TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-182-5p
miRNA Sequence: UUUGGCAAUGGUAGAACUCACACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511261 --1975 --
NM_000038chr531908 1412 728 ----12035
NM_000051chr1162913 2851 2741 2513 774 73 13340 23116 2173 --
NM_000052chrX52465 1340 835 35 23 33465 3068 296 ----
NM_000081chr131629 1369 217 --1609 --
NM_000084chrX106505 6038 4880 4736 2722 2454 2433 1638 785 251 25648 5234 --15119
NM_000090chr23866 690 631 --173 --
NM_000091chr232307 2023 1811 32606 2395 2314 ----
NM_000092chr2114314 3255 2818 2788 1693 1417 1362 921 579 275 72 --23938 1263 43635 3429 3169 1638
NM_000110chr131180 267 172 1913 ----
NM_000112chr555566 3667 1929 1463 873 --24519 889 13591
NM_000115chr1352332 1688 1019 930 702 ----22031 77
NM_000125chr644010 3036 1483 245 14107 24141 575 --
NM_000127chr82285 103 ------
NM_000129chr621454 229 1571 11413 --
NM_000138chr1542604 860 835 227 --12475 --
NM_000151chr1761786 1530 702 461 347 43 ------
NM_000161chr1461670 683 231 198 121 44 3429 420 264 132 --
NM_000165chr61542 1477 ----
NM_000167chrX21248 272 11156 --1594
NM_000170chr91136 ------
NM_000176chr513558 23917 3214 12602 1754
NM_000192chr1231566 1102 1017 --11518 --
NM_000202chrX53435 3262 2954 2432 1184 --11019 33271 2832 1339
NM_000210chr231844 1577 695 12278 11853 --
NM_000216chrX53258 3163 2743 680 148 1254 13215 --
NM_000232chr4--13053 23178 1204 --
NM_000245chr752166 2086 1871 1431 695 --31661 704 555 198
NM_000248chr322867 2369 12644 --22703 2486
NM_000259chr1566270 4806 4399 4386 2023 1358 --32367 2267 698 1585
NM_000267chr1732847 2659 134 ----2801 144
NM_000276chrX21627 311 --21996 198 --
NM_000280chr111388 2981 668 ----
NM_000282chr13--1237 ----
NM_000288chr61343 ------
NM_000291chrX4916 336 128 95 ------
NM_000297chr42760 273 1334 1125 --
NM_000313chr32971 203 --1145 1845
NM_000314chr1053018 2893 2706 2472 474 2944 235 ----
NM_000315chr11397 65 21 ------
NM_000321chr1321754 1617 11645 ----
NM_000328chrX1168 ------
NM_000330chrX42219 2177 1829 27 ------
NM_000332chr667212 5293 4565 2795 461 130 ----14338
NM_000333chr31267 ------
NM_000337chr566199 4123 2533 2388 2268 68 36411 6213 1040 15949 12098
NM_000346chr17--1353 ----
NM_000349chr831331 1301 347 11250 ----
NM_000351chrX32889 2720 388 ------
NM_000353chr1621124 118 --11242 --
NM_000354chrX2250 188 ------
NM_000361chr202473 65 --1727 --
NM_000362chr2211088 1250 --23517 2499
NM_000368chr934833 4717 1732 --14534 14677
NM_000378chr113433 419 260 ------
NM_000408chr263245 3073 2902 2159 1279 192 13390 2789 160 1983
NM_000426chr61140 136 ----
NM_000428chr1462480 2261 2138 1981 547 268 1923 ----
NM_000430chr1763048 2860 2647 2300 1463 557 11205 --1573
NM_000439chr542441 2206 453 86 22248 670 ----
NM_000450chr121140 742 1112 --11424
NM_000451chrX11954 12052 1431 --
NM_000454chr212280 266 ----1235
NM_000462chr1521396 425 11626 ----
NM_000489chrX5846 840 335 184 117 12248 ----
NM_000492chr72325 289 --21533 517 --
NM_000494chr10195 ------
NM_000503chr851530 1451 1360 1354 1271 ------
NM_000522chr71210 1252 --1924
NM_000525chr1121518 144 --21466 1041 --
NM_000555chrX67724 6876 5490 2681 1491 560 36565 6499 1114 27061 6206 --
NM_000596chr72489 226 ------
NM_000601chr71174 ------
NM_000615chr1132219 1926 707 22261 617 12251 --
NM_000618chr1254920 4628 4602 1497 1210 26062 4171 --1521
NM_000618chr1254920 4628 4602 1497 1210 26062 4171 --1521
NM_000633chr1855215 1495 1118 739 70 1211 23915 316 --
NM_000663chr1633021 761 386 11095 --151
NM_000681chr102441 187 21224 1123 11348 --
NM_000684chr101831 --1486 --
NM_000719chr1256538 6421 6028 2551 1640 14600 25624 863 --
NM_000726chr251125 1032 131 107 42 1968 --1577
NM_000782chr2021265 202 --127 --
NM_000794chr52387 68 ------
NM_000806chr521360 600 1383 11370 11739
NM_000807chr43477 85 59 --1164 --
NM_000809chr468186 7500 6389 6323 6034 1508 31748 1218 822 28161 2179 126
NM_000811chr51307 --1271 --
NM_000813chr574802 4244 4027 3703 1741 334 169 --12182 21688 698
NM_000814chr1543970 1065 491 65 23457 1632 ----
NM_000824chr4168 ----1592
NM_000826chr442251 2061 710 46 12465 --1226
NM_000827chr521990 1929 21745 73 1217 --
NM_000829chr111414 ----194
NM_000831chr1105372 5219 4939 4798 966 893 461 366 226 150 --16181 --
NM_000833chr1641526 1349 316 93 11094 ----
NM_000838chr63955 656 414 --22147 389 12761
NM_000844chr351017 748 409 218 53 ------
NM_000845chr7--1441 ----
NM_000868chrX1584 11738 --12534
NM_000875chr1576133 5447 5212 4906 2303 1437 367 15828 14659 46654 5714 5073 593
NM_000891chr1753191 2649 2541 566 393 21333 526 12780 --
NM_000899chr1274110 1468 1223 1197 1018 775 135 23869 3566 21314 576 --
NM_000901chr412156 ------
NM_000902chr353107 2491 1086 944 544 --23074 41 --
NM_000910chr431928 1774 578 --1538 --
NM_000919chr5--1458 ----
NM_000921chr121552 ----146
NM_000926chr11128634 8267 8053 7855 6249 5890 3184 2960 2883 1729 871 407 28552 6520 29132 7936 26984 2928
NM_000933chr2021172 269 1603 11799 --
NM_000944chr43767 513 504 21884 606 ----
NM_000945chr241763 722 715 427 ----11649
NM_000949chr52838 286 ----1352
NM_000950chrX43035 2411 1160 189 13649 11253 --
NM_000963chr122135 1723 1779 ----
NM_000990chr1163737 2722 1028 954 823 32 1842 1470 --
NM_001001132chr211395 ------
NM_001001323chr1222940 2295 2463 127 21120 928 --
NM_001001330chr1011095 140 21077 874 --
NM_001001331chr352485 2460 1662 1018 728 ----12575
NM_001001342chr1031233 411 243 21442 1086 11354 --
NM_001001394chr22536 494 ------
NM_001001395chr1242268 2142 589 242 12206 12551 --
NM_001001396chr1114232 4029 3866 1539 1360 1119 1086 549 373 198 94 11279 21644 1061 --
NM_001001419chr534435 3709 3232 23186 1804 25224 3428 --
NM_001001420chr534435 3709 3232 23186 1804 25224 3428 --
NM_001001433chr2022952 1077 --11111 --
NM_001001436chr161213 --1252 --
NM_001001481chr82624 353 1242 --12751
NM_001001483chr11----1360 --
NM_001001484chr1042269 2009 1994 642 ------
NM_001001556chr151114 ------
NM_001001557chr831770 1756 190 11727 ----
NM_001001664chr243849 3237 2654 274 --12844 --
NM_001001890chr2144035 2971 1161 1079 --13021 13619
NM_001001924chr821822 1500 1485 ----
NM_001001925chr821822 1500 1485 ----
NM_001001931chr821822 1500 1485 ----
NM_001001933chr1144 --1478 --
NM_001001936chr102286 33 ------
NM_001001937chr18141 ------
NM_001001971chr1031403 564 239 --174 --
NM_001001974chr1032130 1571 871 12366 --1447
NM_001001995chrX31796 1744 286 1613 ----
NM_001002243chr22787 606 ------
NM_001002257chr263366 3226 2304 1243 1173 163 12421 ----
NM_001002258chr211526 11778 1755 --
NM_001002265chr103730 304 64 1844 ----
NM_001002266chr103730 304 64 1844 ----
NM_001002269chr91446 ------
NM_001002294chr1160 ------
NM_001002759chr101101 ----1438
NM_001002762chr1072600 2466 2212 1975 1805 1179 1165 12709 --1880
NM_001002838chrX21757 1472 11526 11824 --
NM_001002860chr1484042 3969 3473 3427 1846 355 164 91 24400 3888 ----
NM_001002909chr172393 297 ------
NM_001002914chr1721083 505 ------
NM_001003652chr1867690 7653 6346 6187 5769 1436 1691 --28393 7570
NM_001003674chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_001003675chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_001003682chr161265 1110 1005 580 177 48 11413 ----
NM_001003688chr4------11015
NM_001003694chr31659 ------
NM_001003712chr1264048 2990 2862 2810 2707 218 33899 3775 3116 11274 --
NM_001003792chr33999 381 214 ------
NM_001003793chr33999 381 214 ------
NM_001003794chr333009 2568 690 1261 12955 185
NM_001003810chr43552 220 92 ------
NM_001003940chr1533630 1393 853 --11097 1216
NM_001003942chr1533630 1393 853 --11097 1216
NM_001003943chr1533634 1397 857 --11101 1220
NM_001003954chr8----146 --
NM_001004051chrX------1126
NM_001004127chr13------2282 92
NM_001004304chr1263119 2927 2831 2501 724 712 147 ----
NM_001004317chr674483 3881 3313 3247 1336 530 219 --43508 3282 3113 1729 --
NM_001004342chr1126116 4110 4018 3941 3931 3882 3830 1878 1383 1284 1270 1115 13705 21541 1505 --
NM_001004346chr43403 391 171 21113 950 ----
NM_001004360chr231255 182 92 ------
NM_001004419chr1264490 4462 3272 280 256 21 --11572 --
NM_001005353chr121282 1049 ------
NM_001005353chr121282 1049 ------
NM_001005386chr212227 --52278 2151 946 631 57 --
NM_001005463chr1042427 1673 773 329 12039 --1916
NM_001005473chr554379 2016 1806 1111 694 14180 45648 5233 4143 2639 --
NM_001005502chr1213177 --11626 --
NM_001005609chrX63510 2930 2744 1299 529 299 ----12834
NM_001005739chr22621 567 ------
NM_001005746chr251125 1032 131 107 42 1968 --1577
NM_001005747chr251125 1032 131 107 42 1968 --1577
NM_001006600chr541693 746 722 483 ------
NM_001006612chrX2436 104 ------
NM_001006613chrX2436 104 ------
NM_001006614chrX2436 104 ------
NM_001006636chr21128 ------
NM_001006641chr951763 1489 1142 296 86 ------
NM_001006642chr951763 1489 1142 296 86 ------
NM_001006643chr951763 1489 1142 296 86 ------
NM_001006938chrX3651 561 171 --2125 96 --
NM_001007024chr1764252 3196 1440 749 564 487 22912 401 ----
NM_001007025chr1764252 3196 1440 749 564 487 22912 401 ----
NM_001007088chrX150 ------
NM_001007098chr12101 95 --1900 --
NM_001007102chr63568 559 518 --11512 --
NM_001007237chr11115 ----42213 989 869 756
NM_001007243chr831331 1301 347 11250 ----
NM_001007278chr1314497 14284 35255 3212 1768 --
NM_001007527chr51108 ------
NM_001007559chr1842051 2023 1367 50 ------
NM_001007793chr101285 ------
NM_001007794chr11205 --1635 --
NM_001008239chr1831370 1158 77 12760 1325 --
NM_001008272chr3------1280
NM_001008273chr3------1280
NM_001008392chr343261 3067 1085 1052 13582 13548 --
NM_001008393chr462793 2523 2081 1065 853 342 --1407 --
NM_001008495chr822088 1656 --125 --
NM_001008541chr1021890 653 ------
NM_001008541chr1021890 653 ------
NM_001008564chr1322211 155 ----11840
NM_001008660chr1121433 214 ------
NM_001008707chr1431650 765 594 --21799 377 11391
NM_001008738chr522966 327 ------
NM_001008783chr61281 1712 --1918
NM_001008860chr152789 347 ------
NM_001008892chr152789 347 ------
NM_001008894chr152789 347 ------
NM_001008895chr1311294 21206 317 ----
NM_001009185chr51549 2483 219 1295 --
NM_001009552chr82558 480 ------
NM_001009571chr741132 501 477 164 ----1591
NM_001009814chr13179 ------
NM_001009880chr2254834 3879 1150 288 57 21743 794 14763 --
NM_001009881chr11458 1491 ----
NM_001009882chr11458 1491 ----
NM_001009894chr1221183 336 --21662 1288 --
NM_001009899chr372422 2007 1592 663 376 299 173 34451 1784 1290 ----
NM_001009909chr1163682 575 550 501 464 36 23413 1203 23509 225 1333
NM_001009996chr31114 ------
NM_001010861chr132147 655 138 11124 --12172
NM_001010862chrX22285 985 --1832 123
NM_001010891chr585462 5116 4896 4542 4441 2250 2069 2044 36920 5807 210 16809 16342
NM_001010895chr921710 1650 12054 ----
NM_001010932chr71174 ------
NM_001010942chr1241283 1253 264 65 ------
NM_001010971chr12972 929 --1778 1231
NM_001010984chr111664 --1480 1334
NM_001010989chr161441 ------
NM_001010990chr161441 ------
NM_001011551chrX151 ------
NM_001011553chr72373 46 1705 138 --
NM_001011658chrX22027 1654 --1291 11879
NM_001011666chr755598 4918 1744 1121 383 16016 25541 594 --
NM_001011724chr13------1292
NM_001011725chr13------1292
NM_001011885chr15--21675 256 --11515
NM_001012267chr9177 1193 ----
NM_001012393chr1185078 4997 4833 4787 4327 3314 3257 1334 --24018 800 --
NM_001012420chr1532786 2175 1830 --32812 1811 703 --
NM_001012423chr1542786 2234 2175 1830 --32812 1811 703 --
NM_001012478chr19----1607 --
NM_001012614chr41306 ------
NM_001012732chr42878 164 --158 --
NM_001012751chr1011489 ------
NM_001012755chrX104487 3852 3783 3529 1923 1824 1235 1069 933 694 --13598 --
NM_001012761chr562262 2198 811 429 418 65 ------
NM_001012977chrX11181 ----1909
NM_001013031chr104997 971 878 772 --23136 2629 --
NM_001013399chr61109 ------
NM_001013415chr41577 --2571 561 --
NM_001013438chr3------1224
NM_001013439chr3------170
NM_001013699chr121543 ------
NM_001013717chr541414 1119 527 417 --11226 --
NM_001013843chr15------1580
NM_001014797chr1087457 7052 6217 5728 2586 2082 2004 1021 35819 5539 2760 --2428 250
NM_001014812chr151378 1421 ----
NM_001014831chr191652 ------
NM_001014832chr191652 ------
NM_001014834chr191652 ------
NM_001014835chr191652 ------
NM_001015508chr83658 622 263 ------
NM_001015877chrX21057 263 2537 512 1779 1634
NM_001015882chr92952 253 2141 27 ----
NM_001015887chr32654 247 1358 11649 --
NM_001017368chr1722019 486 12358 --1475
NM_001017371chr21506 ------
NM_001017395chr333588 3114 2703 ------
NM_001017396chr232183 670 226 --1832 12174
NM_001017923chr1431674 643 327 11243 ----
NM_001017926chr821775 1645 1163 11588 --
NM_001017999chr172135 1774 1632 1509 749 696 242 ------
NM_001017999chr172135 1774 1632 1509 749 696 242 ------
NM_001018000chr172135 1774 1632 1509 749 696 242 ------
NM_001018000chr172135 1774 1632 1509 749 696 242 ------
NM_001018001chr172135 1774 1632 1509 749 696 242 ------
NM_001018005chr15--1176 ----
NM_001018009chr33795 748 67 189 ----
NM_001018025chrX1265 1883 ----
NM_001018037chr9--1123 1952 1513
NM_001018053chr141681 1635 475 250 11943 ----
NM_001018056chr9--1591 --1484
NM_001018064chr941796 1636 1568 491 ----11822
NM_001018067chr163422 2080 1706 1426 1196 832 1608 --23665 493
NM_001018068chr163422 2080 1706 1426 1196 832 1608 --23665 493
NM_001018069chr163422 2080 1706 1426 1196 832 1608 --23665 493
NM_001018074chr513558 23917 3214 12602 1754
NM_001018075chr513558 23917 3214 12602 1754
NM_001018076chr513558 23917 3214 12602 1754
NM_001018077chr513558 23917 3214 12602 1754
NM_001020658chr121479 1219 ----1597
NM_001020658chr121479 1219 ----1597
NM_001020825chr511033 11392 177 --
NM_001023567chr1532178 1851 706 --32204 1832 410 --
NM_001024094chr513558 23917 3214 12602 1754
NM_001024372chr852289 1556 1449 557 102 11932 ----
NM_001024455chrX51951 1920 1745 745 490 22683 630 1979 11932
NM_001024647chr1287639 6984 5791 4842 4836 1290 1282 689 1730 16205 1241
NM_001024649chr522239 1959 12835 1315 12168
NM_001024912chr1981486 1389 1368 1214 556 513 358 310 ------
NM_001024947chr5------1863
NM_001024948chr122287 1371 --12200 12138
NM_001024956chr1185881 4707 4343 4277 3752 1952 1386 1179 34724 3580 220 13840 24598 916
NM_001025068chr311621 ------
NM_001025069chr311621 ------
NM_001025076chr1056025 5861 5431 4989 1242 11090 14226 --
NM_001025077chr1077383 7219 6789 6347 2600 1354 178 12448 25584 103 --
NM_001025079chr363771 3712 1615 1463 617 128 11605 23905 433 --
NM_001025100chr1863246 2877 1462 1377 1221 710 12437 ----
NM_001025108chr241453 1061 925 459 1375 ----
NM_001025248chr151919 11291 11265 --
NM_001025249chr151919 11291 11265 --
NM_001025252chr863210 2805 2389 340 293 79 22252 34 167 --
NM_001025253chr863210 2805 2389 340 293 79 22252 34 167 --
NM_001025266chr354554 4092 3790 1205 389 --13068 --
NM_001025366chr621639 451 1285 11468 --
NM_001025366chr621639 451 1285 11468 --
NM_001025367chr621639 451 1285 11468 --
NM_001025367chr621639 451 1285 11468 --
NM_001025368chr621639 451 1285 11468 --
NM_001025368chr621639 451 1285 11468 --
NM_001025369chr621655 467 1301 11484 --
NM_001025369chr621655 467 1301 11484 --
NM_001025370chr621639 451 1285 11468 --
NM_001025370chr621639 451 1285 11468 --
NM_001025580chrX73755 3555 1205 1184 680 566 121 ------
NM_001025595chr411335 ------
NM_001025616chr451537 1285 539 527 197 --11872 1723
NM_001025780chr921109 1061 11605 --1304
NM_001029858chr632523 2446 722 --23101 2109 1377
NM_001029863chr642265 636 597 73 32995 2726 2396 12797 --
NM_001030006chr174797 274 224 141 ------
NM_001030055chr1464054 3602 3533 1771 695 413 14317 23022 1037 11844
NM_001031623chr621684 170 ----21518 609
NM_001031679chr1233037 2749 2586 11127 --1576
NM_001031690chr723041 284 --11903 12657
NM_001031695chr2255152 5002 3797 1939 1464 11663 13576 --
NM_001031700chr41310 11551 ----
NM_001031709chr10--1329 187 --
NM_001031712chr62411 395 ------
NM_001031716chr2----2436 397 1953
NM_001031723chr41320 1475 ----
NM_001031732chr453258 3166 2570 741 584 --13316 --
NM_001031746chr1021376 1081 11408 41354 932 504 478 --
NM_001031804chr1663433 1723 902 710 304 73 2839 748 21344 280 21445 1232
NM_001031812chr542267 2164 1669 344 ----1218
NM_001032280chr621322 311 11662 ----
NM_001032282chr81465 ------
NM_001032288chr2021592 220 ------
NM_001032289chrX2848 143 1956 --1630
NM_001032380chr1031644 1443 625 ----11864
NM_001032394chr652819 2625 2535 2320 323 ------
NM_001032395chr652686 2492 2402 2187 190 ------
NM_001032999chr2075249 4669 4251 4167 4059 1846 1045 13750 ----
NM_001033044chr121420 1401 ----1724
NM_001033056chr121420 1401 ----1724
NM_001033057chr3--136 1530 1244
NM_001033087chr2072523 2300 2041 1198 1156 1054 815 13152 ----
NM_001033112chr5190 1181 --1116
NM_001033117chr354420 4275 3562 1704 206 ------
NM_001033518chr732474 383 308 --21943 430 1250
NM_001033519chr732474 383 308 --21943 430 1250
NM_001033520chr732474 383 308 --21943 430 1250
NM_001033564chr62685 376 11303 121 --
NM_001033566chr171670 ------
NM_001033568chr171670 ------
NM_001033576chr1762659 2488 2219 1857 1021 226 11732 ----
NM_001033578chr82397 284 12325 ----
NM_001033756chr621573 385 1219 11402 --
NM_001033756chr621573 385 1219 11402 --
NM_001034833chr51325 ------
NM_001034850chr521183 248 ----11426
NM_001034954chr1043128 3045 2354 1007 --1847 --
NM_001034955chr1043128 3045 2354 1007 --1847 --
NM_001034956chr1043128 3045 2354 1007 --1847 --
NM_001034957chr1043128 3045 2354 1007 --1847 --
NM_001035chr131211 1082 436 --1105 --
NM_001035003chr431393 1189 346 ------
NM_001035004chr431393 1189 346 ------
NM_001037132chr7163 --31997 1463 425 1559
NM_001037133chr7163 --31997 1463 425 1559
NM_001037164chr731407 776 406 1528 ----
NM_001037172chr341344 1303 1216 36 1261 1291 --
NM_001037174chr211987 12244 ----
NM_001037317chr132147 655 138 11124 --12172
NM_001037332chr512492 22370 1923 22207 1002 --
NM_001037333chr512492 22370 1923 22207 1002 --
NM_001037494chr12----197 --
NM_001037495chr12----197 --
NM_001037582chr421738 1191 31335 1228 503 ----
NM_001037954chr11--31286 614 112 11131 12511
NM_001038702chr5112617 2434 2325 2100 2007 1838 1715 345 286 232 168 22082 488 21041 1003 --
NM_001039091chrX3890 247 133 ----1369
NM_001039350chr731665 1295 494 ------
NM_001039459chr72856 271 ----11053
NM_001039465chr14------176
NM_001039479chr142954 143 32166 879 583 ----
NM_001039538chr233710 3452 2708 33333 2367 1019 --11252
NM_001039569chr243053 2744 2400 819 1102 ----
NM_001039585chr142962 1107 858 391 13066 31355 456 136 2587 416
NM_001039590chrX93764 3599 2616 940 934 506 488 220 160 ------
NM_001039591chrX93764 3599 2616 940 934 506 488 220 160 ------
NM_001039618chr1135394 1617 240 21352 61 ----
NM_001039709chr2075249 4669 4251 4167 4059 1846 1045 13750 ----
NM_001039762chr1021546 1525 11479 1198 12200
NM_001039802chr11215 ------
NM_001039840chrX106040 5801 4275 4250 2217 2201 1454 1306 702 257 35980 3711 1419 24199 636 13941
NM_001039937chr1373809 3317 1520 730 326 281 263 13844 13164 21666 353
NM_001040001chr631987 417 194 ------
NM_001040020chr71339 11458 1154 --
NM_001040057chr721419 507 --11033 11153
NM_001040100chr31249 21189 1027 ----
NM_001040101chr441118 477 414 160 21464 1212 1130 --
NM_001040108chr1453129 2127 796 266 245 --11260 --
NM_001040142chr23870 350 70 199 ----
NM_001040143chr23870 350 70 199 ----
NM_001040152chr754768 4365 3711 3550 1406 31507 1473 1227 65106 4940 3474 3323 1371 815 13460
NM_001040153chr133779 713 310 ------
NM_001040159chr421143 462 ------
NM_001040167chr711173 ------
NM_001040181chr32312 29 ------
NM_001040182chr32312 29 ------
NM_001040183chr32312 29 ------
NM_001040199chr32312 29 ------
NM_001040200chr32312 29 ------
NM_001040202chr421897 1726 --1389 --
NM_001040272chr911823 ------
NM_001040284chr1685857 5376 4554 4327 2023 1951 1293 635 11718 --13987
NM_001040402chr462617 1262 839 825 138 48 22891 529 1232 1455
NM_001040429chr1322705 2628 22945 1402 12447 --
NM_001040440chr52478 160 ------
NM_001040441chr144341 3641 1441 744 --14331 --
NM_001040445chr264165 3954 1862 769 508 181 ------
NM_001040450chr1522416 923 ------
NM_001040453chr1522416 923 ------
NM_001040624chr842469 2257 1722 411 ----21907 86
NM_001040625chr842469 2257 1722 411 ----21907 86
NM_001040626chr842469 2257 1722 411 ----21907 86
NM_001040627chr842469 2257 1722 411 ----21907 86
NM_001040628chr842469 2257 1722 411 ----21907 86
NM_001040629chr842469 2257 1722 411 ----21907 86
NM_001040630chr842469 2257 1722 411 ----21907 86
NM_001040653chr372616 2310 2180 1740 973 866 328 12456 1898 --
NM_001040665chr794910 3529 3138 1859 1787 1673 1183 884 846 190 34783 4230 183 --
NM_001040666chr71612 --1485 --
NM_001040668chr19------1124
NM_001040712chr923338 886 12387 --21116 350
NM_001040876chr431661 393 63 --21759 384 --
NM_001041chr31160 --126 --
NM_001042355chr1674240 4176 3813 3367 1862 1470 91 --21684 1361 --
NM_001042357chr102203 93 11370 ----
NM_001042358chr102203 93 11370 ----
NM_001042360chr102203 93 11370 ----
NM_001042363chr102203 93 11370 ----
NM_001042383chr373489 3414 2943 2250 823 435 230 1545 1910 --
NM_001042388chr181246 ------
NM_001042389chr102203 93 11370 ----
NM_001042390chr102203 93 11370 ----
NM_001042392chr102203 93 11370 ----
NM_001042395chr102203 93 11370 ----
NM_001042406chr63372 222 76 --1460 11014
NM_001042412chr1674240 4176 3813 3367 1862 1470 91 --21684 1361 --
NM_001042413chr983679 3616 2750 994 597 543 294 50 23744 960 ----
NM_001042424chr431162 674 279 --13199 22907 871
NM_001042425chr621322 311 11662 ----
NM_001042453chrX11423 ----11301
NM_001042476chr1611975 ------
NM_001042492chr1732847 2659 134 ----2801 144
NM_001042493chr681963 1737 1658 1498 1363 1248 384 105 ------
NM_001042506chrX11191 ----1909
NM_001042510chr82695 642 ----12073
NM_001042511chr82695 642 ----12073
NM_001042517chr132980 782 1717 --1665
NM_001042552chr121074 301 --1946 --
NM_001042555chr1244635 4408 4308 4180 11460 32944 1356 376 33906 3391 979
NM_001042599chr237461 4880 1308 11225 15897 --
NM_001042601chr332927 1125 260 1733 ----
NM_001042603chr1255149 3619 1668 403 319 24515 809 45045 4855 4539 2148 --
NM_001042604chr374701 3981 3722 3653 594 492 216 ------
NM_001042669chr451537 1285 539 527 197 --11872 1723
NM_001042683chr61593 ------
NM_001043318chr1453724 3109 2562 1313 1121 13547 ----
NM_001043351chr132220 1761 820 ------
NM_001044305chr62658 201 ------
NM_001044385chr253838 2924 2521 1428 849 11192 --13409
NM_001044722chr542267 2164 1669 344 ----1218
NM_001044723chr542267 2164 1669 344 ----1218
NM_001046chr542904 1168 880 259 22620 394 11065 --
NM_001048183chr153450 3127 2882 1480 202 13382 ----
NM_001068chr31262 ------
NM_001071775chr1351682 1192 336 245 32 --11927 --
NM_001076chr41186 ------
NM_001076chr41186 ------
NM_001079874chr152146 1763 340 237 224 11467 1821 11604
NM_001083620chr442249 2059 709 46 12463 --1225
NM_001083621chr184026 3956 3704 1900 1340 649 642 365 11188 11607 --
NM_001096chr171624 ------
NM_001099678chr365486 4580 4525 4123 1288 652 46445 6200 5319 736 --1380
NM_001100108chr178267 8177 7088 6575 2718 2616 1292 11697 58343 8105 7575 3333 2607 --
NM_001106chr3149639 9618 8841 8420 8393 7822 6593 6333 3861 3308 2934 2869 1652 1095 39138 8626 1328 18727 --
NM_001113490chrX43334 1312 1306 1272 --1956 22512 1048
NM_001117chr1852333 2087 1930 1622 467 ------
NM_001121chr1011909 --21803 326 1590
NM_001122679chr511261 --1975 --
NM_001123chr102666 232 2593 531 1521 --
NM_001126chr12855 338 1886 --1210
NM_001148chr41412 11732 21782 678 11948
NM_001153chr2--1830 ----
NM_001167chrX75260 5105 1887 1209 1018 567 105 1635 ----
NM_001172chr141559 ------
NM_001173chr1464054 3602 3533 1771 695 413 14317 23022 1037 11844
NM_001174chrX31548 913 214 32066 1704 718 --11993
NM_001186chr2142786 2722 2061 453 32482 2039 915 ----
NM_001198chr622351 1824 --1592 12415
NM_001201chr453397 3310 355 162 95 23040 445 --22697 705
NM_001204chr257517 5647 2588 1853 1233 32379 2264 1537 11357 16827
NM_001206chr922915 2739 --22289 2177 --
NM_001215chr11380 ------
NM_001218chr1562267 2247 1789 1664 1065 122 11933 11885 1349
NM_001219chr731664 916 547 21412 496 1673 --
NM_001235chr111644 ------
NM_001241chr242463 2307 1887 678 --21781 1738 --
NM_001241chr242463 2307 1887 678 --21781 1738 --
NM_001256chr1732382 1184 188 21983 467 1512 --
NM_001259chr7114740 4431 2240 2112 1387 1150 986 838 642 318 97 ------
NM_001260chr131236 ------
NM_001270chr5--11053 ----
NM_001271chr1583035 2951 2756 1049 805 748 669 120 --22011 354 --
NM_001278chr1041138 795 352 45 ------
NM_001280chr19------1139
NM_001282chr174797 274 224 141 ------
NM_001304chr1733004 2726 1274 ----22988 128
NM_001310chr1231883 727 232 ------
NM_001315chr632216 805 373 ------
NM_001316chr202352 105 --1447 --
NM_001326chr111115 ------
NM_001328chr41306 ------
NM_001329chr10--11433 31553 1262 445 --
NM_001331chr114811 687 108 101 --22389 292 --
NM_001343chr51655 11605 --11286
NM_001351chr321162 1131 ------
NM_001356chrX12075 130 12507 --
NM_001379chr19177 ------
NM_001389chr21------1107
NM_001394chr82739 666 1636 1849 --
NM_001396chr2152331 2158 1917 602 255 --1336 11779
NM_001399chrX63510 2930 2744 1299 529 299 ----12834
NM_001407chr311070 ------
NM_001415chrX21393 612 1263 ----
NM_001416chr171102 ------
NM_001419chr1941804 752 539 507 24634 1848 34572 2976 1029 --
NM_001427chr71229 ------
NM_001430chr221910 34 ----21660 421
NM_001432chr442634 2614 1525 633 23197 1390 1172 --
NM_001438chr162705 2353 1348 1312 1167 616 21471 588 ----
NM_001449chrX1295 ------
NM_001452chr6--1491 --1695
NM_001453chr621583 1077 ----11733
NM_001483chr72934 436 11041 ----
NM_001490chr961445 1395 1332 869 135 74 1366 ----
NM_001497chr952608 2452 2226 1877 64 21048 402 11699 1326
NM_001498chr631200 884 448 ------
NM_001527chr664397 4353 3713 1455 1287 1076 34437 1121 253 13510 11051
NM_001530chr1431048 804 334 --2758 440 --
NM_001542chr11115 ----42213 989 869 756
NM_001543chr584858 4479 3663 3250 1857 855 769 663 33817 1591 970 14411 --
NM_001546chr611201 ------
NM_001565chr4194 ------
NM_001584chr11----1804 --
NM_001587chrX21627 311 --21996 198 --
NM_001604chr111388 2981 668 ----
NM_001616chr263410 2670 1183 721 474 54 13398 1175 1612
NM_001621chr71796 12738 ----
NM_001621chr71796 12738 ----
NM_001649chrX72292 1838 1554 651 450 427 300 11760 11814 --
NM_001650chr1853936 2685 1430 1344 292 ----22767 1308
NM_001655chr111226 --11361 11863
NM_001656chr531974 674 560 ----11673
NM_001660chr31166 --1138 --
NM_001663chr1432313 268 87 ------
NM_001664chr32736 131 ------
NM_001682chr1222654 2009 1177 2834 642 --
NM_001683chr352485 2460 1662 1018 728 ----12575
NM_001684chr1103949 3746 3583 1531 1256 1077 836 803 266 90 1996 21361 778 --
NM_001689chr211526 11778 1755 --
NM_001695chr8103797 3724 3259 3179 2851 2724 1644 606 498 49 ------
NM_001699chr191379 ------
NM_001701chr941433 1218 1137 1041 1502 ----
NM_001706chr3--1285 --1421
NM_001709chr1142335 507 494 251 --1258 --
NM_001714chr122437 408 ------
NM_001723chr63843 711 687 --1139 --
NM_001729chr42373 268 ------
NM_001730chr132539 395 11246 ----
NM_001730chr132539 395 11246 ----
NM_001731chr122677 241 ------
NM_001742chr731691 1386 368 11328 1325 11667
NM_001743chr2--1100 ----
NM_001746chr522239 1959 12835 1315 12168
NM_001754chr2144035 2971 1161 1079 --13021 13619
NM_001759chr1253960 3631 3245 1700 748 23619 3560 1654 --
NM_001769chr123301 134 105 ------
NM_001777chr363771 3712 1615 1463 617 128 11605 23905 433 --
NM_001788chr72373 46 1705 138 --
NM_001791chr11215 ------
NM_001792chr1811175 ------
NM_001798chr1231102 1004 312 11039 1763 --
NM_001812chr4--1281 ----
NM_001830chrX73875 3668 1550 1405 1030 547 240 ------
NM_001844chr12--1380 ----
NM_001845chr1331374 1336 1327 ----1845
NM_001854chr111454 ----11150
NM_001858chr655152 1992 1387 229 44 --12071 24721 437
NM_001863chr191113 ------
NM_001874chr1213177 --11626 --
NM_001875chr22872 162 ------
NM_001893chr17------1389
NM_001901chr6--1161 ----
NM_001903chr5----1773 180
NM_001918chr1118900 8402 8376 8218 6862 2335 2315 735 259 142 65 47828 6834 6594 1372 --29207 7399
NM_001920chr121290 1777 --159
NM_001921chr42878 164 --158 --
NM_001931chr1121172 169 21025 950 ----
NM_001936chr731665 1295 494 ------
NM_001938chr11110 ----11373
NM_001939chrX53809 3600 2962 2744 560 ----12829
NM_001942chr1811509 21925 416 11385 --
NM_001945chr551270 1264 1109 1009 124 2966 183 --1159
NM_001948chr151919 11291 11265 --
NM_001949chr632985 2080 457 22739 2602 12157 --
NM_001955chr611086 ------
NM_001962chr5125 ------
NM_001967chr33571 498 398 --1522 --
NM_001968chr41698 ------
NM_001969chr1423616 2844 1407 13968 11045
NM_001995chr451413 1340 1229 354 268 ------
NM_001999chr531009 555 360 --1370 --
NM_002006chr455074 4513 3701 1536 1371 14931 --31593 760 548
NM_002009chr1531872 748 446 ----1672
NM_002015chr1343378 3244 653 562 32146 607 271 --11266
NM_002024chrX2513 133 32156 1794 650 --11517
NM_002025chrX89282 8963 8157 7864 6320 2993 2896 2400 22666 460 11712 26570 512
NM_002026chr24946 862 839 43 ------
NM_002028chr1431289 430 260 1210 --1141
NM_002031chr61663 ------
NM_002035chr1833953 3761 1243 158 1562 13606
NM_002039chr42842 361 ------
NM_002044chr151114 ------
NM_002046chr121168 ------
NM_002048chr921095 467 ----1910
NM_002061chr12772 141 11818 ----
NM_002063chrX11013 ------
NM_002065chr121420 1401 ----1724
NM_002072chr92847 109 1836 --21021 1004
NM_002074chr11331 --1564 --
NM_002076chr1242634 852 750 734 22267 1160 ----
NM_002092chr444025 3988 3873 1562 23189 654 11919 --
NM_002126chr1762937 2755 2672 1344 486 223 ------
NM_002128chr1312246 ----11692
NM_002129chr41408 --162 --
NM_002138chr43552 220 92 ------
NM_002140chr91982 ------
NM_002145chr17------1107
NM_002154chr5----153 --
NM_002158chr243664 3494 3412 2960 11315 43704 3526 3089 2329 13425
NM_002166chr2--1574 ----
NM_002202chr52920 722 ----1424
NM_002203chr51533 42926 2646 1179 798 --12980
NM_002210chr253427 3222 3165 2564 115 --23516 152 --
NM_002211chr103221 180 86 1719 ----
NM_002214chr792225 1756 1578 1462 1454 1358 1197 725 109 --15016 21100 450
NM_002221chr162856 2380 2220 2000 1137 402 12944 --11898
NM_002222chr321069 148 2487 216 ----
NM_002223chr1242788 1411 673 124 1328 ----
NM_002226chr141219 ------
NM_002228chr111261 ------
NM_002233chr11----1340 --
NM_002239chr21821 ------
NM_002240chr21--1612 ----
NM_002247chr1042174 1492 810 155 ------
NM_002249chr1175 ----1512
NM_002252chr21305 ------
NM_002264chr384252 4033 4013 3741 3601 3233 3078 653 34828 4587 3344 23286 1408 --
NM_002267chr1331712 1626 696 ----1162
NM_002268chr331813 1659 448 ------
NM_002270chr575506 4336 4119 3501 1927 1361 173 24076 677 14879 --
NM_002285chr241453 1061 925 459 1375 ----
NM_002293chr122312 230 1532 ----
NM_002310chr556600 4504 4408 2081 60 11892 12578 --
NM_002333chr1941148 972 949 363 1486 --11256
NM_002349chr211133 1167 ----
NM_002351chrX2288 52 1499 1433 1299
NM_002356chr642235 1957 1152 67 12130 22505 353 1462
NM_002359chr1731322 1147 893 ----14211
NM_002374chr233710 3452 2708 33333 2367 1019 --11252
NM_002376chr141421 1379 1395 --
NM_002381chr23753 106 96 --184 --
NM_002397chr532086 1650 1608 --1885 1362
NM_002399chr1531265 449 55 --2986 181 11371
NM_002439chr53951 914 870 ------
NM_002440chr11137 ----189
NM_002444chrX42018 476 208 122 --11442 11552
NM_002449chr51100 2967 450 --11133
NM_002480chr1231217 587 377 1122 1953 --
NM_002482chr1--1748 ----
NM_002486chr9123 ----12544
NM_002487chr15--1277 ----
NM_002500chr231028 853 143 ------
NM_002514chr821193 1052 ------
NM_002515chr1432019 1283 236 11771 ----
NM_002527chr12----1274 --
NM_002543chr123231 171 70 183 ----
NM_002544chr17--1331 ----
NM_002545chr1185078 4997 4833 4787 4327 3314 3257 1334 --24018 800 --
NM_002576chr1161236 1161 1091 1006 497 31 1301 ----
NM_002577chr333776 3739 2827 13411 ----
NM_002578chrX1430 1461 ----
NM_002581chr955643 741 508 487 281 14630 --24133 22
NM_002586chr621322 161 1463 --11247
NM_002590chr131573 --1460 1357
NM_002595chr1241893 1824 1739 174 1324 ----
NM_002605chr1541167 1156 323 183 21081 785 ----
NM_002613chr1694382 3786 3563 1615 1570 695 267 92 34 --11198 --
NM_002628chr32991 245 ------
NM_002641chrX41673 1560 726 716 1702 ----
NM_002655chr885226 4982 4583 4446 3821 590 230 224 14165 24339 4270 --
NM_002656chr63288 243 169 ------
NM_002687chr142530 258 ------
NM_002709chr211123 13464 11086 11445
NM_002711chr71777 ------
NM_002713chr131126 1082 439 ----11151
NM_002715chr551237 1101 883 165 29 ------
NM_002716chr1153168 2732 1464 653 41 --1938 13007
NM_002718chr322581 2496 32422 572 485 --12722
NM_002730chr191523 1854 1431 --
NM_002731chr142841 2281 2265 136 --1405 1487
NM_002734chr1712245 21824 802 2607 550 --
NM_002740chr352753 2537 370 98 38 1211 ----
NM_002742chr14--125 1152 --
NM_002750chr10260 40 ------
NM_002761chr162134 114 ------
NM_002763chr11433 ------
NM_002765chrX3890 247 133 ----1369
NM_002822chr121228 ------
NM_002828chr18--1275 ----
NM_002829chr91482 ------
NM_002833chr1551249 463 278 183 76 ------
NM_002834chr1264034 2505 1386 1129 909 728 --13219 --
NM_002837chr1263986 1139 1011 761 496 87 ------
NM_002839chr923338 886 12387 --21116 350
NM_002841chr31142 1681 --174
NM_002843chr1123473 2822 1356 --12330
NM_002848chr1221092 807 11188 --11035
NM_002849chr1211087 --1832 --
NM_002855chr1173396 3361 3266 3070 2647 2630 2387 --12350 11230
NM_002858chr1--11059 1189 --
NM_002869chr1111792 12230 1877 --
NM_002881chr231351 314 203 21302 996 1918 --
NM_002886chr343851 1078 716 590 34733 3211 735 13880 --
NM_002890chr51170 ----3666 341 87
NM_002892chr1441198 1180 487 222 21208 502 1103 --
NM_002901chr113760 403 64 ------
NM_002906chr1111678 ----198
NM_002912chr62823 140 ------
NM_002922chr15644 582 450 444 58 ------
NM_002940chr431661 393 63 --21759 384 --
NM_002941chr351644 1323 456 361 328 ------
NM_002959chr173924 3480 3400 1477 1368 829 382 33598 3449 1544 11139 1992
NM_002968chr161809 ------
NM_002973chr121145 1364 ----
NM_002977chr273401 2867 2806 1189 844 669 309 185 11174 1917
NM_002998chr832163 2131 1862 22218 2198 ----
NM_003010chr1741988 1953 808 359 11714 --1756
NM_003014chr711413 1928 11163 --
NM_003020chr15------1179
NM_003022chrX1257 ----21230 871
NM_003032chr332695 2646 683 32719 1684 316 ----
NM_003043chr341475 1223 353 120 23142 640 1388 --
NM_003051chr1----1643 11624
NM_003072chr19--1430 ----
NM_003081chr20--1856 ----
NM_003093chr6----1209 --
NM_003101chr141603 493 447 28 ------
NM_003108chr236908 6000 4524 --35187 1956 830 --
NM_003110chr17----11102 --
NM_003111chr21506 ------
NM_003112chr713116 ----12989
NM_003114chr8------1602
NM_003128chr272761 2684 2573 2449 1971 884 851 ------
NM_003133chr121012 386 1801 ----
NM_003137chr622137 1561 32131 611 227 1399 --
NM_003139chr111739 --1327 --
NM_003150chr17----12062 --
NM_003161chr1753305 2467 2280 2209 814 ------
NM_003162chr211005 --1942 --
NM_003178chr342128 1942 1650 1430 12025 1244 1607
NM_003182chr72152 41 ------
NM_003182chr72152 41 ------
NM_003185chr2031311 868 306 1248 1934 --
NM_003189chr142523 865 352 297 ----1521
NM_003199chr1875201 4067 3941 3756 1687 1402 838 --24935 1859 --
NM_003200chr1952304 1589 865 380 114 ------
NM_003203chr23772 532 465 125 1438 2473 305
NM_003204chr1741774 1572 1520 1290 11276 ----
NM_003206chr61420 ------
NM_003211chr122692 391 1408 31199 76 53 --
NM_003217chr1221799 707 --1229 --
NM_003220chr621322 311 11662 ----
NM_003221chr653907 3667 2663 1205 388 23856 3249 1832 12753
NM_003234chr342366 2001 1734 790 3817 407 71 1536 --
NM_003246chr1521767 309 --11964 --
NM_003247chr631748 443 145 11562 21331 1235 11913
NM_003253chr2131603 447 163 21840 641 --11929
NM_003262chr343912 3435 1508 905 --13687 --
NM_003269chr62276 134 1955 1981 --
NM_003270chrX3450 401 237 --1910 --
NM_003272chr11200 1286 ----
NM_003281chr175283 5185 4218 3801 1857 1775 1728 11704 1539 --
NM_003286chr2021041 284 ------
NM_003295chr13159 ------
NM_003298chr365968 5951 1324 727 511 21 1851 24176 2009 1504
NM_003299chr121234 ------
NM_003319chr23915 742 192 1732 ----
NM_003326chr142747 2450 883 333 21021 456 ----
NM_003336chrX21061 59 --1135 --
NM_003337chr51438 ------
NM_003338chr1051605 1359 731 699 467 --11475 --
NM_003340chr441289 966 565 391 ------
NM_003341chr35680 524 446 208 168 ------
NM_003342chr1762733 2265 1328 932 188 154 21180 585 11130 --
NM_003348chr123579 314 45 ------
NM_003349chr2021592 220 ------
NM_003360chr4156 ------
NM_003373chr1021406 484 11684 ----
NM_003376chr621639 451 1285 11468 --
NM_003376chr621639 451 1285 11468 --
NM_003383chr9--1591 --1484
NM_003385chr21838 1631 2335 186 --
NM_003399chrX11026 ------
NM_003403chr141567 2728 315 1191 --
NM_003406chr841505 1462 641 58 ------
NM_003409chr1851442 1416 1340 1177 74 ------
NM_003410chrX52228 2084 2021 654 426 ------
NM_003411chrY4617 464 427 402 ------
NM_003412chr362324 2311 2027 1069 726 137 1763 ----
NM_003413chrX21747 649 1428 ----
NM_003430chr1941384 1262 660 560 --11368 --
NM_003439chr72895 565 23255 1063 23110 871 --
NM_003442chr111589 ------
NM_003453chr132600 166 ------
NM_003455chr112501 76 1673 21306 631 --
NM_003463chr653379 2937 1208 1022 237 32225 353 310 12858 --
NM_003468chr243584 3198 3118 1544 --23053 70 1985
NM_003473chr1021052 423 137 ----
NM_003478chr1163013 2992 2778 2604 2593 2401 --22286 154 11130
NM_003483chr1242143 972 836 89 --1694 --
NM_003489chr2133341 2268 1033 --12092 1529
NM_003507chr221701 742 --1480 --
NM_003508chr71104 ------
NM_003557chr121429 1239 ------
NM_003562chr171297 ------
NM_003566chr1242349 2220 1208 241 12677 ----
NM_003574chr1864686 4197 4151 3901 1517 425 24445 1725 34582 489 401 --
NM_003583chr1233103 2734 2493 22500 328 ----
NM_003589chr1311294 21206 317 ----
NM_003590chr253296 3242 3012 1206 767 23711 3198 --13999
NM_003591chr10140 ----1430
NM_003592chr71329 ------
NM_003613chr152702 671 --1627 1512
NM_003615chr333497 2925 728 22762 1584 12882 --
NM_003622chr1252080 2003 453 172 158 ------
NM_003624chr1921429 279 ------
NM_003629chr153376 3350 3135 2960 2386 --11143 1676
NM_003633chr552523 1998 869 401 284 ------
NM_003644chr17146576 6006 5546 5521 4513 4354 4003 2223 1690 1032 779 725 256 71 --1298 16285
NM_003651chr121202 1443 ----
NM_003654chr11--1719 --1751
NM_003659chr24293 268 233 31 ------
NM_003671chr943543 3256 2790 2381 21144 417 1789 --
NM_003672chr121970 433 ------
NM_003677chr1211430 ----1334
NM_003701chr131885 --1741 1852
NM_003702chr81268 1761 1703 --
NM_003714chr523075 2340 1537 13021 --
NM_003728chr41509 ------
NM_003743chr232100 1997 728 11680 --12259
NM_003746chr12----197 --
NM_003749chr1322270 2183 12008 --12113
NM_003758chr1551091 259 216 187 153 188 21076 396 --
NM_003758chr1551091 259 216 187 153 188 21076 396 --
NM_003759chr453119 1392 969 715 35 --1869 --
NM_003763chr2022952 1077 --11111 --
NM_003783chr121069 1025 1975 --146
NM_003787chr1841474 527 436 358 ------
NM_003792chr9--1144 ----
NM_003794chr34969 845 293 265 ----11096
NM_003796chr191220 ------
NM_003797chr11170 ------
NM_003798chr91192 ------
NM_003816chr82450 339 ----11431
NM_003822chr153120 2914 2581 970 665 1980 13136 12426
NM_003825chr1531477 1218 1087 ----1316
NM_003829chr92794 307 ------
NM_003831chr18252 44 21539 147 ----
NM_003872chr242697 2145 661 574 23007 2499 ----
NM_003885chr1762456 2094 1793 821 462 151 ------
NM_003887chr231916 1737 202 ----169
NM_003908chr202108 59 ----11216
NM_003909chr842724 2123 532 176 12954 2974 331 --
NM_003913chr664097 3599 3301 1492 795 244 24111 449 1220 12776
NM_003916chrX1102 --1120 11296
NM_003924chr411577 ------
NM_003930chr752530 2385 2379 341 227 1494 12038 1480
NM_003934chr91930 ----145
NM_003941chr711923 1332 --12082
NM_003943chr41126 ------
NM_003946chr161553 ------
NM_003968chr33622 95 56 ------
NM_003972chr1011309 ------
NM_003980chr6----11111 --
NM_003994chr1274110 1468 1223 1197 1018 775 135 23869 3566 21314 576 --
NM_004024chr131342 1325 1024 ------
NM_004028chr1853936 2685 1430 1344 292 ----22767 1308
NM_004046chr18141 ------
NM_004061chr53497 210 190 1619 ----
NM_004067chr71991 11485 ----
NM_004073chr11244 ------
NM_004080chr731505 530 430 ------
NM_004093chr1332324 2158 439 12532 1660 13026
NM_004094chr1482536 2440 2423 2101 1875 849 444 180 23032 2771 32651 2547 339 --
NM_004098chr1031279 1273 377 --11290 --
NM_004100chr622293 1870 ------
NM_004109chr1131799 202 153 ------
NM_004114chrX31011 211 97 1250 ----
NM_004117chr621920 883 --12146 11794
NM_004124chr1423363 842 12385 --32827 2666 413
NM_004130chr32257 98 2599 437 ----
NM_004136chr1572617 2567 2543 1163 978 728 527 ----2869 209
NM_004156chr82558 480 ------
NM_004161chr221023 451 ------
NM_004170chr951802 1670 1363 1354 491 21531 484 --1706
NM_004171chr1196909 6366 6253 3669 3100 2922 2812 2397 950 27997 3579 37567 6767 285 28604 189
NM_004172chr521671 1487 ------
NM_004183chr11------1646
NM_004185chr11186 ------
NM_004229chrX21941 677 1299 1249 --
NM_004232chr1873231 2746 1520 1296 622 400 78 --21303 951 12415
NM_004236chr151472 ------
NM_004242chr6187 ------
NM_004255chr15142 ------
NM_004263chr241825 1701 1456 1149 11306 ----
NM_004267chr31149 ------
NM_004274chr1422555 117 ----12917
NM_004285chr165898 5796 4564 1874 825 626 16425 15963 15181
NM_004290chr51510 ----11344
NM_004296chr1463668 3079 3046 1395 1309 537 11199 11214 --
NM_004306chr8----146 --
NM_004319chr172299 2231 1065 751 570 264 204 22851 29 --22169 1049
NM_004326chr13915 300 23 11092 --134
NM_004329chr101135 11306 ----
NM_004330chr15------1245
NM_004331chr82299 54 ------
NM_004337chr831985 217 37 1362 ----
NM_004338chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_004346chr421055 41 --11426 1390
NM_004349chr81398 --1373 --
NM_004354chr4------1678
NM_004364chr191351 11019 --11074
NM_004370chr611729 ------
NM_004374chr8150 ------
NM_004379chr231304 1216 476 ----1462
NM_004380chr1622491 701 ------
NM_004384chr542267 2164 1669 344 ----1218
NM_004388chr1182 ------
NM_004392chr1331949 1788 901 ------
NM_004397chr1143808 3543 3230 1664 13603 1351 --
NM_004414chr2141321 1300 1129 324 ------
NM_004415chr64667 628 231 23 ------
NM_004427chr12950 451 ------
NM_004429chrX51376 1301 1185 401 331 --21173 86 --
NM_004430chr842716 2626 2612 1111 --12027 12298
NM_004432chr91160 11982 --22080 617
NM_004434chr1431650 765 594 --21799 377 11391
NM_004440chr6----2677 644 1342
NM_004441chr31150 --11296 --
NM_004447chr122987 863 ------
NM_004449chr2111136 2292 201 --1945
NM_004457chr231671 239 27 ------
NM_004459chr1741992 1579 782 441 --2716 213 --
NM_004472chr51155 ------
NM_004491chr1974291 3887 3297 3065 1122 368 175 11497 ----
NM_004500chr1421820 1492 1521 ----
NM_004504chr252930 828 800 590 443 ------
NM_004520chr52540 264 ------
NM_004525chr231349 1147 501 --21156 297 --
NM_004535chr2011164 --11119 --
NM_004537chr1221012 625 ----11382
NM_004561chr1141795 740 671 250 11454 ----
NM_004569chr142610 473 1260 2676 297 --
NM_004571chr2162441 684 548 433 342 140 1913 ----
NM_004583chr17----1778 --
NM_004586chrX44905 4466 3592 1933 15171 21387 931 --
NM_004607chr5--1155 ----
NM_004612chr984351 3923 3845 3789 3595 3463 1883 1512 13035 ----
NM_004615chrX2922 764 ------
NM_004622chr222300 1645 --3529 450 45 21765 99
NM_004634chr31659 ------
NM_004640chr61160 ------
NM_004654chrY2442 162 ------
NM_004655chr1721286 1056 ------
NM_004660chrY12000 --11979 --
NM_004663chr1531521 1293 381 ------
NM_004681chrY1512 ------
NM_004685chr1332653 2586 1198 --12266 --
NM_004686chr81314 1657 --11644
NM_004690chr61581 ------
NM_004703chr1722584 1904 22361 912 ----
NM_004709chrX1622 11784 21382 126 --
NM_004713chr144773 519 227 123 ------
NM_004718chr21172 ------
NM_004725chr1011506 --1415 11017
NM_004726chrX95539 4920 4825 2025 1293 714 214 82 43 3635 556 103 25587 3994 1807
NM_004730chr531817 1644 189 11972 ----
NM_004731chr1211914 11665 ----
NM_004734chr1322328 317 ------
NM_004736chr132188 1396 429 --2821 236 --
NM_004744chr453565 2821 1343 1187 545 33963 3786 3597 13874 --
NM_004745chr855937 5525 4995 4783 581 46434 5057 4695 1255 --11134
NM_004748chr1542831 1672 1380 920 11051 12877 --
NM_004753chr1----1269 --
NM_004755chr143827 326 231 ------
NM_004760chr742173 949 793 420 21535 337 1177 1136
NM_004762chr1751708 1336 143 101 82 11630 --11899
NM_004774chr1721966 723 21047 230 --12645
NM_004779chr521266 351 --1378 --
NM_004781chr141261 323 297 283 ----2682 600
NM_004781chr141261 323 297 283 ----2682 600
NM_004788chr1122446 2440 12549 12500 12713
NM_004792chr2--1192 160 --
NM_004796chr1421529 687 11546 ----
NM_004798chr201809 1747 13157 --
NM_004808chr1053229 2556 2277 1251 362 --23214 1362 1606
NM_004814chr12449 113 167 ----
NM_004815chr184456 3965 3772 3626 3609 1579 1522 464 24493 109 31591 946 621 13827
NM_004834chr253364 2905 2774 2375 1083 --23251 2758 13267
NM_004839chr151459 ------
NM_004841chr12302 95 ------
NM_004844chr33795 748 67 189 ----
NM_004845chrX33559 1463 134 1433 41333 1140 654 259 --
NM_004846chr2--1190 ----
NM_004857chr1424017 1881 1143 --33798 1366 254
NM_004859chr1722373 480 ----12834
NM_004863chr1465100 4979 3971 3897 3805 1886 ----1197
NM_004866chr554782 3937 1527 856 534 1223 ----
NM_004867chrX------1170
NM_004871chr1764252 3196 1440 749 564 487 22912 401 ----
NM_004874chr81402 ------
NM_004884chr1511736 ----21777 142
NM_004897chr101884 1864 ----
NM_004898chr432198 1929 1904 --12648 1278
NM_004904chr755598 4918 1744 1121 383 16016 25541 594 --
NM_004905chr14890 653 117 48 ------
NM_004906chr62447 81 ----1239
NM_004926chr1441137 392 285 202 1327 --21193 631
NM_004929chr831104 355 25 ----11443
NM_004930chr11611 ------
NM_004939chr21130 ------
NM_004947chr341642 642 341 167 --148 --
NM_004948chr1841429 1102 318 288 11191 ----
NM_004949chr1822018 676 --1837 11705
NM_004956chr733724 3247 1101 ----33860 3840 1311
NM_004961chrX21529 1464 --164 --
NM_004969chr101586 ----1127
NM_004985chr12114497 4214 3578 3089 2776 2757 1731 1271 1079 504 186 --11678 13777
NM_004992chrX158093 7399 6909 6820 6791 6581 5980 5727 5299 3030 2718 2191 1679 1646 1387 --38127 7149 2297 --
NM_004992chrX158093 7399 6909 6820 6791 6581 5980 5727 5299 3030 2718 2191 1679 1646 1387 --38127 7149 2297 --
NM_004993chr14--188 11523 11080
NM_004999chr634424 663 38 --23704 1438 1281
NM_005006chr2128 1369 1393 11038
NM_005010chr7163 --31997 1463 425 1559
NM_005016chr121266 ------
NM_005025chr3----1156 --
NM_005028chr1022174 710 ------
NM_005032chrX31020 909 211 --11009 --
NM_005056chr1255393 3863 1912 647 563 24759 1053 35289 5099 4783 --
NM_005063chr1073712 3255 1191 721 485 252 182 196 11299 --
NM_005065chr1443320 1338 615 359 11470 24252 1002 --
NM_005066chr11569 ------
NM_005076chr143637 3103 767 75 197 --13760
NM_005079chr863210 2805 2389 340 293 79 22252 34 167 --
NM_005087chr3------170
NM_005088chrX------1743
NM_005093chr2075249 4669 4251 4167 4059 1846 1045 13750 ----
NM_005095chr141756 1676 582 550 11418 ----
NM_005109chr342327 1682 646 392 187 --1777
NM_005116chr2074201 3204 3150 1743 1348 1300 410 --14014 21835 1398
NM_005119chr111219 ------
NM_005121chr1763179 2959 2671 2608 1445 986 13739 ----
NM_005126chr311712 4909 491 287 53 ----
NM_005134chr181246 ------
NM_005156chr933631 1614 512 13832 24440 797 11663
NM_005164chr121467 12127 1698 11894
NM_005168chr2--1235 --11190
NM_005171chr1231027 517 424 --1283 --
NM_005180chr102551 83 ----11121
NM_005187chr162774 41 1102 --12100
NM_005188chr1196446 5465 5113 2708 2425 2411 969 774 671 --48221 5851 5225 2513 15815
NM_005190chr61109 ------
NM_005191chr311451 ------
NM_005197chr14105935 4702 4498 2379 1977 1918 582 562 348 316 24742 3984 1737 16116
NM_005206chr17--21301 220 ----
NM_005207chr2232653 2561 1046 22619 1383 33283 1181 1028 2197 105
NM_005215chr182716 288 1253 --1196
NM_005231chr111957 --1205 2981 285
NM_005233chr31736 22443 718 ----
NM_005235chr237461 4880 1308 11225 15897 --
NM_005238chr113674 593 367 ----12565
NM_005242chr541311 1270 1251 136 21420 459 ----
NM_005252chr14----1782 --
NM_005256chr111832 ------
NM_005261chr83790 406 214 ------
NM_005276chr123509 446 177 11481 --1212
NM_005276chr123509 446 177 11481 --1212
NM_005277chr421880 712 ----1288
NM_005284chr61392 1380 --1320
NM_005295chr7--178 1228 --
NM_005296chrX1747 2694 670 --1210
NM_005302chr7----1289 --
NM_005316chr111762 --1813 --
NM_005318chr222303 238 --11042 --
NM_005328chr81527 2574 158 ----
NM_005329chr1611767 2706 310 21855 676 12368
NM_005339chr433783 801 631 --1577 --
NM_005342chrX72787 2627 2438 2147 1785 712 159 --12221 --
NM_005359chr1856133 5839 4927 1171 198 26389 964 31964 800 627 --
NM_005370chr1921182 215 ------
NM_005398chr103985 89 34 ------
NM_005399chr144360 3591 3155 829 --11715 --
NM_005400chr242998 2633 822 439 33038 2308 620 127 --
NM_005415chr2128 1163 1623 --
NM_005433chr1812698 137 12458 --
NM_005436chr1043896 3566 2708 153 ----12732
NM_005442chr32611 470 1152 --188
NM_005445chr10--1257 ----
NM_005455chr12629 403 1197 ----
NM_005460chr51498 --1410 --
NM_005475chr1273290 3273 2299 2247 2067 789 131 ------
NM_005493chr62696 557 ------
NM_005494chr72606 154 ------
NM_005497chr1752383 1511 1281 1226 1130 16051 36154 6067 1017 --
NM_005499chr191145 ------
NM_005502chr933220 921 505 1491 ----
NM_005504chr1275377 4782 2539 2362 2155 1379 1104 21301 159 --15416
NM_005509chr541630 1183 696 495 ------
NM_005520chr5------1758
NM_005539chr1051334 927 490 391 21 --1333 1265
NM_005542chr72632 316 --11787 --
NM_005559chr18----136 --
NM_005578chr383923 3379 2037 1867 1401 1331 906 378 14422 11324 13749
NM_005581chr191489 ------
NM_005596chr956300 6002 5068 4740 1720 124 ----
NM_005598chr131414 1266 251 --11277 --
NM_005610chr11740 ------
NM_005626chr11406 ------
NM_005629chrX21064 1009 11331 ----
NM_005637chr1842051 2023 1367 50 ------
NM_005639chr12--1292 11679 --
NM_005647chrX--22376 352 --23207 3109
NM_005648chr82229 176 ------
NM_005649chr5--1511 ----
NM_005655chr81465 ------
NM_005664chr151241 --1254 --
NM_005665chr164869 3874 3227 3149 1339 206 11787 13067 1180
NM_005667chr21131 ------
NM_005668chr574534 4480 4091 2826 1531 1213 402 ------
NM_005688chr34508 449 384 43 --11094 --
NM_005722chr212227 --52278 2151 946 631 57 --
NM_005725chr132407 1602 118 1869 --11533
NM_005730chr1262697 2678 1210 446 262 158 23033 174 11218 1409
NM_005731chr2154 ------
NM_005734chr111734 ------
NM_005738chr731407 776 406 1528 ----
NM_005746chr722616 1969 2723 203 1229 --
NM_005748chr1262694 2651 1058 825 735 64 --1552 --
NM_005749chr171593 --1159 --
NM_005759chr284776 3351 3343 3186 3083 1446 689 403 23195 253 44687 1496 1030 736 --
NM_005778chr3------1470
NM_005779chr533221 2668 706 43071 1421 916 500 1246 --
NM_005780chr131116 ------
NM_005786chr1821010 349 1384 1902 --
NM_005795chr242577 2136 1116 208 22921 2474 21852 752 --
NM_005798chr1314497 14284 35255 3212 1768 --
NM_005801chr173541 238 73 ------
NM_005802chr92841 555 ----1819
NM_005806chr2131102 1052 1028 11284 ----
NM_005808chr343261 3067 1085 1052 13582 13548 --
NM_005813chr252339 2144 838 682 82 32639 1795 803 ----
NM_005822chr622092 534 ----169
NM_005828chr1764576 4178 1865 1307 1186 291 11709 ----
NM_005832chr321162 353 --1295 --
NM_005833chr91167 ------
NM_005839chr12989 112 --1602 167
NM_005840chrX65520 5441 5115 739 243 223 42646 1804 1020 731 ----
NM_005843chr241551 1269 777 612 --1562 1386
NM_005851chr11------1401
NM_005859chr531319 1150 196 1254 ----
NM_005862chr32312 196 1911 ----
NM_005877chr2232337 357 21 ------
NM_005884chr191652 ------
NM_005885chr51311 11339 ----
NM_005898chr1152484 2018 1024 881 155 12960 ----
NM_005900chr4------11015
NM_005901chr1867690 7653 6346 6187 5769 1436 1691 --28393 7570
NM_005903chr534435 3709 3232 23186 1804 25224 3428 --
NM_005907chr621420 395 11694 11070 --
NM_005909chr532953 2748 575 1120 23499 180 --
NM_005910chr17103962 3482 3354 2962 1661 1572 637 489 390 148 ------
NM_005911chr22533 182 ------
NM_005924chr74797 455 360 302 ------
NM_005927chr521019 228 1858 --2146 88
NM_005933chr1172883 2770 2374 2357 2294 595 359 1572 22812 451 12864
NM_005935chr474947 4095 3778 3753 1789 1291 567 ------
NM_005941chr862821 2739 1600 1401 592 235 ----22854 1223
NM_005955chr144950 4724 550 272 15485 1785 --
NM_005962chr1021890 653 ------
NM_005962chr1021890 653 ------
NM_005966chr232156 1733 1511 ------
NM_005977chr133274 268 223 ------
NM_005999chr12459 298 --11353 11311
NM_006007chr933362 3173 1597 2582 292 14231 1719
NM_006011chr1574015 3729 1203 1187 1009 393 43 --24240 3694 --
NM_006036chr232235 691 344 12049 12112 22076 2019
NM_006038chr2022130 747 1580 1244 --
NM_006047chr2053381 2424 2417 1276 726 --33479 3459 371 23561 3006
NM_006079chr62858 725 1525 1852 --
NM_006080chr752674 2460 1825 327 319 --12882 13009
NM_006090chr11205 --1635 --
NM_006095chr463167 3083 1330 682 73 59 12949 22897 221 2533 265
NM_006106chr1132974 654 243 --12266 13323
NM_006108chr111939 22239 145 22343 956 --
NM_006113chr152146 1763 340 237 224 11467 1821 11604
NM_006134chr2121330 294 --11534 181
NM_006135chr121059 99 11276 ----
NM_006136chr72103 76 1445 ----
NM_006139chr232856 2014 126 1803 12415 --
NM_006141chr1642547 2022 1990 59 21899 1804 --12139
NM_006145chr1931105 1098 370 11166 ----
NM_006153chr32510 43 1422 ----
NM_006154chr1552329 2063 1973 1960 350 21967 1930 11818 --
NM_006156chr14----1245 --
NM_006158chr841586 1558 1425 223 ------
NM_006166chr1242529 2393 2383 910 ------
NM_006180chr941796 1636 1568 491 ----11822
NM_006186chr251140 1097 327 182 52 ------
NM_006190chr231037 909 437 ------
NM_006194chr143963 171 148 ------
NM_006196chr21315 ------
NM_006203chr574757 3694 3575 1359 1323 421 105 --25320 3660 11340
NM_006206chr442570 1877 547 187 32678 1897 687 12465 --
NM_006211chr8184 1224 ----
NM_006212chr155131 4384 2131 2114 73 1995 24032 972 --
NM_006216chr22601 44 ------
NM_006226chr221304 214 ------
NM_006243chr11856 ------
NM_006246chr142395 292 ------
NM_006251chr552834 2578 1272 1080 528 --11020 12773
NM_006252chr197046 6070 5945 5653 5634 5110 2111 1507 954 --26493 2156 11487
NM_006256chr142173 1799 874 338 ----1667
NM_006259chr41929 1777 ----
NM_006265chr811338 --1161 --
NM_006267chr21143 ------
NM_006275chr2032279 895 484 ----1659
NM_006277chr22550 256 ------
NM_006283chr874905 4726 4487 4401 3832 723 157 24086 1903 14699 11947
NM_006294chr81493 --1368 --
NM_006298chr642121 1373 1117 277 11347 ----
NM_006303chr71123 --1116 --
NM_006306chrX85003 2078 1816 1744 1012 964 591 132 --14919 --
NM_006309chr31106 ------
NM_006310chr1731345 283 83 1904 ----
NM_006315chr474465 4417 4332 1705 1585 1339 1207 --13968 23899 2880
NM_006320chr41370 1180 ----
NM_006323chr41643 ------
NM_006330chr831421 1120 127 --1550 11213
NM_006334chr9----1213 --
NM_006352chr112080 1734 1304 --
NM_006357chr21446 ------
NM_006366chr621241 351 1880 1888 --
NM_006371chr364382 4325 3922 3510 1502 406 14498 ----
NM_006372chr61407 ------
NM_006375chrX41514 1362 233 111 1272 ----
NM_006379chr732289 1804 376 ----11537
NM_006380chr1713994 13188 23431 698 24386 2926
NM_006390chr1261790 1529 467 324 171 114 ------
NM_006393chr1043997 3651 1351 235 13938 ----
NM_006409chr71258 ------
NM_006416chr61171 ------
NM_006420chr2022266 488 1267 ----
NM_006434chr1043128 3045 2354 1007 --1847 --
NM_006451chr531017 789 287 2905 159 ----
NM_006459chr102617 265 11488 ----
NM_006460chr171482 --1529 11526
NM_006467chr542182 1896 1704 359 ----11632
NM_006478chr221183 ------
NM_006482chr1233103 2734 2493 22500 328 ----
NM_006489chr1432019 1283 236 11771 ----
NM_006491chr141309 ------
NM_006504chr1042865 2448 1888 230 12505 ----
NM_006519chr6--1247 ----
NM_006520chrX31688 1070 46 ----11444
NM_006526chr201547 ------
NM_006537chr15----1128 --
NM_006544chr1475809 5714 5507 4656 1739 1633 377 1926 24804 4093 14364
NM_006546chr17116484 6007 5927 5057 4536 4426 4146 2432 2374 1942 502 24245 712 ----
NM_006547chr711732 2340 39 --11789
NM_006549chr1242483 2347 2067 1039 1297 12684 1787
NM_006557chr911560 ----11292
NM_006559chr1--11206 21227 993 --
NM_006561chr1056025 5861 5431 4989 1242 11090 14226 --
NM_006572chr1721058 334 12824 11038 12740
NM_006577chr22901 506 11190 1873 --
NM_006580chr33496 198 121 ------
NM_006591chr1111653 ------
NM_006595chr1141673 1367 127 85 ------
NM_006599chr16105187 3253 2943 2930 2074 1997 1458 1371 1185 342 26698 5532 37878 6068 1840 --
NM_006602chr20--1541 ----
NM_006609chr232067 1867 1189 22235 1993 12149 11128
NM_006614chr373053 2791 2762 2575 2239 344 178 11316 13313 --
NM_006621chr121885 323 --11645 11586
NM_006624chr1021632 1398 11511 ----
NM_006628chr1534213 1505 797 131 --14639
NM_006633chr5--1740 1165 --
NM_006640chr1741845 1629 135 105 --11622 11642
NM_006654chr1244635 4408 4308 4180 11460 32944 1356 376 33906 3391 979
NM_006667chrX1113 ------
NM_006675chr1263351 3042 2511 2313 896 174 13439 2874 784 22611 248
NM_006681chr4----1122 --
NM_006706chr5------1796
NM_006713chr5--1587 1182 --
NM_006714chr61279 ------
NM_006717chr932817 1291 125 22938 23 11102 --
NM_006718chr63288 243 169 ------
NM_006721chr102666 232 2593 531 1521 --
NM_006722chr322867 2369 12644 --22703 2486
NM_006726chr41137 ------
NM_006729chrX55275 4416 4143 1965 1137 11219 24252 3763 1669
NM_006731chr955494 4062 1781 1730 630 --11992 182
NM_006734chr621122 117 ------
NM_006735chr72366 331 ------
NM_006738chr1544569 1110 1000 888 24446 463 13067 14035
NM_006749chr831277 950 892 11236 ----
NM_006750chr1677424 7252 6401 5451 5358 1185 626 32867 1416 283 --21826 1279
NM_006751chr2187 ------
NM_006754chr72928 339 --31247 105 56 --
NM_006756chr811409 ------
NM_006764chr3193 ------
NM_006766chr82977 399 ------
NM_006775chr612100 1591 22896 1075 --
NM_006777chrX42781 2008 1169 634 12478 12750 12229
NM_006790chr5--1436 ----
NM_006807chr1711344 ------
NM_006813chr62585 308 1374 ----
NM_006814chr2061897 851 795 538 393 374 ------
NM_006820chr163949 3793 3024 2935 2828 469 14227 13452 --
NM_006823chr821401 1368 ------
NM_006826chr21518 --1927 --
NM_006827chr1443284 2931 2310 844 23050 285 --1121
NM_006832chr142896 206 ------
NM_006838chr1261429 739 706 321 207 76 ------
NM_006839chr2--140 ----
NM_006846chr52317 109 ------
NM_006852chr1742786 2236 779 516 1971 --11051
NM_006861chr1262071 559 507 464 354 173 22044 1532 ----
NM_006868chr1852632 2616 2008 1113 528 ----22356 267
NM_006874chr41468 ------
NM_006885chr1644173 4156 2628 437 12741 --1469
NM_006887chr22692 564 ----1528
NM_006888chr1422665 432 1136 22789 278 --
NM_006894chr1160 ------
NM_006902chr153080 3051 2165 145 50 --195 --
NM_006908chr73490 349 121 --11469 21213 315
NM_006915chrX--2750 106 ----
NM_006918chr1185881 4707 4343 4277 3752 1952 1386 1179 34724 3580 220 13840 24598 916
NM_006920chr232036 380 162 22027 98 11624 11563
NM_006922chr241944 895 859 67 196 --21952 511
NM_006924chr1752975 1103 893 750 507 1856 --1443
NM_006925chr14------176
NM_006939chr1421043 787 1232 ----
NM_006940chr1271766 1712 1587 1279 641 375 251 1722 11701 --
NM_006952chr31417 11075 1121 --
NM_006954chr1023277 2248 --1224 13223
NM_006962chrX150 ------
NM_006974chr1023277 2248 --1224 13223
NM_006981chr922035 51 22608 1846 1279 --
NM_006991chr3----11027 --
NM_006997chr101183 ------
NM_007006chr1643552 2927 1203 125 21326 1241 --22976 1140
NM_007007chr1232971 1617 1302 13309 ----
NM_007011chr1562723 2355 2256 1658 1497 341 ------
NM_007017chr5----1681 1745
NM_007023chr23947 687 86 1968 2705 320 --
NM_007026chr171187 ------
NM_007030chr585203 4259 3541 1120 1076 944 843 639 --1822 --
NM_007036chr5--11014 ----
NM_007038chr2145490 4914 1951 307 44938 3937 1586 1183 34220 4071 115 --
NM_007039chr1421702 1497 11605 --1557
NM_007043chr1222122 712 ------
NM_007050chr2097892 7256 6847 5480 5363 5088 1625 1325 182 26929 944 11307 14990
NM_007067chr1731365 1144 368 11044 ----
NM_007069chr11159 ------
NM_007073chr634237 3964 3329 42931 2608 1343 1328 ----
NM_007107chr332001 1961 906 ------
NM_007124chr631487 280 63 ------
NM_007125chrY1133 1244 11430 --
NM_007129chr132915 295 ------
NM_007137chrX64531 3768 1188 1019 1013 248 --13498 15319
NM_007146chr1732849 2260 490 1273 1761 --
NM_007166chr1121433 214 ------
NM_007172chr2243262 2910 2066 171 12766 2741 32 --
NM_007173chr11175 ------
NM_007175chr823455 2485 11174 23535 463 --
NM_007187chr131238 196 ----
NM_007192chr144995 296 188 108 ------
NM_007200chr1544569 1110 1000 888 24446 463 13067 14035
NM_007202chr171691 ------
NM_007212chr11594 ------
NM_007214chr621321 913 11045 ----
NM_007218chr81689 2633 317 ----
NM_007222chr821775 1645 1163 11588 --
NM_007236chr1562045 2005 1916 391 318 146 ----12161
NM_007249chr13117890 6872 6443 3666 3561 3519 3272 2254 2051 1699 602 26288 5955 ----
NM_007269chr12536 163 ------
NM_007271chr651603 1544 1451 619 401 --1747 --
NM_007279chr19----1607 --
NM_007282chr33961 788 167 1802 ----
NM_007283chr333009 2568 690 1261 12955 185
NM_007287chr353107 2491 1086 944 544 --23074 41 --
NM_007288chr353107 2491 1086 944 544 --23074 41 --
NM_007289chr353107 2491 1086 944 544 --23074 41 --
NM_007358chr151521 1370 758 175 158 ------
NM_007361chr14--1538 ----
NM_007373chr102245 132 1569 1266 --
NM_007375chr122279 809 --32571 1096 318 --
NM_012081chr562292 1378 1157 957 910 651 12424 --11429
NM_012090chr12834 386 ------
NM_012095chr1053423 2647 1133 1124 872 ------
NM_012096chr353684 2654 1296 1215 627 --12596 --
NM_012097chr211987 12244 ----
NM_012104chr1153689 2992 2806 2681 472 11060 ----
NM_012104chr1153689 2992 2806 2681 472 11060 ----
NM_012111chr14--1203 ----
NM_012120chr61928 --22911 180 12282
NM_012124chr11--1594 1612 --
NM_012129chr712198 ------
NM_012137chr142570 1986 636 25 12844 1324 2803 207
NM_012141chr1373809 3317 1520 730 326 281 263 13844 13164 21666 353
NM_012153chr1132354 1588 673 --32516 2098 330 --
NM_012158chr1311790 1698 ----
NM_012164chr986788 5836 5775 1372 666 533 338 206 --27322 147 27058 1534
NM_012177chr61439 1579 ----
NM_012193chr1175423 4555 4292 1356 1031 603 48 ----15315
NM_012199chr121467 236 1323 --11289
NM_012210chr9--11558 --11491
NM_012214chr275959 5087 2455 2056 998 695 128 35678 5371 4434 26164 2176 11902
NM_012218chr1941189 1177 1134 222 11877 ----
NM_012224chr421213 980 --1476 --
NM_012234chr362437 2423 855 344 141 123 23541 3386 ----
NM_012238chr1021774 643 21442 61 ----
NM_012249chr222728 801 33476 767 625 12880 --
NM_012250chr1131321 1301 858 --1319 --
NM_012257chr71801 1292 ----
NM_012262chr1105260 4594 4570 4415 4369 3893 3830 2110 1039 171 --1515 --
NM_012279chr541413 650 612 561 1422 ----
NM_012281chr7--11582 ----
NM_012286chrX1192 ------
NM_012287chr374460 4348 4191 3783 3661 3517 3289 14544 34124 1563 316 --
NM_012290chr221394 575 ----11041
NM_012294chr783870 3733 2959 2883 1360 600 311 62 1430 22638 713 33534 2976 1370
NM_012297chr411757 --12070 --
NM_012300chr532469 1609 959 1428 32459 2319 2227 --
NM_012301chr721801 758 12220 ----
NM_012304chr52843 618 12490 42318 1676 951 508 11823
NM_012307chr181729 ------
NM_012308chr1171885 1681 1641 762 669 521 282 --12443 --
NM_012309chr1174657 3906 1919 1351 1033 299 77 ------
NM_012316chr145173 4482 2193 1953 11151 --11514
NM_012328chr741315 1196 496 190 162 ----
NM_012330chr1021542 511 ----1659
NM_012338chr731251 400 105 1463 ----
NM_012347chr622392 920 ------
NM_012383chr92420 46 --1173 170
NM_012395chr733395 2230 41 1508 1802 --
NM_012399chr2221720 458 134 21960 1771 --
NM_012414chr13543 296 216 --1718 1648
NM_012416chr94354 279 239 104 ------
NM_012419chr6--2665 625 --2420 210
NM_012429chr224871 449 251 47 11354 1912 --
NM_012431chr713256 1711 13034 --
NM_012434chr631650 512 401 ----1158
NM_012464chr432748 2701 947 12046 1356 12944
NM_012465chr1073138 2215 866 594 495 484 384 ------
NM_012471chrX51505 669 550 473 354 ----11943
NM_012479chr772600 2525 2434 1870 1833 653 289 --1538 1165
NM_012482chr11562 ------
NM_013231chr1473917 3839 1636 1304 1236 954 292 --14177 23797 2721
NM_013233chr221343 922 --1939 --
NM_013250chr111109 11511 ----
NM_013254chr121633 ------
NM_013255chr737977 6357 1537 38809 6159 1307 16460 48252 7729 2224 1866
NM_013257chr82397 284 12325 ----
NM_013259chr3------1280
NM_013260chr17--1990 ----
NM_013261chr453683 3662 3300 1056 793 21189 838 21397 942 13270
NM_013262chr61591 ----11331
NM_013269chr1254417 4389 3199 207 183 --11499 --
NM_013281chr2021251 131 11072 ----
NM_013286chr353318 1429 1174 773 294 --23419 2645 --
NM_013293chr72200 142 ------
NM_013316chr71431 ------
NM_013354chr821020 509 ------
NM_013357chr83841 808 647 ------
NM_013372chr1511228 12551 1539 23390 818
NM_013374chr362883 2774 2041 1082 737 488 --12717 --
NM_013381chr12----1612 --
NM_013410chr121282 1049 ------
NM_013423chrX1510 11028 --1955
NM_013427chrX1510 11028 --1955
NM_013437chr841276 939 524 313 --1393 --
NM_013438chr911546 ------
NM_013448chr141177 ------
NM_013449chr1232654 2613 715 --1285 --
NM_013937chr6--1467 11017 --
NM_013958chr81436 --1371 --
NM_013959chr81436 --1371 --
NM_013960chr8----1654 --
NM_013961chr81436 --1371 --
NM_013962chr81436 --1371 --
NM_013996chr72152 41 ------
NM_013996chr72152 41 ------
NM_013997chr72152 41 ------
NM_013997chr72152 41 ------
NM_013998chr72152 41 ------
NM_013998chr72152 41 ------
NM_014000chr1021406 484 11684 ----
NM_014007chr931018 396 90 ------
NM_014011chr212577 12409 ----
NM_014016chr341598 1565 629 399 --1296 --
NM_014021chr153291 3013 2268 1287 572 22814 2427 1975 --
NM_014035chr51244 1505 21367 341 --
NM_014043chr311384 1464 --21195 166
NM_014048chr1664940 4454 3787 3393 1294 114 --34657 4543 1193 24669 236
NM_014056chr342356 2254 2115 1978 12261 1749 --
NM_014071chr201517 ------
NM_014089chr1322211 155 ----11840
NM_014109chr841123 425 209 58 ------
NM_014110chr131126 1082 439 ----11151
NM_014112chr885222 4934 4510 4027 2187 1746 1385 1311 --15294 --
NM_014117chr1622222 136 12116 1410 12057
NM_014141chr765103 4508 4124 3701 3437 579 12128 21720 551 --
NM_014153chr161229 ----1453
NM_014154chr31392 ------
NM_014155chr1157369 6907 6753 5519 815 32267 1787 190 12824 --
NM_014159chr31145 ------
NM_014160chr321418 213 ------
NM_014181chr211923 1316 12654 12888
NM_014225chr191370 ------
NM_014233chr172673 631 ------
NM_014245chr32770 166 ------
NM_014248chr22--1153 ----
NM_014253chrX42221 1616 976 439 --21961 287 --
NM_014263chr1031351 264 141 --1131 --
NM_014271chrX1731 ------
NM_014278chr42461 110 ------
NM_014283chr11160 --2953 543 --
NM_014294chr841421 1313 170 116 1438 ----
NM_014296chr321006 145 --1314 --
NM_014309chr2255142 4992 3787 1929 1454 11653 13566 --
NM_014313chr121380 319 1398 21543 304 1241
NM_014316chr1611975 ------
NM_014319chr1231594 1309 489 ------
NM_014325chr121458 12250 1133 1422
NM_014331chr411209 27573 6469 36839 5468 1324 12291
NM_014333chr1121844 925 12621 ----
NM_014335chr1531272 1024 366 --1886 --
NM_014342chr1141406 1000 540 292 11271 --21227 929
NM_014350chr54434 418 390 131 1930 --1186
NM_014363chr13--11131 183 --
NM_014372chr12722 61 ------
NM_014376chr512492 22370 1923 22207 1002 --
NM_014381chr1453129 2127 796 266 245 --11260 --
NM_014392chr441118 477 414 160 21464 1212 1130 --
NM_014393chr821602 450 --11731 --
NM_014395chr431972 1422 190 ------
NM_014423chr564561 4533 4091 1340 1087 944 25610 5479 33812 1724 872 13566
NM_014445chr332164 1780 528 31634 860 832 32328 2275 2214 --
NM_014447chr411334 ------
NM_014456chr1011746 1400 ----
NM_014488chr111632 ------
NM_014494chr1631720 1485 454 1235 12146 --
NM_014496chrX--193 ----
NM_014500chrX1233 ------
NM_014563chrX22027 1654 --1291 11879
NM_014567chr16168 ------
NM_014574chr141159 11015 ----
NM_014584chr1431645 655 381 ------
NM_014585chr221234 1162 ------
NM_014588chr202757 119 123 ----
NM_014602chr31349 ------
NM_014606chr4----11129 11452
NM_014613chr542823 2351 2340 1234 12114 22814 1003 --
NM_014614chr221211 172 11457 ----
NM_014615chr1673409 3199 1196 492 419 384 197 13116 ----
NM_014618chr91341 ------
NM_014620chr121145 ------
NM_014632chr11144 ------
NM_014634chr2293649 3418 2995 2915 2890 2505 2298 1453 756 13610 12276 13438
NM_014635chr221527 697 1241 --185
NM_014636chr942756 1648 1033 658 33989 3178 897 12953 --
NM_014647chr1611999 --12283 --
NM_014660chr73337 171 144 --11110 --
NM_014666chr52401 76 ------
NM_014669chr16----1131 --
NM_014670chr241409 1145 1131 1011 ------
NM_014676chr121479 1219 ----1597
NM_014682chr842037 1887 97 81 ----11954
NM_014685chr161441 ------
NM_014686chr1952484 2244 1920 1842 251 ------
NM_014690chr723041 284 --11903 12657
NM_014699chr161320 ------
NM_014701chr1543125 2223 2155 1269 ------
NM_014702chr643312 2495 1110 838 11378 --151
NM_014705chr71796 11557 --1323
NM_014707chr731801 864 524 11611 --11518
NM_014709chr21600 ------
NM_014713chr21352 ------
NM_014717chr19--1763 1869 --
NM_014719chr7--11104 ----
NM_014720chr1021525 607 ----1563
NM_014721chr6127424 7380 6526 6386 6266 4987 4979 1799 1686 1339 1241 615 --16288 25103 632
NM_014727chr191313 ------
NM_014729chr811607 1792 1112 --
NM_014730chr1254941 1501 1004 640 614 13529 15088 --
NM_014730chr1254941 1501 1004 640 614 13529 15088 --
NM_014731chr20--141 ----
NM_014732chr1665866 4435 1860 1706 723 264 35809 1605 207 ----
NM_014733chr552155 2014 399 328 289 1429 ----
NM_014735chrX42012 1393 497 217 ------
NM_014738chr171743 --1750 --
NM_014743chr432571 809 365 --1655 1243
NM_014751chr812066 1268 --11935
NM_014752chr11------2793 264
NM_014755chr233709 2672 1050 --21477 1310 24103 1650
NM_014757chr542397 2275 1592 578 1649 ----
NM_014764chr121946 ----1374
NM_014774chr132263 613 119 11192 --1247
NM_014781chr821155 1092 ------
NM_014787chr121067 39 ------
NM_014795chr21899 ------
NM_014800chr72856 271 ----11053
NM_014802chr1241118 389 325 60 ------
NM_014804chr1721353 175 1531 ----
NM_014810chr132277 491 33 --1255 --
NM_014819chr531847 1586 465 1549 --11718
NM_014824chr1131844 1722 193 --11675 --
NM_014827chr11330 ------
NM_014828chr1442459 2009 1862 317 ------
NM_014830chr1263384 1159 1114 1095 663 347 --12411 --
NM_014832chr133622 212 168 --1744 --
NM_014835chr2052242 2214 1651 786 541 ----1171
NM_014836chr1031644 1443 625 ----11864
NM_014838chr2221035 230 ------
NM_014839chr12777 327 22539 2080 22301 1549 --
NM_014840chr12132880 2824 2506 2324 1302 1000 782 723 625 512 201 195 186 23288 2786 12207 13027
NM_014841chr621158 1087 ------
NM_014847chr11445 ------
NM_014850chr354420 4275 3562 1704 206 ------
NM_014859chr172549 119 1283 2527 85 11438
NM_014864chr134278 4010 996 33488 1553 283 --1867
NM_014867chr853870 3841 3830 3120 639 --12833 --
NM_014870chr184026 3956 3704 1900 1340 649 642 365 11188 11607 --
NM_014873chr141734 846 318 195 --121 --
NM_014877chr17107103 6394 6328 5362 2352 2178 1951 1712 1296 1034 21902 200 12150 22988 1085
NM_014888chr71339 11458 1154 --
NM_014893chrY32052 573 262 1845 ----
NM_014901chr582222 2052 1831 1787 1779 436 310 135 --1182 --
NM_014903chr1272468 2349 1991 1869 587 101 82 1170 12104 --
NM_014906chr1773278 3229 3185 3179 1243 789 766 12775 24115 1281 --
NM_014912chr1023354 281 23088 807 23186 636 --
NM_014920chr653793 3564 2912 865 144 12847 ----
NM_014923chr1352237 1940 1856 130 44 11559 ----
NM_014925chr121294 ------
NM_014939chr182964 133 --1312 --
NM_014945chr511945 ------
NM_014946chr22789 644 2518 468 ----
NM_014947chr143006 838 432 211 23113 297 22625 96 --
NM_014949chr1------1876
NM_014952chr1541754 1491 806 744 ------
NM_014961chr41742 ------
NM_014962chr2042171 1793 1167 740 ------
NM_014965chr32831 654 1149 --11682
NM_014974chr1061761 1493 1255 1132 564 478 11450 --11791
NM_014978chr1021276 213 ------
NM_014982chr1494687 4539 3891 3799 850 735 389 379 227 --14162 21893 368
NM_014992chr142708 638 ----1794
NM_014997chr762942 2755 1927 1884 669 565 12440 --1694
NM_014999chr1211092 1162 --11431
NM_015000chr1233133 1935 180 1923 ----
NM_015005chr1451749 1663 1089 603 266 1474 --1616
NM_015008chr333588 3114 2703 ------
NM_015017chr13934 910 257 11176 ----
NM_015025chr242729 2683 2613 1701 --12228 --
NM_015026chr1273891 3484 3329 3159 1869 1202 971 --24729 3738 --
NM_015032chr1332898 2224 2035 1575 12473 --
NM_015039chr144334 3089 2978 46 13985 33316 1549 1180 --
NM_015045chr1042276 1391 385 379 ----1173
NM_015049chr232633 2577 2203 ----23297 3263
NM_015051chr943259 1034 1018 164 22678 1091 13268 23141 292
NM_015055chr1132715 1062 847 --32898 1006 535 --
NM_015057chr132683 170 ------
NM_015068chr783620 3217 2563 1547 1495 1455 1346 258 3359 325 79 33958 3792 223 --
NM_015071chr576383 5003 4074 2423 126 118 85 45741 5583 5473 4869 ----
NM_015074chr174669 4421 3614 1812 1487 776 578 --11873 14499
NM_015090chr186071 4536 2420 2260 1815 1751 629 131 25999 4248 35736 4193 3830 --
NM_015092chr1674177 3793 3425 3087 1882 1334 889 11794 ----
NM_015093chr61130 ----199
NM_015094chr2254533 4169 3873 1779 1160 ------
NM_015097chr331463 663 429 --1308 --
NM_015101chr12928 670 ----1970
NM_015107chrX31854 895 622 --2667 56 1537
NM_015115chr462617 1262 839 825 138 48 22891 529 1232 1455
NM_015130chr421054 353 11351 ----
NM_015138chr1542824 2360 2316 128 ----11913
NM_015144chr1643911 3248 1083 299 11360 23812 2434 33202 2867 178
NM_015150chr3--2673 22 --140
NM_015153chr61672 ------
NM_015155chr1043022 2695 2600 2114 11194 ----
NM_015156chr1473493 3223 3191 2903 928 759 550 --23694 3415 1524
NM_015158chr92838 47 1690 ----
NM_015163chr1452004 1989 1903 1479 391 1417 ----
NM_015170chr821590 245 --1320 11455
NM_015185chrX32674 650 405 22965 2954 12914 --
NM_015186chr9------1473
NM_015187chr41895 --1108 --
NM_015191chr1151723 1107 934 510 443 --1690 --
NM_015200chr42964 870 12581 ----
NM_015206chr1563373 2582 2367 1113 752 554 13212 13067 --
NM_015208chr1833059 2658 290 ----12989
NM_015209chr172135 1774 1632 1509 749 696 242 ------
NM_015213chr112749 544 1590 ----
NM_015215chr152868 2804 2137 1958 929 ----11078
NM_015225chr952759 2091 1136 976 776 --1200 1614
NM_015236chr4137 2579 194 11505 --
NM_015247chr1674240 4176 3813 3367 1862 1470 91 --21684 1361 --
NM_015256chr51549 2483 219 1295 --
NM_015260chr1941381 1176 1059 344 3494 304 190 ----
NM_015263chr152964 900 ------
NM_015264chr2254834 3879 1150 288 57 21743 794 14763 --
NM_015265chr242330 2297 860 838 1729 12205 22385 1729
NM_015267chr1242088 1538 1527 460 1613 ----
NM_015269chr11458 1491 ----
NM_015270chr1242208 1827 336 110 3835 802 613 12162 1946
NM_015271chr473609 3024 2886 2699 1326 1111 977 199 12795 --
NM_015272chr1631758 1339 529 ------
NM_015278chr631291 1216 275 12428 13076 --
NM_015286chr1551815 909 555 404 48 32150 1798 348 --32468 2194 523
NM_015288chr573766 3061 2565 1423 754 663 234 23213 1375 13205 --
NM_015294chr173928 816 75 1317 --1920
NM_015296chr131161 ----11046
NM_015308chr11------179
NM_015313chr1154295 3567 3560 2959 1601 11170 21508 1003 --
NM_015314chr752529 2439 2271 1808 1577 12337 ----
NM_015315chr533240 2701 532 22885 2568 --13060
NM_015322chr15--138 ----
NM_015323chr631615 375 22 11504 11252 11597
NM_015328chr752833 2448 1148 783 691 --22137 552 --
NM_015332chr763553 3316 1368 1353 1267 1018 21026 803 ----
NM_015335chr1242230 622 566 153 ------
NM_015336chr1252591 2577 1848 735 575 12671 ----
NM_015339chr20--1747 ----
NM_015344chr81658 ----126
NM_015355chr1721430 437 --1541 11614
NM_015358chr2111083 ------
NM_015361chr21767 ------
NM_015365chrX73755 3555 1205 1184 680 566 121 ------
NM_015382chr143751 162 95 ------
NM_015385chr1043128 3045 2354 1007 --1847 --
NM_015387chr2--1278 11513 11685
NM_015393chr443699 3575 1442 1333 33718 2730 1373 --12630
NM_015394chr1222132 573 12467 12063 --
NM_015397chr931854 1429 704 11371 21935 259 --
NM_015423chr1141753 1657 1444 252 11204 11253 --
NM_015429chr3------1734
NM_015436chr42513 269 ----12157
NM_015439chr61486 ------
NM_015446chr131496 1377 529 ------
NM_015455chr542674 1409 1193 242 ----13998
NM_015458chr835349 3443 1784 --25184 575 --
NM_015460chr382119 1977 1950 1486 1389 367 305 22 21878 590 12106 11371
NM_015461chr18--1596 ----
NM_015464chr71408 11000 1664 --
NM_015466chr31222 ------
NM_015475chr22775 25 --21046 915 --
NM_015483chr7144 ----158
NM_015497chr151360 ------
NM_015520chr321767 194 1734 --1942
NM_015527chr162292 91 ------
NM_015535chr242726 1038 913 84 174 ----
NM_015541chr321108 25 --1891 --
NM_015548chr62773 173 ------
NM_015554chr1542471 2068 783 324 ------
NM_015555chr621684 170 ----21518 609
NM_015559chr1831100 920 328 ------
NM_015560chr3--1457 ----
NM_015565chr2122254 710 ------
NM_015568chr2084294 4205 3762 2920 2684 701 523 492 33861 3077 802 11284 --
NM_015569chr164122 1616 1571 1338 935 197 1168 ----
NM_015571chr642282 2003 1705 884 ------
NM_015575chr263425 1305 551 544 357 41 ------
NM_015576chr352935 2572 2130 2122 1203 --1731 --
NM_015577chr521604 34 ------
NM_015578chr192542 109 ----1632
NM_015599chr6159 ------
NM_015610chr732474 383 308 --21943 430 1250
NM_015626chr17------21125 1024
NM_015640chr163422 2080 1706 1426 1196 832 1608 --23665 493
NM_015646chr1241283 1253 264 65 ------
NM_015657chr231035 237 195 --1680 --
NM_015684chr14------2232 218
NM_015691chrX72894 2809 2691 2527 2340 1855 504 22602 497 ----
NM_015693chr41244 ------
NM_015713chr852874 2780 2486 205 35 ----1781
NM_015834chr21--1955 ----
NM_015850chr852151 817 753 495 230 22466 2003 11633 --
NM_015852chr753324 1428 1024 595 511 1744 13051 --
NM_015878chr842006 1894 1661 1435 22051 1815 ----
NM_015879chr18127005 6910 6227 5783 3345 3049 2799 2250 2067 1497 550 247 28389 5670 ----
NM_015885chr111308 ----1740
NM_015886chr895665 5391 3935 3754 2200 1000 838 643 104 24023 4009 --14075
NM_015888chr122946 542 12856 1157 --
NM_015891chr621536 47 ------
NM_015902chr82960 204 ------
NM_015905chr7163 ------
NM_015906chr134123 3075 931 --1187 13423
NM_015907chr41353 ------
NM_015908chr7196 ------
NM_015912chr822461 307 ----1358
NM_015913chr13245 238 158 --1715 --
NM_015920chr151522 ------
NM_015941chr81130 ------
NM_015955chr2----1516 --
NM_015980chr521590 1517 21443 1044 ----
NM_015981chr562389 2098 1106 985 964 232 22612 2527 --13006
NM_015995chr1565098 4836 3859 3384 801 736 21160 133 --35258 3847 1634
NM_015999chr11677 ------
NM_016002chr12697 560 --2618 528 1112
NM_016003chr732474 383 308 --21943 430 1250
NM_016009chr164831 4370 1659 1036 198 142 --14553 --
NM_016018chr862602 2137 1825 714 235 128 11783 11961 --
NM_016019chr72853 676 ------
NM_016021chr642714 2054 2006 595 --12207 --
NM_016023chr831984 1671 412 21526 656 --12194
NM_016025chr1631967 1643 485 ------
NM_016037chr13410 120 23 --1254 --
NM_016040chr132533 848 833 12332 --1938
NM_016045chr2021266 1141 ------
NM_016061chr251459 599 559 431 338 ------
NM_016066chr1123 ------
NM_016072chr1221851 673 11725 ----
NM_016073chr153924 887 107 ------
NM_016076chr133169 2424 1038 23067 1274 --1396
NM_016078chr171857 --1222 --
NM_016083chr643499 3086 545 126 --21395 151 --
NM_016090chr112340 109 ------
NM_016096chr82695 642 ----12073
NM_016097chr182696 42 --1920 1110
NM_016101chr161379 --195 --
NM_016107chr511278 ------
NM_016124chr1----11438 11282
NM_016126chr1158 ------
NM_016131chr231564 885 26 --1854 11872
NM_016132chr1543277 2843 2639 2546 1701 22980 318 --
NM_016141chr33579 514 221 ------
NM_016144chr52777 565 1710 171 --
NM_016205chr41539 ------
NM_016206chr358870 6307 6005 966 324 26994 755 25971 228 28600 8538
NM_016213chr15155 ------
NM_016217chr623523 898 22418 1315 33541 3223 571 --
NM_016227chr11160 --2953 543 --
NM_016248chr1353678 3532 1542 661 235 1190 2746 652 --
NM_016252chr22690 60 ------
NM_016255chr653141 2997 2707 1222 693 32341 1177 161 ----
NM_016257chr172911 2729 2515 2144 1351 1300 538 12417 ----
NM_016260chr2127670 6759 5223 4707 2530 2071 1891 1513 1458 1000 944 338 --27157 1185 --
NM_016271chr1852129 1908 1860 1812 945 1457 ----
NM_016279chr5----1130 --
NM_016287chr131474 387 160 11873 11527 --
NM_016289chr221554 98 --21912 1498 --
NM_016300chr3--1334 ----
NM_016303chrX2436 104 ------
NM_016308chr131932 1464 658 1816 11486 --
NM_016311chr11114 ------
NM_016312chr122216 97 ------
NM_016315chr251541 1476 699 405 96 1412 ----
NM_016322chr933165 2444 998 22467 162 13075 --
NM_016333chr16--1524 ----
NM_016340chr53405 311 101 --184 --
NM_016351chr71175 ------
NM_016353chr842381 1945 805 693 22142 1675 --11844
NM_016357chr12------165
NM_016374chr111350 ------
NM_016374chr111350 ------
NM_016399chr12--2774 217 3750 722 63 --
NM_016401chr112302 40 ------
NM_016418chr2263445 2554 1533 1256 1056 731 13729 13172 13551
NM_016422chr114628 196 126 27 ----1278
NM_016441chr2----1238 --
NM_016448chr151601 1335 630 384 244 11821 ----
NM_016454chr15--1305 ----
NM_016470chr202392 344 --1407 148
NM_016472chr143443 305 205 1394 --11361
NM_016480chr5190 1181 --1116
NM_016485chr621938 383 ------
NM_016488chr1241912 1696 1289 593 ------
NM_016507chr1733054 505 151 32998 2306 1148 --21193 87
NM_016513chr653793 3564 2912 865 144 12847 ----
NM_016516chr22621 567 ------
NM_016519chr41202 ----176
NM_016525chr9----1940 --
NM_016530chr1553735 894 737 559 144 23523 1400 ----
NM_016531chr473676 1494 1188 772 619 320 247 33683 2949 1141 1543 23257 399
NM_016542chrX11423 ----11301
NM_016544chr273429 2997 2889 1072 1063 724 122 ----13323
NM_016588chr61936 ----1188
NM_016603chr5194 11924 ----
NM_016604chr51889 ------
NM_016614chr63497 264 105 --2699 589 --
NM_016621chr1163323 3268 1466 258 229 146 --3406 247 166 14166
NM_016626chr1821365 442 --11583 1260
NM_016628chr101656 ------
NM_016644chr51445 ------
NM_016823chr17--21171 90 ----
NM_016824chr1011909 --21803 326 1590
NM_016834chr17103962 3482 3354 2962 1661 1572 637 489 390 148 ------
NM_016835chr17103962 3482 3354 2962 1661 1572 637 489 390 148 ------
NM_016841chr17103962 3482 3354 2962 1661 1572 637 489 390 148 ------
NM_016937chrX2814 302 ------
NM_016950chr421143 462 ------
NM_017420chr1422738 1033 23847 1219 ----
NM_017423chr441669 889 671 614 11524 11655 --
NM_017447chr2143360 2909 762 447 21209 305 13340 2146 116
NM_017456chr1751708 1336 143 101 82 11630 --11899
NM_017519chr61379 ------
NM_017540chr562644 2448 2082 732 636 288 --12753 --
NM_017548chr311563 ----11541
NM_017563chr385640 4397 2323 1951 520 450 376 27 --25298 1736 1250
NM_017569chr131145 ------
NM_017580chr102881 815 21558 888 ----
NM_017582chr141627 1343 1171 245 2700 587 ----
NM_017590chr2211810 ------
NM_017593chr41190 ------
NM_017599chr121318 1698 --21324 310
NM_017610chr1542085 1929 1904 1464 --11705 --
NM_017628chr454268 1222 1067 770 741 24340 4227 34956 4129 63 --
NM_017633chr643658 3575 2717 347 11493 21527 556 --
NM_017635chr1151119 1062 492 466 425 ------
NM_017637chr9108522 8516 5945 5724 3114 3055 1587 994 885 27 67296 2848 1485 1116 963 741 --57725 7470 6759 2083 1896
NM_017641chr1221188 447 1858 ----
NM_017644chr344240 4169 3987 371 24791 3424 13478 --
NM_017645chr91950 22724 695 --12777
NM_017650chr795258 5100 4916 2053 2037 1748 805 611 303 --16049 25315 1716
NM_017657chr22787 606 ------
NM_017658chr1463911 3781 3371 1765 930 540 1571 24239 240 --
NM_017662chr941689 609 402 44 --11784 12038
NM_017709chr124335 359 --24257 1522 13243
NM_017737chr12401 80 1305 --3847 559 515
NM_017746chr9185 ------
NM_017747chr51355 ------
NM_017748chr171325 1104 1856 --
NM_017752chrX41787 642 450 373 1310 ----
NM_017754chr6104978 4905 4895 4867 4588 4031 3827 1660 799 27 24754 109 14445 --
NM_017761chr141198 952 579 421 21047 945 21302 47 --
NM_017768chr13293 172 27 --1943 --
NM_017769chr1433175 1260 1010 23237 2792 --12267
NM_017770chr672241 2051 1114 1002 756 444 150 --12653 --
NM_017778chr811486 ----1344
NM_017787chr1042778 509 499 487 1594 12189 11906
NM_017794chr9--1298 1321 --
NM_017798chr204505 473 395 222 ------
NM_017811chr963154 2381 2320 872 771 609 --21926 492 12154
NM_017813chr885303 5193 3959 3599 1045 989 722 237 11836 --35820 1794 1395
NM_017831chr1854766 4570 4154 3328 2950 13444 182 --
NM_017843chr201635 ------
NM_017845chr41542 ------
NM_017848chrX33891 3873 3552 ------
NM_017849chr243062 2074 1245 818 1365 ----
NM_017870chr111166 ------
NM_017902chr1074727 3516 2035 315 286 124 28 11321 --11637
NM_017905chr131568 ------
NM_017907chr111502 ------
NM_017913chr9--1445 ----
NM_017919chr9125797 5464 4923 4694 4682 4491 1471 1239 1071 377 246 29 24571 1005 ----
NM_017922chr141158 ------
NM_017938chrX61719 1387 781 364 310 123 ------
NM_017944chr1132986 2489 1949 --22798 1108 11195
NM_017946chr71424 ------
NM_017953chr1----191 --
NM_017954chr741132 501 477 164 ----1591
NM_017990chr1653897 3342 1635 946 441 --23250 707 --
NM_017994chr711116 12300 12206 --
NM_018003chr1532410 1533 722 1609 ----
NM_018014chr2----11235 --
NM_018027chr1013052 1698 13301 --
NM_018030chr1831041 288 203 11108 ----
NM_018046chr531312 595 262 1739 ----
NM_018047chr52849 637 ------
NM_018061chr131380 477 303 21424 424 ----
NM_018078chr411014 ------
NM_018079chr21505 ------
NM_018084chr223147 409 22349 225 --1943
NM_018085chr178104 7910 6458 2389 2306 2234 2078 56931 5197 3212 2419 2251 15387 --
NM_018086chr261642 1347 1194 489 409 348 ----11485
NM_018094chrX1144 ------
NM_018098chr341176 1077 855 269 1333 ----
NM_018103chr1--1324 ----
NM_018105chr811157 ------
NM_018112chr92430 65 ------
NM_018114chr31114 ------
NM_018120chr831464 1197 72 --1518 --
NM_018121chr1062637 1175 644 348 162 98 22377 702 ----
NM_018133chr33879 379 84 --22107 130 --
NM_018155chr341177 975 813 251 12911 ----
NM_018159chrX31234 1085 689 --173 --
NM_018184chr332126 1676 189 ------
NM_018195chr1152049 1848 1725 1502 743 11354 169 --
NM_018200chr1542532 1992 1744 667 11918 ----
NM_018202chr12669 121 ------
NM_018211chr131463 863 231 1153 ----
NM_018214chr641257 1171 1083 814 ------
NM_018221chr2263 46 ------
NM_018230chr11473 ------
NM_018241chr41102 --11047 --
NM_018243chr474063 3884 3806 3602 3579 3069 976 11259 11023 --
NM_018246chr862829 2239 2043 1834 1786 504 12711 11892 1244
NM_018247chr643135 2497 2406 1259 --2562 421 12045
NM_018254chr111889 ------
NM_018257chr2042399 1948 983 754 --1609 1662
NM_018266chr331113 1066 1059 ----2694 379
NM_018287chr10--1506 --21183 1031
NM_018293chr352011 745 443 80 27 --1669 12082
NM_018299chr82624 353 1242 --12751
NM_018307chr171670 ------
NM_018315chr41577 --2571 561 --
NM_018317chr4--1236 1288 --
NM_018323chr431668 1631 349 ----197
NM_018327chr201528 1560 ----
NM_018328chr21381 1137 ----
NM_018334chr7--170 ----
NM_018339chr921265 333 21651 1515 ----
NM_018351chr1264014 3522 3043 1795 1017 99 ------
NM_018362chr1163822 3786 499 265 127 81 ----1681
NM_018364chr193440 3371 2655 1136 1024 919 721 358 141 13484 ----
NM_018374chr734789 4191 557 1775 11636 --
NM_018375chr1421674 38 21333 516 1747 31937 1494 1468
NM_018388chrX41030 985 313 140 ------
NM_018389chr11------1226
NM_018399chr64280 160 151 80 ----1264
NM_018403chr343748 3583 3127 795 ------
NM_018409chr42797 36 12487 ----
NM_018413chr12------158
NM_018416chr1252612 2246 602 545 409 1159 1314 --
NM_018429chr562330 2242 2142 2066 1881 284 ----1864
NM_018433chr2----1555 --
NM_018434chr5--1138 1131 --
NM_018439chr1852661 2181 2049 372 310 32272 1631 163 ----
NM_018440chr878540 6992 6529 5799 5749 5697 2000 21114 214 11532 25813 3169
NM_018444chr832086 805 647 --12286 --
NM_018482chr842518 2404 1630 884 22476 773 --1223
NM_018489chr132232 2119 1548 1714 ----
NM_018490chr1141687 1563 1496 536 11290 1415 --
NM_018509chr1711707 11204 ----
NM_018527chr131164 ------
NM_018559chr131223 1237 ----
NM_018566chr1115073 5067 4635 4417 4343 4315 3617 2063 1707 851 255 11422 14989 14250
NM_018584chr11107 2952 935 --1310
NM_018590chr1011215 ------
NM_018602chr1541701 1644 470 312 --11412 11590
NM_018638chr1235307 491 173 1758 1883 --
NM_018640chr1242268 2142 589 242 12206 12551 --
NM_018650chr121903 764 ------
NM_018657chr3----126 1725
NM_018662chr184232 3935 3607 3601 3591 3313 2869 790 ------
NM_018684chrX21251 922 1207 130 --
NM_018685chr71116 ----2843 226
NM_018695chr541693 746 722 483 ------
NM_018708chr1941533 1220 1033 204 11295 11323 --
NM_018712chr1121543 1201 11364 ----
NM_018715chr141528 1402 901 813 11426 --11659
NM_018718chr741911 1835 1592 933 11731 22263 1724 --
NM_018834chr53736 716 346 ------
NM_018841chr143521 3178 419 99 23060 352 ----
NM_018847chr931536 426 416 11333 1374 --
NM_018890chr73490 349 121 --11469 21213 315
NM_018939chr52607 542 ------
NM_018945chr673314 3263 1252 852 619 375 187 2827 207 13152 --
NM_018951chr72834 273 1239 11137 --
NM_018953chr121841 ------
NM_018979chr121659 11027 1226 1125
NM_018999chr1054314 1669 1093 805 746 23539 972 11300 --
NM_019000chr521183 248 ----11426
NM_019001chr374701 3981 3722 3653 594 492 216 ------
NM_019004chr71751 1611 11696 11511
NM_019006chr151535 ------
NM_019022chr1832778 2418 2229 --1118 --
NM_019024chr2----135 --
NM_019028chr11----1360 --
NM_019036chr63372 222 76 --1460 11014
NM_019040chr11--1250 158 --
NM_019045chrX1626 ----1205
NM_019050chr42463 354 11651 --1508
NM_019063chr222266 2034 --1531 --
NM_019072chr553704 3393 1064 452 247 1752 33481 1698 1367 --
NM_019073chr1137 ------
NM_019084chr1031842 819 309 22561 197 --22065 399
NM_019091chr231022 933 37 ------
NM_019094chr1282748 1270 1047 923 559 542 332 108 13509 33285 1031 785 --
NM_019114chr911676 --22212 995 --
NM_019116chr1663519 3270 3129 3110 318 53 --13232 --
NM_019117chrX13173 53445 2421 637 609 282 ----
NM_019555chr32683 167 --11739 11318
NM_019556chrX2462 319 ----1978
NM_019590chr1021181 196 2130 119 --2526 491
NM_019595chr22550 256 ------
NM_019600chr151564 ------
NM_019610chr121474 1378 1650 ----
NM_019842chr62441 283 ------
NM_019860chr10--1598 ----
NM_019891chr13942 912 822 ----1322
NM_019895chr32312 29 ------
NM_019903chr1011909 --21803 326 1590
NM_020066chr1--1307 ----
NM_020122chr265821 4474 4378 1990 1041 1012 11931 146 --
NM_020123chr10--1373 ----
NM_020133chr665789 4609 4423 4162 2087 2009 24389 1153 --25603 387
NM_020141chr141751 782 493 31 1827 1627 --
NM_020147chr153778 357 71 --1159 --
NM_020148chr182373 130 --22049 801 22920 2175
NM_020151chr231453 1364 211 ------
NM_020159chr43500 295 151 --11338 --
NM_020177chr573335 3321 3273 2777 2506 2083 1235 2778 250 11072 --
NM_020178chr1711236 --1971 --
NM_020182chr2063548 3067 2988 2969 2797 532 11103 12374 --
NM_020184chr252283 1842 722 505 159 --1690 12305
NM_020200chr10173 ------
NM_020225chr41132 --1323 --
NM_020228chr112366 205 12441 1160 --
NM_020240chr5112617 2434 2325 2100 2007 1838 1715 345 286 232 168 22082 488 21041 1003 --
NM_020309chr19174 1143 ----
NM_020336chr2083812 2955 2475 1541 1491 1115 1077 507 --33648 2407 1097 --
NM_020337chr452507 2043 1239 1120 776 ------
NM_020338chr1073688 3050 2993 2897 2725 1312 342 ------
NM_020341chr20--11580 11562 --
NM_020342chr232089 1823 1055 --12583 12491
NM_020346chr1111271 ------
NM_020347chr362121 1922 1830 1713 1661 85 ------
NM_020354chr101226 1909 --1323
NM_020357chr31550 --1204 11679
NM_020366chr14176 ------
NM_020381chr63456 392 208 ----1133
NM_020390chr364444 4243 3854 3475 3404 71 23426 3296 14235 --
NM_020403chr1331320 398 44 --21767 1570 --
NM_020425chr681963 1737 1658 1498 1363 1248 384 105 ------
NM_020437chr221328 ------
NM_020440chr163064 2996 1110 956 732 152 1496 ----
NM_020443chr175769 5096 2203 2193 1839 703 476 46897 6032 5348 4667 36153 1160 639 --
NM_020455chr652819 2625 2535 2320 323 ------
NM_020456chr1352355 1665 601 412 356 ------
NM_020463chr21191 41493 1173 965 224 ----
NM_020466chr664938 4003 3931 3260 1888 991 --13812 --
NM_020473chrX41673 1560 726 716 1702 ----
NM_020482chr62595 45 1199 ----
NM_020546chr552820 2623 2193 1016 531 --1465 11265
NM_020630chr101612 1632 --1713
NM_020640chr332090 884 453 ------
NM_020644chr112853 697 ------
NM_020651chr211706 ------
NM_020654chr31381 ----2617 398
NM_020673chr2047671 5414 818 643 27740 1830 47473 6381 5545 5242 --
NM_020686chr1633021 761 386 11095 --151
NM_020689chr2021108 301 --11322 --
NM_020697chr821042 289 ----1268
NM_020699chr174623 4398 4173 4087 3475 1176 533 24509 1583 ----
NM_020715chr141882 --12273 --
NM_020717chrX63364 3333 3106 1997 1714 1012 23327 1844 31682 1427 258 13089
NM_020732chr61379 ------
NM_020734chr1252684 2279 1049 405 358 ----1264
NM_020739chr1542831 1672 1380 920 11051 12877 --
NM_020749chr821822 1500 1485 ----
NM_020752chr1032496 2393 453 --193 12299
NM_020754chr34418 315 166 71 1402 ----
NM_020766chrX54201 4028 899 608 571 24285 314 ----
NM_020768chr542129 585 501 257 22146 895 12830 --
NM_020771chr651506 1022 491 235 72 --11142 11181
NM_020772chr1778478 7527 7074 7006 5476 5404 1284 21457 1320 36370 1753 601 48461 7846 7142 2006
NM_020774chr1865068 4719 4455 4299 3942 1146 12021 ----
NM_020776chr1822971 2563 22019 240 12740 21888 1037
NM_020778chr1574801 4283 3941 3864 3731 3186 298 34764 3671 1955 ----
NM_020791chr1721198 1088 21426 44 ----
NM_020794chr11209 1115 183 --
NM_020801chr542198 2122 737 272 ----2859 405
NM_020805chr181454 1104 11713 --
NM_020809chr1132230 589 192 1182 1121 --
NM_020810chr141364 43451 3338 2735 2675 12521 --
NM_020818chr143333 171 26 ------
NM_020819chr62356 247 ----1755
NM_020824chr10165 ------
NM_020830chr242527 796 658 411 ------
NM_020832chr11566 ------
NM_020841chr1264048 2990 2862 2810 2707 218 33899 3775 3116 11274 --
NM_020853chr1252760 2717 2666 2552 792 ----12335
NM_020856chr1921599 1248 ------
NM_020858chr1521487 157 2805 428 1868 1486
NM_020859chr423856 520 11006 12651 --
NM_020860chr4----11093 --
NM_020868chr231255 182 92 ------
NM_020871chrX--32078 972 543 --1793
NM_020872chr33715 595 563 ------
NM_020873chr33863 186 103 1279 ----
NM_020897chr18974 498 432 403 387 336 279 256 ------
NM_020905chr22299 123 ------
NM_020918chr1023393 488 --12699 12274
NM_020921chr1433132 3126 100 23259 1224 ----
NM_020922chrX21757 1472 11526 11824 --
NM_020924chr93433 374 78 ------
NM_020926chrX125 ------
NM_020927chr162833 170 11528 21740 454 1963
NM_020940chr1052733 2628 2453 2294 944 12787 11170 1769
NM_020948chr163574 3287 3143 3126 2984 1019 11409 23607 824 --
NM_020951chr1942337 2214 2202 1755 ----1197
NM_020956chr19124342 4074 3450 3326 3095 2918 1225 1019 932 732 185 47 51902 1854 1809 1731 1653 ----
NM_020963chr11174 ------
NM_020977chr41412 11732 21782 678 11948
NM_020981chr21234 ----1767
NM_020983chr1242208 1827 336 110 3835 802 613 12162 1946
NM_021005chr151242 1178 --2314 116
NM_021007chr23870 350 70 199 ----
NM_021033chr1383077 2963 2954 2330 2195 700 508 146 ------
NM_021045chr1032340 1851 781 22459 985 11990 --
NM_021072chr532429 981 587 ------
NM_021083chrX63613 3545 2822 2796 2477 453 11442 --13482
NM_021088chr232183 670 226 --1832 12174
NM_021090chr22114756 4738 4501 3887 3601 3432 1780 1414 1120 420 302 --1284 11987
NM_021097chr263055 2714 2555 2120 951 88 ----12607
NM_021111chr911069 ------
NM_021116chr768903 7657 7608 7372 6772 2330 --37051 679 118 17266
NM_021132chr1041214 1181 488 206 ----11320
NM_021136chr141191 ----1248
NM_021140chrX1141 ------
NM_021145chr72823 795 --11092 --
NM_021151chr721040 442 1414 199 --
NM_021159chr411130 1501 --1195
NM_021183chrX32528 2137 139 ------
NM_021190chr13858 472 329 --11191 --
NM_021191chr1231687 775 302 21579 278 12169 --
NM_021202chr2042977 2300 1999 901 --22637 34 12518
NM_021215chr2021511 512 ----1528
NM_021219chr211160 ------
NM_021227chr4147 ------
NM_021238chr121677 1337 21533 746 --
NM_021240chr92675 605 1188 ----
NM_021242chrX4982 943 755 372 ------
NM_021252chr101327 ------
NM_021253chr641220 1145 1128 945 11247 ----
NM_021255chr1433609 2564 55 14042 ----
NM_021614chr52209 38 ------
NM_021622chr1032130 1571 871 12366 --1447
NM_021626chr171507 ------
NM_021629chr364179 3871 3482 2029 1545 577 ------
NM_021643chr231771 692 265 --11707 --
NM_021722chr71134 ------
NM_021723chr71175 ------
NM_021809chr2031716 388 148 2341 99 --22488 492
NM_021813chr6105806 5725 5257 4953 4822 3932 3785 2137 1584 854 12128 13887 11019
NM_021814chr611580 11650 ----
NM_021815chr223006 238 22500 946 1380 --
NM_021911chr574802 4244 4027 3703 1741 334 169 --12182 21688 698
NM_021912chr1543970 1065 491 65 23457 1632 ----
NM_021913chr191379 ------
NM_021914chr1452339 2140 1532 547 173 ------
NM_021940chr62658 201 ------
NM_021951chr92837 802 ------
NM_021954chr1332251 900 379 --11099 1501
NM_021960chr132714 2147 413 32293 1835 828 --12755
NM_021961chr1186506 6053 2838 2809 2049 1680 1280 366 14638 25795 1460 --
NM_021963chrX2298 255 ------
NM_021964chr395822 5805 5633 5166 4551 1544 452 247 200 11910 16354 --
NM_021965chr931359 332 73 1374 ----
NM_021967chr5--11321 ----
NM_021984chrX21529 1464 --164 --
NM_021987chrX21529 1464 --164 --
NM_021988chr2021592 220 ------
NM_021990chrX21529 1464 --164 --
NM_021998chrX21033 369 ------
NM_022037chr22857 199 ------
NM_022041chr1652432 2396 527 429 291 22440 1818 ----
NM_022048chr1565937 4332 2252 1988 1267 1185 23972 1313 12321 --
NM_022073chr1411141 --2218 167 1202
NM_022075chr11142 ------
NM_022080chr2032122 548 306 22252 652 ----
NM_022087chr71445 ------
NM_022114chr124048 3074 11593 13090 --
NM_022118chr13------1210
NM_022121chr62871 236 1130 ----
NM_022130chr521185 240 11301 ----
NM_022133chr811553 11495 --11691
NM_022136chr211180 ------
NM_022143chr721141 258 2525 268 11538 --
NM_022145chr51625 ------
NM_022166chr1675996 5242 5003 4105 1273 618 520 22378 1020 35756 4238 1642 --
NM_022173chr22857 199 ------
NM_022336chr232146 1478 87 177 12364 --
NM_022351chr853846 3442 3417 2720 231 23670 221 22488 1096 --
NM_022361chr63545 429 390 --1133 --
NM_022367chr11711 ------
NM_022442chr2021592 220 ------
NM_022456chr1287639 6984 5791 4842 4836 1290 1282 689 1730 16205 1241
NM_022459chr1352517 1962 1327 1304 360 15999 ----
NM_022465chr1242591 2363 1983 311 ------
NM_022475chr41533 ------
NM_022484chr72104 61 ------
NM_022491chr1242218 1186 992 182 13133 ----
NM_022494chr101415 --1331 1473
NM_022497chr332964 2676 651 2892 188 12828 --
NM_022567chrX2787 197 ------
NM_022650chr51170 ----3666 341 87
NM_022658chr1221270 445 ------
NM_022726chr611301 21487 1206 ----
NM_022730chr21334 ------
NM_022745chr162967 2812 2297 2085 1117 359 1979 12788 --
NM_022751chr18--1248 ----
NM_022753chr122833 2729 12022 2161 91 12235
NM_022763chr342676 2617 530 451 22919 2731 --12133
NM_022776chr3--11086 ----
NM_022780chr231452 359 243 --2743 133 11762
NM_022782chr121138 ------
NM_022802chr10--11433 31553 1262 445 --
NM_022822chr111148 ------
NM_022824chr541620 1420 598 168 --21513 1213 --
NM_022825chrX------1312
NM_022826chr22851 370 ------
NM_022831chr1--1454 --11550
NM_022838chrX--1330 ----
NM_022893chr21174 12208 11173 12764
NM_022894chr22235 196 2229 154 --11604
NM_022898chr1423864 1100 --34067 1506 48 --
NM_022912chr232639 999 336 22237 559 12807 12116
NM_022978chr5--11321 ----
NM_023000chr1441198 1180 487 222 21208 502 1103 --
NM_023001chr1441198 1180 487 222 21208 502 1103 --
NM_023010chrX2829 650 1151 1285 --
NM_023011chr132835 588 ----1829
NM_023012chr12------1719
NM_023039chr51360 ------
NM_023074chr1941181 1111 888 53 ------
NM_023076chr1652472 2268 2235 2217 194 1532 1516 11836
NM_023105chr852151 817 753 495 230 22466 2003 11633 --
NM_023106chr852151 817 753 495 230 22466 2003 11633 --
NM_023110chr852151 817 753 495 230 22466 2003 11633 --
NM_023111chr852151 817 753 495 230 22466 2003 11633 --
NM_023923chr153450 3127 2882 1480 202 13382 ----
NM_023927chr521220 1205 1881 1953 --
NM_023934chrX31872 1450 521 ------
NM_024019chr4------1233
NM_024046chr321157 256 ------
NM_024077chr91308 ----1563
NM_024082chrX1154 ----1115
NM_024085chr25701 368 348 164 150 ------
NM_024090chr431507 1325 545 ----1664
NM_024095chr12169 ------
NM_024122chrX1251 ------
NM_024345chr994991 4980 4687 4476 4287 2414 2303 370 288 25606 907 15445 --
NM_024415chr5--1171 ----
NM_024421chr1841221 894 110 80 2983 437 ----
NM_024423chr1864192 3208 2814 1693 538 244 11535 ----
NM_024424chr113433 419 260 ------
NM_024425chr113433 419 260 ------
NM_024426chr113433 419 260 ------
NM_024494chr11186 ------
NM_024523chr72441 92 1155 ----
NM_024524chr31535 ----23144 1277
NM_024529chr131191 878 470 ------
NM_024563chr531265 748 560 --11369 --
NM_024567chr82593 584 ------
NM_024581chr6--190 ----
NM_024582chr431135 922 720 ------
NM_024590chr43398 356 186 --11198 --
NM_024612chr171202 1879 165 1184
NM_024613chr821766 1223 --11846 1745
NM_024639chr632813 2121 2055 --1641 --
NM_024646chr123783 980 11065 ----
NM_024652chr151133 --21088 776 1930
NM_024659chr21128 ------
NM_024665chr3113764 3512 3320 1856 1792 1557 1383 1202 850 707 186 13392 ----
NM_024670chr1041418 437 426 367 ----1139
NM_024674chr13865 660 31 42971 2912 2407 357 21257 922 --
NM_024683chr17--123 ----
NM_024689chrX21645 563 21691 1235 ----
NM_024692chr221717 1478 --1409 1614
NM_024721chr852607 2593 864 732 671 1221 ----
NM_024744chr212580 1951 1151 21924 478
NM_024751chr481992 1575 1528 1438 1414 847 565 30 1248 1325 --
NM_024755chr15------1580
NM_024761chr964893 4686 3981 3653 601 393 --24456 1146 --
NM_024770chr241492 406 296 125 26066 2341 14940 --
NM_024779chr1221323 1155 ----1104
NM_024812chr842183 1450 1343 451 11826 ----
NM_024824chr1421346 389 21231 1082 11320 182
NM_024834chr1021578 484 --2688 675 --
NM_024893chr204942 637 308 210 ----1101
NM_024900chr462247 1786 1541 836 798 628 ------
NM_024900chr462247 1786 1541 836 798 628 ------
NM_024909chr621279 372 ----11128
NM_024911chr11149 2861 73 1529 1677
NM_024915chr852462 2317 2277 1076 827 12818 12194 1535
NM_024920chr44997 647 590 320 21471 475 ----
NM_024930chr562742 2679 885 756 549 446 12100 1809 12780
NM_024941chr521348 1202 ------
NM_024944chr211188 --1511 1219
NM_024946chr1631518 1506 667 1154 --1320
NM_024947chr3107913 7200 6781 2812 2552 2066 871 761 728 420 ------
NM_024948chr10------1661
NM_024949chr464761 4701 4631 1284 403 115 --34800 1784 270 44624 4341 3500 990
NM_024954chr101214 ------
NM_024969chr22654 288 1270 ----
NM_024989chr267883 5556 5510 3226 663 415 47139 4997 3206 2576 13171 1838
NM_024991chr1043128 3045 2354 1007 --1847 --
NM_024993chr221437 529 --11152 --
NM_025054chr874111 3709 3017 2939 1055 896 378 1421 14075 --
NM_025073chr163897 3248 3174 1220 649 527 22888 1212 34498 3474 3189 --
NM_025074chr463016 2504 2140 852 487 227 12203 ----
NM_025076chr21439 ------
NM_025134chr1622015 678 ------
NM_025137chr15------189
NM_025146chr311010 --22718 660 1293
NM_025147chr24996 955 854 254 11008 ----
NM_025160chr154307 3927 3645 3185 1248 21648 584 14239 --
NM_025180chr373488 3413 2943 2250 823 435 230 1545 1910 --
NM_025181chr21186 ------
NM_025191chr1--13130 --12492
NM_025211chr9--187 ----
NM_025221chr431393 1189 346 ------
NM_025222chr332889 2746 1863 1514 ----
NM_025238chr15--31472 546 53 --11312
NM_025244chr2168 ------
NM_030579chr1673522 3038 2352 1478 1437 227 98 1653 13442 13322
NM_030625chr102486 32 ------
NM_030627chr531576 1345 210 ------
NM_030634chr172254 1813 1656 1610 952 429 353 11983 ----
NM_030637chr14167 ------
NM_030639chrX51781 1700 1524 1427 587 1691 ----
NM_030647chr745807 1402 971 257 21958 1913 35675 1663 657 --
NM_030648chr495577 5049 4848 4349 3929 3817 1822 1581 1571 21096 300 24624 1213 13979
NM_030650chr273952 3556 3309 3297 3200 2597 1203 13568 --22723 863
NM_030660chr14--188 11523 11080
NM_030664chr1042269 2009 1994 642 ------
NM_030667chr1221092 807 11188 --11035
NM_030668chr1221092 807 11188 --11035
NM_030669chr1221092 807 11188 --11035
NM_030670chr1222124 1839 12220 --12067
NM_030671chr1222124 1839 12220 --12067
NM_030751chr1031807 719 554 1455 ----
NM_030751chr1031807 719 554 1455 ----
NM_030755chr1431912 237 120 ------
NM_030762chr1241924 1753 1518 1383 --21259 775 --
NM_030763chrX1751 1271 ----
NM_030772chr11457 ------
NM_030780chr821068 143 21359 1116 --1311
NM_030782chr5----145 1105
NM_030786chr131686 556 197 1105 ----
NM_030791chr14--11854 1742 --
NM_030797chr22256 117 ------
NM_030799chr511645 22092 1515 11849 1863
NM_030802chr171339 1137 ----
NM_030806chr199119 8399 2818 1939 1545 1285 1056 524 518 57614 7506 7195 3510 2043 38372 6600 2470 21560 183
NM_030816chr163623 3159 2639 1336 1030 430 ----12478
NM_030820chr611006 ------
NM_030918chr145055 1487 335 167 25175 3627 14693 11078
NM_030920chr151411 723 700 516 376 11804 ----
NM_030922chr152789 347 ------
NM_030938chr1741069 371 354 176 1859 ----
NM_030939chr61447 1993 ----
NM_030949chr611022 1415 ----
NM_030964chr543602 3432 950 110 21426 235 1882 --
NM_031216chr1831729 867 253 ------
NM_031262chr91925 ------
NM_031263chr91982 ------
NM_031268chr1694382 3786 3563 1615 1570 695 267 92 34 --11198 --
NM_031284chr151896 ------
NM_031296chr44456 162 128 122 ------
NM_031305chr451537 1285 539 527 197 --11872 1723
NM_031314chr1421820 1492 1521 ----
NM_031362chr232233 1949 1737 32532 2321 2240 ----
NM_031365chr232369 2085 1873 32668 2457 2376 ----
NM_031366chr232369 2085 1873 32668 2457 2376 ----
NM_031369chr43552 220 92 ------
NM_031370chr43552 220 92 ------
NM_031371chr111350 ------
NM_031371chr111350 ------
NM_031372chr441579 1471 189 155 ------
NM_031407chrX------192
NM_031418chr112992 749 1482 11749 11122
NM_031427chr1425543 188 44784 4681 1280 861 1621 --
NM_031431chr1331427 1305 1198 1205 --21740 398
NM_031435chr1253369 3173 3107 1335 1291 2375 76 1227 --
NM_031442chrX42253 2043 1041 149 ----1764
NM_031445chr232515 2456 306 11364 1134 --
NM_031449chr741472 1357 227 213 11987 ----
NM_031459chr131640 1119 463 ----11027
NM_031461chr83889 842 233 1123 ----
NM_031463chr1651832 1762 723 624 325 --131 --
NM_031469chr653688 1538 674 414 123 23919 2493 11183 21509 1328
NM_031476chr1642699 723 316 72 1364 ----
NM_031483chr2032636 1438 1265 1301 1593 --
NM_031845chr233710 3452 2708 33333 2367 1019 --11252
NM_031847chr233710 3452 2708 33333 2367 1019 --11252
NM_031892chrX1398 2241 85 ----
NM_031916chr5--129 ----
NM_031922chr62550 354 ------
NM_031935chr11791 --1920 --
NM_031989chr121266 ------
NM_032025chr33488 205 104 1630 ----
NM_032027chr12286 279 ------
NM_032041chr842469 2257 1722 411 ----21907 86
NM_032102chr1132393 741 391 12808 1139 --
NM_032121chrX32524 1999 798 1182 ----
NM_032139chr191867 21103 356 ----
NM_032144chr211648 --1729 11792
NM_032145chr62772 109 ------
NM_032146chr32463 163 ------
NM_032153chr3--11953 12426 --
NM_032160chr1843306 1052 816 340 31394 369 236 ----
NM_032169chr33563 288 216 ------
NM_032181chr22642 95 ------
NM_032195chr213356 201 161 2409 364 ----
NM_032208chr233283 672 134 ----21294 186
NM_032211chr1061201 922 788 292 107 32 ------
NM_032221chr2011399 --11442 --
NM_032228chr1133503 3471 198 --190 --
NM_032229chr13------1465
NM_032231chr151254 1297 ----
NM_032239chr441172 979 929 157 ------
NM_032256chr123970 922 707 ------
NM_032268chr1643219 2687 2138 436 --13039 1603
NM_032290chr5------1129
NM_032291chr111645 1529 1392 --
NM_032321chr223059 305 12015 1479 12899
NM_032352chr141367 11378 --11283
NM_032373chr1075011 4530 3767 2102 1918 1092 146 12236 25509 555 15550
NM_032410chr83384 332 112 1218 ----
NM_032434chr241541 474 428 50 11443 ----
NM_032436chr131748 ----21002 780
NM_032438chr63568 559 518 --11512 --
NM_032439chr1021579 455 1284 ----
NM_032440chr1052430 2242 2171 2027 929 ------
NM_032446chr563850 3371 3295 1221 699 78 --21095 1054 --
NM_032457chr433909 2390 655 --13399 --
NM_032458chrX2593 33 3867 842 238 11109 1964
NM_032466chr811103 ------
NM_032499chr151594 21487 249 11721 --
NM_032505chr352754 2483 2420 2258 665 12164 11754 --
NM_032507chr61223 ------
NM_032521chr2022961 2019 ------
NM_032547chr421425 566 ----11217
NM_032550chr102286 33 ------
NM_032557chr42844 671 ------
NM_032558chr911111 ------
NM_032564chr112397 308 ----1122
NM_032574chr2272 33 1273 ----
NM_032578chr1041442 974 416 259 1599 ----
NM_032622chr42346 76 ------
NM_032632chr1421773 36 21352 63 11845 --
NM_032679chr19--1295 --11071
NM_032682chr331189 963 346 33645 1424 908 --23124 302
NM_032689chr19149 1649 --1281
NM_032711chr1731322 1147 893 ----14211
NM_032727chr1041409 1330 1123 1105 2416 302 ----
NM_032784chr61137 ------
NM_032801chr1162254 2182 2072 1587 819 67 --1762 --
NM_032810chr101564 21015 531 ----
NM_032826chr775163 4123 3762 3411 2190 391 87 13804 45148 4925 4425 1428 --
NM_032828chr19194 24961 1031 23474 3321 --
NM_032833chr122429 300 ------
NM_032837chr1762172 1692 1481 827 327 248 11863 ----
NM_032842chr751675 1634 1569 1293 415 ------
NM_032859chr1363901 3836 2886 2804 1362 609 ----33577 1564 287
NM_032870chr61548 ------
NM_032873chr1174262 4238 3322 1397 1024 644 591 ----14430
NM_032900chr1083550 2591 2375 1576 1209 1167 865 356 23669 2616 --2935 119
NM_032918chr123950 352 181 ------
NM_032936chr7170 ------
NM_032949chr131573 --1460 1357
NM_032961chr411386 ------
NM_032991chr421055 41 --11426 1390
NM_033012chr131885 --1741 1852
NM_033020chr134123 3075 931 --1187 13423
NM_033030chr22512 239 11622 11374 --
NM_033031chrX1166 ------
NM_033044chr12834 386 ------
NM_033089chr2041444 1432 1146 1108 158 ----
NM_033103chr1911183 ------
NM_033105chr82456 144 ------
NM_033116chr141237 ------
NM_033121chr1241797 1530 524 64 --11456 11225
NM_033124chr121111 ------
NM_033132chr1372241 1680 1537 522 328 108 76 --1562 --
NM_033143chr464632 3904 1438 1426 1037 176 ------
NM_033150chr12--1380 ----
NM_033181chr643499 3086 545 126 --21395 151 --
NM_033224chr777289 7224 6027 5530 3153 2648 723 --11430 --
NM_033225chr822842 1036 --22430 2031 13138
NM_033227chr51504 ----1203
NM_033228chr51544 ----1243
NM_033261chr101158 ------
NM_033274chr553633 3102 2829 1413 1275 22392 716 ----
NM_033285chr853654 3181 1353 964 498 ----14379
NM_033290chrX63737 2557 2510 1321 1135 616 1539 --11442
NM_033305chr9--1123 1952 1513
NM_033309chr1641143 1122 457 67 ------
NM_033326chr1142020 977 963 743 22488 565 ----
NM_033331chr943543 3256 2790 2381 21144 417 1789 --
NM_033360chr12114618 4335 3699 3210 2897 2878 1852 1392 1200 625 307 --11799 13898
NM_033375chr1731096 254 242 21253 261 11540 --
NM_033389chr1743854 1636 1197 1152 21385 814 11499 --
NM_033394chr231276 307 286 1197 ----
NM_033425chr11--31286 614 112 11131 12511
NM_033429chr1532440 1114 1049 43111 1064 757 561 --22066 1092
NM_033480chr622392 920 ------
NM_033481chr622392 920 ------
NM_033495chrX2888 312 2709 430 ----
NM_033503chr1533630 1393 853 --11097 1216
NM_033505chr2126619 6585 6537 5504 4857 4364 2709 2357 2164 1678 1502 473 --15603 1502
NM_033512chr832834 2542 444 1892 1998 --
NM_033551chr533240 2701 532 22885 2568 --13060
NM_033632chr41577 --2571 561 --
NM_033642chrX31011 211 97 1250 ----
NM_033644chr532469 1609 959 1428 32459 2319 2227 --
NM_033645chr532469 1609 959 1428 32459 2319 2227 --
NM_033656chr2195905 5800 5054 4788 4711 4138 4015 3660 636 34452 1893 203 11866 23898 362
NM_044472chr11545 ------
NM_052811chr1314497 14284 35255 3212 1768 --
NM_052827chr1231102 1004 312 11039 1763 --
NM_052840chr1521043 277 ----11151
NM_052867chr1341091 945 355 111 1494 ----
NM_052879chr1232879 568 300 ----23993 2943
NM_052885chr1284347 4186 4109 3828 3624 1768 1498 353 44953 4043 845 427 ----
NM_052898chr81244 1424 11770 --
NM_052900chr821285 644 174 --11223
NM_052901chr951763 1489 1142 296 86 ------
NM_052904chr631115 234 190 ------
NM_052905chr211338 ------
NM_052917chr253134 2543 1224 1094 328 --13221 --
NM_052918chr1041196 1170 1077 971 --43335 2828 134 60 --
NM_052927chr542067 684 523 497 ------
NM_052937chr822084 1780 ----1616
NM_052954chr2162233 1819 1585 1416 802 29 ------
NM_053016chr987407 7115 6450 2675 1993 980 637 482 27030 1674 ----
NM_053023chr1132221 2072 898 ------
NM_053024chr321313 567 ------
NM_053064chr1411071 --12734 --
NM_053281chrX------1416
NM_054016chr1----2470 374 --
NM_054016chr1----2470 374 --
NM_054016chr1----2470 374 --
NM_054026chr8----1906 --
NM_057158chr82739 666 1636 1849 --
NM_057175chr422571 62 1222 12465 11688
NM_057178chr1722019 486 12358 --1475
NM_057749chr821161 338 1957 ----
NM_058170chr11223 11634 1552 --
NM_058191chr211850 ------
NM_058237chr143904 815 790 ------
NM_058241chr242363 2207 1787 578 --21681 1638 --
NM_058241chr242363 2207 1787 578 --21681 1638 --
NM_078625chr62860 201 1982 --1844
NM_080546chr91603 --11540 21647 204
NM_080597chr1831041 288 203 11108 ----
NM_080629chr111454 ----11150
NM_080630chr111454 ----11150
NM_080632chrX2829 650 1151 1285 --
NM_080645chr611729 ------
NM_080669chr1753725 1814 1564 593 466 34816 4003 3960 ----
NM_080671chr242104 1881 407 308 22005 369 ----
NM_080676chr2072523 2300 2041 1198 1156 1054 815 13152 ----
NM_080717chr1231566 1102 1017 --11518 --
NM_080743chr622551 2036 ------
NM_080759chr1331949 1788 901 ------
NM_080760chr1331949 1788 901 ------
NM_080832chrX41156 345 190 85 ------
NM_080867chr1465012 4878 4792 3915 3596 724 1857 ----
NM_080872chr843947 3801 1454 406 23546 2967 33346 742 484 --
NM_080874chr411759 185 ----
NM_080927chr343277 2926 2154 157 ------
NM_100264chr101656 ------
NM_100486chr101656 ------
NM_130385chr1141294 1245 910 767 --12176 --
NM_130391chr923338 886 12387 --21116 350
NM_130392chr923338 886 12387 --21116 350
NM_130393chr923338 886 12387 --21116 350
NM_130435chr1042865 2448 1888 230 12505 ----
NM_130436chr2152331 2158 1917 602 255 --1336 11779
NM_130438chr2172908 2735 2494 1179 832 459 348 --1913 12356
NM_130439chr1021890 653 ------
NM_130439chr1021890 653 ------
NM_130442chr72856 271 ----11053
NM_130797chr731665 1295 494 ------
NM_130798chr1531477 1218 1087 ----1316
NM_130808chr3146 ----1321
NM_130811chr20--1856 ----
NM_130831chr3--1457 ----
NM_130832chr3--1457 ----
NM_130833chr3--1457 ----
NM_130834chr3--1457 ----
NM_130835chr3--1457 ----
NM_130836chr3--1457 ----
NM_130837chr3--1457 ----
NM_130838chr1521396 425 11626 ----
NM_130839chr1521396 425 11626 ----
NM_130846chr1211087 --1832 --
NM_130847chr1195206 5174 5057 4741 3895 2229 1297 842 467 --15683 --
NM_133170chr2097892 7256 6847 5480 5363 5088 1625 1325 182 26929 944 11307 14990
NM_133264chr1731479 1254 973 --1486 13470
NM_133265chrX43334 1312 1306 1272 --1956 22512 1048
NM_133329chr251617 1611 1336 598 101 ------
NM_133330chr431162 674 279 --13199 22907 871
NM_133331chr431162 674 279 --13199 22907 871
NM_133334chr4106373 5275 4700 4668 2189 2059 2033 1953 1806 1038 14316 46094 4224 1926 453 15450
NM_133335chr431162 674 279 --13199 22907 871
NM_133367chr642485 2233 2171 760 11333 ----
NM_133370chr453258 3166 2570 741 584 --13316 --
NM_133372chr522966 327 ------
NM_133378chr23915 742 192 1732 ----
NM_133432chr23915 742 192 1732 ----
NM_133437chr23915 742 192 1732 ----
NM_133468chr74670 633 339 206 --1616 --
NM_133496chr144049 3369 1426 1328 --43277 2771 1048 628 --
NM_133503chr121290 1777 --159
NM_133504chr121290 1777 --159
NM_133505chr121290 1777 --159
NM_133506chr121290 1777 --159
NM_133631chr351644 1323 456 361 328 ------
NM_133646chr273941 3899 3745 3721 3686 1933 1622 15398 --11334
NM_134265chr17------21125 1024
NM_134428chr91262 ----196
NM_134442chr231304 1216 476 ----1462
NM_134447chr191220 ------
NM_134470chr31750 ----1645
NM_138270chrX5846 840 335 184 117 12248 ----
NM_138285chr2125 --1544 --
NM_138292chr1162913 2851 2741 2513 774 73 13340 23116 2173 --
NM_138333chr921936 252 --2435 77 1978
NM_138335chr42862 111 ------
NM_138340chr18--1494 ----
NM_138426chr742364 2301 1754 761 ------
NM_138437chrX------1126
NM_138459chr613018 12552 --23139 3035
NM_138468chr264786 2075 1752 1315 814 316 35167 2175 290 22546 697 --
NM_138473chr1265020 4338 3553 3504 793 723 21997 1040 11258 --
NM_138558chr131126 1082 439 ----11151
NM_138559chr2----11225 --
NM_138565chr111957 --1205 2981 285
NM_138569chr6268 58 ------
NM_138576chr1423864 1100 --34067 1506 48 --
NM_138638chr1452339 2140 1532 547 173 ------
NM_138639chr19------1124
NM_138713chr16105187 3253 2943 2930 2074 1997 1458 1371 1185 342 26698 5532 37878 6068 1840 --
NM_138714chr16105187 3253 2943 2930 2074 1997 1458 1371 1185 342 26698 5532 37878 6068 1840 --
NM_138729chr1137 ------
NM_138730chr62112 32 ------
NM_138731chr1471699 1392 1365 952 856 704 556 12922 23148 2869 --
NM_138766chr5--1458 ----
NM_138773chr52828 54 ----1353
NM_138782chr521876 1811 ----11804
NM_138821chr5--1458 ----
NM_138822chr5--1458 ----
NM_138931chr3--1285 --1421
NM_138969chr841406 458 247 173 11448 ----
NM_138970chr1421529 687 11546 ----
NM_138971chr1153689 2992 2806 2681 472 11060 ----
NM_138971chr1153689 2992 2806 2681 472 11060 ----
NM_138972chr1153689 2992 2806 2681 472 11060 ----
NM_138972chr1153689 2992 2806 2681 472 11060 ----
NM_138973chr1153689 2992 2806 2681 472 11060 ----
NM_138973chr1153689 2992 2806 2681 472 11060 ----
NM_139012chr632216 805 373 ------
NM_139014chr632296 885 453 ------
NM_139015chr1211711 11281 11666 --
NM_139046chr10260 40 ------
NM_139062chr17------1471
NM_139072chr21586 --2873 744 --
NM_139168chr531759 1378 257 --1280 --
NM_139207chr1231686 232 186 ----12056
NM_139244chr61209 1338 --1662
NM_139276chr17----12062 --
NM_139279chr223475 1383 1901 12584 --
NM_139312chr1031351 264 141 --1131 --
NM_139321chr2041269 1245 1043 607 11446 --13482
NM_144498chr2052242 2214 1651 786 541 ----1171
NM_144567chr122677 1915 22552 2532 ----
NM_144570chr1642749 2732 2294 724 22542 464 ----
NM_144571chr4126534 6108 5688 5173 4600 2721 1853 1678 899 862 771 37 25507 1118 --15643
NM_144578chr1484545 4092 3894 3842 2184 1598 1579 543 11589 34217 4111 3784 35009 2120 1839
NM_144590chr1032951 2326 2100 --1913 12049
NM_144595chr133779 713 310 ------
NM_144599chr1545352 5163 2000 1608 25323 5127 ----
NM_144632chr272167 2161 844 416 370 211 115 --11544 12254
NM_144654chr92324 295 ------
NM_144664chr1141930 819 689 378 1943 1239 22605 1859
NM_144665chr11--1110 ----
NM_144721chr442150 1107 232 35 1295 12653 --
NM_144724chr51751 ------
NM_144726chr51204 ------
NM_144767chr1544569 1110 1000 888 24446 463 13067 14035
NM_144778chr133857 98 26 1114 --22400 819
NM_144949chr212577 12409 ----
NM_144963chr81698 --12682 12185
NM_144973chr12--14395 25061 5025 13732
NM_144981chr11195 ------
NM_144984chr1011167 11287 2990 577 --
NM_145005chr92993 197 ------
NM_145021chr103730 304 64 1844 ----
NM_145037chr31269 ----1319
NM_145049chr52884 770 1180 ----
NM_145053chr112594 446 ------
NM_145055chr1831370 1158 77 12760 1325 --
NM_145115chr742052 2023 801 768 2294 197 ----
NM_145117chr1153218 2738 2365 2322 529 --13239 --
NM_145159chr141219 ------
NM_145175chr221437 1103 ------
NM_145203chr132683 321 ------
NM_145206chr1052787 2722 2523 374 318 23177 831 23263 261 --
NM_145247chr101101 ----1438
NM_145251chr1411361 --1413 1424
NM_145259chr256273 5410 2427 1919 76 36480 5199 2769 ----
NM_145263chr411824 2666 108 ----
NM_145274chr172720 217 ------
NM_145284chrX42263 1014 952 714 11919 ----
NM_145307chr1074022 3602 2941 1788 1680 1447 740 ------
NM_145313chr1011355 ------
NM_145341chr1011746 1400 ----
NM_145686chr253364 2905 2774 2375 1083 --23251 2758 13267
NM_145687chr253364 2905 2774 2375 1083 --23251 2758 13267
NM_145690chr841505 1462 641 58 ------
NM_145728chr1551815 909 555 404 48 32150 1798 348 --32468 2194 523
NM_145735chr1352860 2557 2212 1088 159 1381 --12606
NM_145753chr311320 --11535 11124
NM_145800chrX21059 1031 ------
NM_145802chrX21008 980 ------
NM_145893chr1641810 1731 1394 28 --1690 --
NM_147147chr634237 3964 3329 42931 2608 1343 1328 ----
NM_147156chr10144 --11257 --
NM_147175chrX32094 1484 1439 1587 ----
NM_147181chr431393 1189 346 ------
NM_147182chr431393 1189 346 ------
NM_147183chr431393 1189 346 ------
NM_147189chr81552 1210 1140 11623
NM_147223chr232283 2180 911 11863 --12442
NM_147233chr232100 1997 728 11680 --12259
NM_148174chr842006 1894 1661 1435 22051 1815 ----
NM_148894chr41405 --1977 11096
NM_152236chr221183 ------
NM_152261chr1231945 352 42 ----160
NM_152265chr131441 1327 570 ------
NM_152277chr531545 1333 60 --11869 --
NM_152278chrX288 46 --2494 142 1417
NM_152280chr152988 2401 1332 967 653 13533 --12911
NM_152282chr341344 1303 1216 36 1261 1291 --
NM_152283chr521117 179 ------
NM_152291chr41929 1911 11092 --
NM_152298chr1--1748 ----
NM_152309chr1052001 1908 1741 376 288 12078 --1247
NM_152317chr123207 177 164 ------
NM_152334chr152819 572 1502 ----
NM_152342chr16----192 --
NM_152352chr1882520 2483 2383 2234 906 823 644 215 --22909 2395 1101
NM_152388chr253838 2924 2521 1428 849 11192 --13409
NM_152400chr421365 711 1275 ----
NM_152402chr41508 1225 ----
NM_152409chr5--13465 13058 12361
NM_152410chr61419 1116 ----
NM_152414chr831526 1176 1158 ------
NM_152415chr82170 26 ------
NM_152417chr821038 826 2256 183 ----
NM_152422chr941737 677 496 208 31486 1479 713 1699 --
NM_152424chrX114727 3773 3359 3316 3294 3234 3076 1821 1705 796 565 12971 21525 311 --
NM_152441chr121276 ------
NM_152446chr141912 --1390 1127
NM_152450chr1531566 1480 119 11461 41869 1360 606 39 --
NM_152470chr1813779 --12705 --
NM_152520chr21786 --1834 --
NM_152522chr2----1377 --
NM_152523chr21588 --1180 1750
NM_152538chr32654 247 1358 11649 --
NM_152549chr52478 160 ------
NM_152556chr72303 133 22273 1582 12494 1682
NM_152570chr9----134 --
NM_152581chrX1970 1579 ----
NM_152588chr1231350 1186 546 ------
NM_152622chr573411 2890 2248 2219 932 746 428 --1833 --
NM_152624chr555925 5691 1544 974 317 22921 2660 --16960
NM_152629chr983679 3616 2750 994 597 543 294 50 23744 960 ----
NM_152641chr1222601 731 --1238 --
NM_152660chr1----1770 --
NM_152666chr11834 ------
NM_152667chr2031250 1120 335 ------
NM_152678chr342376 640 594 111 12157 ----
NM_152688chr61689 --1700 2678 397
NM_152692chrX151 ------
NM_152695chrX41836 1807 1792 1440 ----1475
NM_152696chr1--132 ----
NM_152699chr363626 3233 2878 2432 1485 869 ------
NM_152733chr666297 5858 2383 1689 834 385 35514 3972 1355 11800 --
NM_152734chr665278 5201 4906 994 608 240 34621 3423 944 11282 --
NM_152738chr62326 38 --1381 --
NM_152745chr71439 --1121 --
NM_152753chr641515 709 523 425 1493 --21503 790
NM_152754chr732656 971 287 12793 1108 --
NM_152756chr534308 3853 3257 13828 ----
NM_152758chr831205 866 742 ------
NM_152774chr711681 --11965 --
NM_152787chrX53165 3154 2809 2662 2427 1887 23033 864 11172
NM_152789chr721419 507 --11033 11153
NM_152793chr795194 4979 4592 3947 3861 1224 676 590 246 24357 3404 --15065
NM_152835chr162641 2627 2588 2450 2361 917 ----12870
NM_152836chr811553 11495 --11691
NM_152837chr811553 11495 --11691
NM_152838chr2053381 2424 2417 1276 726 --33479 3459 371 23561 3006
NM_152862chr2154 ------
NM_152902chr121630 472 ----11985
NM_152924chr1562723 2355 2256 1658 1497 341 ------
NM_152945chr2--1192 ----
NM_152989chr1271766 1712 1587 1279 641 375 251 1722 11701 --
NM_152994chr21621 ----1406
NM_152996chr142081 1822 73 23 21414 778 11358 1451
NM_152999chr794910 3529 3138 1859 1787 1673 1183 884 846 190 34783 4230 183 --
NM_153013chr541978 1692 522 376 ------
NM_153020chr621359 468 ------
NM_153035chr132698 306 258 ------
NM_153050chr22114756 4738 4501 3887 3601 3432 1780 1414 1120 420 302 --1284 11987
NM_153051chr22114756 4738 4501 3887 3601 3432 1780 1414 1120 420 302 --1284 11987
NM_153184chr32606 386 11581 --21283 1225
NM_153186chr92838 47 1690 ----
NM_153188chr575506 4336 4119 3501 1927 1361 173 24076 677 14879 --
NM_153207chr1223650 540 11225 13304 --
NM_153235chr651788 938 922 624 163 197 21687 174 --
NM_153251chr131253 ------
NM_153262chr112371 13062 12076 1234
NM_153332chr83969 188 40 ----22844 2798
NM_153341chr1--2309 272 ----
NM_153365chr432483 911 311 3610 460 77 2888 60 11789
NM_153456chr13126358 6265 5957 5726 4714 4187 3895 3847 2457 1969 979 607 24406 4157 21287 767 15907
NM_153499chr1242581 2445 2165 1137 1395 12782 1885
NM_153500chr1242581 2445 2165 1137 1395 12782 1885
NM_153607chr562927 2902 946 498 314 44 12704 ----
NM_153616chr1521487 157 2805 428 1868 1486
NM_153617chr1521487 157 2805 428 1868 1486
NM_153618chr1521487 157 2805 428 1868 1486
NM_153619chr1562725 2608 2571 1395 243 193 ----1164
NM_153620chr731776 1130 606 1726 1711 --
NM_153633chr121145 ------
NM_153634chr12125 11288 ----
NM_153645chr2243262 2910 2066 171 12766 2741 32 --
NM_153646chr1452576 953 870 280 263 ------
NM_153647chr1452576 953 870 280 263 ------
NM_153648chr1452576 953 870 280 263 ------
NM_153649chr132220 1761 820 ------
NM_153689chr232295 816 100 ------
NM_153694chr121255 ------
NM_153704chr82291 75 ------
NM_153712chr233291 3008 2952 13108 ----
NM_153715chr72834 273 1239 11137 --
NM_153810chr1094858 4438 4127 1713 1554 1418 718 557 543 --14738 1643
NM_153812chr142345 1497 346 306 1210 2316 193 11791
NM_170587chr81268 1761 1703 --
NM_170607chr17------11098
NM_170665chr1284501 2936 1693 1671 1032 520 492 326 14495 1784 11650
NM_170674chr1531265 449 55 --2986 181 11371
NM_170675chr152941 125 ----11047
NM_170676chr152941 125 ----11047
NM_170677chr1531265 449 55 --2986 181 11371
NM_170679chr511013 ------
NM_170692chr12302 95 ------
NM_170706chr144334 3089 2978 46 13985 33316 1549 1180 --
NM_170709chr82397 284 12325 ----
NM_170710chr422748 2432 23127 91 ----
NM_170721chr1721179 35 ------
NM_170724chr631103 1000 263 11014 ----
NM_170731chr1142335 507 494 251 --1258 --
NM_170732chr1142335 507 494 251 --1258 --
NM_170733chr1142335 507 494 251 --1258 --
NM_170734chr1142335 507 494 251 --1258 --
NM_170735chr1142335 507 494 251 --1258 --
NM_170750chrX1837 ------
NM_170775chr52209 38 ------
NM_170782chr1175 ----1512
NM_171825chr562389 2098 1106 985 964 232 22612 2527 --13006
NM_172016chr641220 1145 1128 945 11247 ----
NM_172058chr851530 1451 1360 1354 1271 ------
NM_172059chr851530 1451 1360 1354 1271 ------
NM_172060chr851530 1451 1360 1354 1271 ------
NM_172069chr231594 896 272 1410 1202 --
NM_172070chr251718 1615 1522 737 398 12012 ----
NM_172071chr126760 2626 1933 17214 15167
NM_172103chr622293 1870 ------
NM_172105chr622293 1870 ------
NM_172127chr452082 1778 1661 624 351 145 ----
NM_172128chr452038 1734 1617 580 307 ------
NM_172164chr1--1748 ----
NM_172178chr12147 1257 --1348
NM_172193chr1411342 1380 ----
NM_172216chr1242483 2347 2067 1039 1297 12684 1787
NM_172218chr8------1602
NM_172226chr1242581 2445 2165 1137 1395 12782 1885
NM_172231chr19192 ------
NM_172315chr1531265 449 55 --2986 181 11371
NM_172316chr1531265 449 55 --2986 181 11371
NM_172344chr251617 1611 1336 598 101 ------
NM_172350chr121815 373 --122 11710
NM_172359chr121819 377 --126 11714
NM_172373chr131261 1947 1939 --
NM_173075chr421772 164 11437 11389 11506
NM_173076chr231035 237 195 --1680 --
NM_173078chrX1152 ------
NM_173084chr32928 803 22226 161 12275 149
NM_173156chr121603 117 ------
NM_173167chr1762659 2488 2219 1857 1021 226 11732 ----
NM_173171chr251140 1097 327 182 52 ------
NM_173172chr261448 1405 1029 635 490 360 ------
NM_173173chr251140 1097 327 182 52 ------
NM_173198chr922035 51 22608 1846 1279 --
NM_173200chr922035 51 22608 1846 1279 --
NM_173214chr16105187 3253 2943 2930 2074 1997 1458 1371 1185 342 26698 5532 37878 6068 1840 --
NM_173216chr332695 2646 683 32719 1684 316 ----
NM_173217chr332695 2646 683 32719 1684 316 ----
NM_173355chr21378 1112 ----
NM_173454chr1541167 1156 323 183 21081 785 ----
NM_173468chr495702 5695 5107 1637 1480 1315 791 311 172 12141 --1838
NM_173469chr1511230 --11347 1494
NM_173470chrX42500 2358 829 651 22492 2270 1521 --
NM_173472chr3--162 ----
NM_173495chrX41914 802 795 401 --12547 22276 120
NM_173505chr182945 292 1440 ----
NM_173510chr2222545 1013 --2501 182 129
NM_173511chr263556 3287 3211 2744 1335 892 22751 709 53387 3112 1208 1096 359 --
NM_173514chr51584 ------
NM_173517chr72415 319 ------
NM_173519chr832047 631 434 ------
NM_173552chr382277 2115 2103 1716 1678 715 529 398 1901 --11905
NM_173554chr10--129 ----
NM_173557chr184741 651 612 34 --1502 --
NM_173576chr1062310 2275 2063 1936 1778 319 11763 ----
NM_173582chr1156191 6097 4358 4243 2040 15462 ----
NM_173591chr122895 64 --11001 1830
NM_173595chr1285090 4266 1698 853 382 318 240 157 14559 11708 1262
NM_173602chr1233641 3068 397 13660 --21449 1207
NM_173631chr1941343 943 543 368 ------
NM_173642chr1169166 7887 7844 7830 7332 7109 6361 6036 5896 5757 5580 3268 2442 1344 846 662 36717 6521 6384 --23353 2254
NM_173645chr22476 454 ------
NM_173647chr21980 ------
NM_173654chr32895 189 1118 ----
NM_173666chr511163 ----198
NM_173694chrX----1406 1616
NM_173698chrX31393 201 97 11541 2508 33 1566
NM_173797chr51329 31346 1267 1063 --1414
NM_173808chr124424 1011 ----1670
NM_173809chr1031233 411 243 21442 1086 11354 --
NM_173822chr221382 1336 12085 --11917
NM_173829chr545135 4783 4710 75 25495 1085 ----
NM_173848chr81193 --3813 709 237 --
NM_173851chr883286 1599 1517 1218 1018 787 583 463 13540 23463 1107 --
NM_174890chr101711 ----1104
NM_174911chr853960 1565 1213 657 90 23151 3082 1773 --
NM_174929chr741472 1357 227 213 11987 ----
NM_174938chr9194 ------
NM_175061chr732161 648 23 2548 233 ----
NM_175607chr331517 1400 1390 ------
NM_175612chr331517 1400 1390 ------
NM_175623chr1287639 6984 5791 4842 4836 1290 1282 689 1730 16205 1241
NM_175634chr81398 --1373 --
NM_175635chr81398 --1373 --
NM_175636chr81398 --1373 --
NM_175733chr112239 28 2680 437 ----
NM_175747chr6124 ----1307
NM_175852chr182544 2488 1992 1973 1948 1015 934 655 ------
NM_175854chr1352684 2265 1747 408 337 ------
NM_175861chr1245783 4357 2098 1915 24790 4741 21672 553 11392
NM_175863chr61379 ------
NM_175873chr51400 --11241 1553
NM_175876chr121023 237 11768 21077 898 22608 1720
NM_175931chr162774 41 1102 --12100
NM_176814chr71234 11142 ----
NM_176815chr362534 721 551 284 268 179 1828 --12156
NM_177424chr1------22074 65
NM_177538chr278892 8419 7254 5782 5754 3251 2298 --18504 --
NM_177553chr111832 ------
NM_177968chr221451 180 --1217 --
NM_177976chr32463 163 ------
NM_177985chr211987 12244 ----
NM_177990chr20--11580 11562 --
NM_177995chr941737 677 496 208 31486 1479 713 1699 --
NM_178010chr1271766 1712 1587 1279 641 375 251 1722 11701 --
NM_178011chr1052620 1993 1299 924 29 ------
NM_178031chr111166 ------
NM_178123chr22313 155 --151 --
NM_178151chrX67724 6876 5490 2681 1491 560 36565 6499 1114 27061 6206 --
NM_178152chrX67724 6876 5490 2681 1491 560 36565 6499 1114 27061 6206 --
NM_178153chrX67724 6876 5490 2681 1491 560 36565 6499 1114 27061 6206 --
NM_178171chr171701 ------
NM_178190chr11295 ------
NM_178232chr151589 ------
NM_178313chr261984 1833 1792 1465 1370 643 1861 ----
NM_178314chr12----1847 --
NM_178423chr7--11295 --11148
NM_178424chr5----1418 1482
NM_178425chr7--11295 --11148
NM_178505chr1083627 3523 3264 3230 2619 906 377 193 12366 1810 --
NM_178509chr1744085 3697 2917 193 33987 3465 2600 23037 2628 11577
NM_178554chr353435 3149 2729 1284 1009 --13247 --
NM_178566chr921509 1434 ------
NM_178578chr2061897 851 795 538 393 374 ------
NM_178812chr821437 1400 ------
NM_178815chr1042139 1092 290 74 12037 12113 --
NM_178818chr1622492 106 ------
NM_178864chr11142 ------
NM_181054chr1431194 950 480 --1904 --
NM_181077chr1532171 1849 706 --32197 1830 410 --
NM_181265chr422748 2432 23127 91 ----
NM_181310chr621906 1875 ------
NM_181351chr1132219 1926 707 22261 617 12251 --
NM_181354chr821461 1062 --11321 1495
NM_181358chr121308 1116 12588 12820 13783
NM_181361chr321162 353 --1295 --
NM_181442chr20--1747 ----
NM_181443chr2042171 1793 1167 740 ------
NM_181453chr221527 697 1241 --185
NM_181459chr21966 --2438 412 --
NM_181460chr211013 --2485 459 --
NM_181481chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_181482chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_181483chr1896671 6637 6451 5865 5350 4574 4424 2097 511 --14669 --
NM_181486chr1231566 1102 1017 --11518 --
NM_181504chr573708 3478 3382 2728 1509 1417 969 23600 616 --1635
NM_181523chr573708 3478 3382 2728 1509 1417 969 23600 616 --1635
NM_181524chr573708 3478 3382 2728 1509 1417 969 23600 616 --1635
NM_181645chr111695 2616 199 ----
NM_181702chr83790 406 214 ------
NM_181706chr1142240 1716 207 94 22264 1773 --1397
NM_181712chr131742 1315 727 1123 ----
NM_181714chr611674 51687 1515 791 359 90 21413 181 --
NM_181723chr842117 2068 791 785 ----1656
NM_181746chr11142 ------
NM_181762chrX21061 59 --1135 --
NM_181777chrX21061 59 --1135 --
NM_181782chr621674 404 1559 ----
NM_181784chr252298 2252 2077 1638 871 ------
NM_181828chr2263445 2554 1533 1256 1056 731 13729 13172 13551
NM_181829chr2263445 2554 1533 1256 1056 731 13729 13172 13551
NM_181830chr2263445 2554 1533 1256 1056 731 13729 13172 13551
NM_181836chr522111 31 --12363 --
NM_181839chr821401 1368 ------
NM_181886chr441289 966 565 391 ------
NM_181887chr441289 966 565 391 ------
NM_181888chr441289 966 565 391 ------
NM_181889chr441289 966 565 391 ------
NM_181890chr441289 966 565 391 ------
NM_181891chr441289 966 565 391 ------
NM_181892chr431336 1013 438 ------
NM_181893chr441289 966 565 391 ------
NM_181897chr322581 2496 32422 572 485 --12722
NM_182314chrX41514 1362 233 111 1272 ----
NM_182485chr463699 3258 3076 2422 1194 460 --13153 13317
NM_182487chr983255 3133 2974 1698 1661 1053 831 198 13739 11082 --
NM_182511chr1831355 1041 569 ------
NM_182551chr263366 3226 2304 1243 1173 163 12421 ----
NM_182641chr1741992 1579 782 441 --2716 213 --
NM_182646chr463699 3258 3076 2422 1194 460 --13153 13317
NM_182648chr141177 ------
NM_182666chr35680 524 446 208 168 ------
NM_182678chr21446 ------
NM_182715chr72928 339 --31247 105 56 --
NM_182717chr1021352 67 1270 1208 --
NM_182720chr1021352 67 1270 1208 --
NM_182721chr1021352 67 1270 1208 --
NM_182722chr1021352 67 1270 1208 --
NM_182723chr1021352 67 1270 1208 --
NM_182756chr23609 175 96 271 48 2634 406 --
NM_182757chr673188 2978 2613 2472 2296 353 140 13253 22357 96 12385
NM_182763chr132703 2136 402 32282 1824 817 --12744
NM_182765chr101285 ------
NM_182767chr1212039 11974 21737 239 12006
NM_182789chr531017 789 287 2905 159 ----
NM_182797chr2021192 289 1623 11819 --
NM_182800chr7196 ------
NM_182830chr143872 806 419 ----1346
NM_182853chr1021352 67 1270 1208 --
NM_182898chr755598 4918 1744 1121 383 16016 25541 594 --
NM_182899chr755598 4918 1744 1121 383 16016 25541 594 --
NM_182907chr622351 1824 --1592 12415
NM_182911chr2168 ------
NM_182918chr2111136 2292 201 --1945
NM_182948chr142841 2281 2265 136 --1405 1487
NM_182964chr1153218 2738 2365 2322 529 --13239 --
NM_182972chr132803 2717 1098 --1492 --
NM_182976chr1--1796 ----
NM_183004chr1423616 2844 1407 13968 11045
NM_183011chr1021352 67 1270 1208 --
NM_183012chr1021352 67 1270 1208 --
NM_183013chr1021352 67 1270 1208 --
NM_183043chr133274 268 223 ------
NM_183044chr133274 268 223 ------
NM_183061chr31130 ------
NM_183323chr531017 789 287 2905 159 ----
NM_183353chrX1862 --1277 --
NM_183380chr62773 173 ------
NM_183381chr33961 788 167 1802 ----
NM_183383chr33961 788 167 1802 ----
NM_183384chr33961 788 167 1802 ----
NM_183398chr51510 ----11344
NM_183399chr51510 ----11344
NM_183400chr51510 ----11344
NM_183401chr51510 ----11344
NM_183416chr151919 1821 1768 805 685 ------
NM_194071chr754679 3605 1925 86 66 1302 23614 749 --
NM_194247chr264480 4280 3247 1686 247 54 ----23760 519
NM_194278chr1453724 3109 2562 1313 1121 13547 ----
NM_194282chr421233 538 ----1746
NM_194283chr533567 3367 201 33928 3519 2651 11668 --
NM_194285chr1132531 326 250 22985 2538 1459 --
NM_194286chr1295700 5645 5398 5260 4836 1803 1215 986 45 --21101 937 --
NM_194291chr852505 2313 2240 1138 893 12088 ----
NM_194292chr151621 1357 649 572 65 --11169 --
NM_194298chr1051745 794 461 331 29 21930 1463 11822 --
NM_194314chr143701 3477 238 44 45301 4470 3670 992 11708 --
NM_194317chr242703 1840 1828 138 1984 --12182
NM_194356chr1242357 850 519 38 ------
NM_194434chr1864686 4197 4151 3901 1517 425 24445 1725 34582 489 401 --
NM_194449chr18------1369
NM_197941chr552945 2575 2085 755 31 1227 ----
NM_197962chr1123 ------
NM_197968chr132600 166 ------
NM_197970chr22512 239 11622 11374 --
NM_198040chr12950 451 ------
NM_198081chr642596 2210 2137 614 32829 2073 927 --1215
NM_198123chr821285 644 174 --11223
NM_198124chr821285 644 174 --11223
NM_198128chr1852129 1908 1860 1812 945 1457 ----
NM_198150chr531401 1395 462 --21514 1169 --
NM_198158chr322867 2369 12644 --22703 2486
NM_198159chr322867 2369 12644 --22703 2486
NM_198177chr322867 2369 12644 --22703 2486
NM_198178chr322867 2369 12644 --22703 2486
NM_198181chr1532555 1979 716 --12581 --
NM_198188chr9125 ------
NM_198195chr33622 95 56 ------
NM_198204chr17------11098
NM_198205chr17------11098
NM_198215chr1031403 564 239 --174 --
NM_198225chr1031644 1443 625 ----11864
NM_198261chr12------1719
NM_198262chr12------1719
NM_198268chr121308 1116 12588 12820 13783
NM_198269chr121308 1116 12588 12820 13783
NM_198270chrX1115 ----13111
NM_198281chr462498 2383 2374 2149 906 130 165 ----
NM_198320chr1213177 --11626 --
NM_198321chr562644 2448 2082 732 636 288 --12753 --
NM_198336chr72544 228 --11699 --
NM_198337chr72679 363 --11834 --
NM_198391chr2021251 131 11072 ----
NM_198399chr311621 ------
NM_198400chr1552329 2063 1973 1960 350 21967 1930 11818 --
NM_198401chr81319 --11286 --
NM_198404chr132786 265 ------
NM_198465chrX32945 1811 578 12139 22262 992 --
NM_198484chr376370 4797 4107 2188 2136 1712 1410 35531 5012 4146 ----
NM_198485chr352453 1699 629 603 504 1695 ----
NM_198513chr841740 1496 557 450 --11399 --
NM_198521chr12--1149 ----
NM_198569chr652686 2492 2402 2187 190 ------
NM_198570chr7----1352 --
NM_198581chr281892 1807 961 760 456 420 332 294 11500 16333 36925 1947 655
NM_198715chr176243 6158 5384 4680 4180 1397 1179 45892 4778 1430 164 35329 1816 667 15458
NM_198793chr363767 3708 1611 1459 613 124 11601 23901 429 --
NM_198799chr201562 ------
NM_198829chr73490 349 121 --11469 21213 315
NM_198830chr171624 ------
NM_198859chr395023 4216 4123 4112 3889 3700 1877 1871 280 25074 1744 1797 --
NM_198896chr1111792 12230 1877 --
NM_198904chr531801 1735 819 --21958 1891 --
NM_198935chr2063017 2874 2535 2137 1254 310 --32244 2071 431 --
NM_198963chr22212 26 ------
NM_198990chr753341 3176 2550 1108 339 22797 235 ----
NM_198991chr18--1226 1658 --
NM_198995chr183376 146 94 ------
NM_199003chr821441 1023 ------
NM_199040chr1282748 1270 1047 923 559 542 332 108 13509 33285 1031 785 --
NM_199136chr71360 ----1177
NM_199144chr2021592 220 ------
NM_199169chr2063548 3067 2988 2969 2797 532 11103 12374 --
NM_199170chr2063548 3067 2988 2969 2797 532 11103 12374 --
NM_199171chr2063548 3067 2988 2969 2797 532 11103 12374 --
NM_199188chr1232879 568 300 ----23993 2943
NM_199189chr53736 716 346 ------
NM_199190chr1232879 568 300 ----23993 2943
NM_199203chr2021592 220 ------
NM_199320chr432672 236 50 12546 22034 840 --
NM_199320chr432672 236 50 12546 22034 840 --
NM_199324chr423257 1019 1573 1195 --
NM_199330chr151459 ------
NM_199331chr151459 ------
NM_199332chr151459 ------
NM_199355chr1611105 --1156 11244
NM_199421chr1465012 4878 4792 3915 3596 724 1857 ----
NM_199436chr22789 644 2518 468 ----
NM_199437chr112366 205 12441 1160 --
NM_199438chr112366 205 12441 1160 --
NM_199439chr112366 205 12441 1160 --
NM_199454chr124048 3074 11593 13090 --
NM_199461chr1043255 2997 1350 757 22556 1025 ----
NM_199482chr2--1278 11513 11685
NM_201266chr242697 2145 661 574 23007 2499 ----
NM_201279chr242697 2145 661 574 23007 2499 ----
NM_201432chr17146576 6006 5546 5521 4513 4354 4003 2223 1690 1032 779 725 256 71 --1298 16285
NM_201433chr17146576 6006 5546 5521 4513 4354 4003 2223 1690 1032 779 725 256 71 --1298 16285
NM_201434chr17----1778 --
NM_201437chr811409 ------
NM_201568chr121603 117 ------
NM_201569chr121603 117 ------
NM_201591chr421880 712 ----1288
NM_201592chr421880 712 ----1288
NM_201613chr12--1898 ----
NM_201624chr13934 910 257 11176 ----
NM_201628chr142553 2169 1358 355 --43238 1191 651 479 --
NM_201995chr111240 ------
NM_201999chr41468 ------
NM_203304chr191616 ------
NM_203327chr2074201 3204 3150 1743 1348 1300 410 --14014 21835 1398
NM_203349chr153692 459 310 1787 11647 1439
NM_203350chr12524 298 192 ----
NM_203364chr11196 1274 ----
NM_203372chr231671 239 27 ------
NM_203390chr851870 1761 529 433 181 11389 ----
NM_203391chrX21248 272 11156 --1594
NM_203403chr9------1338
NM_203406chr532555 2300 740 ----32698 1156 217
NM_203417chr2141321 1300 1129 324 ------
NM_203418chr2141321 1300 1129 324 ------
NM_203437chr22787 606 ------
NM_203451chr1332323 2101 787 1529 12338 --
NM_203458chr131545 907 648 11480 12489 --
NM_203459chr152589 2066 600 407 129 12349 185 12316
NM_203463chr253987 3942 1516 896 409 23554 1914 --24096 3284
NM_203464chr121282 1049 ------
NM_203473chrX------1312
NM_203474chrX------1312
NM_203475chrX------1312
NM_203476chrX------1312
NM_203487chr1331320 398 44 --21767 1570 --
NM_203504chr411757 --12070 --
NM_203505chr411757 --12070 --
NM_205768chr112080 1734 1304 --
NM_205836chr53530 116 32 162 ----
NM_205860chr153120 2914 2581 970 665 1980 13136 12426
NM_206594chr162705 2353 1348 1312 1167 616 21471 588 ----
NM_206595chr162705 2353 1348 1312 1167 616 21471 588 ----
NM_206809chr62801 105 ------
NM_206852chr141191 ----1248
NM_206853chr643333 1475 1339 226 11487 --21453 1147
NM_206854chr644594 1487 984 698 --13500 --
NM_206855chr655559 2452 1949 1663 939 --14465 --
NM_206857chr141191 ----1248
NM_206860chr101183 ------
NM_206861chr101183 ------
NM_206862chr101183 ------
NM_206866chr2142786 2722 2061 453 32482 2039 915 ----
NM_206876chr211123 13464 11086 11445
NM_206907chr552834 2578 1272 1080 528 --11020 12773
NM_206914chr1241850 1728 330 53 11859 ----
NM_206925chr1562267 2247 1789 1664 1065 122 11933 11885 1349
NM_207012chr1053423 2647 1133 1124 872 ------
NM_207032chr20--11594 ----
NM_207033chr20--11502 ----
NM_207034chr20--11502 ----
NM_207123chr42842 361 ------
NM_207304chr131744 ----22287 706
NM_207317chr5--1433 ----
NM_207325chr1941376 523 514 149 11961 21917 1270 --
NM_207337chr1231051 951 874 ------
NM_207359chr31146 1685 1581 2405 196
NM_207361chr1376247 5315 5240 2126 444 360 320 15211 --14657
NM_207371chr101303 1349 ----
NM_207372chr1042458 1663 648 268 1340 2860 204 --
NM_207422chrX1156 ------
NM_207445chr1512047 1187 22133 605 --
NM_207468chr1----1514 --
NM_207517chr1521906 1886 ------
NM_207518chr191523 1854 1431 --
NM_207577chr1162048 2032 1040 981 535 237 12933 21878 1812 --
NM_207645chr113448 309 48 ------
NM_207647chr932446 2150 2027 ------
NM_207660chr1421346 389 21231 1082 11320 182
NM_207661chr1421346 389 21231 1082 11320 182
NM_207662chr1421346 389 21231 1082 11320 182
NM_212460chr731407 776 406 1528 ----
NM_212471chr1712245 21824 802 2607 550 --
NM_212472chr1712245 21824 802 2607 550 --
NM_212474chr24946 862 839 43 ------
NM_212475chr24946 862 839 43 ------
NM_212476chr24946 862 839 43 ------
NM_212478chr24946 862 839 43 ------
NM_212482chr24946 862 839 43 ------
NM_212554chr1021582 1179 1365 ----
NM_212558chr933727 3177 1053 24075 1723 ----
NM_213589chr295291 5138 5005 4874 4487 3608 1801 1660 570 --25490 1991 --
NM_213590chr1314497 14284 35255 3212 1768 --
NM_213619chr81130 ------
NM_213620chr81130 ------
NM_213654chr31392 ------