TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-183-3p
miRNA Sequence: GUGAAUUACCGAAGGGCCAUAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531253 1247 927 21116 151 11292 1815
NM_000038chr561997 1732 1713 739 473 114 11428 21625 619 --
NM_000051chr1193584 3556 2721 2639 2507 1338 1142 967 956 13347 22676 759 --
NM_000052chrX83458 3112 3094 2432 2197 1169 974 825 11099 --11355
NM_000059chr135739 623 588 127 69 2795 330 2829 223 --
NM_000081chr141744 1351 478 335 21268 357 11272 --
NM_000084chrX186369 5966 5684 5434 5226 5112 4800 2112 1890 1867 1722 904 744 645 596 590 514 172 36808 4892 520 ----
NM_000092chr294119 3259 1719 1366 1212 1206 1141 570 278 11446 24425 1804 --
NM_000108chr731890 412 183 2304 289 11342 21821 456
NM_000109chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_000112chr5105375 4712 4672 4647 3647 3595 3501 3364 2213 1932 --24455 1193 --
NM_000115chr1352155 1926 1884 1814 236 32546 712 436 22593 1762 12116
NM_000138chr1531895 517 240 11064 1538 22106 177
NM_000153chr1461335 1109 683 674 184 143 --31607 1297 154 --
NM_000163chr552390 1989 1670 406 279 22049 472 42127 1453 817 556 12166
NM_000165chr661603 1426 1082 592 394 82 1239 31720 1449 1319 --
NM_000176chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_000216chrX143896 3459 3090 2957 2828 2666 2637 2557 1604 1466 1448 851 431 371 22985 551 11023 11180
NM_000217chr1264117 3444 886 711 407 273 --14606 25099 3476
NM_000232chr472976 2452 2271 1127 887 856 329 --43198 2287 2032 190 1968
NM_000233chr23325 258 72 --1354 1664
NM_000252chrX3612 585 264 --21140 275 --
NM_000259chr15135898 5799 5524 5473 4840 2152 1902 1487 1374 974 902 762 532 35343 1737 715 86211 5943 5793 5613 3872 1851 1433 1023 --
NM_000264chr9113258 2698 2309 2273 1153 979 955 636 523 388 128 23407 1105 32620 2467 376 --
NM_000267chr17113000 2711 2347 2266 1389 1349 1050 963 909 794 787 23510 177 12567 --
NM_000332chr6106973 6910 5894 4685 4343 2686 2293 1780 1698 106 24802 1419 25175 1016 17120
NM_000351chrX81715 1661 1542 1046 1036 851 839 118 12848 1947 --
NM_000390chrX73342 3299 3274 3095 3006 308 256 13250 12535 32814 2778 760
NM_000408chr293407 3375 2643 2482 2404 2347 2162 865 740 21249 944 ----
NM_000448chr11113141 2685 2419 2039 1063 849 834 802 720 470 454 32781 1306 501 13173 --
NM_000461chr394325 4303 3669 3109 3051 1657 1627 755 26 13557 --1618
NM_000462chr1531882 1579 1323 21190 58 11661 21657 1203
NM_000503chr841890 1867 1693 758 --1535 1681
NM_000544chr6_cox_hap173387 3258 2957 2441 2114 316 205 23195 1264 1900 --
NM_000555chrX116504 6102 6060 5230 3082 2641 1213 1052 963 780 323 67672 7462 5742 2495 1471 1161 16437 27519 6271
NM_000584chr471239 1050 878 757 428 339 246 ------
NM_000618chr12116640 6461 6431 6343 5457 4991 4851 4344 1820 1354 842 25062 4045 14632 --
NM_000618chr12116640 6461 6431 6343 5457 4991 4851 4344 1820 1354 842 25062 4045 14632 --
NM_000806chr561663 1218 752 622 71 47 --1131 --
NM_000809chr4268930 8572 8457 8404 7518 7418 7207 6994 6937 3525 3497 3415 3344 3286 3132 2774 2765 2718 2548 2386 2033 1881 1253 1245 157 111 49299 9193 8743 1872 58984 6903 5992 2095 679 28220 7251
NM_000813chr5165614 5255 5144 4939 4133 4030 4000 3550 3444 1844 1336 1275 1157 1096 998 299 45555 5152 4465 3654 15230 45208 4982 4188 1111
NM_000826chr452392 1846 1804 878 295 --2466 402 1750
NM_000866chr32402 370 --3431 210 134 1626
NM_000868chrX92636 2581 2519 2428 2226 1863 801 414 67 1855 22627 981 --
NM_000875chr1597080 6929 5931 5683 1775 1433 631 586 534 42514 2322 1101 1058 12458 15724
NM_000899chr12134241 4179 4046 3915 3755 3587 3316 2952 2681 1720 1667 90 52 24367 4260 34150 3602 160 12859
NM_000901chr472504 2459 2441 2352 2035 885 683 12053 62448 2196 2057 1658 983 101 12469
NM_000910chr471932 1919 1521 1478 742 735 137 1184 11694 11895
NM_000912chr873258 3207 2477 2191 1367 1281 651 2107 50 23370 1394 --
NM_000926chr11279489 9452 7890 7713 7291 6900 6737 6708 6423 5747 3360 3326 3224 3212 2521 2327 2299 2233 1885 1675 1149 998 958 826 651 483 227 39443 7195 134 22877 1956 --
NM_000945chr241629 1620 732 174 11595 3709 396 275 1383
NM_000953chr1461753 1719 1503 1491 687 414 21604 92 2481 449 11138
NM_000959chr1113922 3650 3166 3039 3000 1443 1335 744 507 140 100 1945 13262 11208
NM_000962chr973134 2959 2074 1249 1117 745 168 --1490 22773 401
NM_000963chr192113 2097 1672 1526 951 783 559 543 504 --11758 152
NM_001001323chr12112967 2820 2669 1141 1096 898 700 677 207 88 48 ----12776
NM_001001419chr5145227 4924 4226 3777 3641 3212 2091 1078 969 598 465 311 240 49 13302 11868 --
NM_001001420chr5145227 4924 4226 3777 3641 3212 2091 1078 969 598 465 311 240 49 13302 11868 --
NM_001001433chr2063232 3157 2936 949 532 393 2770 215 1559 --
NM_001001481chr8133494 3481 3214 3083 3062 2409 2378 2300 1179 835 720 706 250 --22979 2447 --
NM_001001484chr1052297 2048 1950 564 533 3783 707 332 11787 --
NM_001001664chr2103973 3535 3144 3124 3051 2786 1620 1598 729 254 34000 3339 809 4741 549 197 158 --
NM_001001665chr293123 3034 3000 2725 2182 2075 945 448 355 12963 ----
NM_001001668chr1984003 3943 3853 3769 3368 1287 1237 1007 --1190 23657 971
NM_001001890chr21113973 3736 3187 1547 1314 1231 1138 805 623 493 480 21576 1338 ----
NM_001001928chr22108321 8183 8119 7814 7414 5185 3135 1912 402 349 22978 2065 22378 2076 --
NM_001002257chr242848 2795 192 144 12904 23459 2443 12951
NM_001002860chr1474562 3350 3109 2849 460 207 81 33705 2889 902 1541 --
NM_001003652chr18157945 7532 7140 5574 5390 5365 5315 2937 2205 2155 1730 1282 851 831 544 1101 46513 6021 5670 1441 12279
NM_001003674chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_001003675chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_001003679chr162098 1623 1575 708 229 113 12029 42085 1786 903 811 --
NM_001003688chr451071 994 888 247 134 2948 143 1860 --
NM_001003712chr1233628 3416 1102 43824 3122 2472 648 33464 1283 879 22843 489
NM_001004125chr91945 ----21022 799
NM_001004196chr351204 928 856 419 30 --1383 1409
NM_001004317chr673798 3261 2764 1046 728 686 617 1420 33959 3691 194 13682
NM_001004360chr271869 1813 1471 1236 592 517 329 21724 1364 ----
NM_001004419chr12104431 4148 4119 3804 3446 1350 1273 500 338 152 11842 1306 --
NM_001004441chr551422 1341 508 377 317 1556 21684 1558 --
NM_001005386chr242205 2077 2003 1893 12255 12057 2862 195
NM_001005404chr17114417 3499 3159 3019 1625 1595 1553 1498 1452 1057 614 --24454 3476 --
NM_001005473chr5106468 5833 4789 4757 4657 1297 1136 747 529 291 75796 5352 5263 4915 2505 2066 1786 14572 12147
NM_001005502chr12115235 5211 5143 4978 3991 3495 3324 2101 2087 1869 773 35221 3922 488 43485 3273 1778 189 --
NM_001006600chr572177 2032 1924 1797 920 768 200 --2914 757 --
NM_001007024chr1794352 3775 3282 3183 3076 2803 2737 545 425 --13011 14413
NM_001007025chr1794352 3775 3282 3183 3076 2803 2737 545 425 --13011 14413
NM_001007097chr974627 4095 3918 3180 1518 1481 512 25088 2028 25123 3490 1282
NM_001007246chr2181885 1608 1484 1225 758 652 271 226 11793 11428 1473
NM_001007466chr674756 4453 4092 3314 1998 1976 1204 33399 3345 1744 14944 --
NM_001008401chr19101496 1424 1374 1179 546 306 279 221 139 57 21367 919 ----
NM_001008408chr7146406 5974 5831 5408 5351 5338 4541 4176 2573 1534 1132 772 340 158 15875 14617 15021
NM_001008539chr8115264 4974 4864 4370 4178 3882 3430 2106 1262 1084 1016 25273 1244 54632 4187 1654 126 116 --
NM_001008541chr1022310 1568 152 --11489
NM_001008541chr1022310 1568 152 --11489
NM_001008564chr1362285 2264 2185 1670 1383 213 1186 --11615
NM_001008738chr5112688 2621 2517 2396 2378 1966 1905 1002 404 397 237 21898 457 --1839
NM_001008744chr1461141 1126 583 516 460 392 126 31331 503 202 --
NM_001008801chr19122104 2054 2008 1625 1354 670 586 405 377 317 233 64 22047 40 2644 419 --
NM_001008925chr493548 3392 3377 3304 2167 553 531 521 338 13455 ----
NM_001009554chr4114631 4565 4422 4348 4012 3551 1619 1579 944 903 444 1333 43109 3030 3007 1850 --
NM_001009554chr4114631 4565 4422 4348 4012 3551 1619 1579 944 903 444 1333 43109 3030 3007 1850 --
NM_001009894chr1281725 1532 1233 617 535 485 298 181 31488 328 286 11321 1272
NM_001009899chr3126295 6279 6181 5731 5132 4813 4636 4576 3992 2140 1493 1431 14093 34656 4248 861 15701
NM_001009931chr15915 907 100 67 23 2951 40 --1833
NM_001009959chr262377 894 636 368 167 50 22608 1685 52423 2266 1689 1044 295 12371
NM_001009960chr7112562 2349 2343 2312 825 486 449 394 313 61 35 --22470 143 --
NM_001010846chr1143654 3264 3181 2917 1653 1518 1393 1202 1195 835 608 512 463 303 11785 24351 822 14551
NM_001010853chr692908 2612 2192 2139 2049 985 673 611 472 ----12022
NM_001010861chr1152771 2592 2308 2073 1979 1906 1889 1869 1725 1713 817 789 435 123 114 22815 2807 22525 735 2932 898
NM_001010862chrX52995 2922 1029 1012 522 22130 210 --22385 2198
NM_001010888chrX94176 3906 3806 3736 3406 768 577 515 86 13032 12925 13850
NM_001010891chr5186886 6789 6525 6271 6247 5319 5246 5207 4506 4444 4305 4226 2663 1944 1328 1125 778 376 44608 1993 1923 1882 65467 5061 2739 1768 367 353 --
NM_001010922chr1153902 3123 3023 2856 2786 1580 1179 1167 1121 1099 843 721 649 440 63 33517 450 75 13482 --
NM_001010942chr1231028 995 472 2488 56 --11237
NM_001010984chr172476 2430 2259 1919 1626 906 520 1249 11865 1352
NM_001010986chrX92297 2179 2152 2143 1922 841 419 123 91 --12307 --
NM_001011513chr464030 3777 3146 1090 272 69 2300 79 33598 3275 2887 --
NM_001011666chr796488 6427 4634 4370 2532 2525 2296 2241 796 56153 5328 5301 4009 1425 55769 4664 4048 1495 1070 --
NM_001011708chr262917 2835 2107 1902 1050 861 --22669 635 --
NM_001012393chr1184968 4838 4538 3671 3230 1640 978 509 34435 1859 753 25152 3382 --
NM_001012398chr1631058 978 326 --31033 770 221 2939 56
NM_001012420chr1582841 2411 2072 917 729 395 146 80 32442 1028 290 1133 --
NM_001012751chr1081900 1613 1535 1313 768 621 470 192 31388 497 387 21878 310 --
NM_001012754chr13101904 1811 1755 1668 702 434 286 87 49 36 --1335 --
NM_001012755chrX114916 4642 4209 4180 4165 3842 3614 1937 1526 1348 1286 33988 3817 1279 --13713
NM_001012756chr19103298 3230 3095 2830 2635 2501 871 734 455 74 1124 11149 --
NM_001012968chrX42805 2242 2028 102 1901 12375 12524
NM_001013620chr12188496 8156 7966 7879 6983 6953 6726 6655 6612 5905 5296 2989 2431 2288 2047 655 532 526 58069 5732 5397 3375 3339 56096 3130 2648 2592 344 16910
NM_001013746chr7102074 2026 1803 1636 825 590 535 451 204 36 --2371 287 32016 1883 1767
NM_001014380chr13155893 5196 5135 4882 4426 3999 3904 3753 2032 1351 1238 732 500 478 22 1856 14094 15770
NM_001014797chr10128249 7991 6359 5054 2955 2573 2545 1906 1205 781 761 98 11265 12503 --
NM_001015048chr1463051 2921 2585 1980 769 74 --12907 13193
NM_001015049chr1463051 2921 2585 1980 769 74 --12907 13193
NM_001017424chr181879 1767 1574 1549 1469 1458 1437 1422 31739 1733 1356 11316 --
NM_001017425chr181879 1767 1574 1549 1469 1458 1437 1422 31739 1733 1356 11316 --
NM_001017440chr796945 5840 5515 5141 5026 2234 1874 1422 1337 25069 1377 48238 5965 5288 1254 --
NM_001017923chr1451387 1118 520 497 187 2410 313 21437 1155 2402 100
NM_001017926chr841726 1618 1380 733 1244 --11247
NM_001017930chrX81313 1201 566 452 383 298 203 57 21490 930 171 --
NM_001017970chr1492260 2186 2032 1918 1693 973 715 696 565 22406 2391 1877 11745
NM_001018067chr194668 4309 4254 4128 3762 3584 1721 1088 243 23524 647 45203 4961 2069 1760 15240
NM_001018068chr194668 4309 4254 4128 3762 3584 1721 1088 243 23524 647 45203 4961 2069 1760 15240
NM_001018069chr194668 4309 4254 4128 3762 3584 1721 1088 243 23524 647 45203 4961 2069 1760 15240
NM_001018074chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_001018075chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_001018076chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_001018077chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_001018089chr1543835 1239 947 305 2673 28 32533 2503 56 13463
NM_001024094chr5103663 3384 3141 3135 3093 1095 1042 622 577 229 13549 --1906
NM_001024647chr1255847 5620 5210 2591 349 12799 47197 6726 2067 230 11112
NM_001024948chr1123423 3412 2748 2678 2650 2522 2387 2348 1134 889 686 309 --2697 487 --
NM_001024956chr1185358 5143 4555 3687 2050 945 891 455 55499 5057 4331 3667 668 15461 15281
NM_001025072chr3122743 2343 2251 2039 1908 809 658 630 309 268 144 134 1331 148 --
NM_001025073chr3122743 2343 2251 2039 1908 809 658 630 309 268 144 134 1331 148 --
NM_001025076chr10135864 5564 5519 5490 5396 4262 4192 3826 2078 1766 1145 297 281 --25897 67 --
NM_001025077chr10167222 6922 6877 6848 6754 5620 5550 5184 2503 1655 1639 1111 1038 434 290 218 2777 355 27255 1425 --
NM_001025079chr383866 3032 2881 2628 1663 1507 1459 1354 14051 44055 3212 186 89 --
NM_001025100chr18143951 3392 3365 3349 3329 3283 3022 1380 1287 1272 924 821 589 580 23534 484 ----
NM_001025252chr893116 2601 2530 2393 2205 2158 755 591 405 22192 836 ----
NM_001025253chr893116 2601 2530 2393 2205 2158 755 591 405 22192 836 ----
NM_001025266chr3154843 4525 3878 3679 3349 3331 3071 1745 1582 1306 1148 1088 738 265 134 --14134 34097 3585 1975
NM_001025356chr1263025 2976 2934 1209 504 36 21857 785 22765 2634 1459
NM_001025366chr651717 1619 1462 1396 1323 11912 --11276
NM_001025366chr651717 1619 1462 1396 1323 11912 --11276
NM_001025367chr651717 1619 1462 1396 1323 11912 --11276
NM_001025367chr651717 1619 1462 1396 1323 11912 --11276
NM_001025368chr651717 1619 1462 1396 1323 11912 --11276
NM_001025368chr651717 1619 1462 1396 1323 11912 --11276
NM_001025369chr651733 1635 1478 1412 1339 11928 --11292
NM_001025369chr651733 1635 1478 1412 1339 11928 --11292
NM_001025370chr651717 1619 1462 1396 1323 11912 --11276
NM_001025370chr651717 1619 1462 1396 1323 11912 --11276
NM_001025580chrX92895 1538 1175 925 865 641 558 519 242 11691 42980 1683 1159 508 11075
NM_001025780chr981442 1270 1078 1016 603 474 331 271 1423 31306 623 212 --
NM_001029858chr693258 2869 2315 2238 1357 1287 954 716 421 13315 12297 --
NM_001029863chr683094 2876 2719 2481 1250 872 348 204 --12618 11202
NM_001030055chr14174358 4229 3696 3656 3280 3244 3190 3090 3047 2958 1851 1682 827 751 485 416 205 54409 3350 1424 1378 976 54561 1762 1365 431 103 --
NM_001031623chr681733 1312 1242 1229 630 347 339 270 --11751 1646
NM_001031700chr462292 2018 925 757 687 646 --32443 2242 863 --
NM_001031732chr4153590 3384 3092 2816 2751 2667 2618 2450 1241 1149 986 592 266 110 83 12740 --12724
NM_001031748chr123517 461 188 ----1578
NM_001031804chr1673562 3236 3214 1362 521 456 77 14130 --11480
NM_001032394chr652815 2434 2401 2382 280 --12406 1842
NM_001032395chr652682 2301 2268 2249 147 --22273 1053 1709
NM_001033087chr2063054 2647 2363 257 207 133 22372 1060 12993 11071
NM_001033659chr1731613 1401 1170 ----11376
NM_001033756chr651651 1553 1396 1330 1257 11846 --11210
NM_001033756chr651651 1553 1396 1330 1257 11846 --11210
NM_001034841chr1674953 4475 3904 1469 1440 694 539 25411 2194 45225 4892 1243 1208 15400
NM_001037317chr1152771 2592 2308 2073 1979 1906 1889 1869 1725 1713 817 789 435 123 114 22815 2807 22525 735 2932 898
NM_001037535chrX71592 1238 1113 1104 312 221 21 1418 11156 --
NM_001037536chrX71592 1238 1113 1104 312 221 21 1418 11156 --
NM_001037540chrX71592 1238 1113 1104 312 221 21 1418 11156 --
NM_001037954chr1173285 2687 2558 2400 2207 1340 920 33179 2738 1152 1625 13507
NM_001039199chr20135014 4932 4896 4833 4511 4185 3326 3084 1245 416 215 85 30 170 24229 4027 --
NM_001039348chr22854 792 2869 176 1891 1128
NM_001039349chr22854 792 2869 176 1891 1128
NM_001039547chr3147958 7867 6967 5299 1937 1922 1834 1769 903 679 618 515 414 355 25556 5459 21992 922 25924 5135
NM_001039569chr262809 2530 1294 836 559 524 13014 1665 2446 112
NM_001039585chr1124179 3907 3423 3296 3257 1700 1592 1001 764 397 357 187 11202 23519 2649 11465
NM_001039590chrX153922 3910 3846 3826 3491 3258 3218 2875 1562 1443 1335 1291 481 333 270 34055 2763 853 23416 1599 --
NM_001039591chrX153922 3910 3846 3826 3491 3258 3218 2875 1562 1443 1335 1291 481 333 270 34055 2763 853 23416 1599 --
NM_001039618chr11145617 5101 4972 4409 3985 3847 3695 2183 2081 2000 1891 1145 1026 419 11957 35678 4524 4479 25411 5132
NM_001039840chrX185913 5530 5491 4914 4724 4585 4261 3945 3875 2236 1897 1574 1564 1497 1335 1241 865 327 26074 5506 35370 1409 1139 24084 1368
NM_001039937chr1374024 3028 3008 2968 1670 643 378 21537 1155 13550 1226
NM_001040142chr221563 413 41788 701 321 285 22342 433 --
NM_001040143chr221563 413 41788 701 321 285 22342 433 --
NM_001040152chr7174664 4185 4128 4048 3834 3761 3753 3580 3464 3421 3197 1764 1189 909 872 421 88 35136 4868 3443 13160 14891
NM_001040159chr451391 1354 361 346 97 21452 375 11429 --
NM_001040202chr492546 2437 2349 772 755 316 292 199 27 11959 ----
NM_001040284chr16155710 5262 5220 5172 5047 4642 3934 3827 3667 2294 2264 2258 1423 1117 669 15950 33846 3700 1782 --
NM_001040429chr1363051 2648 2400 1041 868 436 23538 995 33027 2820 722 --
NM_001040441chr194913 4313 4174 3400 503 426 357 95 40 23901 1503 15399 13852
NM_001040446chr562764 2190 2030 468 434 168 --22552 374 12623
NM_001040450chr1542655 2515 2311 375 1476 52461 864 613 535 444 --
NM_001040453chr1542655 2515 2311 375 1476 52461 864 613 535 444 --
NM_001040665chr7125049 4757 4719 4650 4031 3926 3509 3322 3169 800 733 161 --31872 1301 219 1368
NM_001040708chr871046 917 831 445 412 318 122 --1297 --
NM_001040712chr9113221 3098 3041 2853 2735 2406 1433 1053 767 363 177 21219 269 ----
NM_001042355chr1675335 5071 3941 3291 969 640 435 24195 1778 --14291
NM_001042412chr1675335 5071 3941 3291 969 640 435 24195 1778 --14291
NM_001042492chr17113000 2711 2347 2266 1389 1349 1050 963 909 794 787 23510 177 12567 --
NM_001042510chr861979 1591 867 848 391 21 --21740 476 11944
NM_001042511chr861979 1591 867 848 391 21 --21740 476 11944
NM_001042533chr3103043 2788 2627 2611 2503 2486 2212 1034 816 803 32350 719 87 ----
NM_001042537chrX41887 894 608 361 1880 1744 11819
NM_001042543chr491619 1363 1174 1073 982 539 483 235 45 2635 597 --1364
NM_001042555chr12114505 4421 4402 4128 3945 3860 3780 3124 1232 416 188 1906 21627 1407 14511
NM_001042599chr2147696 7398 6873 6247 6090 5265 4925 2910 2456 2227 2078 1578 1099 709 27878 754 36941 6808 2495 37862 1177 592
NM_001042601chr3103291 3137 3014 2684 2672 2345 751 591 500 31 11200 ----
NM_001042603chr12125036 4805 4636 4571 4529 4214 3631 3591 3570 1957 1725 1621 ------
NM_001042604chr3104669 4241 3646 3449 3397 1533 1136 1025 736 27 24635 3025 24532 3586 --
NM_001042683chr661657 1549 1394 730 526 211 --21481 432 21680 1329
NM_001044385chr2104033 3665 3058 2959 2660 1322 1259 822 369 185 --22734 500 --
NM_001046chr593037 2689 2633 2071 903 739 509 215 127 11124 21053 840 12871
NM_001083620chr452390 1844 1802 877 294 --2465 401 1749
NM_001099678chr3106423 6273 5616 5394 4649 4477 2441 2360 205 77 14715 36357 1639 1608 16371
NM_001100108chr1127889 7382 7299 7260 5878 5047 3169 2966 2854 2004 1517 407 47998 3277 3093 1648 25818 2740 28232 6476
NM_001106chr3199602 8452 8207 7654 7315 7197 7096 6875 6420 5926 3868 3153 2696 2659 2590 2506 2409 1027 905 28705 7881 39559 1869 1314 --
NM_001113490chrX53613 2506 926 564 249 12621 22795 697 12249
NM_001121chr1061200 616 532 506 387 165 11338 1257 --
NM_001122679chr531253 1247 927 21116 151 11292 1815
NM_001160chr1272847 2719 2601 2247 2190 1036 736 22822 1888 ----
NM_001167chrX116649 5769 5641 4769 4569 2017 1859 1842 1193 414 297 45010 2557 2317 2167 26522 5718 25526 2403
NM_001173chr14174358 4229 3696 3656 3280 3244 3190 3090 3047 2958 1851 1682 827 751 485 416 205 54409 3350 1424 1378 976 54561 1762 1365 431 103 --
NM_001186chr21113116 2808 2769 2649 2239 2228 2134 971 399 362 33 1336 23208 2711 --
NM_001201chr4113763 3099 2970 2801 2605 2557 1590 1357 932 845 662 33023 1027 899 33729 3344 630 2723 34
NM_001204chr2237476 7196 6695 6564 6427 5960 5919 5546 5437 2770 2709 2435 2110 2042 1932 1667 1656 1579 1344 1179 1114 842 164 57023 6858 6729 6367 5513 11108 --
NM_001219chr74667 460 391 376 --137 11931
NM_001227chr1061361 1199 1036 526 233 105 ----1126
NM_001241chr282423 2284 1946 1752 1733 1613 1532 106 --12045 1142
NM_001241chr282423 2284 1946 1752 1733 1613 1532 106 --12045 1142
NM_001259chr7126214 5879 5839 5792 5673 5642 4536 4088 2363 1235 1021 748 12261 66021 5569 2281 2005 1838 562 35530 3899 504
NM_001278chr1051079 896 841 805 211 --11146 1188
NM_001304chr1733346 1171 852 12836 43782 3336 3286 2582 1253
NM_001310chr1262710 2178 2154 2070 1227 46 13098 3757 359 339 --
NM_001396chr2142640 2253 370 343 --22192 1863 22682 947
NM_001412chrX63665 3648 3504 3419 1433 910 --13287 12544
NM_001427chr71232 ----21856 55
NM_001432chr4103870 3567 3449 3400 3355 3330 2638 966 596 234 13283 33853 2991 2873 --
NM_001438chr1133617 3598 3089 3083 2631 2564 2545 2518 2493 2241 1154 828 298 33373 3234 1101 1126 --
NM_001453chr651780 1556 1255 522 156 --31483 512 208 --
NM_001460chr1133616 3508 2874 2524 2336 1273 1227 1116 990 923 413 113 105 1557 --12815
NM_001490chr9123715 3530 3311 3244 3116 2557 2410 2394 2338 1322 824 670 12433 1511 --
NM_001530chr1451015 931 721 342 84 --1152 1126
NM_001609chr10154101 4015 3789 3667 3514 3490 3317 3163 3067 3029 1174 1010 849 785 369 22728 746 11148 22981 1624
NM_001621chr742421 402 150 96 22384 821 32822 769 682 --
NM_001621chr742421 402 150 96 22384 821 32822 769 682 --
NM_001650chr1883877 3623 3461 3435 3318 3142 1616 907 43747 3247 2940 711 23814 157 13653
NM_001663chr1452621 2443 2063 944 574 11076 --11025
NM_001682chr1282681 2534 2383 855 810 612 414 391 ----12490
NM_001713chr531138 445 162 --1288 1997
NM_001730chr1361431 1069 1028 622 469 440 11274 ----
NM_001730chr1361431 1069 1028 622 469 440 11274 ----
NM_001742chr761745 1318 1277 1157 622 440 11142 1303 --
NM_001754chr21113973 3736 3187 1547 1314 1231 1138 805 623 493 480 21576 1338 ----
NM_001755chr1662217 1812 1506 367 265 239 --12296 1360
NM_001759chr1294828 4533 4434 1658 1374 1244 904 725 397 14488 12032 14198
NM_001777chr383866 3032 2881 2628 1663 1507 1459 1354 14051 44055 3212 186 89 --
NM_001806chr1972947 2647 2321 2265 2020 493 461 12003 21108 914 1180
NM_001854chr161119 1041 528 463 236 229 21271 600 11404 --
NM_001858chr6165120 4928 4378 3824 3569 3540 3530 3306 1930 1303 1177 668 581 423 284 201 1689 33554 1979 1867 24305 1558
NM_001874chr12115235 5211 5143 4978 3991 3495 3324 2101 2087 1869 773 35221 3922 488 43485 3273 1778 189 --
NM_001918chr1198896 8822 8270 7813 7657 7299 7275 7066 6908 6704 6239 5725 3548 3155 1454 698 674 594 88 97935 7906 6318 6312 6257 6229 3359 2285 2004 17617 12913
NM_001938chr171827 1723 1571 1232 758 459 85 1198 1679 --
NM_001941chr18103508 3147 2815 2756 2720 1391 776 756 496 134 22743 71 11078 --
NM_001949chr693233 2902 2764 2724 2392 2147 900 816 788 1868 1560 --
NM_002006chr4205184 5097 4887 4821 4610 4404 3978 3959 3940 3725 3516 3507 2264 2228 1624 1440 1288 1221 676 462 45139 1994 1023 435 23670 3528 25591 1298
NM_002009chr1572702 2308 2009 1748 1740 1017 282 12093 2835 300 21861 587
NM_002025chrX207239 7184 6596 6580 6548 6061 5871 5688 5648 3717 3556 3420 3357 3067 2306 1547 1368 901 666 650 38151 2164 484 --16491
NM_002033chr1183764 3055 3044 805 771 742 724 406 22861 1004 23490 3188 13913
NM_002035chr1863990 3729 879 844 165 40 ----23643 2785
NM_002040chr21103132 3120 2901 2448 2401 2265 2178 1193 725 514 32517 1181 699 --12280
NM_002061chr151675 1565 522 371 31 1411 --1596
NM_002069chr721711 1365 31896 1761 1635 --21187 701
NM_002126chr1783987 3429 2526 1226 1073 652 399 256 22710 1372 1916 --
NM_002158chr2143809 3476 2827 2799 2644 2605 1369 1282 1100 1024 500 489 219 38 23349 3097 11323 23583 2683
NM_002182chr362771 2609 2582 2295 666 130 1350 32433 1822 629 11830
NM_002203chr594002 3451 3400 3047 2829 911 559 511 285 --11112 13656
NM_002210chr2113511 3423 3211 3110 2607 2522 2172 893 764 725 175 11248 33230 2344 970 12945
NM_002214chr7135212 5165 4848 4042 3980 3961 1908 1465 1327 1105 632 505 67 55375 4248 4066 3621 1691 33873 2270 928 11716
NM_002223chr1273677 2886 2732 2686 2524 658 157 --24012 3894 --
NM_002264chr394953 4391 3933 3328 2030 2020 1602 1002 745 24781 1429 --34018 3791 863
NM_002270chr5115632 5542 4704 4674 4621 3714 2061 1758 827 799 767 64245 4108 2267 1276 1003 608 15308 34417 908 469
NM_002271chr1362173 2026 1604 805 703 293 1319 --11652
NM_002310chr5166431 6422 6046 5680 5491 5430 4733 4036 4020 1706 1653 1532 952 887 782 538 22417 864 46286 6276 4131 1747 --
NM_002336chr1284191 4157 4085 3677 3096 1845 1783 1624 54170 3932 1460 1329 1012 13282 --
NM_002349chr281551 1486 1111 1102 518 381 158 24 ------
NM_002351chrX61616 1570 1062 539 374 210 11529 --2623 41
NM_002392chr127465 228 218 176 107 71 55 ------
NM_002451chr973798 3108 2935 1237 1195 835 41 2977 887 --13579
NM_002545chr1184968 4838 4538 3671 3230 1640 978 509 34435 1859 753 25152 3382 --
NM_002546chr83625 497 117 ----1261
NM_002577chr364046 3770 3281 2476 1425 1305 23858 1051 1585 13978
NM_002581chr964934 4597 1823 1371 1296 138 --35487 5460 517 --
NM_002594chr2072072 2028 2001 1761 1688 779 513 --22161 652 1555
NM_002595chr1291957 1842 1661 1489 1462 1286 1270 546 483 ----1632
NM_002641chrX81922 1818 1681 1660 1337 1297 209 43 11244 1105 --
NM_002645chr1192540 2284 2243 2027 1140 896 310 274 97 12868 --22315 2089
NM_002655chr8105218 4579 4038 3942 3426 3262 1849 881 539 385 14775 1217 23707 1216
NM_002709chr2123306 3233 2958 2602 2364 2356 2219 1418 1389 1248 729 436 32436 2205 228 23584 2380 --
NM_002718chr342620 2051 1785 555 21804 523 12267 12501
NM_002731chr1112794 2364 2087 1945 1260 1227 652 567 536 501 100 ------
NM_002734chr1732155 2095 1687 --1865 22312 1548
NM_002737chr17125907 5637 5461 5397 5196 4071 2212 1693 1562 1334 234 105 --11129 --
NM_002834chr1293880 3711 3643 3613 3568 3498 3395 687 388 21276 333 23189 507 --
NM_002837chr12144291 4242 4019 3989 3537 3344 3208 3048 3002 2867 1713 1660 1562 720 33827 1056 629 1116 2299 153
NM_002839chr9113221 3098 3041 2853 2735 2406 1433 1053 767 363 177 21219 269 ----
NM_002869chr1162087 1640 817 611 516 123 ----11998
NM_002874chr942475 1902 1877 396 2972 444 22260 966 --
NM_002886chr3105043 4910 4833 4818 4008 3812 1414 1407 1226 464 14741 34524 3979 1014 --
NM_002906chr1172377 2339 2040 1656 1490 1474 469 31712 629 142 ----
NM_002948chr341229 494 42 24 ----11137
NM_002959chr144411 3948 2775 1146 1316 --23769 2932
NM_002998chr861977 1941 1810 1739 809 489 22094 187 31871 504 385 --
NM_003032chr362431 2407 2139 1910 1066 729 ----22529 2398
NM_003034chr12137736 7585 7400 6521 6048 5845 5808 5494 5276 3257 1732 734 678 52902 1966 1910 1666 292 37721 6972 2594 21805 865
NM_003046chr8115264 4974 4864 4370 4178 3882 3430 2106 1262 1084 1016 25273 1244 54632 4187 1654 126 116 --
NM_003071chr33805 461 226 22069 1892 1574 22034 1883
NM_003099chr1586526 4830 2482 2451 1916 1693 1660 1373 --45088 2472 2088 1700 --
NM_003108chr276549 5689 5625 4836 4468 4447 379 26146 4862 16407 1619
NM_003112chr772983 2552 2506 2245 1224 1034 380 12109 1395 --
NM_003155chr872524 2493 2242 549 444 337 106 --12204 22595 953
NM_003161chr1783359 3217 3179 2955 2902 2751 2389 234 23000 26 21291 552 --
NM_003199chr1844637 3571 669 368 23992 1265 --1398
NM_003221chr643888 954 885 432 164 11160 24003 784
NM_003247chr631876 1621 64 1518 --21298 1249
NM_003262chr3125228 5049 5033 4573 3275 3254 3192 1793 1065 803 287 223 21089 513 24792 740 25193 4037
NM_003270chrX4881 856 475 436 ----3218 186 141
NM_003274chr2142996 2412 2358 2011 21963 1028 --1762
NM_003292chr142026 1839 421 149 --21727 575 1694
NM_003304chr351387 1243 469 432 30 1576 1443 11035
NM_003342chr1783183 3175 2795 2271 1211 1112 1061 481 22596 2245 --2808 609
NM_003348chr1281585 1446 1439 1371 1364 1356 1303 390 --1174 --
NM_003376chr651717 1619 1462 1396 1323 11912 --11276
NM_003376chr651717 1619 1462 1396 1323 11912 --11276
NM_003392chr394053 3444 2945 1248 1158 1045 799 426 65 23271 720 1563 14004
NM_003411chrY101739 1729 1689 1507 1438 1211 456 243 236 50 21768 1660 11408 --
NM_003412chr393077 2902 2833 2795 2223 2096 1207 862 733 ----11239
NM_003413chrX31574 765 295 ----21463 640
NM_003423chr1982295 2233 1964 1904 1604 769 602 473 1733 2338 88 --
NM_003430chr1941460 1117 353 185 11243 1269 11600
NM_003463chr692984 2812 2194 2063 1203 1186 912 335 52 12377 22239 840 21146 713
NM_003468chr2104196 3855 2990 2937 1678 931 697 524 297 267 --22715 248 --
NM_003478chr1153315 3164 1318 910 770 22878 2473 13346 22291 2271
NM_003489chr2193337 3179 3123 2473 2426 2235 992 883 164 23359 483 21217 463 --
NM_003566chr1293182 3141 3076 2141 1227 1030 729 549 313 42263 2239 605 370 12166 --
NM_003574chr18105405 5263 5057 4727 3992 1910 1872 1769 747 260 25751 305 --15677
NM_003583chr1283923 3421 3157 3139 1013 981 748 134 21455 1172 ----
NM_003590chr2163881 3841 2983 2873 2865 2523 1522 1438 1254 1126 1000 828 743 645 492 298 34029 3757 3661 1895 1852
NM_003615chr393798 3288 3048 2729 2473 1345 803 361 320 23558 710 11423 --
NM_003618chr21285 --41051 481 205 119 --
NM_003663chr363024 2627 918 871 724 180 21290 1233 13125 --
NM_003672chr191997 1867 1689 1674 1252 769 581 499 369 --11623 --
NM_003679chr152732 2147 1394 1106 487 22629 2244 53323 2350 1313 1114 88 --
NM_003722chr351681 1038 749 181 175 32748 873 822 1449 1405
NM_003763chr2063232 3157 2936 949 532 393 2770 215 1559 --
NM_003772chr114959 812 291 67 1495 --21262 482
NM_003774chr1273278 3248 2778 2573 995 497 367 32756 2111 988 --22809 2294
NM_003783chr141095 828 153 137 1119 --2396 334
NM_003787chr1841696 1338 1050 489 11674 11244 2327 285
NM_003794chr37890 755 728 308 222 196 119 171 --1238
NM_003831chr18101716 1655 1615 1391 1282 572 482 303 265 224 ------
NM_003873chr1032241 2184 1611 12127 --1957
NM_003884chr331261 1245 657 ----11722
NM_003885chr1731988 712 52 134 22547 2291 32689 2643 1000
NM_003913chr6114163 4076 3997 3921 3846 3172 3124 3043 890 828 263 11729 11540 --
NM_003921chr161514 1225 704 586 214 21 --11752 --
NM_003930chr762447 2227 553 429 411 285 22350 731 ----
NM_003934chr951279 987 880 474 452 1812 ----
NM_003941chr752563 2538 2431 2186 2076 32039 1928 780 22095 318 21642 1555
NM_003994chr12134241 4179 4046 3915 3755 3587 3316 2952 2681 1720 1667 90 52 24367 4260 34150 3602 160 12859
NM_004006chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004007chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004009chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004010chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004011chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004012chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004013chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004014chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004015chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004016chrX92305 2193 1970 1949 1900 1703 465 291 21 ------
NM_004017chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004018chrX92305 2193 1970 1949 1900 1703 465 291 21 ------
NM_004020chrX92391 2279 2056 2035 1986 1789 551 377 107 ------
NM_004021chrX92305 2193 1970 1949 1900 1703 465 291 21 ------
NM_004022chrX92305 2193 1970 1949 1900 1703 465 291 21 ------
NM_004023chrX92305 2193 1970 1949 1900 1703 465 291 21 ------
NM_004028chr1883877 3623 3461 3435 3318 3142 1616 907 43747 3247 2940 711 23814 157 13653
NM_004035chr17105218 4803 3902 3815 3674 3515 3364 3178 1266 1158 54933 4763 4740 305 81 21474 1113 --
NM_004094chr1472740 2116 1121 1082 707 480 257 32890 585 27 32693 978 761 1319
NM_004100chr662394 1748 886 752 481 146 22107 771 1508 167
NM_004105chr22854 792 2869 176 1891 1128
NM_004109chr1162310 2204 2181 1789 1614 603 22350 2129 21828 127 --
NM_004124chr1483078 2604 2213 1255 1002 897 426 263 23019 1351 33524 3316 475 --
NM_004133chr8102416 2387 2312 2271 2175 2026 1842 1026 888 760 --32578 2563 2335 1314
NM_004136chr1583240 2386 2295 2196 1181 1048 1039 482 13197 12077 --
NM_004161chr271504 1146 651 550 527 455 362 21465 1055 --11452
NM_004170chr941270 700 541 150 1213 21721 1367 11642
NM_004171chr11169437 9233 9193 9148 9015 8358 8285 8098 7560 7157 7067 3169 2106 822 550 213 47205 3637 3239 2677 27304 6975 28132 2037
NM_004229chrX82246 1962 1807 1649 1484 1377 888 61 1261 1629 --
NM_004232chr18173873 3836 3698 3343 3112 2949 2896 2427 1499 1357 1309 1292 1273 958 741 625 473 ------
NM_004272chr551684 1232 688 518 468 11975 31782 1607 391 11917
NM_004293chr993809 3527 2537 2422 1207 1099 861 175 155 22514 533 12682 1510
NM_004337chr852244 1959 1831 1799 312 12328 1652 31463 845 730
NM_004338chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_004380chr1671891 1799 1748 923 796 428 341 42663 2383 1985 825 --12071
NM_004397chr1173815 3539 3350 3342 1541 708 407 --14313 11318
NM_004412chr10145999 5917 5129 4373 3945 2214 2097 440 413 407 393 170 83 59 55877 5454 5226 1174 96 32375 2111 1196 11049
NM_004447chr1231089 1082 88 1195 2894 107 1359
NM_004458chrX72527 2261 2210 1984 1068 932 187 1498 --22362 992
NM_004464chr4113668 3445 3080 3056 1626 1350 1341 1283 1250 710 219 33122 1327 976 --13595
NM_004501chr1123917 3862 3642 3296 3045 1131 1057 942 741 716 419 342 --11029 --
NM_004504chr253059 2851 871 852 761 --12075 12279
NM_004537chr1291574 1511 964 445 387 202 190 168 72 --11278 --
NM_004580chr1551562 525 277 194 161 11284 128 11400
NM_004586chrX115462 4880 4588 4374 4327 4099 3687 1944 1320 986 471 --44700 3962 1222 577 11057
NM_004612chr973423 3098 1876 1845 1200 1020 59 1728 41393 1346 559 449 --
NM_004660chrY72269 1950 1774 464 395 273 116 22351 1965 --2736 130
NM_004666chr641483 477 444 314 ----2566 39
NM_004686chr861774 1531 1286 1237 600 375 --1385 11273
NM_004726chrX104365 4287 3960 3855 2256 1994 1438 1356 1129 338 22181 1210 ----
NM_004736chr182077 1630 1618 1604 1496 545 200 194 ------
NM_004744chr4143975 3937 3659 3045 2710 2678 1495 1468 1203 1165 694 394 252 199 --13540 --
NM_004745chr845448 5432 1354 1309 56472 6322 5876 5870 4336 --14349
NM_004748chr15104069 3962 3905 3322 1210 672 537 392 193 95 24139 3042 44055 3283 2968 1552 --
NM_004760chr752230 1574 801 657 617 ----12294
NM_004775chr1852196 1520 935 903 472 --12015 2302 297
NM_004788chr112635 255 1597 --12073
NM_004796chr1472351 2042 1612 858 849 821 798 12223 12402 --
NM_004815chr1174934 4781 4707 4663 4416 4310 3926 3721 3654 1623 1422 1001 988 845 553 545 271 24330 3184 11924 --
NM_004834chr253300 3261 3245 1191 865 1936 12230 11038
NM_004857chr1494640 4505 4291 4050 3659 3298 3181 1644 1180 34311 3961 1249 24784 376 44321 4195 3044 1382
NM_004866chr5115066 5026 4788 4744 4511 3619 1711 813 664 590 342 24049 1673 33393 3250 3222 --
NM_004871chr1794352 3775 3282 3183 3076 2803 2737 545 425 --13011 14413
NM_004873chr1463051 2921 2585 1980 769 74 --12907 13193
NM_004904chr796488 6427 4634 4370 2532 2525 2296 2241 796 56153 5328 5301 4009 1425 55769 4664 4048 1495 1070 --
NM_004921chr172281 2209 1962 862 628 609 90 42044 2006 1817 1765 12048 1222
NM_004926chr1421797 1215 ----11415
NM_004956chr794420 3483 2949 2938 2784 1150 1016 627 391 44608 3997 2966 1618 24520 2928 --
NM_004985chr12134054 3848 3653 3542 2883 1336 1282 926 475 454 400 98 49 11441 34044 3040 1643 --
NM_004999chr6104431 4407 4334 4236 1697 1225 1176 1049 726 213 31138 825 342 33462 3023 1002 23672 1087
NM_005036chr22108321 8183 8119 7814 7414 5185 3135 1912 402 349 22978 2065 22378 2076 --
NM_005056chr12125280 5049 4880 4815 4773 4458 3875 3835 3814 2201 1969 1865 ------
NM_005063chr1083816 3805 3164 2618 2567 1550 1543 1380 22843 143 1853 1726
NM_005065chr1475403 5270 5182 4204 4177 4137 770 35075 3601 1669 24322 1924 14112
NM_005079chr893116 2601 2530 2393 2205 2158 755 591 405 22192 836 ----
NM_005121chr17113175 3026 2869 2660 2347 1361 1119 1088 1006 761 113 13446 11498 --
NM_005156chr984593 3873 3509 2073 1986 1042 747 40 31854 707 381 11284 25270 419
NM_005188chr11108268 8190 8099 5422 2575 2160 1585 1508 1156 436 22669 2642 16584 --
NM_005197chr1495889 5732 5089 4928 2113 1772 1712 1418 157 --25874 5603 14645
NM_005235chr2147696 7398 6873 6247 6090 5265 4925 2910 2456 2227 2078 1578 1099 709 27878 754 36941 6808 2495 37862 1177 592
NM_005271chr10------2901 484
NM_005339chr472959 1480 1198 600 528 441 217 21217 196 --23931 3369
NM_005359chr18166368 5998 5750 5477 4558 4379 4095 2182 1890 1517 1104 1009 593 484 293 247 21216 693 22075 408 --
NM_005385chr382686 2044 2022 1866 827 763 278 264 1163 1532 --
NM_005399chr1104356 3835 3824 3450 3302 3099 1175 190 181 29 13663 ----
NM_005400chr252985 2892 2794 2050 719 --12101 12097
NM_005402chr751437 1331 1150 464 158 21629 203 3605 517 51 11402
NM_005406chr1811520 1551 31500 1320 1263 11048
NM_005433chr1882819 2744 2256 1964 1801 1780 435 195 22799 2039 ----
NM_005436chr1074143 3689 3481 1387 1209 700 467 13022 21377 454 --
NM_005455chr12558 119 21351 94 21787 1717 1389
NM_005458chr922228 1989 11968 --11973
NM_005497chr17136179 6070 5759 5462 4859 4691 4506 2430 2216 2152 2144 1776 580 24551 1926 34585 1092 696 15954
NM_005502chr992947 2888 2659 2410 2205 2136 2125 638 237 1152 1360 --
NM_005504chr1296265 6099 4863 4794 4279 2189 1804 825 391 25257 4724 14036 12089
NM_005506chr472753 2284 1984 1044 563 557 264 ----12762
NM_005522chr751331 1182 310 266 163 --1469 1482
NM_005570chr186877 844 814 783 178 100 21188 64 ----
NM_005578chr385088 4508 1999 1949 1790 1755 1675 616 34579 596 558 --13955
NM_005591chr1192738 2693 1782 736 600 412 390 352 343 32296 1112 329 42323 1848 155 131 12522
NM_005596chr9156183 6173 5851 5714 4957 4939 3978 1834 1456 1119 987 975 893 885 270 45269 4853 4591 967 ----
NM_005623chr17------2490 128
NM_005639chr1271803 1612 1515 1270 1195 144 117 1156 ----
NM_005665chr1134712 4696 4690 4192 3532 3115 1691 1228 921 905 660 522 76 1327 14445 23583 1361
NM_005668chr583606 2955 1585 1502 1312 1249 822 752 24540 1556 43686 3457 3241 515 --
NM_005715chr641042 895 627 176 12817 --12563
NM_005722chr242205 2077 2003 1893 12255 12057 2862 195
NM_005725chr162367 2267 1895 426 277 110 21987 651 ----
NM_005746chr762216 2182 2032 1891 1060 911 --22623 2116 --
NM_005748chr1283367 3262 2835 2517 1016 976 306 113 2780 341 1717 --
NM_005759chr2114750 4112 3951 3797 3705 3346 3215 1626 1571 1303 914 --1306 --
NM_005779chr543667 2984 1244 1132 --11290 22676 1163
NM_005795chr2142945 2824 2740 2712 2599 2573 2558 2252 2216 2031 1871 986 382 337 13047 22933 1917 --
NM_005840chrX86309 5424 5091 4758 1864 1852 760 254 --11308 11185
NM_005868chr782376 2338 2298 1995 1721 930 531 243 ------
NM_005898chr1132656 2245 2037 12965 11187 11277
NM_005900chr451071 994 888 247 134 2948 143 1860 --
NM_005901chr18157945 7532 7140 5574 5390 5365 5315 2937 2205 2155 1730 1282 851 831 544 1101 46513 6021 5670 1441 12279
NM_005903chr5145227 4924 4226 3777 3641 3212 2091 1078 969 598 465 311 240 49 13302 11868 --
NM_005941chr8114155 3809 3776 3587 3463 3013 1579 1484 1159 1121 114 31370 1113 58 13386 13412
NM_005944chr351204 928 856 419 30 --1383 1409
NM_005962chr1022310 1568 152 --11489
NM_005962chr1022310 1568 152 --11489
NM_005977chr138931 874 761 662 652 298 263 163 1175 1680 --
NM_005999chr151572 1556 1334 343 27 21206 1162 1315 41215 1187 527 368
NM_006007chr994435 4008 2863 1583 1375 857 753 459 280 32775 1687 773 23550 1409 --
NM_006016chr672264 2104 1964 808 451 361 354 --3459 368 35 11811
NM_006055chr293211 2871 2290 2155 1184 1138 977 212 137 --12591 --
NM_006080chr782710 2645 2185 2106 1186 1135 953 126 1438 12440 1652
NM_006089chrX61406 1229 1187 1178 146 32 1459 --161
NM_006095chr4143820 3717 3447 3366 3310 3126 3078 3013 3002 1736 1136 1126 1111 144 33897 3814 1285 1561 --
NM_006106chr1183082 2803 2525 2261 1278 1257 1012 686 --13075 --
NM_006141chr1662653 2630 2278 1944 1918 387 ----12563
NM_006154chr15112894 2814 2420 1911 1182 1087 1075 1037 981 709 271 12741 12218 --
NM_006158chr851433 319 252 124 34 ----11480
NM_006166chr1272654 2379 2060 414 287 157 53 --32520 1712 374 1353
NM_006197chr842093 1678 1671 784 22141 273 11986 1896
NM_006203chr564752 4587 1923 1875 494 486 23428 3392 41292 790 762 735 25573 4648
NM_006206chr442780 1850 839 325 1734 --12968
NM_006226chr261307 1286 1153 500 431 89 2958 952 3937 459 162 11041
NM_006241chr331942 271 83 21979 1737 1339 12162
NM_006251chr5133340 3179 2959 2925 2402 2230 2136 1251 919 892 658 596 363 22182 2082 32439 1113 310 22917 852
NM_006252chr1185605 4929 4822 4812 4800 4661 2742 2545 2456 2149 1786 1365 1339 957 427 278 216 194 17368 47611 5309 1695 1357 16032
NM_006256chr142096 1806 1017 439 --22760 883 11859
NM_006265chr83543 332 257 --21304 34 31249 1045 391
NM_006267chr241899 1414 630 326 1317 --1401
NM_006282chr2094231 3814 3744 3638 3378 3200 2989 1585 1220 13761 14212 --
NM_006283chr894888 4490 4463 4264 3327 1914 1308 464 406 --14391 13727
NM_006287chr261849 1764 1752 961 304 28 --41953 1008 891 201 --
NM_006300chr1992375 2326 2264 1855 1663 1607 979 841 317 21490 125 1908 --
NM_006315chr4104450 3869 3828 3497 2770 1641 1568 572 346 145 13227 --1516
NM_006359chrX41887 894 608 361 1880 1744 11819
NM_006379chr752132 1961 1715 1704 932 12302 11577 --
NM_006380chr1774208 3085 3040 585 401 285 50 33845 1326 1301 11037 --
NM_006386chr2272253 1647 878 824 280 173 122 --12111 11569
NM_006393chr1074534 4434 3777 2910 744 412 192 23300 785 11703 --
NM_006420chr2053181 2649 2333 2183 886 1741 --23327 876
NM_006457chr464030 3777 3146 1090 272 69 2300 79 33598 3275 2887 --
NM_006460chr1771513 1411 1238 573 345 257 146 3724 585 366 --1415
NM_006466chr203751 222 167 --167 163
NM_006482chr1283923 3421 3157 3139 1013 981 748 134 21455 1172 ----
NM_006504chr1082981 2840 2377 418 277 264 251 100 --167 132
NM_006520chrX51208 588 506 497 238 1217 --11657
NM_006524chr75943 753 446 278 26 2893 783 61027 866 698 362 194 110 --
NM_006529chr481610 1354 1165 1064 530 474 226 36 2626 588 --1355
NM_006534chr2083295 2579 2539 1310 1269 497 462 272 22141 1364 ----
NM_006538chr264188 3290 2896 1264 1213 685 ----11677
NM_006540chr841458 1419 1290 1234 ----11257
NM_006544chr14155776 5625 5061 4290 3958 3734 2187 1958 1846 1301 1167 1117 498 230 23 25441 1660 24811 3787 24884 1978
NM_006546chr1785776 4578 1841 1282 1168 872 587 485 --21336 1328 --
NM_006547chr762034 2003 1363 749 371 313 2678 671 ----
NM_006561chr10135864 5564 5519 5490 5396 4262 4192 3826 2078 1766 1145 297 281 --25897 67 --
NM_006572chr17113532 3464 2964 2705 2626 2466 2435 1229 1220 656 108 33302 3111 2307 12506 12767
NM_006599chr16268010 7999 7949 7881 7809 7789 7230 6547 6489 6444 6334 6088 5877 5861 5704 5630 5582 5055 2489 2239 2038 1888 1178 1019 668 34 2438 315 77153 7125 6567 6558 5993 5512 2615 --
NM_006614chr353077 1435 1340 1331 516 33668 925 719 23356 2347 --
NM_006620chr694782 4594 3661 3552 3153 1904 1459 1308 562 34685 1689 1357 --23319 367
NM_006626chr9112595 2526 2503 2031 1977 1886 851 694 548 542 273 --12046 --
NM_006628chr1584693 4174 4122 1662 1285 1051 767 702 --33361 1585 1060 1910
NM_006629chr1862216 2042 1073 1032 807 167 22379 2066 22485 263 --
NM_006646chr1372914 2839 2525 2298 1865 698 583 32980 2349 2332 ----
NM_006654chr12114505 4421 4402 4128 3945 3860 3780 3124 1232 416 188 1906 21627 1407 14511
NM_006682chr752314 2079 626 266 52 --22166 966 22123 1064
NM_006717chr9123354 3342 3269 3263 3253 2522 2465 2343 1256 788 661 524 12456 ----
NM_006729chrX154984 4723 4396 4355 4110 3900 3878 3865 3821 1885 1550 1146 881 589 522 1335 33631 1805 1368 11576
NM_006731chr9124908 4728 4459 4283 3657 2243 1836 1657 970 902 876 150 21048 313 45587 5564 2250 1028 25705 4930
NM_006746chrX71592 1238 1113 1104 312 221 21 1418 11156 --
NM_006750chr16157947 7005 6476 6185 6112 6047 5727 5232 5141 5059 2112 2063 1921 1357 497 17876 16300 11190
NM_006756chr861414 990 613 508 441 196 --1945 11522
NM_006777chrX92961 2923 2523 2301 2294 2062 773 145 94 12570 ----
NM_006814chr2042583 2378 2328 385 21882 1662 32302 2287 1975 --
NM_006851chr1272689 2679 2403 808 458 413 299 --1685 12895
NM_006873chr2123233 2996 2823 2310 1245 1168 1126 1114 950 923 800 439 12855 32421 226 49 --
NM_006885chr1693405 3340 3292 3164 2856 1277 1084 1057 1025 23553 36 ----
NM_006902chr172378 2326 2318 2113 2104 819 689 --22738 2078 12050
NM_006912chr1102521 2436 2337 2290 2175 1661 807 645 365 321 --12259 --
NM_006915chrX82428 2394 2335 2253 1875 1607 1594 412 --32540 1016 176 22167 341
NM_006918chr1185358 5143 4555 3687 2050 945 891 455 55499 5057 4331 3667 668 15461 15281
NM_006922chr272595 2464 2233 1888 1751 596 401 --22158 750 --
NM_006924chr1793495 3344 3304 3247 1742 1507 1245 746 219 33200 2998 1463 11040 24262 83
NM_006947chr451704 1553 1545 1539 121 11620 11159 1554
NM_006948chr2192458 2133 1985 1814 696 628 556 542 422 11978 ----
NM_006956chr752086 1943 1787 219 93 11481 32029 2020 626 1852
NM_006981chr942785 2262 2058 509 22997 2348 22146 254 11064
NM_006996chr151851 1582 1194 606 584 21704 467 --31709 243 220
NM_007007chr1294489 4183 4049 3587 3512 3216 3144 1334 110 13935 11185 --
NM_007010chr1761902 1466 1303 636 620 38 21198 524 ----
NM_007011chr15156906 6880 6826 6565 6183 5986 4740 2586 2229 1853 1218 804 720 697 627 56270 5458 4750 1271 1046 26027 663 26897 1346
NM_007034chr161042 880 820 693 323 244 --2769 227 --
NM_007038chr21144899 4856 4651 4326 3927 3838 2419 2104 2073 1570 1231 887 767 43 44150 3952 3895 850 25266 2229 11241
NM_007054chr573083 2805 811 465 265 142 93 23482 668 --33811 3205 580
NM_007106chr13132780 2368 2314 2174 2113 1983 1814 1743 970 927 888 666 401 ----11090
NM_007114chr363290 987 741 623 531 356 21275 577 1851 --
NM_007124chr642029 1942 1799 580 --21323 490 11395
NM_007137chrX75333 4220 1889 1557 650 513 77 31971 605 381 11724 --
NM_007146chr1752327 2281 2169 2076 544 1733 22162 607 12579
NM_007157chrX73002 1901 911 643 613 282 219 1849 32187 2069 1067 --
NM_007159chr351379 611 323 237 214 11170 21518 362 --
NM_007173chr1151890 1822 1593 650 421 --31974 1957 455 22050 953
NM_007175chr893580 3506 3408 2885 2733 2263 1240 1139 269 --22976 2810 --
NM_007187chr135975 884 708 161 102 ----1254
NM_007212chr182111 2039 1911 914 788 634 489 332 --12180 --
NM_007222chr841726 1618 1380 733 1244 --11247
NM_007249chr13218968 8939 8775 8351 7893 7765 7545 7196 7132 6693 6049 5729 3707 3687 3237 2528 2476 2065 1848 1509 58 --27312 1890 --
NM_007269chr12569 468 --1489 2178 82
NM_007292chr17105218 4803 3902 3815 3674 3515 3364 3178 1266 1158 54933 4763 4740 305 81 21474 1113 --
NM_007345chr1872200 2089 1944 1818 1784 681 445 --1283 12067
NM_007347chr1573204 2547 2391 615 344 312 142 1673 22574 419 --
NM_007358chr141835 683 420 216 2120 56 --11671
NM_012081chr563253 3121 3111 2731 553 237 13753 22484 1205 11336
NM_012082chr82939 145 1849 3853 202 112 --
NM_012096chr3133537 3444 3082 2809 2680 2354 1484 1429 1266 1083 765 701 307 23578 658 ----
NM_012120chr682337 2175 2159 2109 936 668 158 39 12422 22304 1070 1817
NM_012129chr792142 1924 1907 1702 1660 666 650 423 122 --41545 975 960 850 --
NM_012141chr1374024 3028 3008 2968 1670 643 378 21537 1155 13550 1226
NM_012158chr1381821 1745 1499 1365 1155 82 71 29 ------
NM_012164chr9157052 7033 6541 6469 6407 6188 5606 5000 4812 4756 4742 2371 2309 1569 1034 27327 556 45882 4888 1578 916 27580 4765
NM_012180chr48704 622 616 468 460 204 184 163 ------
NM_012193chr1155431 4029 3550 1474 1020 --55396 3443 1685 839 816 --
NM_012214chr2106240 5562 5061 4901 4516 4250 1963 1860 1025 942 26428 4807 1452 --
NM_012234chr393779 3608 3579 3164 3081 2668 1156 430 131 3742 619 48 23308 2427 --
NM_012238chr1071501 1272 1179 486 312 294 155 --21662 1189 --
NM_012243chr1--1614 --2880 851
NM_012249chr293386 2845 2822 2639 2291 1343 858 844 820 1101 11357 --
NM_012252chr7115178 4432 3457 3371 2156 2128 2077 2008 660 152 21 45026 4585 3980 490 25083 3323 --
NM_012262chr1134960 4842 4180 3988 3897 3495 3471 3295 1630 1621 1143 570 489 45003 3565 3516 604 14329 23559 3274
NM_012287chr3204534 4033 3940 3440 3245 3093 1793 1768 1546 1534 1399 1225 1186 869 762 743 307 248 97 87 23170 731 54433 3947 3025 1118 656 --
NM_012300chr542292 2197 1017 178 --21836 360 32542 751 615
NM_012309chr1184943 4630 4056 3642 3359 1965 1658 727 11667 24155 3025 --
NM_012328chr761413 1391 1274 1207 938 234 1164 --1393
NM_012334chr544586 4518 3286 3175 24665 4152 24382 3734 34004 3947 3477
NM_012347chr631082 783 232 32354 2195 2189 11117 13000
NM_012382chr594403 3859 3611 2995 2881 1646 1275 588 321 13620 --22822 491
NM_012388chr1593001 2474 2340 2241 2184 2068 626 226 217 12742 1733 --
NM_012463chr1271495 1412 1374 658 596 588 130 1438 --11336
NM_012464chr472888 2731 2445 2218 1038 742 301 12497 22195 315 12786
NM_012465chr1093380 3150 3123 3028 2932 1307 1178 1125 946 1899 22593 2310 11201
NM_012479chr731081 868 249 --11936 22360 279
NM_013229chr1272847 2719 2601 2247 2190 1036 736 22822 1888 ----
NM_013231chr1453590 1584 1310 1294 939 11721 1137 11627
NM_013255chr7198774 8742 8377 6824 6625 6505 6449 5788 5716 3342 2818 2376 2110 2046 1987 1541 1316 523 376 36763 5372 1885 37122 1654 780 12426
NM_013269chr12104358 4075 4046 3731 3373 1277 1200 427 265 79 11769 1233 --
NM_013281chr2041104 1054 1004 247 1474 1140 11025
NM_013302chr1694309 3995 3771 2867 1873 1492 1424 454 392 24044 3614 11335 1950
NM_013341chr262917 2835 2107 1902 1050 861 --22669 635 --
NM_013374chr3142748 2693 2676 2504 2351 2046 1011 834 528 511 459 412 244 129 --32827 2173 29 11046
NM_013386chr151728 1601 1289 694 654 11669 21258 1134 --
NM_013438chr971782 1773 1487 695 461 383 236 --2333 33 --
NM_013943chr183209 3026 2750 2734 2430 2105 512 239 23034 2709 13006 13047
NM_013995chrX32444 2068 653 1199 12281 12090
NM_014005chr5102795 2299 2024 1199 764 752 716 570 308 165 32465 2376 2357 22205 984 22863 520
NM_014011chr272177 1988 1012 945 930 680 529 11628 1992 --
NM_014016chr371693 1471 1089 663 466 246 210 1301 21503 1188 --
NM_014021chr182575 1378 1334 992 981 782 480 337 32912 2516 852 ----
NM_014028chr662499 1225 1206 1105 781 199 22878 2571 2788 501 1685
NM_014048chr1654756 4546 4070 3801 526 44273 3792 646 640 ----
NM_014089chr1362285 2264 2185 1670 1383 213 1186 --11615
NM_014106chr15102824 2174 2094 2086 1089 904 734 488 454 191 --1301 1969
NM_014112chr885353 1848 1347 1027 953 730 521 440 65308 5234 4541 2125 912 55 12031 13486
NM_014141chr784320 3987 3256 2138 1871 1777 947 476 35360 3668 1514 25005 1170 --
NM_014155chr1197127 6918 6770 5369 2550 2488 2110 2102 1218 36354 5817 341 --24837 346
NM_014217chr181879 1767 1574 1549 1469 1458 1437 1422 31739 1733 1356 11316 --
NM_014253chrX72274 2153 1906 1634 1007 924 203 --2908 860 --
NM_014331chr4286950 6764 6714 5838 5699 5654 5089 5029 4976 3002 2920 2652 2335 2136 2083 1996 1989 1972 1933 1860 1216 994 976 673 518 475 169 157 47835 7307 2442 2257 27058 2400 --
NM_014333chr1181761 1029 990 779 555 504 226 86 --2683 548 --
NM_014423chr5105512 4397 4209 3800 2135 1574 573 373 315 280 21944 401 11250 --
NM_014548chr1551335 1303 520 499 340 1272 --1129
NM_014607chr252098 1998 1934 1408 431 ----154
NM_014616chr3103476 3161 2721 1334 613 552 189 96 51 32 --43323 1346 533 118 1807
NM_014635chr251655 1337 1197 364 265 --1405 11272
NM_014670chr271614 1607 1450 1421 505 372 311 ----1288
NM_014678chr22------2100 95
NM_014682chr872242 2033 1948 1715 1651 1510 132 --32055 393 311 11992
NM_014683chr1762100 2009 1422 1383 1325 704 --1603 1637
NM_014701chr1582883 2848 2709 1342 1180 385 208 112 13331 13221 23416 3383
NM_014707chr761717 887 671 295 250 75 22098 404 12203 --
NM_014711chr1621677 135 21528 362 21340 366 31906 1412 398
NM_014721chr636952 6751 6057 46582 5790 4827 518 15741 26429 4589
NM_014729chr852007 1965 1780 575 36 12260 --1629
NM_014733chr592093 1844 1831 1587 1541 1531 480 260 38 22196 187 1754 1224
NM_014752chr1151907 519 414 382 236 1497 11657 --
NM_014787chr182835 2651 2144 2040 819 499 433 140 --11927 12676
NM_014795chr271391 1042 1005 955 894 468 249 --1351 1433
NM_014802chr1221145 39 --2357 274 1302
NM_014803chr1092979 2758 2598 2147 1971 1945 1917 308 240 1719 12742 --
NM_014810chr183717 3250 2892 2708 2646 1066 391 139 23292 1258 31177 1008 853 13198
NM_014829chr552196 1975 1844 559 403 1941 1945 22409 1573
NM_014832chr1372090 1697 1448 1335 1296 747 292 1807 2811 250 --
NM_014841chr621270 1080 --21031 930 1874
NM_014864chr1103908 3518 3403 3384 2721 1562 1341 850 833 273 13498 ----
NM_014867chr873835 3735 3326 3144 3123 1025 1006 23255 2534 --1552
NM_014873chr1104820 4735 3670 3218 3171 1582 1366 715 339 39 1115 ----
NM_014877chr17227811 7743 7339 7288 7119 6645 6563 6068 6006 5400 5268 4884 4874 3011 2197 2046 1101 846 742 463 157 38 21195 1023 ----
NM_014879chr34960 921 194 122 2319 138 --1128
NM_014897chr1793060 2781 2565 2254 1253 711 645 291 86 ----1741
NM_014899chr573130 3082 2880 2357 2157 508 139 32575 2250 349 --13069
NM_014900chr24347 280 183 167 21164 1059 2922 174 1890
NM_014906chr17104039 4007 3999 3982 3516 3429 3330 3200 1334 1307 22743 419 53443 2919 2682 929 403 --
NM_014912chr1093357 3343 2611 1274 1187 673 494 342 263 --23063 235 12267
NM_014920chr663710 3414 3311 3292 3057 2863 1417 43468 1333 757 618 --
NM_014923chr135935 619 402 386 299 11685 --11890
NM_014936chr6132862 2769 2660 2509 1853 1778 1755 1151 1024 952 689 386 360 12178 22496 2256 --
NM_014942chr692628 1906 1864 787 764 605 504 498 128 2684 334 ----
NM_014946chr2122958 2273 1161 1115 1079 962 831 508 414 309 267 189 --1940 12894
NM_014953chr1364250 4104 3408 1115 319 120 13206 54389 4281 4165 2676 476 22703 217
NM_014962chr2092772 2668 2249 1114 1108 562 320 135 102 --22925 478 32733 826 771
NM_014982chr14245156 4987 4887 4783 4559 4355 4263 4027 3887 3862 3815 3699 3367 2068 1871 1795 1485 1333 1323 1118 1041 563 405 358 1977 44790 4104 1230 1177 --
NM_015000chr1293107 3052 2366 2185 1986 834 585 560 348 22920 856 32572 2342 2241 32437 2432 2036
NM_015020chr1653153 2906 2481 1201 687 --32763 2597 855 13861
NM_015025chr222608 535 2742 493 1698 22495 991
NM_015026chr12194562 4402 4349 4325 4213 4049 3939 3914 3304 3208 3085 2974 1846 1577 1468 632 360 145 98 13150 33546 1363 153 14385
NM_015040chr272779 2682 2495 2341 1039 966 724 11147 --23270 445
NM_015059chr1583712 3497 3109 3017 2719 2465 1281 1183 --23963 3085 12780
NM_015068chr7123516 3037 2980 2900 2686 2613 2605 2432 1540 1163 616 41 23988 3720 --13743
NM_015071chr595974 5778 5588 4995 4314 1440 1194 914 58 --46175 6168 2433 1312 --
NM_015074chr1134895 4889 4871 4791 4539 4430 4279 4138 3609 3091 1232 479 74 23838 1149 24230 3593 --
NM_015076chr6124257 4109 3951 3736 3161 2901 2839 1200 1175 1132 885 682 44548 4189 3870 3345 ----
NM_015087chr1352724 2401 1077 885 396 32470 1756 717 --11936
NM_015092chr16104542 4199 3969 2968 1383 1360 1282 862 835 716 54093 3801 3397 2923 793 54421 2951 1214 1184 1157 --
NM_015097chr372218 1930 1746 1577 837 502 250 1207 1263 1259
NM_015110chr982453 2064 1753 1707 880 584 430 83 --1473 --
NM_015137chr872572 2244 2212 1741 968 212 174 --1858 11864
NM_015141chr32671 160 11795 32402 1777 351 12766
NM_015144chr1663889 1293 1120 1007 761 696 14002 13044 --
NM_015170chr841787 1714 684 642 12095 --22033 1859
NM_015172chr161564 1443 1329 1211 254 149 --21200 297 --
NM_015192chr2052999 2958 2742 2254 1126 22782 260 22941 541 1606
NM_015199chr352985 2491 1064 871 254 2384 89 22945 2416 --
NM_015200chr492540 1931 732 695 540 472 408 344 73 ------
NM_015208chr1883966 3603 2677 2491 2456 1607 1468 1279 12759 13489 1790
NM_015247chr1675335 5071 3941 3291 969 640 435 24195 1778 --14291
NM_015265chr2102641 2321 2276 1919 1022 991 918 690 655 205 ------
NM_015271chr484291 4261 1571 1507 1320 1005 582 285 23433 2685 43503 3107 1732 1725 23441 1470
NM_015272chr1641524 1374 760 669 11385 2254 104 11865
NM_015275chr12122193 2018 1961 1823 1718 1552 700 572 441 328 283 156 31857 674 380 21493 1444 22038 1988
NM_015278chr662620 2486 1359 1147 985 834 --23378 2351 11158
NM_015310chr8138318 8045 7668 7621 6237 3370 2848 2707 1538 1339 741 660 123 1364 36571 5670 2632 15929
NM_015313chr11104533 4323 4047 1612 1551 1429 1151 381 247 165 --24210 257 --
NM_015314chr752318 2249 2137 1892 1857 11783 --11762
NM_015323chr6101685 1582 1568 1321 1134 705 528 358 269 128 21298 419 --11442
NM_015336chr12102489 2419 2375 1969 1924 637 425 371 248 223 31934 803 723 1625 --
NM_015347chr1262740 2079 1823 1813 999 210 12633 22807 2207 --
NM_015355chr1791951 1761 1608 1345 1254 718 569 545 55 12021 ----
NM_015365chrX92895 1538 1175 925 865 641 558 519 242 11691 42980 1683 1159 508 11075
NM_015387chr241671 1358 574 254 11402 32036 1597 1414 --
NM_015412chr3122743 2343 2251 2039 1908 809 658 630 309 268 144 134 1331 148 --
NM_015423chr1131533 1246 1156 ----11416
NM_015436chr493367 3211 3196 3123 1328 372 350 340 157 13274 ----
NM_015446chr11440 --51441 1055 449 427 90 --
NM_015455chr573756 3323 3186 3130 2572 1307 442 14004 131 12889
NM_015458chr8105132 4549 4496 4484 3644 1497 1411 950 665 75 --33333 3270 834 --
NM_015460chr351998 1931 1365 714 531 --21899 349 11631
NM_015483chr72800 305 1297 11150 2852 437
NM_015535chr2124126 3819 3192 3141 3030 2709 1437 1041 799 174 143 66 33204 3181 423 --14163
NM_015550chr7103590 3210 3191 2776 2724 1445 652 444 335 302 12365 13449 --
NM_015553chr6124622 4458 4183 4137 4001 2000 1688 1438 1271 1227 834 219 33985 3936 1042 23884 1146 --
NM_015555chr681733 1312 1242 1229 630 347 339 270 --11751 1646
NM_015564chr5133213 3191 3156 2217 1116 623 604 461 334 208 155 104 76 43370 3227 936 908 22506 1221 --
NM_015565chr2152031 1885 770 719 260 ----11998
NM_015569chr1134677 4515 4386 3022 2988 1489 1218 962 938 920 777 428 349 1727 23391 1294 --
NM_015571chr6132649 2608 2547 2500 2403 1762 1682 859 583 530 353 325 139 2848 625 11819 --
NM_015602chr151817 1583 1285 267 74 ----21808 1722
NM_015640chr194668 4309 4254 4128 3762 3584 1721 1088 243 23524 647 45203 4961 2069 1760 15240
NM_015646chr1231028 995 472 2488 56 --11237
NM_015852chr7123041 2878 2290 1205 872 704 620 536 452 284 200 32 12254 72700 1454 1040 956 788 368 116 12501
NM_015878chr852179 761 755 378 102 22104 1553 1171 2723 81
NM_015879chr18168180 7864 7257 6822 6107 5636 5437 3359 2776 2276 1890 1431 894 673 568 546 35315 2227 1807 66203 5304 2788 2036 1878 1608 16145
NM_015886chr8175621 5594 5337 5211 4634 4097 4079 3815 3713 3547 2254 2235 2167 1657 1091 950 535 --24105 432 24180 575
NM_015888chr1123057 2949 2469 2322 2216 915 658 652 512 339 278 151 32388 1170 1164 --12432
NM_015906chr1174747 4630 4576 4477 4462 4423 4219 4210 4109 4029 3922 3636 3542 3252 1629 1616 276 33956 3793 1440 23523 1795 11903
NM_016009chr1114682 4655 4069 3972 3516 1377 927 706 637 409 178 31546 754 624 33911 1413 1076 --
NM_016018chr8102346 2249 2207 2185 2062 1906 973 727 494 199 1422 --186
NM_016023chr861592 1367 603 380 326 210 41498 661 631 446 11988 41968 1842 707 579
NM_016040chr192679 2556 2298 2147 1902 1049 1012 875 128 --22095 903 --
NM_016075chr13133158 2985 2975 2935 2628 700 523 388 314 189 164 137 99 33197 2314 216 ----
NM_016081chr461802 1777 1646 1584 815 621 21993 434 11461 1901
NM_016083chr683470 3193 2605 2398 1195 734 716 631 23598 2750 1487 12735
NM_016096chr861979 1591 867 848 391 21 --21740 476 11944
NM_016132chr15103090 2872 2646 2621 2368 982 605 597 380 162 13405 12271 11145
NM_016133chr251200 1062 642 527 294 --11534 21098 547
NM_016156chr1192339 2315 2184 1995 1964 954 260 107 82 31700 1659 700 12237 --
NM_016206chr3238786 7068 6947 6780 6539 6114 6088 5771 5612 3286 2944 2334 2053 2044 2017 1987 1732 1498 1302 1267 1248 870 686 76446 2557 2296 1904 1345 1315 1011 46184 2925 2186 1759 16381
NM_016217chr6153429 3218 3083 2780 2505 2282 1289 1281 1023 947 575 566 293 167 89 ----1103
NM_016220chr7102074 2026 1803 1636 825 590 535 451 204 36 --2371 287 32016 1883 1767
NM_016248chr1383601 3411 3167 3063 3023 2924 567 382 24027 803 1170 33850 3005 2895
NM_016252chr23644 629 607 1728 --1144
NM_016255chr6113327 3306 3248 2442 2350 2191 2167 2159 1346 989 345 22883 195 32985 2515 785 --
NM_016257chr152227 1157 952 903 774 11046 23231 1273 23535 1360
NM_016260chr2227613 7566 7538 7057 6762 5737 5251 5055 5049 4665 2921 2891 2418 2306 2234 1537 1188 831 576 376 316 133 46715 2628 2269 253 55716 5394 1101 583 306 35728 5490 1613
NM_016271chr1862179 1525 871 683 584 578 1510 1111 11713
NM_016275chr372575 2060 986 928 841 770 494 52648 2123 1976 1052 757 12652 --
NM_016289chr252198 814 780 687 34 21503 232 22053 79 12343
NM_016297chr2103626 3221 3212 1371 871 713 681 614 577 31 31469 1448 878 23490 428 --
NM_016308chr161516 1433 1325 823 772 189 21995 257 1752 --
NM_016315chr261532 1223 1200 663 544 170 --126 --
NM_016396chr1562914 2836 2477 1900 1851 417 22455 1053 12464 --
NM_016422chr1163116 3021 2905 2333 641 539 12167 23193 2320 --
NM_016467chr231276 1216 1190 21209 286 --11418
NM_016513chr663710 3414 3311 3292 3057 2863 1417 43468 1333 757 618 --
NM_016519chr41391 --1403 2477 472
NM_016530chr15114042 3785 3530 3300 3275 3119 2988 2624 1404 888 539 11060 --13800
NM_016531chr493659 3271 3156 2595 1637 1316 1281 131 102 1675 34054 1507 108 11209
NM_016544chr263397 2795 1471 1362 378 242 --43856 3146 1586 141 32966 2563 2530
NM_016588chr67918 712 309 294 146 98 79 ----1894
NM_016617chr13112129 2001 1904 1792 1494 676 534 435 336 302 251 11522 11939 --
NM_016824chr1061200 616 532 506 387 165 11338 1257 --
NM_016929chr674073 4041 3870 3776 3108 2945 1282 --11819 24605 1139
NM_016950chr451391 1354 361 346 97 21452 375 11429 --
NM_016953chr2135521 5197 5170 4961 4908 4712 4144 1952 1713 1509 937 644 469 45545 4316 888 688 24700 809 --
NM_017415chr594575 4560 4272 3917 3749 2856 2850 1454 903 185 33116 1381 1115 --
NM_017420chr1441490 1308 1078 291 --43469 3351 952 752 --
NM_017423chr4112199 2036 1942 1912 1644 1509 1358 654 443 264 46 --12250 11546
NM_017437chr1442156 1861 602 325 ----31909 847 691
NM_017444chr851812 430 414 370 326 1629 11244 11659
NM_017447chr2194414 4229 4090 3926 3364 2914 629 368 347 21651 877 44356 2765 730 296 --
NM_017563chr3156105 5570 5420 5333 4831 4778 4637 4470 4153 3956 2306 1750 935 512 53 25770 4661 ----
NM_017610chr1542129 1628 1353 801 11590 1754 1411
NM_017628chr4115046 4774 4612 4393 3659 3610 1774 1208 1048 494 202 --35177 5165 723 1329
NM_017633chr663506 3117 1581 644 453 390 13435 22794 2600 --
NM_017637chr9149436 9309 7302 6093 5770 2300 2185 1774 1380 1102 919 597 519 359 25910 2648 28039 1411 22841 1914
NM_017643chr1773016 2634 2010 1173 1009 608 191 22915 1023 23108 2222 --
NM_017644chr3205152 4965 4764 4295 4160 3827 3336 3293 3276 3270 1908 1841 1803 1554 1459 1250 695 556 505 122 --21687 1480 --
NM_017645chr942911 2047 1182 557 22068 2062 22598 745 1761
NM_017650chr7115808 5763 5520 4618 3882 2400 1677 1647 1224 512 178 26020 4704 24254 2227 --
NM_017658chr14104233 3842 3495 3017 1736 1613 1594 1328 876 855 22939 711 11036 13351
NM_017666chrX112143 2048 1858 1718 1673 1635 1473 1466 808 345 21 162 ----
NM_017672chr1551374 1175 1169 1124 531 --1986 11053
NM_017705chr15143807 3101 2845 2589 2465 2298 1314 1266 1101 898 268 260 183 132 13542 ----
NM_017709chr1104070 3610 3112 2981 2718 1557 1345 1124 516 117 24322 3671 ----
NM_017762chr1572300 1793 1550 828 692 612 505 12435 11845 --
NM_017769chr1482906 2711 2644 2628 2322 2303 212 123 --23144 2106 --
NM_017770chr672588 1818 948 600 592 112 100 12297 21925 686 --
NM_017801chr372381 2144 1953 866 595 417 297 52567 2373 2358 2305 469 11876 --
NM_017813chr8164947 4737 4532 4483 4141 4011 3759 2105 1644 1119 985 896 702 637 455 358 45369 3786 1876 1600 24279 1925 --
NM_017831chr18124739 4678 4630 4548 4149 3491 3467 1826 1424 1144 908 165 44727 3599 1342 943 34402 4290 4006 --
NM_017919chr9115848 5790 5322 4583 4410 4335 3635 2134 2024 1941 423 11336 24397 3645 13602
NM_017987chr1042183 1852 1417 1365 21533 769 --1429
NM_018036chr1484349 4292 2842 1435 1406 491 284 89 11767 24247 665 2636 138
NM_018078chr431005 957 759 ----2912 785
NM_018084chr283020 2585 1329 1202 1132 661 606 382 1217 ----
NM_018085chr1107748 7623 7103 5505 5054 3237 1957 1052 912 150 46909 6422 6175 2879 ----
NM_018098chr351019 947 844 406 376 --31004 222 189 1262
NM_018126chr491312 1203 1112 474 436 399 372 297 106 --21343 115 --
NM_018133chr382228 2118 1971 1755 828 748 382 205 --1409 --
NM_018155chr373031 2664 1277 1110 405 381 330 32575 1153 491 --22361 965
NM_018157chr1242070 1990 1984 652 12022 23195 3110 11269
NM_018211chr161742 1366 821 810 401 296 --11684 --
NM_018214chr631314 1159 221 11103 --11176
NM_018227chr4123077 3058 3003 2748 2059 1228 1162 1026 754 375 120 83 42993 2798 2482 473 161 --
NM_018254chr1152379 2296 2276 2042 1753 1720 1705 1604 1597 1580 790 766 442 168 119 22320 617 21977 1501 --
NM_018293chr362832 2637 2300 1114 1047 101 1606 52744 2617 1814 1083 920 --
NM_018299chr8133494 3481 3214 3083 3062 2409 2378 2300 1179 835 720 706 250 --22979 2447 --
NM_018313chr352580 1840 865 858 101 11676 ----
NM_018318chr121765 1124 2823 169 1868
NM_018319chr1461141 1126 583 516 460 392 126 31331 503 202 --
NM_018342chr411699 11082 --21432 1087
NM_018348chr1651284 953 413 136 43 2931 22 --179
NM_018351chr1284761 4203 3874 2929 1236 1119 1113 29 172 43116 2985 1660 324 --
NM_018361chr8123178 3166 2660 2501 2476 1228 1195 873 637 371 335 86 23509 2803 34086 3555 706 11411
NM_018362chr1193908 3886 3406 3333 3122 2827 1360 487 107 64031 3264 3142 2600 1315 994 --22933 1151
NM_018364chr1123409 3382 2990 2895 2838 2785 1128 972 813 503 336 109 22617 259 11181 12877
NM_018374chr7184991 4730 4353 4334 3808 3649 3223 3209 1682 1575 1533 1499 1372 842 366 352 334 218 24145 1114 35198 3303 1629 24656 4454
NM_018375chr1431449 524 295 --11523 11407
NM_018429chr542521 2124 1142 1115 --52589 2163 2070 948 198 --
NM_018439chr18102476 2447 2096 1908 1611 695 248 221 114 28 --2589 487 --
NM_018440chr8138101 7619 7369 6975 6797 5366 3452 3305 3163 2521 2476 1468 1099 22976 1625 15299 11302
NM_018566chr1104733 4629 4493 3810 3241 1685 1523 1431 1120 834 31971 962 913 24152 564 --
NM_018569chr471547 1168 1056 432 389 319 249 1220 11605 21421 601
NM_018638chr12175681 5175 5077 3996 3886 2112 1991 1900 1471 1246 1080 1032 909 886 407 255 102 35573 5403 596 1515 25432 269
NM_018650chr131840 1455 663 4864 783 649 506 ----
NM_018662chr133698 2943 698 --14241 24183 396
NM_018672chr174858 732 668 52 ----1657
NM_018695chr572177 2032 1924 1797 920 768 200 --2914 757 --
NM_018698chrX71399 1241 556 460 383 53 37 11633 11548 --
NM_018834chr55918 810 695 325 318 1969 1869 --
NM_018847chr961475 1425 1368 778 738 643 --11657 11981
NM_018898chr552346 1937 1918 1534 707 12021 12227 11660
NM_018899chr552346 1937 1918 1534 707 12021 12227 11660
NM_018900chr552346 1937 1918 1534 707 12021 12227 11660
NM_018901chr552346 1937 1918 1534 707 12021 12227 11660
NM_018902chr552346 1937 1918 1534 707 12021 12227 11660
NM_018903chr552346 1937 1918 1534 707 12021 12227 11660
NM_018904chr552346 1937 1918 1534 707 12021 12227 11660
NM_018905chr552346 1937 1918 1534 707 12021 12227 11660
NM_018906chr552346 1937 1918 1534 707 12021 12227 11660
NM_018907chr552346 1937 1918 1534 707 12021 12227 11660
NM_018908chr552346 1937 1918 1534 707 12021 12227 11660
NM_018909chr552346 1937 1918 1534 707 12021 12227 11660
NM_018910chr552346 1937 1918 1534 707 12021 12227 11660
NM_018911chr552346 1937 1918 1534 707 12021 12227 11660
NM_018947chr7104814 4697 3686 3207 1926 1401 517 407 208 94 34908 4894 1495 21456 704 --
NM_018958chr1564059 3706 3301 3121 3026 836 33218 2583 1637 12851 --
NM_018970chr752659 2258 2176 715 404 22053 90 1149 11193
NM_018992chr1621590 1400 --11580 11560
NM_018999chr10104963 4653 4453 4413 3932 3572 3094 3084 1837 1016 11807 43155 1569 1330 454 --
NM_019001chr3104669 4241 3646 3449 3397 1533 1136 1025 736 27 24635 3025 24532 3586 --
NM_019004chr782254 2211 1976 1924 1687 557 422 90 --182 --
NM_019022chr18113176 3115 2513 2424 2401 2163 1266 1104 447 225 65 ------
NM_019035chr421781 419 --11417 22020 229
NM_019044chr274768 4761 3840 662 647 394 336 14436 1359 1262
NM_019050chr451895 1690 1658 871 256 1710 1347 32274 2063 1478
NM_019067chrX114898 4882 4562 4534 4301 3975 3725 3619 3338 3322 295 12981 11804 --
NM_019069chr3102621 1886 1861 931 780 374 217 175 125 76 ----12348
NM_019072chr5113654 2974 2697 2642 1657 1595 1490 1428 1222 1049 693 53504 2670 2654 1421 1102 --11086
NM_019080chr1361534 1499 1043 1028 967 950 11244 11248 --
NM_019083chr181645 1608 1093 1048 502 344 334 183 21135 388 --11374
NM_019084chr1082603 2152 1859 1044 871 658 561 434 --22364 881 --
NM_019087chr581622 1461 1387 699 476 312 216 67 ----11173
NM_019098chr851691 1629 373 357 36 11728 21592 337 --
NM_019114chr972446 1682 890 740 711 626 423 11021 --2696 579
NM_019117chrX83300 2865 2758 2342 1130 712 135 41 11379 ----
NM_019593chr2042422 2274 454 218 2744 106 11057 1673
NM_019891chr15903 429 237 225 150 2884 125 21153 1126 --
NM_019903chr1061200 616 532 506 387 165 11338 1257 --
NM_020122chr2125969 5888 5740 5681 4857 4199 1644 1342 1303 1044 177 93 24405 4163 34772 4250 2100 --
NM_020141chr171981 1734 1527 957 815 518 89 12308 22118 941 12002
NM_020143chr23369 351 167 --1239 2398 194
NM_020144chr781999 1890 1691 1400 1361 635 210 111 ------
NM_020150chr1061909 1829 1375 399 392 333 1808 --1320
NM_020177chr5103068 3055 3040 2872 2118 1121 968 824 637 148 22591 956 --12427
NM_020199chr541276 1009 161 32 --1515 1505
NM_020245chr674662 4359 3998 3220 1904 1882 1110 33305 3251 1650 14850 --
NM_020337chr483051 2706 2088 2012 1996 1257 1042 958 --1915 --
NM_020341chr2031944 587 448 11497 2474 52 11804
NM_020342chr262483 1725 1059 756 685 548 --31884 1646 438 12247
NM_020347chr352326 1883 570 514 183 11795 32183 1585 482 22179 2034
NM_020390chr3154644 4580 4551 3897 3638 3263 3193 3112 1836 1670 1476 1312 188 161 56 34808 3930 1014 11442 24387 4068
NM_020443chr1116989 6890 6282 5899 5420 5117 4990 2669 2206 370 269 25009 4700 26856 5973 1787
NM_020455chr652815 2434 2401 2382 280 --12406 1842
NM_020466chr6124861 4650 4432 4381 4342 4274 4183 3818 1834 1556 910 607 33514 3472 374 23651 1571 11870
NM_020473chrX81922 1818 1681 1660 1337 1297 209 43 11244 1105 --
NM_020640chr35907 861 403 227 111 --11923 11668
NM_020647chr862276 1798 1593 843 272 168 ----1883
NM_020651chr261794 1197 627 612 261 36 --21812 1453 --
NM_020654chr371665 1594 1485 1058 1024 579 429 --1489 --
NM_020673chr20227402 7349 6692 6409 6336 5736 5614 5426 5201 4891 4731 3054 2924 2833 2679 2321 1861 1496 1455 1308 394 126 14975 35444 4880 1653 16902
NM_020704chr751976 1949 1919 1791 94 12393 21843 815 --
NM_020711chr262377 894 636 368 167 50 22608 1685 52423 2266 1689 1044 295 12371
NM_020718chr16136620 6515 6419 5896 5795 5584 5162 5067 4591 2268 1700 1415 813 16185 25007 1833 35261 2653 160
NM_020727chr21153935 3853 3704 3502 3492 3319 3261 2834 2557 1518 1444 1307 920 806 703 32861 1345 592 ----
NM_020734chr1222769 570 --32439 2334 1167 1694
NM_020739chr15104069 3962 3905 3322 1210 672 537 392 193 95 24139 3042 44055 3283 2968 1552 --
NM_020748chr1761900 1731 790 695 540 336 21541 125 ----
NM_020766chrX94301 3853 3811 3107 1649 1529 889 295 258 24597 3994 21087 468 --
NM_020771chr691278 1215 557 363 307 274 124 59 41 11383 21202 598 --
NM_020772chr17128266 7302 7208 6865 6531 6395 5849 5297 2516 1914 1016 217 17365 38223 2971 1653 27505 471
NM_020774chr18236164 5855 5671 5342 4997 4906 4879 4751 4663 4619 4464 4219 2236 2124 1702 1348 1032 1014 518 343 311 218 93 76061 5306 5292 4709 4426 4079 632 2788 239 --
NM_020782chr1284371 4098 3073 1859 1410 1135 904 288 23029 824 44773 4529 1820 978 1960
NM_020783chr1872125 1984 661 581 479 392 179 12013 1955 --
NM_020786chr1681674 1375 1326 585 414 403 339 112 21878 330 ----
NM_020792chr372306 2107 2039 430 407 161 86 12611 --1927
NM_020794chr1121434 1413 1403 1367 1349 1285 1113 1080 996 416 302 60 ----11334
NM_020796chr551037 962 853 524 514 22194 491 22943 1010 --
NM_020802chr1173170 2684 2152 1353 1269 339 319 22839 1250 23407 3384 --
NM_020819chr661054 898 878 870 849 206 --2932 129 --
NM_020830chr242728 2443 2392 1075 23108 939 --12572
NM_020841chr1233628 3416 1102 43824 3122 2472 648 33464 1283 879 22843 489
NM_020844chr8127548 7423 7175 7072 6701 6055 5600 4962 2791 1982 1379 396 44701 2846 873 747 22321 1591 14879
NM_020859chr454011 3729 3427 2762 535 44049 4022 3996 897 13290 --
NM_020868chr271869 1813 1471 1236 592 517 329 21724 1364 ----
NM_020870chr452212 1973 721 649 550 21776 702 2389 313 --
NM_020871chrX92179 2061 1645 833 430 389 375 330 68 42313 2020 309 291 21609 820 --
NM_020872chr361822 1754 1637 1368 1118 212 ----2496 361
NM_020909chr293830 2781 2686 1433 1263 1226 939 469 75 13687 14071 --
NM_020940chr10102690 2653 2531 2031 2003 1906 1003 867 507 435 22149 594 22112 1112 --
NM_020948chr1153451 3396 3087 2705 2687 2674 2587 2573 2321 1025 964 745 370 288 149 22593 2395 22811 271 13052
NM_021007chr221563 413 41788 701 321 285 22342 433 --
NM_021033chr1373539 3149 2431 1170 1104 961 592 13498 23363 688 --
NM_021083chrX173651 3329 2877 2741 2649 2602 1456 1428 1415 1312 1284 1122 1069 896 702 309 221 --12352 23408 601
NM_021101chr362563 2440 2360 1725 720 405 12312 1532 11802
NM_021148chr792467 2454 2433 2253 1703 995 786 578 412 1929 22185 65 1774
NM_021183chrX62169 1742 1611 980 807 301 1954 11989 11870
NM_021191chr1252417 2231 2163 1812 309 21624 76 22071 1022 32255 121 55
NM_021201chr1172043 1878 1671 1634 824 175 159 ----11750
NM_021215chr2062131 1604 701 656 177 144 1626 12391 12180
NM_021255chr14133185 2889 2750 2531 2519 1605 1583 1434 1371 1249 633 388 361 11084 23265 1426 11139
NM_021647chr4114631 4565 4422 4348 4012 3551 1619 1579 944 903 444 1333 43109 3030 3007 1850 --
NM_021813chr675592 2142 1698 1128 1030 667 644 1633 23722 3673 25568 5563
NM_021814chr661591 1438 1301 1154 548 486 3426 315 142 2307 117 --
NM_021821chr124757 172 65 37 ----2817 529
NM_021911chr5165614 5255 5144 4939 4133 4030 4000 3550 3444 1844 1336 1275 1157 1096 998 299 45555 5152 4465 3654 15230 45208 4982 4188 1111
NM_021954chr1383640 3413 2929 2468 2412 2317 973 903 --23215 2642 13059
NM_021961chr11107191 6774 6200 5926 5055 4951 4627 1999 1718 404 11471 1549 --
NM_021964chr3105985 4468 4348 4278 4245 2642 2553 1618 1236 354 46439 4813 4196 1926 ----
NM_021999chr132752 596 1573 --1144
NM_022041chr1682503 2344 2337 2304 2240 2183 1890 647 ----11857
NM_022049chr151892 1576 1567 1497 1195 11431 31656 1346 318 11879
NM_022058chr251966 1715 620 447 109 31785 730 606 22009 1352 --
NM_022091chr642575 2526 2388 2261 41080 1030 865 68 2978 550 --
NM_022114chr164769 2901 1425 1398 1379 550 --23995 1436 14101
NM_022351chr873479 3293 2467 1387 689 194 164 22901 2461 33546 1547 1303 --
NM_022456chr1255847 5620 5210 2591 349 12799 47197 6726 2067 230 11112
NM_022459chr13156274 5755 5637 5319 4984 4801 4568 4317 4046 2207 1570 1252 1202 899 92 46334 6239 4993 1232 51356 1318 1162 639 25 25881 2536
NM_022462chr19133109 3043 3013 2929 2707 2623 2524 2417 2375 1371 1240 1048 986 --13022 12465
NM_022469chr132372 2091 974 12584 13078 12911
NM_022473chr1574175 3771 3397 3258 1163 636 457 14187 23603 372 --
NM_022475chr41130 --1269 1121
NM_022476chr1631058 978 326 --31033 770 221 2939 56
NM_022491chr12103416 3341 3048 2946 2780 2688 1309 1290 786 466 1922 11145 --
NM_022763chr353215 2400 1100 707 618 12267 32905 1026 357 --
NM_022781chr972940 2838 2368 2161 1237 238 23 --32239 1202 1113 --
NM_022824chr521941 1581 --21887 1284 11726
NM_022831chr161610 1460 1429 736 543 159 --31794 1479 277 --
NM_022845chr1662171 1766 1460 321 219 193 --12250 1314
NM_022893chr263001 2401 2198 1089 920 834 --3791 407 330 --
NM_022898chr1474766 3596 589 470 417 249 224 1452 23303 1559 --
NM_022900chr71815 ----21181 348
NM_022901chr931611 1579 604 21527 554 11534 11412
NM_022918chr1131882 364 155 21609 536 21766 350 11421
NM_022977chrX72527 2261 2210 1984 1068 932 187 1498 --22362 992
NM_023929chr842752 2061 540 459 --32813 979 635 12325
NM_024052chr1722905 905 1679 --13133
NM_024091chr51182 2253 173 --1190
NM_024345chr9135954 5779 5550 5533 5403 4987 4905 4605 4344 4153 4001 2058 61 1719 44782 4015 1416 699 --
NM_024607chr864127 2993 2793 1712 1514 572 24433 3708 33712 2849 1363 --
NM_024611chr1543835 1239 947 305 2673 28 32533 2503 56 13463
NM_024636chr772690 2514 1145 1099 948 679 617 31993 803 43 ----
NM_024641chr673013 2834 2610 2601 2100 1033 42 12760 1230 32740 612 461
NM_024646chr153596 3311 1260 1113 165 12809 33035 1427 1403 --
NM_024665chr3114698 4585 4360 4173 4037 3949 3127 1885 1610 1386 1325 --11269 --
NM_024670chr1081718 1282 1216 647 580 398 382 118 31592 551 360 1111 --
NM_024740chr11144100 3927 3779 3770 3719 3622 3453 3399 3232 3094 954 661 638 49 23815 3505 14042 --
NM_024744chr282574 2337 1019 922 842 262 207 24 31929 1884 666 12026 --
NM_024751chr421603 1578 --11878 1342
NM_024761chr965055 4936 3319 1116 744 341 12085 45133 3299 1371 1297 --
NM_024770chr2216477 6327 6183 5873 5758 5607 5313 5210 5115 4640 4601 4359 4216 2605 2345 2213 1580 558 527 303 229 21988 720 25145 4155 --
NM_024824chr1451603 1248 528 515 154 11549 21720 1715 --
NM_024828chr9111448 1409 1302 1198 1037 1004 425 415 208 73 58 ----1565
NM_024884chr1493609 3051 1510 1483 1419 1087 476 330 158 11772 --22783 77
NM_024913chr731667 1473 1386 1192 --11227
NM_024947chr3289614 9344 9240 8951 8876 8647 8543 8525 7943 7465 7110 7047 6891 6799 6697 6565 6028 5941 3439 3340 3316 2601 2223 1790 1367 1006 290 209 --46529 1109 446 167 31088 373 344
NM_024949chr4124946 4642 4265 3506 1968 1774 1730 1543 1133 701 185 162 11565 23335 1079 --
NM_024989chr2268158 7968 7722 7110 6957 6413 6385 5828 5786 5670 5229 5037 3143 2610 2513 2342 2045 2038 2009 1818 1367 1334 1164 787 462 226 1815 68025 7406 7214 2999 2949 32 26205 641
NM_024993chr221525 209 ----21090 388
NM_025054chr8133838 3722 3696 3563 3299 3196 2916 1327 818 714 473 280 274 12565 21389 645 23519 110
NM_025134chr16112100 2041 1939 1770 629 520 411 349 263 247 176 1571 42525 2030 720 387 12411
NM_025146chr362262 2203 819 753 299 64 2990 308 1402 --
NM_025147chr241191 848 397 271 1302 --1195
NM_025160chr163566 3552 1350 1117 1032 855 31213 939 932 13888 --
NM_025191chr1103325 3200 3181 3134 2772 2524 2498 2402 878 335 23063 2246 33355 2841 2692 13165
NM_025214chr18102679 2644 2609 2289 1782 905 757 670 591 509 --12565 --
NM_030621chr1483962 3422 3192 1614 1438 1217 977 945 33937 3680 121 21477 1248 --
NM_030625chr1032522 2324 963 --11806 12264
NM_030627chr5184123 4045 3804 3727 3441 3265 3046 3031 2882 2551 2522 1313 1099 776 752 649 622 524 23704 1436 53953 3305 2714 1155 951 --
NM_030637chr14--2491 133 1548 1618
NM_030647chr7145264 5230 4962 4854 4492 4170 3848 2461 2349 2302 2099 1978 1559 1241 12236 46029 2240 428 334 --
NM_030648chr4105394 5172 3942 3850 2182 1443 1116 910 787 469 45568 3626 1021 984 15105 11983
NM_030664chr1052297 2048 1950 564 533 3783 707 332 11787 --
NM_030674chr12185193 5126 5101 4898 4813 4549 4379 3904 3821 2178 2154 1899 1626 1153 699 484 374 201 14504 35166 3675 2098 --
NM_030755chr14132953 2806 2418 2349 2059 1937 713 633 616 378 301 220 212 33112 2896 969 22878 2252 1815
NM_030763chrX7785 704 635 313 288 121 26 ----1742
NM_030777chr2092455 2399 2299 2188 1750 1654 1643 1596 762 1545 1615 --
NM_030791chr1481750 1618 1597 1572 1557 1543 1154 131 2268 105 1717 --
NM_030806chr1149454 9336 8099 7723 6995 6041 5903 5728 2921 2881 2477 2329 1735 1708 27211 3609 38721 7141 6538 19071
NM_030817chr1283750 3427 3164 3151 2682 2521 2294 1499 13453 --11465
NM_030881chr2272253 1647 878 824 280 173 122 --12111 11569
NM_030918chr1115190 4821 3882 3522 1988 1794 1624 1584 627 519 435 13569 15260 --
NM_030934chr171844 1694 1426 1260 91 70 51 --2366 272 11643
NM_030953chr551484 1453 1339 478 368 174 1218 1202
NM_030963chr62638 172 ----2646 429
NM_031296chr4122721 2651 2610 2540 2499 2357 1881 1730 1704 886 622 29 22766 2006 --11861
NM_031411chr552346 1937 1918 1534 707 12021 12227 11660
NM_031427chr14185550 5207 4888 4812 4735 4087 3931 3682 2295 2247 2139 1313 1154 866 792 631 428 391 25266 1600 ----
NM_031435chr12103364 3147 3076 2901 2638 2164 1314 717 464 81 1937 1710 --
NM_031438chr561672 1268 589 406 162 37 41927 1608 1560 1414 11418 2625 617
NM_031468chr796945 5840 5515 5141 5026 2234 1874 1422 1337 25069 1377 48238 5965 5288 1254 --
NM_031469chr6133828 3606 3214 3059 3053 2573 1436 1421 1401 1297 1039 850 831 22740 1003 13803 23584 2702
NM_031483chr2093382 2942 2652 2313 2266 933 707 603 467 12988 --22385 924
NM_031844chr1123917 3862 3642 3296 3045 1131 1057 942 741 716 419 342 --11029 --
NM_031849chr552346 1937 1918 1534 707 12021 12227 11660
NM_031857chr552346 1937 1918 1534 707 12021 12227 11660
NM_031860chr552346 1937 1918 1534 707 12021 12227 11660
NM_032012chr9174916 4799 4567 4272 4122 4013 3958 3682 3436 1849 1795 1737 1326 747 387 207 55 25156 38 13471 --
NM_032025chr33430 406 114 31408 477 331 2381 362 --
NM_032047chr392341 2093 2004 1804 1590 944 479 191 146 1258 21638 870 1784
NM_032102chr1172980 1135 962 461 331 271 170 --13127 --
NM_032116chr13155893 5196 5135 4882 4426 3999 3904 3753 2032 1351 1238 732 500 478 22 1856 14094 15770
NM_032145chr691735 1720 1358 1226 329 247 232 103 47 ----1739
NM_032160chr1894246 4201 3713 3469 2951 1566 1548 926 889 44222 3152 3140 3062 --13145
NM_032175chr561841 1512 1502 1496 1130 270 1325 --11630
NM_032182chr1071553 491 461 393 261 241 229 ------
NM_032199chr1073613 3129 2817 1181 808 741 596 32902 2747 2457 1582 13068
NM_032217chr441217 1170 1018 335 1922 11078 2987 567
NM_032228chr1182863 2853 2839 2234 1034 871 438 369 --33111 3078 3056 --
NM_032291chr151939 1849 735 71 31 31505 406 338 --1318
NM_032303chr971829 1592 1368 1342 741 647 521 ----21141 586
NM_032321chr243205 2893 2334 806 --13181 13074
NM_032373chr10165947 5512 5220 5075 5031 4855 4776 4542 4228 3651 3639 2112 1830 1541 1178 527 24181 1784 1280 14848
NM_032440chr1062270 2012 737 621 601 84 42647 2341 1168 483 ----
NM_032446chr5133131 2914 2788 2769 1292 1125 1058 843 798 600 480 416 104 12701 13670 --
NM_032457chr473768 3160 2472 2445 1312 230 172 --1962 13869
NM_032471chr62845 288 --11062 1333
NM_032505chr352275 2025 606 374 257 12677 21915 738 22073 1111
NM_032509chr862510 2338 1009 927 822 717 1368 1602 12578
NM_032521chr2073001 2400 2028 1956 1037 402 358 22214 194 ----
NM_032682chr373507 2951 2312 2265 1434 1412 967 42749 2723 1368 418 32649 1327 310 --
NM_032778chr3103043 2788 2627 2611 2503 2486 2212 1034 816 803 32350 719 87 ----
NM_032804chr104859 779 684 540 1884 --22270 470
NM_032832chr6101726 1669 1452 1174 1103 486 285 227 199 187 --21351 50 --
NM_032833chr161759 786 769 734 433 132 ----22611 2551
NM_032859chr13103362 3023 2996 2904 2704 2633 741 407 175 37 13751 13712 11524
NM_032873chr1153545 3280 3050 3018 952 13978 44368 1363 178 111 11160
NM_032968chrX74014 3630 3173 3162 2988 1672 1457 33883 217 54 21619 186 --
NM_032969chrX74014 3630 3173 3162 2988 1672 1457 33883 217 54 21619 186 --
NM_032973chrY74006 3622 3168 3157 2983 1666 1635 33875 217 54 21618 186 --
NM_033020chr1174747 4630 4576 4477 4462 4423 4219 4210 4109 4029 3922 3636 3542 3252 1629 1616 276 33956 3793 1440 23523 1795 11903
NM_033081chr2031058 128 91 --11032 11335
NM_033132chr1341976 637 630 516 32334 1635 854 32066 1589 1452 1175
NM_033143chr4113999 3776 3411 3387 2821 1681 1672 1614 1581 1041 550 43453 1658 1307 183 --13926
NM_033181chr683470 3193 2605 2398 1195 734 716 631 23598 2750 1487 12735
NM_033211chr581778 1279 814 445 366 299 285 29 --1355 --
NM_033224chr7127640 7532 7312 7167 6758 5985 5814 5449 5151 3087 3037 731 37737 2441 2316 42814 1740 1154 1006 11305
NM_033285chr882995 1380 788 752 642 603 592 390 14216 ----
NM_033290chrX123675 3572 3522 2595 2409 1141 909 869 792 514 205 196 23710 1265 ----
NM_033326chr1142463 2426 2310 1019 --31945 945 222 11013
NM_033338chr1061361 1199 1036 526 233 105 ----1126
NM_033339chr1061361 1199 1036 526 233 105 ----1126
NM_033360chr12144175 3969 3774 3663 3004 1457 1403 1047 596 575 521 219 170 35 21562 46 34165 3161 1764 --
NM_033425chr1173285 2687 2558 2400 2207 1340 920 33179 2738 1152 1625 13507
NM_033429chr1562962 2791 2782 2142 1070 54 12924 13054 12182
NM_033480chr631082 783 232 32354 2195 2189 11117 13000
NM_033481chr631082 783 232 32354 2195 2189 11117 13000
NM_033505chr2166768 6723 6234 6165 5518 4986 4821 2647 2192 2053 1483 1367 1216 1102 896 622 11402 2905 289 15929
NM_033644chr542292 2197 1017 178 --21836 360 32542 751 615
NM_033645chr542292 2197 1017 178 --21836 360 32542 751 615
NM_033656chr21195958 5355 5334 5215 5132 4945 4898 4815 4630 4609 3963 2319 1869 1171 870 661 587 92 21 14347 35421 1905 1808 23705 1306
NM_052832chr873018 2985 879 810 724 520 360 --52820 2618 1881 1138 566 12578
NM_052862chr121477 480 --2396 364 1381
NM_052879chr12153707 3671 3526 2936 2930 2818 2782 1345 1268 1178 822 635 282 255 166 12667 23896 1086 13564
NM_052885chr12224680 4495 4330 4260 4182 4157 3862 3804 3757 3481 3462 3273 3253 3115 1772 1725 1502 1435 1219 1002 598 228 24904 4732 34994 4209 1417 13163
NM_052904chr631351 421 337 41276 438 239 124 11014 --
NM_052917chr2113361 3320 2666 2614 2606 2312 2255 2088 915 552 493 32961 625 597 1138 --
NM_052918chr1073404 3199 3078 2574 1443 485 311 22360 2283 --11357
NM_052927chr53812 805 436 ----21563 870
NM_052932chr1172418 2120 873 867 692 236 56 --2859 711 22376 501
NM_052937chr852396 2259 328 291 35 --2796 544 12555
NM_053016chr9115078 5016 4902 2689 2355 1962 1766 1647 1209 812 661 56659 3062 2524 2239 1399 ----
NM_053042chr4103108 3037 2660 1949 1228 942 629 437 114 71 2881 829 1995 --
NM_053043chr7146406 5974 5831 5408 5351 5338 4541 4176 2573 1534 1132 772 340 158 15875 14617 15021
NM_053064chr14103108 2685 2609 2447 2409 2288 1045 698 435 204 22781 2423 ----
NM_054016chr161786 1678 1423 1313 1285 297 11305 ----
NM_054016chr161786 1678 1423 1313 1285 297 11305 ----
NM_054016chr161786 1678 1423 1313 1285 297 11305 ----
NM_058241chr282323 2184 1846 1652 1633 1513 1432 921 --11945 142
NM_058241chr282323 2184 1846 1652 1633 1513 1432 921 --11945 142
NM_080591chr973134 2959 2074 1249 1117 745 168 --1490 22773 401
NM_080629chr161119 1041 528 463 236 229 21271 600 11404 --
NM_080630chr161119 1041 528 463 236 229 21271 600 11404 --
NM_080671chr252234 1987 1947 1684 133 11476 --12255
NM_080676chr2063054 2647 2363 257 207 133 22372 1060 12993 11071
NM_080764chr2273253 1299 658 471 291 285 143 --21185 273 --
NM_080832chrX61804 1736 1687 1179 449 172 31393 1348 1304 31375 1336 89 --
NM_080867chr1484916 4655 4466 4379 3726 1611 1234 455 15063 43126 513 295 270 24144 3148
NM_080872chr8103561 3059 2862 2782 2524 925 626 531 390 99 12515 33088 2490 1326 --
NM_080927chr363284 2704 2183 2146 1096 754 --22289 1356 12255
NM_130391chr9113221 3098 3041 2853 2735 2406 1433 1053 767 363 177 21219 269 ----
NM_130392chr9113221 3098 3041 2853 2735 2406 1433 1053 767 363 177 21219 269 ----
NM_130393chr9113221 3098 3041 2853 2735 2406 1433 1053 767 363 177 21219 269 ----
NM_130435chr1082981 2840 2377 418 277 264 251 100 --167 132
NM_130436chr2142640 2253 370 343 --22192 1863 22682 947
NM_130438chr2163217 2830 2170 947 920 390 --22769 2440 23259 2079
NM_130439chr1022310 1568 152 --11489
NM_130439chr1022310 1568 152 --11489
NM_130809chr552733 2719 2632 2429 292 21165 264 --32591 1207 734
NM_130838chr1531882 1579 1323 21190 58 11661 21657 1203
NM_130839chr1531882 1579 1323 21190 58 11661 21657 1203
NM_133265chrX53613 2506 926 564 249 12621 22795 697 12249
NM_133329chr271760 1660 1331 1301 751 420 350 1508 --11453
NM_133334chr485177 5073 4845 4367 1941 863 521 490 11349 24298 4203 11958
NM_133370chr4153590 3384 3092 2816 2751 2667 2618 2450 1241 1149 986 592 266 110 83 12740 --12724
NM_133372chr5112688 2621 2517 2396 2378 1966 1905 1002 404 397 237 21898 457 --1839
NM_133468chr742012 1896 778 389 --12101 32357 862 287
NM_133478chr272482 2434 2406 2220 1736 518 431 42571 2356 2134 542 --12561
NM_133493chr684586 4571 4317 3886 3262 3222 1640 1443 23662 2940 21137 1011 13335
NM_133496chr1124418 3958 3737 3641 3559 3066 3004 1227 1153 840 276 163 34074 1633 1173 14144 --
NM_133638chr531417 900 207 --21073 120 1107
NM_138286chr19134367 4339 3804 3430 2799 2789 2764 2688 2668 1728 1273 1044 445 11539 31012 609 64 13606
NM_138292chr1193584 3556 2721 2639 2507 1338 1142 967 956 13347 22676 759 --
NM_138316chr1021382 1336 --11129 2185 136
NM_138333chr962470 2336 669 409 187 84 22087 1718 ----
NM_138423chr1572288 2004 1806 1485 742 574 404 21663 1565 ----
NM_138444chr13114627 4551 4478 4031 3918 3881 3791 3292 3074 780 594 14245 13200 --
NM_138459chr6103491 3325 3131 3009 2728 2229 1294 436 401 21 33152 2577 789 2119 103 --
NM_138468chr2106301 6192 5894 4023 1704 1274 692 650 310 283 14520 35512 4346 4222 15520
NM_138494chr7112562 2349 2343 2312 825 486 449 394 313 61 35 --22470 143 --
NM_138576chr1474766 3596 589 470 417 249 224 1452 23303 1559 --
NM_138621chr264188 3290 2896 1264 1213 685 ----11677
NM_138694chr6103703 3529 3513 3325 2657 2374 1309 1015 753 420 32857 574 479 --32938 2764 220
NM_138713chr16268010 7999 7949 7881 7809 7789 7230 6547 6489 6444 6334 6088 5877 5861 5704 5630 5582 5055 2489 2239 2038 1888 1178 1019 668 34 2438 315 77153 7125 6567 6558 5993 5512 2615 --
NM_138714chr16268010 7999 7949 7881 7809 7789 7230 6547 6489 6444 6334 6088 5877 5861 5704 5630 5582 5055 2489 2239 2038 1888 1178 1019 668 34 2438 315 77153 7125 6567 6558 5993 5512 2615 --
NM_138715chr862101 1839 1519 1502 1442 325 1786 12155 --
NM_138731chr14124119 3239 3203 3151 2992 2908 2862 1501 1282 933 696 574 13085 11215 --
NM_138782chr592431 1963 1910 1798 1767 937 549 272 185 --41597 1509 732 362 --
NM_138959chr1166350 6341 5841 5709 4546 4478 4433 4198 2679 2571 2147 2089 1254 981 488 316 --26008 5095 15821
NM_138970chr1472351 2042 1612 858 849 821 798 12223 12402 --
NM_139048chr31309 21232 1055 1172 21197 1046
NM_139169chr1031507 782 263 21852 793 42195 1999 387 157 --
NM_139207chr12112248 2185 1638 876 864 842 746 456 334 240 110 2676 658 11952 --
NM_139321chr2023927 3058 43985 2908 1466 879 34012 3393 676 14146
NM_144567chr1102723 2221 2187 2053 1884 1121 1058 912 334 24 22783 2295 ----
NM_144571chr4186271 6209 6148 6050 5300 5292 5072 4718 4498 4342 2725 2304 2090 1737 1681 1416 716 511 55873 5455 2298 1567 841 36065 5459 1884 24532 220
NM_144578chr14115260 4594 3964 2179 2041 1736 1188 977 867 802 272 54640 4447 4406 1704 557 ----
NM_144632chr282369 2299 2119 866 802 425 273 222 1495 11818 --
NM_144664chr11141969 1863 1796 1785 1728 1706 1671 991 966 950 928 488 403 381 --42256 2124 2086 1646 --
NM_144721chr472686 1902 1894 1113 1097 1059 436 32562 590 465 12783 --
NM_144778chr13102738 2701 2347 2334 1871 1798 668 393 377 128 22507 595 11959 1989
NM_144949chr272177 1988 1012 945 930 680 529 11628 1992 --
NM_144963chr8102234 2205 2194 1976 1681 1029 958 751 366 328 32363 2160 1813 --12293
NM_144973chr1295005 4706 3755 3634 3570 868 854 821 183 25163 4051 24969 166 --
NM_145037chr351464 1312 1145 1129 1111 ----11327
NM_145207chr4135054 4841 4054 3995 3588 3255 3238 1884 1564 1293 861 539 127 24790 792 35162 5131 4778 11102
NM_145251chr1461281 1152 1034 467 430 322 1477 1397 --
NM_145259chr2186876 6798 6370 6294 6250 5969 5860 5760 5270 4951 4659 2468 2257 1988 1744 1331 1030 209 --24541 4441 16730
NM_145263chr462148 1614 861 464 222 213 11939 --1555
NM_145291chr41410 ----2445 440
NM_145307chr1083766 3397 3259 1002 869 799 764 743 21252 835 43905 3221 262 55 21380 350
NM_145320chr7103590 3210 3191 2776 2724 1445 652 444 335 302 12365 13449 --
NM_145321chr7103590 3210 3191 2776 2724 1445 652 444 335 302 12365 13449 --
NM_145322chr7103590 3210 3191 2776 2724 1445 652 444 335 302 12365 13449 --
NM_145686chr253300 3261 3245 1191 865 1936 12230 11038
NM_145687chr253300 3261 3245 1191 865 1936 12230 11038
NM_145808chr7103026 2938 2627 2322 2101 1986 1040 756 354 135 12925 23085 329 --
NM_147175chrX51451 1349 779 752 156 ----12178
NM_148174chr852179 761 755 378 102 22104 1553 1171 2723 81
NM_148571chr1771309 666 611 429 338 331 78 1415 ----
NM_148955chr1586526 4830 2482 2451 1916 1693 1660 1373 --45088 2472 2088 1700 --
NM_148977chr1021382 1336 --11129 2185 136
NM_148978chr1021382 1336 --11129 2185 136
NM_152261chr1242529 2098 920 313 11755 --12345
NM_152263chr1145986 5724 5328 5200 4476 4374 2300 2186 1843 1779 1267 1255 414 369 26025 4687 24707 4573 --
NM_152277chr562131 1522 709 401 228 124 11721 --11693
NM_152300chr1761902 1466 1303 636 620 38 21198 524 ----
NM_152344chr1731114 441 274 ----21496 189
NM_152388chr2104033 3665 3058 2959 2660 1322 1259 822 369 185 --22734 500 --
NM_152399chr451234 1102 486 439 172 21031 152 --1831
NM_152407chr562663 2480 2430 2421 2151 437 --1802 --
NM_152409chr5103502 3478 3371 3076 3061 2784 2722 707 623 86 43145 2875 973 725 1574 --
NM_152433chr1141595 1417 1179 492 --1482 21701 202
NM_152510chr222698 604 ----2841 836
NM_152551chr662911 2833 2061 1118 961 815 ----1853
NM_152556chr7122410 2226 2165 2142 2042 1609 1019 748 649 563 299 163 ------
NM_152608chr1112370 2325 2020 1760 1673 1036 897 839 644 413 387 --32293 2245 2112 --
NM_152622chr583313 3233 2995 2909 2789 2719 2299 2275 1988 23190 873 23067 2354
NM_152624chr5106822 6384 6309 5804 5792 2538 1813 1557 1454 933 36342 5608 1133 37168 5635 4641 16812
NM_152641chr1252726 2362 2034 594 304 ----1449
NM_152673chr384235 3870 3814 3512 1690 1629 1278 319 54202 3261 2866 1007 596 33342 3049 2796 --
NM_152678chr372537 2469 2250 1872 1657 543 495 1681 --21087 764
NM_152699chr373704 2847 2785 858 366 209 135 ----13155
NM_152754chr7103773 3767 3032 2995 2988 2783 581 373 281 171 --53532 3440 2880 982 81 23727 1408
NM_152756chr5103806 3643 3358 3260 2770 1748 1539 1183 1058 935 1732 33821 1364 221 24219 3036
NM_152758chr892635 2622 2186 1162 921 884 834 310 27 22811 482 22912 1979 22668 2650
NM_152765chr841687 1543 683 494 12401 22334 1631 12346
NM_152774chr752417 2070 2022 905 212 1440 21074 514 --
NM_152787chrX103682 3554 3083 3036 2547 2399 1271 997 563 245 23207 1227 21043 699 --
NM_152793chr7104885 4865 4343 3615 3581 3302 1933 1633 679 257 21013 849 24620 1000 --
NM_152826chr1586526 4830 2482 2451 1916 1693 1660 1373 --45088 2472 2088 1700 --
NM_152890chr151061 894 260 202 25 11158 21089 947 11191
NM_152903chr1382756 2731 2239 984 975 479 345 210 1601 1275 1169
NM_152924chr15156906 6880 6826 6565 6183 5986 4740 2586 2229 1853 1218 804 720 697 627 56270 5458 4750 1271 1046 26027 663 26897 1346
NM_152995chr41858 --2886 336 1310
NM_152996chr131995 1380 1317 11701 --31725 246 164
NM_152999chr7125049 4757 4719 4650 4031 3926 3509 3322 3169 800 733 161 --31872 1301 219 1368
NM_153013chr592477 2125 1849 1820 786 588 536 528 278 --1636 --
NM_153018chr17103307 3187 2854 2611 2453 2151 2031 1065 785 394 12106 32820 630 581 --
NM_153042chr641813 495 457 428 31259 613 607 ----
NM_153182chr3103043 2788 2627 2611 2503 2486 2212 1034 816 803 32350 719 87 ----
NM_153184chr351569 1557 1326 1231 781 --2795 769 --
NM_153188chr5115632 5542 4704 4674 4621 3714 2061 1758 827 799 767 64245 4108 2267 1276 1003 608 15308 34417 908 469
NM_153207chr1232528 832 631 23402 2715 33695 1097 503 --
NM_153235chr662323 2281 2107 263 226 178 21890 767 32432 1932 410 --
NM_153256chr1051583 1490 1410 637 401 11857 --11567
NM_153262chr151042 944 656 460 285 2935 257 1292 --
NM_153332chr8112954 2700 2619 2275 2041 994 983 817 758 724 491 ----1261
NM_153365chr482792 2547 2167 2125 2031 1995 1960 677 22299 902 12101 --
NM_153367chr1083345 3023 2669 2582 2493 1555 1320 1019 ----13222
NM_153689chr2112003 1875 1648 1583 1517 806 639 362 218 193 67 --32271 1989 86 --
NM_153705chr11112428 2339 2322 2232 2170 1001 783 346 324 279 105 ------
NM_153810chr10134728 4715 4622 4441 4202 4028 3292 2034 1849 1620 1422 578 156 ------
NM_170710chr483155 3003 2536 2397 928 844 817 751 --33011 2478 794 1182
NM_172058chr841890 1867 1693 758 --1535 1681
NM_172059chr841890 1867 1693 758 --1535 1681
NM_172060chr841890 1867 1693 758 --1535 1681
NM_172069chr271638 1537 710 674 241 213 150 22278 658 11446 12114
NM_172070chr2122027 1768 1752 1643 1577 825 594 387 293 174 77 48 ------
NM_172071chr1206969 6682 6393 6010 5125 2967 2635 2535 2503 2489 2470 2461 2359 1756 1619 1207 418 409 236 121 12795 67418 6544 2666 2449 778 176 1200
NM_172103chr662394 1748 886 752 481 146 22107 771 1508 167
NM_172105chr662394 1748 886 752 481 146 22107 771 1508 167
NM_172193chr142837 347 21135 100 21179 181 --
NM_172232chr174858 732 668 52 ----1657
NM_172240chr1211045 --1403 2210 181
NM_172344chr271760 1660 1331 1301 751 420 350 1508 --11453
NM_172373chr137880 364 321 296 129 102 72 21325 197 ----
NM_173082chr651394 1286 1131 467 263 --21218 169 21417 1066
NM_173198chr942785 2262 2058 509 22997 2348 22146 254 11064
NM_173200chr942785 2262 2058 509 22997 2348 22146 254 11064
NM_173214chr16268010 7999 7949 7881 7809 7789 7230 6547 6489 6444 6334 6088 5877 5861 5704 5630 5582 5055 2489 2239 2038 1888 1178 1019 668 34 2438 315 77153 7125 6567 6558 5993 5512 2615 --
NM_173216chr362431 2407 2139 1910 1066 729 ----22529 2398
NM_173217chr362431 2407 2139 1910 1066 729 ----22529 2398
NM_173468chr4145263 5218 5111 4971 4769 4734 4633 4477 4427 1833 1420 1089 771 219 55653 4108 3843 1664 1118 34871 1887 1319 13802
NM_173500chr1541200 1102 569 342 1360 --11158
NM_173510chr2242900 2751 983 840 2545 510 31898 787 532 --
NM_173511chr293594 3478 3176 3037 3025 2842 2761 1566 367 13835 22498 1212 13012
NM_173519chr871961 1906 1613 1474 1436 1312 481 11996 11563 11330
NM_173531chr19163858 3491 3053 3013 2846 2721 2693 2681 2537 2509 1295 832 752 669 466 57 13109 1141 11036
NM_173536chr4115114 4159 4061 3504 1537 1357 1299 426 321 275 45 33951 3882 87 51629 1618 299 255 181 --
NM_173552chr372432 2321 2171 1779 1007 828 489 32221 1651 936 1835 --
NM_173576chr1032344 1556 628 1585 42233 2124 1927 423 1644
NM_173582chr11136107 4351 4275 4060 2337 2053 1902 1811 1212 1056 982 614 332 24589 293 65988 5689 5586 4331 2266 501 46159 763 222 205
NM_173602chr12123821 3604 3038 2803 2498 2310 1091 991 896 831 520 342 43742 3665 2337 334 12515 1582
NM_173632chr19113394 2932 2460 2172 2164 717 635 563 481 417 306 22788 1163 33341 2549 390 12320
NM_173642chr198457 7787 7363 7177 5891 5707 5568 1164 673 47937 5826 5674 455 17387 --
NM_173644chr2071760 1417 1393 1240 810 521 412 --31823 1627 1296 --
NM_173648chr221097 753 --11079 2198 107
NM_173694chrX92363 2245 2218 2209 1988 907 485 189 157 --12373 --
NM_173808chr1104380 4121 3913 3774 3372 1268 1073 601 368 162 1838 33391 3267 1507 --
NM_173829chr5166175 6113 5669 5576 5303 5012 3993 2381 2266 2248 2216 2168 1482 1424 976 306 45088 1126 442 31 21653 712 14285
NM_173830chr62921 835 1276 1580 174
NM_174911chr844014 3417 2939 1024 23454 1239 13661 13233
NM_174916chr1572196 1718 1558 1484 817 256 240 12370 22168 1881 32299 382 57
NM_174921chr43793 319 307 --1845 1834
NM_175623chr1255847 5620 5210 2591 349 12799 47197 6726 2067 230 11112
NM_175624chr1255942 5715 5305 2686 444 12894 47292 6821 2162 325 11207
NM_175625chr1255942 5715 5305 2686 444 12894 47292 6821 2162 325 11207
NM_175736chr12107732 7493 6838 6046 5954 5880 5123 1827 1739 447 67722 6197 5550 4731 3102 2664 --16825
NM_175854chr1382416 829 508 492 480 302 296 222 22034 720 21936 1738 1560
NM_175861chr12145968 5895 5344 5338 4871 4556 4534 3647 1473 715 684 477 324 120 22041 1135 35762 5522 1578 14923
NM_175876chr1112358 1927 1850 1743 887 874 852 800 627 480 240 ------
NM_175907chr1862206 1012 577 420 294 75 22257 1972 22587 2460 --
NM_175910chr1971807 1645 584 406 267 238 154 --7932 687 603 519 435 351 183 --
NM_175921chr594152 3965 3120 2964 2676 2608 275 204 196 1612 1707 --
NM_176081chr10145999 5917 5129 4373 3945 2214 2097 440 413 407 393 170 83 59 55877 5454 5226 1174 96 32375 2111 1196 11049
NM_176083chr10145999 5917 5129 4373 3945 2214 2097 440 413 407 393 170 83 59 55877 5454 5226 1174 96 32375 2111 1196 11049
NM_177424chr161831 662 357 190 183 153 11699 --1713
NM_177438chr1483962 3422 3192 1614 1438 1217 977 945 33937 3680 121 21477 1248 --
NM_177538chr2118759 8463 8400 7459 6536 6262 3542 3391 3006 2387 126 68262 7390 7111 5390 2619 869 36340 5669 166 --
NM_177968chr26860 826 724 523 430 31 11800 21745 708 --
NM_177974chr1572288 2004 1806 1485 742 574 404 21663 1565 ----
NM_177990chr2031944 587 448 11497 2474 52 11804
NM_178011chr10123074 2936 2695 2609 2426 2243 2131 2107 2068 2037 2008 1315 12545 1145 23216 368
NM_178151chrX116504 6102 6060 5230 3082 2641 1213 1052 963 780 323 67672 7462 5742 2495 1471 1161 16437 27519 6271
NM_178152chrX116504 6102 6060 5230 3082 2641 1213 1052 963 780 323 67672 7462 5742 2495 1471 1161 16437 27519 6271
NM_178153chrX116504 6102 6060 5230 3082 2641 1213 1052 963 780 323 67672 7462 5742 2495 1471 1161 16437 27519 6271
NM_178509chr17113743 3179 3000 2983 2722 817 692 637 315 303 205 23660 464 31626 531 406 --
NM_178566chr941813 1536 1370 693 2473 400 2337 303 --
NM_178578chr2042583 2378 2328 385 21882 1662 32302 2287 1975 --
NM_178812chr851635 1598 1155 1029 73 1105 1169 1256
NM_178815chr1082700 2589 2294 2279 2162 2147 1712 1054 12780 195 --
NM_180989chr1382474 2046 1987 1871 1862 1813 1518 809 --31994 1894 606 --
NM_180991chr5112408 1925 858 749 715 563 550 422 416 368 40 42678 1757 528 470 32602 2506 2228 --
NM_181054chr1461161 1077 867 488 230 161 --1298 1272
NM_181265chr483155 3003 2536 2397 928 844 817 751 --33011 2478 794 1182
NM_181358chr183810 3640 3253 2756 1194 262 243 222 34180 4124 1207 1835 --
NM_181443chr2092772 2668 2249 1114 1108 562 320 135 102 --22925 478 32733 826 771
NM_181453chr251655 1337 1197 364 265 --1405 11272
NM_181481chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_181482chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_181483chr18146948 6877 6745 6736 6422 5971 4868 4372 2423 2168 1785 1554 1185 144 24557 4335 32626 1162 1003 --
NM_181504chr583625 3232 2626 1066 821 798 577 34 24140 3102 --1252
NM_181521chr16127232 4790 4551 2841 2192 2117 1192 1152 974 941 621 123 --24875 92 14440
NM_181523chr583625 3232 2626 1066 821 798 577 34 24140 3102 --1252
NM_181524chr583625 3232 2626 1066 821 798 577 34 24140 3102 --1252
NM_181659chr2083295 2579 2539 1310 1269 497 462 272 22141 1364 ----
NM_181659chr2083295 2579 2539 1310 1269 497 462 272 22141 1364 ----
NM_181672chrX61953 1754 1597 1413 438 328 --21680 342 1733
NM_181673chrX61953 1754 1597 1413 438 328 --21680 342 1733
NM_181706chr1172055 1892 1659 788 726 627 621 21835 590 2600 191 --
NM_181714chr671973 1700 1677 1658 1286 1242 730 ------
NM_181723chr862249 2171 1804 1560 1506 524 32059 1531 705 1365 --
NM_181783chr12101965 1722 1481 1463 1423 622 449 375 312 243 21258 88 21894 1307 21975 1384
NM_181787chr8133751 3365 3063 3035 2507 2445 1547 1247 1150 1131 1040 705 404 23657 718 12995 1478
NM_181794chr62845 288 --11062 1333
NM_181795chr62845 288 --11062 1333
NM_181836chr572477 2145 1933 1053 822 300 60 --12614 2717 585
NM_181861chr1272847 2719 2601 2247 2190 1036 736 22822 1888 ----
NM_181868chr1272847 2719 2601 2247 2190 1036 736 22822 1888 ----
NM_181869chr1272932 2804 2686 2332 2275 1121 821 22907 1973 ----
NM_181897chr342620 2051 1785 555 21804 523 12267 12501
NM_182485chr473719 3386 3298 3243 3000 2658 202 1992 32614 1058 392 13672
NM_182515chr19146602 5438 5362 5192 2438 2209 2196 1879 1651 1405 1323 1244 314 150 55432 5332 5007 2529 1371 4726 566 398 231 16589
NM_182551chr242848 2795 192 144 12904 23459 2443 12951
NM_182646chr473719 3386 3298 3243 3000 2658 202 1992 32614 1058 392 13672
NM_182703chr1541452 408 103 39 ----1300
NM_182734chr2053246 3205 2989 2501 89 43029 1985 507 60 23188 788 22071 853
NM_182757chr663356 3000 2412 1394 1129 974 1313 21383 700 --
NM_182758chr1583562 3504 3338 3324 2739 2528 635 217 31239 410 313 1498 13921
NM_182762chr7196239 5763 5752 5729 5649 5533 5502 4949 4545 2355 2211 1784 1429 1218 937 900 540 369 181 11722 13986 44059 4017 3974 1952
NM_182765chr1062336 2124 1547 631 330 170 1710 --12108
NM_182830chr1461909 1800 1776 1438 847 31 32268 2095 2073 --11785
NM_182896chr371818 1709 1678 1517 1395 488 267 --11854 1500
NM_182898chr796488 6427 4634 4370 2532 2525 2296 2241 796 56153 5328 5301 4009 1425 55769 4664 4048 1495 1070 --
NM_182899chr796488 6427 4634 4370 2532 2525 2296 2241 796 56153 5328 5301 4009 1425 55769 4664 4048 1495 1070 --
NM_182948chr1112794 2364 2087 1945 1260 1227 652 567 536 501 100 ------
NM_183043chr138931 874 761 662 652 298 263 163 1175 1680 --
NM_183044chr138931 874 761 662 652 298 263 163 1175 1680 --
NM_183234chr1551562 525 277 194 161 11284 128 11400
NM_183235chr1551562 525 277 194 161 11284 128 11400
NM_183236chr1551562 525 277 194 161 11284 128 11400
NM_194247chr294392 4370 4114 3657 3474 3465 2977 1645 629 31552 1296 695 21206 401 --
NM_194282chr4113126 3059 2745 2637 2284 2243 1918 1179 896 310 243 145 2319 99 12201
NM_194285chr1153418 998 773 519 369 --1618 12354
NM_194291chr882972 2720 2161 2118 1093 957 587 500 --32330 2125 116 --
NM_194292chr161624 1256 1172 611 507 279 1427 1391 --
NM_194301chr1451119 393 299 152 142 ------
NM_194314chr1115628 5427 4582 4462 3945 3645 1132 1090 792 553 503 44939 4475 894 455 --11020
NM_194328chr972940 2838 2368 2161 1237 238 23 --32239 1202 1113 --
NM_194329chr972940 2838 2368 2161 1237 238 23 --32239 1202 1113 --
NM_194330chr972940 2838 2368 2161 1237 238 23 --32239 1202 1113 --
NM_194332chr972940 2838 2368 2161 1237 238 23 --32239 1202 1113 --
NM_194434chr18105405 5263 5057 4727 3992 1910 1872 1769 747 260 25751 305 --15677
NM_197941chr553084 2909 892 595 334 1502 23068 2939 1533
NM_198081chr662509 1938 1213 1061 786 209 1170 --11111
NM_198128chr1862179 1525 871 683 584 578 1510 1111 11713
NM_198181chr15112172 2139 934 742 481 318 215 185 157 127 65 21093 376 5232 202 172 144 114 22480 240
NM_198268chr183810 3640 3253 2756 1194 262 243 222 34180 4124 1207 1835 --
NM_198269chr183810 3640 3253 2756 1194 262 243 222 34180 4124 1207 1835 --
NM_198270chrX113228 2731 2461 2372 1184 975 924 810 729 428 290 ------
NM_198273chr5173019 2924 2914 2760 2574 2243 2155 2139 1157 823 660 549 431 386 340 313 93 ----1229
NM_198281chr483405 3390 3371 768 434 368 351 35 13025 21001 526 13085
NM_198320chr12115235 5211 5143 4978 3991 3495 3324 2101 2087 1869 773 35221 3922 488 43485 3273 1778 189 --
NM_198391chr2041104 1054 1004 247 1474 1140 11025
NM_198400chr15112894 2814 2420 1911 1182 1087 1075 1037 981 709 271 12741 12218 --
NM_198439chr1141595 1417 1179 492 --1482 21701 202
NM_198465chrX42916 2802 1822 1063 1259 32507 1875 572 12812
NM_198503chr162363 2190 1732 1593 1533 99 32174 804 246 22219 952 1809
NM_198549chr1102856 2828 2711 2368 2235 2187 1315 1307 1300 107 --22620 2554 12348
NM_198569chr652682 2301 2268 2249 147 --22273 1053 1709
NM_198578chr1251286 1211 1133 312 297 1592 --2278 144
NM_198581chr2177519 6984 6573 6429 5887 5856 5630 5301 4942 4834 2992 2618 2378 1936 1549 701 515 27552 5995 86245 5005 4755 4687 3027 1796 1196 787 11672
NM_198584chr881999 1902 1745 1683 795 759 732 333 12696 1105 12685
NM_198793chr383862 3028 2877 2624 1659 1503 1455 1350 14047 44051 3208 182 85 --
NM_198859chr3104855 4795 3780 3464 2043 1841 790 766 742 366 --23766 3668 --
NM_198889chr441217 1170 1018 335 1922 11078 2987 567
NM_198896chr1162087 1640 817 611 516 123 ----11998
NM_198900chr12107732 7493 6838 6046 5954 5880 5123 1827 1739 447 67722 6197 5550 4731 3102 2664 --16825
NM_198990chr772416 2220 1082 1024 959 173 41 23200 3119 21330 1039 --
NM_199132chr19122104 2054 2008 1625 1354 670 586 405 377 317 233 64 22047 40 2644 419 --
NM_199188chr12153707 3671 3526 2936 2930 2818 2782 1345 1268 1178 822 635 282 255 166 12667 23896 1086 13564
NM_199189chr55918 810 695 325 318 1969 1869 --
NM_199190chr12153707 3671 3526 2936 2930 2818 2782 1345 1268 1178 822 635 282 255 166 12667 23896 1086 13564
NM_199320chr462106 2029 2015 546 135 126 1887 --11898
NM_199320chr462106 2029 2015 546 135 126 1887 --11898
NM_199421chr1484916 4655 4466 4379 3726 1611 1234 455 15063 43126 513 295 270 24144 3148
NM_199436chr2122958 2273 1161 1115 1079 962 831 508 414 309 267 189 --1940 12894
NM_199454chr164769 2901 1425 1398 1379 550 --23995 1436 14101
NM_199482chr241671 1358 574 254 11402 32036 1597 1414 --
NM_201278chr1192339 2315 2184 1995 1964 954 260 107 82 31700 1659 700 12237 --
NM_201281chr1192339 2315 2184 1995 1964 954 260 107 82 31700 1659 700 12237 --
NM_201437chr861414 990 613 508 441 196 --1945 11522
NM_203282chr1951762 1592 1579 1231 376 31733 1377 1342 1213 --
NM_203350chr12652 453 11246 21682 1612 1284
NM_203390chr871707 1651 1332 565 540 261 22 1204 21721 1636 1512
NM_203394chr1262576 2022 2016 1845 1034 589 --22759 2292 1251
NM_203406chr562910 2762 2722 2243 1150 798 --21027 46 22688 2386
NM_203458chr153672 3650 3479 2360 475 --53185 2813 2799 816 114 --
NM_203459chr152452 2386 2075 1728 1004 --2788 222 11841
NM_203463chr2104931 4738 4146 3980 3614 3586 3009 1849 1789 548 24422 577 --11577
NM_205836chr53508 262 240 1228 1625 1233
NM_205852chr1232010 1991 160 1861 1138 1520
NM_206594chr1133617 3598 3089 3083 2631 2564 2545 2518 2493 2241 1154 828 298 33373 3234 1101 1126 --
NM_206595chr1133617 3598 3089 3083 2631 2564 2545 2518 2493 2241 1154 828 298 33373 3234 1101 1126 --
NM_206853chr6123681 3245 3064 2800 2755 1621 1560 1152 837 606 274 156 2745 47 2264 193 --
NM_206854chr6144942 4506 4325 4061 4016 3478 2098 1867 1535 1417 1217 1210 967 272 32006 1308 1269 21525 1454 --
NM_206855chr6185907 5471 5290 5026 4981 4443 4111 3847 2500 2382 2182 2175 1932 1237 814 765 417 165 22273 2234 22490 2419 --
NM_206866chr21113116 2808 2769 2649 2239 2228 2134 971 399 362 33 1336 23208 2711 --
NM_206876chr2123306 3233 2958 2602 2364 2356 2219 1418 1389 1248 729 436 32436 2205 228 23584 2380 --
NM_206907chr5133340 3179 2959 2925 2402 2230 2136 1251 919 892 658 596 363 22182 2082 32439 1113 310 22917 852
NM_206909chr8138318 8045 7668 7621 6237 3370 2848 2707 1538 1339 741 660 123 1364 36571 5670 2632 15929
NM_206938chr1172043 1878 1671 1634 824 175 159 ----11750
NM_206939chr1172043 1878 1671 1634 824 175 159 ----11750
NM_206940chr1172043 1878 1671 1634 824 175 159 ----11750
NM_207015chr321600 710 32412 654 460 22041 2010 21652 61
NM_207303chr1093766 3626 3254 2967 2872 2789 2751 1260 837 24124 607 1304 13927
NM_207304chr13112625 2588 2234 2221 1758 1685 1050 1041 555 280 264 22394 482 11846 1876
NM_207361chr13196241 6206 6027 5718 5467 5449 5088 4730 4604 4492 1957 1884 1781 1616 1285 1238 691 663 596 26086 5522 24157 3948 12470
NM_207406chr4156347 6241 6227 6070 5774 5360 4940 4883 4307 4134 3985 1938 1545 1376 1128 25957 816 15847 1425
NM_207647chr9102251 2133 1958 1825 1819 1724 1706 1649 579 414 22586 2558 11976 --
NM_207660chr1451603 1248 528 515 154 11549 21720 1715 --
NM_207661chr1451603 1248 528 515 154 11549 21720 1715 --
NM_207662chr1451603 1248 528 515 154 11549 21720 1715 --
NM_212471chr1732155 2095 1687 --1865 22312 1548
NM_212472chr1732155 2095 1687 --1865 22312 1548
NM_212558chr9113353 3255 3154 3055 3040 2937 1526 1316 971 450 260 32884 1541 1082 13623 --
NM_213589chr2105607 4800 4303 3635 3387 1869 1690 821 811 74 24206 3442 22007 1291 11950
NM_213606chr1082755 2691 2563 2511 2255 1719 808 306 11681 ----
NM_213651chr151728 1601 1289 694 654 11669 21258 1134 --