216 7006 6570 5966 5737 5092 4976 2679 2592 2511 2221 2021 2015 1972 1028 1011 27280 5208 47170 6175 2990 318 --
NM_198968chr1393744 3721 3198 1460 1420 1316 1244 1196 663 --13030 1463
NM_199040chr1273646 3386 2850 2776 1129 1074 1007 --33525 2408 828 --
NM_199320chr472913 2331 2012 897 761 622 439 2931 376 1246 12459
NM_199320chr472913 2331 2012 897 761 622 439 2931 376 1246 12459
NM_199462chr194897 4790 4460 3648 1243 1109 990 883 92 11927 23749 134 1608
NM_201269chr141115 947 568 439 1346 11056 --
NM_203327chr20114182 3979 3944 3877 3665 3437 3289 3127 1270 1258 648 11022 ----
NM_203350chr121459 596 ----1540
NM_203364chr1121162 206 1446 --1465
NM_203458chr143246 1487 1438 1307 13347 --13356
NM_203463chr254335 1445 604 417 250 24053 1561 24266 1802 --
NM_206854chr6115397 5184 5168 4681 1746 1023 571 431 168 60 23 14921 ----
NM_206855chr6126362 6149 6133 5646 4120 1988 1536 1396 1133 1025 988 819 15886 ----
NM_206909chr8117764 7648 7590 7149 7105 6851 2161 1883 1411 624 470 87058 6383 6243 5487 5417 1577 1486 501 ----
NM_207303chr1082594 1223 1030 788 711 644 587 110 21232 855 --14056
NM_207361chr1384927 4194 2375 2049 1008 875 750 512 21184 246 31516 1075 60 --
NM_207406chr4116526 6321 6102 5866 5807 4456 4415 1542 1288 1003 803 25137 1684 14146 16468
NM_213589chr284313 1696 1258 1128 619 546 454 87 ------
NM_213651chr1----11213 1441