TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-183-5p
miRNA Sequence: UAUGGCACUGGUAGAAUUCACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521413 729 152 11924 --
NM_000044chrX3350 317 128 ------
NM_000052chrX32891 2152 36 --13010 --
NM_000061chrX------1382
NM_000081chr12419 216 ------
NM_000084chrX116112 5718 4879 4737 2717 2432 2391 1661 1639 786 252 --16832 --
NM_000088chr171887 --11063 1932
NM_000089chr72527 57 ------
NM_000090chr22689 632 ----1251
NM_000091chr242604 2306 1002 27 ------
NM_000109chrX42489 1931 1727 337 12337 ----
NM_000110chr11911 ----11027
NM_000125chr643856 3056 2625 246 13038 ----
NM_000127chr82286 102 ------
NM_000129chr631143 1065 228 ------
NM_000138chr1532605 423 297 2878 229 1609 --
NM_000161chr1441408 682 427 418 ------
NM_000163chr532271 2100 233 ------
NM_000165chr631124 555 541 ------
NM_000167chrX11249 2274 186 ----
NM_000176chr533557 3324 3063 13586 --22738 1294
NM_000189chr242335 589 80 68 ------
NM_000202chrX53669 3261 2895 2433 1183 22956 300 ----
NM_000210chr262276 1993 1643 1576 696 627 1411 ----
NM_000214chr2021573 181 11296 11337 169
NM_000245chr752087 1872 1736 763 696 1240 1483 --
NM_000248chr332370 2197 1973 ------
NM_000252chrX21429 1127 11292 ----
NM_000255chr6--1161 1155 --
NM_000259chr15106269 5904 5137 4807 4760 4422 2510 2323 861 545 34743 4401 4388 16354 15336
NM_000264chr953337 2347 858 311 115 12613 12584 --
NM_000266chrX2864 332 ----1849
NM_000267chr1743012 2846 2129 135 11261 ----
NM_000276chrX31628 1548 312 --12227 --
NM_000282chr131235 ------
NM_000288chr62344 103 ------
NM_000289chr121249 ------
NM_000297chr4--11477 --11795
NM_000304chr171836 ------
NM_000314chr1073151 2473 1243 942 683 233 98 22708 785 22934 213 --
NM_000321chr1331755 1643 228 ------
NM_000332chr6117211 6550 5294 4865 4566 2794 1040 796 462 334 131 --14495 12818
NM_000337chr596211 5396 5374 5341 2269 1609 1112 693 267 16393 1422 --
NM_000346chr171351 --11567 --
NM_000361chr2041989 1868 1836 474 1820 ----
NM_000362chr2212760 1150 22510 244 --
NM_000368chr934107 3685 1148 14738 --11936
NM_000371chr181101 ------
NM_000393chr221650 1552 11330 ----
NM_000396chr1----189 --
NM_000408chr243074 2965 2673 193 12877 ----
NM_000411chr2121138 423 12232 ----
NM_000426chr61139 ------
NM_000428chr1441982 921 814 269 12482 ----
NM_000430chr1762815 2752 1242 1203 558 358 1738 2853 318 --
NM_000439chr552029 1713 668 528 87 ------
NM_000442chr1711185 ------
NM_000447chr11164 ----181
NM_000451chrX1417 1322 --1855
NM_000452chr1321700 248 ------
NM_000461chr343403 3283 3130 873 --148 13453
NM_000462chr151461 ------
NM_000474chr7149 ------
NM_000480chr1121638 1516 1349 ----
NM_000489chrX42616 845 839 710 1337 ----
NM_000495chrX3394 113 102 1784 ----
NM_000503chr831531 1361 1355 ------
NM_000508chr42963 353 1845 1114 --
NM_000555chrX57880 7725 6112 2585 264 --16716 --
NM_000574chr131244 1150 987 11059 ----
NM_000598chr7--11195 1503 --
NM_000609chr1052738 2459 1259 413 209 1139 ----
NM_000610chr1121182 87 --1281 --
NM_000615chr1132374 1927 558 12242 --12648
NM_000618chr1244921 4627 4603 1306 --21219 909 16577
NM_000618chr1244921 4627 4603 1306 --21219 909 16577
NM_000619chr121431 ------
NM_000621chr1331426 909 340 ------
NM_000641chr1921564 1166 ----1442
NM_000663chr1633020 1093 385 --32772 2023 1933 22743 404
NM_000668chr431267 276 266 ------
NM_000673chr4132 ------
NM_000719chr1246029 5323 4248 1639 ------
NM_000720chr31140 ------
NM_000721chr172514 2424 2275 1974 1028 890 877 1213 11697 --
NM_000724chr1021675 193 ------
NM_000725chr1221018 815 ------
NM_000726chr23121 106 53 144 ----
NM_000793chr1433849 1891 1515 1882 15104 --
NM_000794chr541073 386 105 69 1824 ----
NM_000800chr511460 --11662 --
NM_000806chr521798 611 21362 602 ----
NM_000807chr42653 60 ------
NM_000813chr585039 4245 4026 3897 2258 1742 1555 432 --1491 --
NM_000814chr1543285 1570 1066 799 24061 1088 ----
NM_000824chr42346 118 ------
NM_000826chr442463 2001 1908 23 12253 ----
NM_000827chr542241 2221 1928 71 --21646 1639 --
NM_000833chr1631527 1350 1082 1164 ----
NM_000838chr652619 1823 954 777 655 11805 11083 --
NM_000840chr71160 ------
NM_000842chr11----1150 --
NM_000845chr71439 ------
NM_000868chrX11949 --22292 2235 --
NM_000875chr1556125 4340 2068 1438 1276 --16145 --
NM_000891chr1743192 2881 2650 1312 12543 ----
NM_000899chr1253929 3065 1469 1198 504 11225 ----
NM_000902chr321087 945 1546 ----
NM_000919chr51437 --1201 --
NM_000924chr12149 11367 ----
NM_000926chr11149225 8550 8268 7856 7475 7454 5891 2843 2011 1948 1728 1175 1110 406 12885 13306 --
NM_000933chr202601 528 1271 1512 --
NM_000945chr251770 1762 1485 839 426 ------
NM_000959chr142807 1063 908 229 2676 603 ----
NM_000965chr311127 ------
NM_001001132chr211396 --1444 --
NM_001001331chr331890 1019 954 1870 ----
NM_001001389chr1121182 87 --1281 --
NM_001001390chr1121182 87 --1281 --
NM_001001391chr1121182 87 --1281 --
NM_001001392chr1121228 133 --1327 --
NM_001001394chr21495 ------
NM_001001396chr174028 3865 3801 1546 1118 1087 550 44351 4234 4017 4002 1652 --
NM_001001419chr533197 1148 715 44423 3234 734 647 23900 2046 --
NM_001001420chr533197 1148 715 44423 3234 734 647 23900 2046 --
NM_001001436chr161143 ----1637
NM_001001481chr833487 398 230 22862 2163 ----
NM_001001484chr1012010 22271 644 ----
NM_001001556chr152115 66 --11590 --
NM_001001557chr8--22205 532 ----
NM_001001664chr243238 1530 411 275 --12873 12830
NM_001001668chr1924202 1479 --13277 13030
NM_001001669chr532300 2079 1851 --12218 --
NM_001001740chr1183 ------
NM_001001740chr1183 ------
NM_001001924chr821823 1499 --1444 --
NM_001001925chr821823 1499 --1444 --
NM_001001931chr821823 1499 --1444 --
NM_001001933chr12523 45 ------
NM_001001937chr18142 ------
NM_001001971chr1031404 565 65 ------
NM_001001995chrX41795 1745 1403 413 ------
NM_001002243chr21788 ------
NM_001002257chr272888 2427 2305 1244 1174 855 111 ------
NM_001002258chr2----21747 94 --
NM_001002264chr13187 ------
NM_001002294chr1161 ------
NM_001002838chrX1383 194 ----
NM_001002860chr1453472 3428 3391 1845 579 13971 13789 --
NM_001003406chr222615 330 ------
NM_001003652chr1825768 5379 47655 6189 5470 55 27721 5784 --
NM_001003674chr1876638 5866 5538 5491 1727 1304 510 ------
NM_001003675chr1876638 5866 5538 5491 1727 1304 510 ------
NM_001003688chr421220 895 ------
NM_001003698chr641279 1272 573 210 ----1170
NM_001003699chr641279 1272 573 210 ----1170
NM_001003712chr1273709 3406 2811 2531 1449 378 217 12864 --13061
NM_001003794chr373010 2316 1133 1127 776 720 259 ------
NM_001003800chr953517 2628 2335 1338 78 ------
NM_001003810chr41221 --1307 --
NM_001004304chr1273120 2928 2830 2007 866 725 711 ------
NM_001004317chr643474 3134 1657 1335 1672 1178 --
NM_001004419chr1244463 3273 1656 255 ------
NM_001005266chr151478 ------
NM_001005267chr151478 ------
NM_001005268chr151478 ------
NM_001005269chr151478 ------
NM_001005404chr1732852 579 114 14486 ----
NM_001005463chr1032063 2037 330 --11728 --
NM_001005476chr22702 508 --1487 --
NM_001005502chr1233178 1820 735 --24871 642 1761
NM_001005505chr341430 1375 554 299 ------
NM_001005526chr21101 ------
NM_001005739chr21183 ------
NM_001005746chr23121 106 53 144 ----
NM_001005747chr23121 106 53 144 ----
NM_001005910chr3----156 --
NM_001005911chr3----156 --
NM_001006118chrY1212 ------
NM_001006120chrY1212 ------
NM_001006600chr51484 1724 ----
NM_001006612chrX1105 ------
NM_001006613chrX1105 ------
NM_001006614chrX1105 ------
NM_001006938chrX--1653 ----
NM_001006943chr11230 ------
NM_001007023chr1433849 1891 1515 1882 15104 --
NM_001007024chr1783700 3497 3197 2910 1441 748 624 514 ------
NM_001007025chr1783700 3497 3197 2910 1441 748 624 514 ------
NM_001007027chr111230 ------
NM_001007088chrX21077 49 ------
NM_001007094chr1064316 4197 3429 3361 1621 811 11711 ----
NM_001007097chr954344 4058 1936 1290 59 11070 ----
NM_001007102chr6--1561 --1494
NM_001007156chr1521877 1524 --11896 --
NM_001007226chr171507 ------
NM_001007227chr171507 ------
NM_001007228chr171507 ------
NM_001007229chr171507 ------
NM_001007230chr171507 ------
NM_001007237chr132644 275 222 ------
NM_001007246chr2151838 1267 765 518 496 ------
NM_001007257chr111017 --11471 11271
NM_001007277chr1131035 859 134 --1436 --
NM_001007471chr93864 657 195 ------
NM_001007526chrY1212 ------
NM_001007527chr51107 ------
NM_001007559chr1832052 2022 1368 ----1552
NM_001007793chr101284 ------
NM_001008220chr533832 827 278 --23804 1366 11354
NM_001008225chr7----1481 --
NM_001008239chr1832875 1371 1086 179 1911 --
NM_001008392chr323068 667 1845 --12631
NM_001008401chr1921477 587 ------
NM_001008495chr811657 --141 --
NM_001008541chr1032058 1904 315 --22166 1810 --
NM_001008541chr1032058 1904 315 --22166 1810 --
NM_001008564chr1342272 2212 1793 1704 1157 ----
NM_001008660chr1121434 215 --11062 --
NM_001008783chr61282 1880 ----
NM_001008860chr151790 ------
NM_001008892chr151790 ------
NM_001008894chr151790 ------
NM_001008895chr1331295 1204 315 --172 --
NM_001008925chr44979 422 302 26 --13197 --
NM_001009185chr5--1551 ----
NM_001009552chr81559 1482 --1156
NM_001009566chr131094 535 50 --11308 --
NM_001009571chr741625 1221 502 476 ------
NM_001009814chr13180 ------
NM_001009899chr375656 2123 1591 1476 1254 662 300 15787 --14687
NM_001009909chr1153281 502 463 272 37 13684 11441 --
NM_001009955chr1----181 --
NM_001009955chr1----181 --
NM_001009996chr31115 --1421 --
NM_001010854chr14----170 1252
NM_001010888chrX43653 3070 2865 1350 --14563 --
NM_001010891chr566600 5805 4287 2646 1566 134 14833 24647 2275 --
NM_001010927chr6--1500 ----
NM_001010942chr1231319 1254 64 ------
NM_001011513chr453847 3357 2648 1065 499 12878 1894 --
NM_001011515chr42886 176 --11089 --
NM_001011516chr42886 176 --11089 --
NM_001011546chr201113 156 ----
NM_001011551chrX152 ------
NM_001011645chrX3350 317 128 ------
NM_001011657chrX2411 111 ------
NM_001011658chrX42026 1660 1653 398 21704 1491 ----
NM_001011666chr735599 1743 459 ------
NM_001011718chr202974 254 ------
NM_001011885chr152254 22 ------
NM_001012267chr921856 78 --11293 1676
NM_001012393chr1154898 4715 3506 1689 1333 --24885 592 --
NM_001012420chr1522693 350 ------
NM_001012423chr1532693 421 350 12236 ----
NM_001012755chrX73530 3418 1924 1823 1234 884 582 1696 1278 --
NM_001012761chr542263 1949 1711 705 22200 67 ----
NM_001012989chrX--1182 ----
NM_001013398chr7--11195 1503 --
NM_001013406chr711504 --11267 --
NM_001013620chr12128030 7313 6181 6040 6015 5944 3267 2585 2201 1545 843 399 1765 13284 --
NM_001013693chr132082 1928 535 ----12592
NM_001013693chr132082 1928 535 ----12592
NM_001013699chr121542 ------
NM_001014286chr13192 ------
NM_001014797chr1078152 7109 7053 5950 5537 2587 1432 ------
NM_001014809chr41637 ------
NM_001014812chr152419 379 ------
NM_001014831chr191653 ------
NM_001014832chr191653 ------
NM_001014834chr191653 ------
NM_001014835chr191653 ------
NM_001015508chr81621 ------
NM_001015877chrX32805 2400 262 ------
NM_001015882chr92377 254 ------
NM_001015887chr341805 1196 356 246 1656 11331 --
NM_001017368chr1732356 2020 136 1611 ----
NM_001017371chr21507 ------
NM_001017420chr821359 901 ------
NM_001017440chr7108018 6800 5462 5149 2961 1700 842 759 634 53 38169 5260 5225 16297 --
NM_001017523chr1231901 1445 1284 11252 ----
NM_001017923chr1421227 328 --21521 1257 --
NM_001018005chr151174 ------
NM_001018008chr151576 ------
NM_001018025chrX3810 572 563 1267 ----
NM_001018037chr931397 1234 404 11355 ----
NM_001018056chr91589 ------
NM_001018065chr975574 5460 5199 4296 2357 1683 32 16079 14921 24370 857
NM_001018066chr975574 5460 5199 4296 2357 1683 32 16079 14921 24370 857
NM_001018072chr1231901 1445 1284 11252 ----
NM_001018074chr533557 3324 3063 13586 --22738 1294
NM_001018075chr533557 3324 3063 13586 --22738 1294
NM_001018076chr533557 3324 3063 13586 --22738 1294
NM_001018077chr533557 3324 3063 13586 --22738 1294
NM_001018089chr1543767 3084 2733 1561 --22558 743 13521
NM_001018090chr1552453 2110 1011 79 36 22079 1973 ----
NM_001018091chr1552563 2220 1121 189 146 22189 2083 ----
NM_001018102chr1552453 2110 1011 79 36 22079 1973 ----
NM_001018108chr151695 ------
NM_001018111chr743499 2731 1523 1280 --163 --
NM_001020825chr521032 538 11061 --1213
NM_001023567chr1542080 849 705 421 ------
NM_001024094chr533557 3324 3063 13586 --22738 1294
NM_001024372chr842288 1555 558 101 --11485 1483
NM_001024455chrX52191 2171 1921 929 61 171 ----
NM_001024463chr153996 386 280 ------
NM_001024649chr532240 1909 921 --12717 --
NM_001024736chr1511445 --11347 --
NM_001024847chr312211 22397 203 ----
NM_001024912chr1941485 555 359 309 1515 ----
NM_001024948chr122240 396 --23089 24 --
NM_001025076chr1086026 4988 1699 1485 1243 1088 994 671 --25627 1811 12129
NM_001025077chr1087384 6346 2843 2601 2446 2352 2029 235 1180 16985 --
NM_001025079chr343713 3339 1023 618 23023 1617 13765 13317
NM_001025105chr51593 ------
NM_001025107chr122301 587 ----136
NM_001025107chr122301 587 ----136
NM_001025108chr263309 2866 1062 587 373 70 ------
NM_001025233chr1231997 820 258 ------
NM_001025252chr833235 821 80 22597 295 ----
NM_001025253chr833235 821 80 22597 295 ----
NM_001025266chr374791 3814 3507 1728 1386 481 390 --24628 242 --
NM_001025366chr631749 1640 450 ------
NM_001025366chr631749 1640 450 ------
NM_001025367chr631749 1640 450 ------
NM_001025367chr631749 1640 450 ------
NM_001025368chr631749 1640 450 ------
NM_001025368chr631749 1640 450 ------
NM_001025369chr631765 1656 466 ------
NM_001025369chr631765 1656 466 ------
NM_001025370chr631749 1640 450 ------
NM_001025370chr631749 1640 450 ------
NM_001025389chr1121638 1516 1349 ----
NM_001025390chr1121638 1516 1349 ----
NM_001025580chrX73756 3390 3186 1206 1185 567 122 11352 ----
NM_001025595chr41630 11337 ----
NM_001025616chr42540 526 ------
NM_001025780chr931603 1110 612 ------
NM_001029858chr642447 1111 1023 708 12525 13111 --
NM_001029863chr653111 2228 2016 1240 642 32267 1288 599 ----
NM_001030006chr1752091 477 273 238 140 ------
NM_001030055chr1433161 3015 412 ------
NM_001031623chr62726 169 --1565 --
NM_001031679chr1223123 2750 --1116 --
NM_001031700chr43311 246 240 --1376 --
NM_001031723chr42473 321 ------
NM_001031732chr453167 644 585 422 357 13260 12295 --
NM_001031740chr111234 ------
NM_001031748chr12----1570 --
NM_001031804chr1653529 3351 3031 860 709 11725 24104 1338 --
NM_001031812chr531776 1670 343 1124 ----
NM_001032280chr61577 ------
NM_001032282chr82904 466 ------
NM_001032283chr12------1213
NM_001032284chr12------1213
NM_001032288chr20------1203
NM_001032289chrX2144 37 1850 ----
NM_001032296chr1352888 2504 881 642 447 12878 11956 --
NM_001032363chr1187 ----11433
NM_001032363chr1187 ----11433
NM_001032380chr1031645 1381 626 --1662 --
NM_001032394chr622820 324 --1218 --
NM_001032395chr622687 191 --185 --
NM_001032999chr2035250 4668 4166 --1196 --
NM_001033047chr432353 759 523 --1662 --
NM_001033049chr212652 425 ------
NM_001033057chr342103 787 416 34 --11866 1435
NM_001033059chr61604 ----11995
NM_001033087chr2032452 2301 1284 ----13239
NM_001033117chr353932 3561 1920 1110 205 --11195 --
NM_001033507chr131602 1581 1368 ------
NM_001033557chr21937 11042 ----
NM_001033566chr171842 ------
NM_001033568chr171842 ------
NM_001033578chr841526 1502 398 285 ------
NM_001033756chr631683 1574 384 ------
NM_001033756chr631683 1574 384 ------
NM_001034025chr12------1739
NM_001034837chr52592 499 ------
NM_001034838chr52592 499 ------
NM_001035chr11437 1268 1980 --
NM_001035003chr421394 1341 ------
NM_001035004chr421394 1341 ------
NM_001035511chr131570 1520 307 ------
NM_001035512chr151677 1627 1410 414 66 ------
NM_001035513chr151677 1627 1410 414 66 ------
NM_001037131chr21517 ------
NM_001037132chr7--11568 --1756
NM_001037133chr7--11568 --1756
NM_001037164chr731497 405 108 ------
NM_001037172chr341345 1302 1217 950 1514 ----
NM_001037290chr111818 ------
NM_001037332chr512493 2712 75 1513 --
NM_001037333chr512493 2712 75 1513 --
NM_001037535chrX21001 529 11446 11300 --
NM_001037536chrX21001 529 11446 11300 --
NM_001037540chrX21001 529 11446 11300 --
NM_001037637chr5152 ------
NM_001037738chr5----186 --
NM_001037872chr21151 1736 --142
NM_001037954chr113602 328 110 ------
NM_001038707chr131975 341 26 ------
NM_001038707chr131975 341 26 ------
NM_001039091chrX2891 248 ------
NM_001039350chr771666 1646 1377 1351 1294 1253 1158 --1435 --
NM_001039479chr1452336 1900 606 260 238 ------
NM_001039538chr233331 3027 1017 ------
NM_001039574chr111015 --1267 --
NM_001039580chr433952 837 500 25085 1669 24535 3645 23786 1700
NM_001039585chr163064 1320 1165 486 217 160 2933 860 ----
NM_001039590chrX43763 2615 935 507 ------
NM_001039591chrX43763 2615 935 507 ------
NM_001039618chr1122340 1350 --11898 12034
NM_001039709chr2035250 4668 4166 --1196 --
NM_001039840chrX106027 5978 4753 2066 1698 1455 1417 597 258 36 15445 ----
NM_001039916chr122855 295 --1226 --
NM_001039917chr122855 295 --1226 --
NM_001039918chr122855 295 --1226 --
NM_001039919chr122855 295 --1226 --
NM_001039920chr122855 295 --1226 --
NM_001039937chr1344113 966 280 264 ------
NM_001040001chr621988 195 ------
NM_001040057chr721418 508 ----11262
NM_001040101chr441462 1210 413 30 ------
NM_001040142chr232262 871 69 1385 ----
NM_001040143chr232262 871 69 1385 ----
NM_001040151chr1124490 3861 --24164 470 --
NM_001040152chr774769 4366 3721 1959 1225 1159 315 13713 ----
NM_001040157chr432685 308 203 ------
NM_001040159chr421144 259 ------
NM_001040167chr711174 ----1444
NM_001040181chr34813 311 201 30 ------
NM_001040182chr34813 311 201 30 ------
NM_001040183chr34813 311 201 30 ------
NM_001040199chr34813 311 201 30 ------
NM_001040200chr34813 311 201 30 ------
NM_001040214chr652241 810 733 639 490 ------
NM_001040272chr911824 ------
NM_001040284chr1655375 3978 1740 1294 636 11953 15163 --
NM_001040402chr432618 1263 139 ------
NM_001040409chr2--2751 735 1342 --
NM_001040429chr1323364 2704 1662 ----
NM_001040440chr51161 ----1120
NM_001040446chr552122 1725 617 364 69 12270 1570 --
NM_001040450chr1522805 2398 12334 --1290
NM_001040453chr1522805 2398 12334 --1290
NM_001040455chr1121321 505 --1849 155
NM_001040655chr1521238 45 1208 ----
NM_001040656chr1521238 45 1208 ----
NM_001040657chr1521238 45 1208 ----
NM_001040658chr1521238 45 1208 ----
NM_001040659chr1521238 45 1208 ----
NM_001040660chr1521238 45 1208 ----
NM_001040665chr7104911 3696 3530 3274 1674 930 885 760 174 47 127 ----
NM_001040708chr81189 1933 ----
NM_001040709chr132583 1790 488 ------
NM_001040712chr943339 2762 2683 2385 --22819 1389 12402
NM_001040876chr41729 165 ----
NM_001042404chr11379 ----11405
NM_001042422chr17160 --1180 --
NM_001042423chr17160 --1180 --
NM_001042425chr61577 ------
NM_001042481chr14----1651 188
NM_001042492chr1743012 2846 2129 135 11261 ----
NM_001042493chr651962 1659 1499 1249 532 11365 1244 --
NM_001042494chr1563408 2654 1085 683 632 65 --11366 --
NM_001042495chr1563408 2654 1085 683 632 65 --11366 --
NM_001042496chr1563408 2654 1085 683 632 65 --11366 --
NM_001042497chr1563408 2654 1085 683 632 65 --11366 --
NM_001042537chrX52377 1771 1665 373 116 --11555 --
NM_001042555chr1274636 4409 4323 4179 3671 3139 665 14310 33206 1769 826 --
NM_001042599chr266404 6299 6127 4881 844 401 12133 ----
NM_001042601chr342785 2044 1124 865 --1465 11080
NM_001042603chr1285150 4513 4399 3531 1669 589 402 318 ------
NM_001042604chr374488 4011 3654 1865 1477 1321 960 11087 ----
NM_001042669chr42540 526 ------
NM_001042681chr132561 930 324 ------
NM_001042682chr132561 930 324 ------
NM_001042682chr132561 930 324 ------
NM_001043318chr1423725 3545 --11549 --
NM_001044722chr531776 1670 343 1124 ----
NM_001044723chr531776 1670 343 1124 ----
NM_001046chr542673 2367 2263 919 ------
NM_001071775chr1341828 1193 335 246 ------
NM_001079874chr151764 1465 468 386 232 ------
NM_001083620chr442461 1999 1906 23 12251 ----
NM_001083621chr194368 3957 3927 3703 1899 1622 1341 1142 364 13806 24150 792 --
NM_001099678chr395672 5404 4974 4579 4526 4124 1289 1045 653 35785 1685 467 14689 --
NM_001106chr3169617 9136 8842 8624 8567 7823 7585 3860 3554 3400 3108 2884 2870 1653 1612 116 26335 1249 47545 7014 2228 2163 12498
NM_001111chr122301 587 ----136
NM_001113490chrX23011 1332 33022 2357 1274 13383 1827
NM_001123chr103591 220 95 1668 ----
NM_001126chr161033 884 434 339 243 185 ------
NM_001149chr1031029 944 338 --1312 11246
NM_001153chr22828 74 ------
NM_001167chrX44457 2000 1017 568 15107 14257 --
NM_001173chr1433161 3015 412 ------
NM_001174chrX32064 716 213 11550 12335 --
NM_001186chr213695 483 286 22788 2724 ----
NM_001201chr443396 1211 443 356 ------
NM_001204chr297518 7283 5648 5183 2968 2636 1854 1258 763 12288 --16879
NM_001206chr91637 12741 ----
NM_001207chr5152 ------
NM_001215chr11381 ------
NM_001219chr72915 572 21666 549 ----
NM_001235chr111645 --164 --
NM_001237chr41969 ------
NM_001237chr41969 ------
NM_001238chr19--1494 ----
NM_001241chr252464 2392 2306 2100 1888 ------
NM_001241chr252464 2392 2306 2100 1888 ------
NM_001253chr6--1232 ----
NM_001256chr1752383 2052 1981 465 130 11186 21862 101 --
NM_001259chr755868 4739 4430 289 98 21389 840 ----
NM_001270chr5----11061 --
NM_001271chr1532755 1048 747 ----12324
NM_001274chr11146 ------
NM_001278chr101351 2797 47 ----
NM_001282chr1752091 477 273 238 140 ------
NM_001310chr1232544 1884 393 ------
NM_001313chr41637 ------
NM_001315chr632217 887 806 12260 ----
NM_001326chr111116 ------
NM_001331chr111100 12790 12158 --
NM_001343chr511603 ------
NM_001351chr311320 11133 --11583
NM_001364chr1154756 3727 1114 666 236 ------
NM_001378chr2----1191 --
NM_001386chr81957 12158 1979 --
NM_001387chr543079 2565 2520 692 --22810 2107 --
NM_001396chr21------11023
NM_001397chr142336 1900 898 316 ------
NM_001407chr311071 ------
NM_001416chr171103 ------
NM_001418chr112507 45 ------
NM_001418chr112507 45 ------
NM_001419chr1932949 1846 1805 --14218 --
NM_001423chr1231766 1614 713 ------
NM_001426chr21487 --1207 --
NM_001432chr433703 1524 1471 ------
NM_001438chr143243 2408 1367 1166 11350 ----
NM_001449chrX31269 951 294 ------
NM_001460chr133272 380 47 1833 1891 --
NM_001490chr983099 2569 1446 1396 858 805 557 364 11334 ----
NM_001541chr11--1150 ----
NM_001542chr132644 275 222 ------
NM_001543chr574649 3815 3437 1856 1408 968 664 1383 24761 1218 --
NM_001570chr321432 1359 1394 ----
NM_001587chrX31628 1548 312 --12227 --
NM_001616chr253508 3411 1135 720 375 12672 21176 818 --
NM_001621chr732736 797 120 ------
NM_001621chr732736 797 120 ------
NM_001634chr61604 ----11995
NM_001635chr7----11075 --
NM_001649chrX22291 428 ------
NM_001650chr1883937 3038 2965 1628 1548 1379 533 291 1122 ----
NM_001655chr1121976 172 --11561 --
NM_001656chr511852 ------
NM_001660chr31167 ------
NM_001662chr7------1358
NM_001677chr1--190 ----
NM_001678chr1711801 ------
NM_001683chr331890 1019 954 1870 ----
NM_001684chr173745 3582 3518 1263 835 804 267 44068 3951 3734 3719 1369 --
NM_001689chr2----21747 94 --
NM_001699chr193560 447 378 ------
NM_001701chr9--11043 ----
NM_001729chr41372 ------
NM_001730chr131540 ------
NM_001730chr131540 ------
NM_001731chr121593 ----1169
NM_001743chr21166 ------
NM_001745chr51218 11069 1377 --
NM_001746chr532240 1909 921 --12717 --
NM_001753chr72498 60 ----11631
NM_001755chr1632042 373 200 ------
NM_001759chr1245316 4173 1772 749 15027 ----
NM_001777chr343713 3339 1023 618 23023 1617 13765 13317
NM_001789chr351397 682 523 259 234 ------
NM_001798chr1231103 1037 1005 1314 ----
NM_001812chr41279 ------
NM_001819chr201251 ------
NM_001830chrX63876 3430 2994 1551 645 454 1905 144 --
NM_001854chr1268 50 11456 ----
NM_001855chr92565 218 ------
NM_001858chr621037 230 11994 24422 1906 --
NM_001859chr912726 --23289 3149 13979
NM_001874chr1233178 1820 735 --24871 642 1761
NM_001881chr101395 1129 ----
NM_001892chr51593 ------
NM_001901chr61339 --1155 --
NM_001924chr1--1509 ----
NM_001931chr112948 875 ------
NM_001935chr23692 673 21 ------
NM_001936chr771666 1646 1377 1351 1294 1253 1158 --1435 --
NM_001938chr13732 135 111 11612 --1160
NM_001945chr571345 1145 1132 1108 464 181 125 --11373 --
NM_001949chr632499 829 67 22253 555 ----
NM_001966chr3----1312 --
NM_001967chr32497 399 1573 ----
NM_001977chr41673 11245 ----
NM_001980chr1252235 2040 726 397 71 11928 ----
NM_001995chr441341 1253 355 267 ------
NM_001999chr5--21011 362 11223 --
NM_002006chr475690 4514 2151 1820 1456 1372 393 15649 ----
NM_002009chr15--1379 ----
NM_002015chr1332383 2144 269 13246 22200 242 --
NM_002024chrX42154 514 444 423 ------
NM_002025chrX58158 2399 2369 2042 604 12995 --18109
NM_002031chr61662 ------
NM_002039chr41841 ------
NM_002040chr2132658 2407 876 13086 ----
NM_002044chr152115 66 --11590 --
NM_002046chr121169 ------
NM_002048chr931096 466 269 ----11136
NM_002056chr21897 ------
NM_002076chr1242265 1020 749 198 12036 13205 --
NM_002077chr921417 194 ------
NM_002078chr31131 --2664 37 --
NM_002080chr164398 339 306 53 ------
NM_002092chr464133 4026 3910 3874 3375 652 33070 1761 1428 ----
NM_002114chr61153 ------
NM_002126chr1753832 2938 2671 630 224 --21198 275 --
NM_002128chr13--1944 --11715
NM_002138chr41221 --1307 --
NM_002139chrX----1514 --
NM_002146chr1711204 ------
NM_002156chr21182 ------
NM_002158chr233495 3373 888 --33418 1164 637 --
NM_002160chr9----1412 --
NM_002166chr21696 ------
NM_002182chr3--12500 --1820
NM_002193chr241929 1497 1328 131 ------
NM_002199chr41677 ------
NM_002202chr52933 241 ------
NM_002203chr552812 2644 1177 796 296 13140 --12569
NM_002210chr243223 3166 2565 114 ------
NM_002211chr10187 --11133 11019
NM_002214chr731359 724 372 24530 740 ----
NM_002222chr321324 214 ------
NM_002223chr122819 123 11413 ----
NM_002228chr11924 ------
NM_002232chr141220 1132 974 932 ------
NM_002247chr1022173 156 1812 ----
NM_002251chr2042052 1798 163 27 ----12142
NM_002252chr21306 ------
NM_002253chr431432 1288 960 ------
NM_002264chr364585 3776 3342 1447 1252 31 13874 14767 --
NM_002267chr1342466 1539 697 269 ------
NM_002268chr321814 449 11661 ----
NM_002270chr535505 4120 174 24943 1363 ----
NM_002285chr263309 2866 1062 587 373 70 ------
NM_002293chr132611 2019 530 ------
NM_002294chrX1376 ----1195
NM_002296chr141529 1513 309 48 ------
NM_002310chr556601 4503 4409 4216 989 11173 14448 --
NM_002336chr1231567 645 565 33635 3572 3377 --1216
NM_002349chr22173 72 11655 ----
NM_002356chr631153 473 66 ------
NM_002359chr1753569 1408 1321 1233 679 --11154 --
NM_002360chr752609 2467 2282 1631 658 11819 ----
NM_002374chr233331 3027 1017 ------
NM_002376chr141377 ------
NM_002381chr21107 1755 ----
NM_002383chr161845 ------
NM_002397chr552087 1726 1685 1609 1569 12032 2307 98 21882 56
NM_002398chr21550 ------
NM_002399chr151450 ------
NM_002402chr72773 362 --1254 --
NM_002430chr222878 549 --1581 --
NM_002439chr52952 915 1872 ----
NM_002444chrX32017 1591 207 ------
NM_002479chr12693 584 ----1126
NM_002480chr1271218 1162 1146 588 431 376 103 ------
NM_002487chr152275 242 ------
NM_002500chr21144 11030 ----
NM_002504chr91150 ------
NM_002523chr74760 325 209 45 ------
NM_002524chr11796 ----11018
NM_002537chr1511109 ------
NM_002545chr1154898 4715 3506 1689 1333 --24885 592 --
NM_002572chr11--1365 ----
NM_002576chr1151162 1102 477 299 30 ------
NM_002577chr333409 2828 883 ------
NM_002578chrX1431 ------
NM_002583chr122561 462 ----1611
NM_002589chr4195 ------
NM_002590chr133574 543 222 ------
NM_002594chr202565 253 ----22251 483
NM_002616chr171222 ------
NM_002623chr201238 ------
NM_002628chr34992 807 319 115 11211 --1966
NM_002639chr1811337 1138 ----
NM_002641chrX31693 1674 1559 ------
NM_002645chr112592 459 ------
NM_002651chr11233 --1731 --
NM_002655chr884983 4584 4478 4163 4090 756 689 591 13823 13714 --
NM_002656chr61168 3290 273 245 ----
NM_002657chr2033569 2976 846 --13828 --
NM_002667chr6156 --1471 --
NM_002687chr141259 ------
NM_002706chr21220 ------
NM_002709chr232372 1124 171 12706 ----
NM_002711chr71776 --1312 --
NM_002715chr551236 1102 166 86 30 ----1142
NM_002719chr1412146 ----179
NM_002731chr122266 137 ----1207
NM_002734chr1722244 800 11856 1279 --
NM_002737chr1756063 5206 4826 2336 656 --1832 --
NM_002738chr16136 1331 11145 --
NM_002740chr352754 2719 1813 371 39 --12532 --
NM_002745chr2241486 1421 714 218 --1646 --
NM_002748chr151193 --1103 --
NM_002752chr51528 ------
NM_002755chr155581 261 154 136 49 ------
NM_002765chrX2891 248 ------
NM_002786chr111112 ------
NM_002806chr14195 ------
NM_002816chr17------1237
NM_002827chr2031577 1534 559 21763 659 ----
NM_002829chr91409 --1899 --
NM_002830chr2----1280 163
NM_002833chr1561360 1248 506 462 231 77 ------
NM_002834chr1223809 2755 1730 11349 --
NM_002835chr72763 50 ------
NM_002837chr1254002 3981 3307 497 86 ------
NM_002838chr11814 ------
NM_002839chr943339 2762 2683 2385 --22819 1389 12402
NM_002841chr33679 550 143 ------
NM_002844chr611248 ------
NM_002848chr1221228 806 ------
NM_002849chr122855 336 ------
NM_002857chr152518 1753 887 121 86 ----1142
NM_002874chr942418 2335 1790 615 11815 ----
NM_002881chr241300 994 924 271 1316 ----
NM_002886chr354731 1466 1114 1077 733 13732 ----
NM_002890chr52852 282 ------
NM_002892chr142488 38 31200 224 215 ----
NM_002902chr15------1223
NM_002906chr1131679 452 124 ------
NM_002912chr61824 --131 --
NM_002922chr13581 445 57 1232 ----
NM_002923chr11598 173 1563 --
NM_002924chr11457 ------
NM_002940chr41729 165 ----
NM_002941chr311324 --11359 --
NM_002942chr321263 302 ----1393
NM_002955chr641279 1272 573 210 ----1170
NM_002977chr252857 2807 845 600 310 23403 2504 ----
NM_002993chr431089 708 674 --11062 --
NM_002994chr44735 702 260 238 ------
NM_002998chr862212 2196 2130 568 463 337 ------
NM_003001chr151677 1627 1410 414 66 ------
NM_003020chr151357 ------
NM_003030chr331960 1300 457 ------
NM_003042chr331618 1385 178 ----12210
NM_003043chr323823 3140 1355 11623 --
NM_003069chrX1183 ------
NM_003072chr191418 ------
NM_003074chr32704 318 1384 ----
NM_003088chr7----11104 --
NM_003099chr1586163 5985 5830 5701 5561 5159 2578 2105 15021 1353 --
NM_003101chr11494 ------
NM_003111chr21507 ------
NM_003112chr713117 --11085 12313
NM_003115chr12480 360 ------
NM_003118chr542059 242 143 110 ------
NM_003128chr262762 2683 1972 1083 885 600 12451 12463 --
NM_003131chr642057 1737 1493 290 ------
NM_003139chr111841 --1904 --
NM_003150chr171142 --11905 --
NM_003155chr822657 265 12776 12566 --
NM_003156chr1131305 1196 940 11237 ----
NM_003161chr1762484 2473 2279 813 807 110 --13528 --
NM_003170chr172582 415 ------
NM_003178chr372129 2112 1974 1943 1651 1498 148 --21915 97 --
NM_003182chr72151 40 ------
NM_003182chr72151 40 ------
NM_003185chr2011312 ------
NM_003188chr61333 ------
NM_003199chr1825200 837 33943 3758 1810 14574 --
NM_003200chr1952303 1836 1590 866 255 ------
NM_003203chr24773 531 464 182 22352 1979 ----
NM_003217chr1211798 --11510 --
NM_003220chr61577 ------
NM_003221chr643668 1112 728 387 --1875 --
NM_003222chr20------1299
NM_003223chr161109 ------
NM_003234chr352365 2100 2065 1735 69 12003 1629 --
NM_003236chr242296 1178 432 96 --1849 --
NM_003242chr312211 22397 203 ----
NM_003244chr18136 ------
NM_003246chr1531803 1768 749 --1325 --
NM_003253chr212448 164 11605 11801 --
NM_003262chr344856 4007 3419 904 --14376 --
NM_003270chrX3451 402 238 ------
NM_003272chr13742 475 201 ------
NM_003281chr1115184 4885 4455 4217 3800 3324 1727 1702 1345 1232 320 11859 ----
NM_003286chr20--11043 ----
NM_003295chr133174 60 37 ------
NM_003298chr345952 4571 1771 1323 ------
NM_003299chr121235 ------
NM_003336chrX177 ------
NM_003338chr1041606 1360 1268 732 --11492 --
NM_003339chr511234 ------
NM_003340chr431435 1290 967 ------
NM_003341chr33679 447 209 ------
NM_003342chr1782969 2732 2556 2371 1329 1178 933 187 12267 --12913
NM_003348chr1211076 1182 11255 --
NM_003349chr20------1203
NM_003350chr82295 225 --1754 --
NM_003359chr4173 ------
NM_003360chr42273 57 ------
NM_003371chr93549 482 208 ------
NM_003373chr102723 512 ------
NM_003376chr631749 1640 450 ------
NM_003376chr631749 1640 450 ------
NM_003380chr101217 ------
NM_003383chr91589 ------
NM_003385chr21179 ------
NM_003390chr113216 167 101 ------
NM_003392chr333965 3373 368 1587 1961 --
NM_003403chr142568 313 ------
NM_003405chr222713 90 ------
NM_003406chr831846 1712 59 ------
NM_003409chr181953 ------
NM_003410chrX32163 2085 757 ------
NM_003412chr322312 761 ------
NM_003413chrX41748 1537 658 426 1621 ----
NM_003421chr1064316 4197 3429 3361 1621 811 11711 ----
NM_003423chr192823 290 11020 11955 --
NM_003430chr1921385 559 11496 ----
NM_003439chr71564 ------
NM_003463chr662938 2898 2558 2223 351 238 23103 2828 22598 2148 --
NM_003470chr1611489 ------
NM_003473chr102684 424 ------
NM_003478chr1173224 3127 3014 2594 2400 2245 658 1900 ----
NM_003483chr123813 401 90 1974 ----
NM_003489chr2143378 3342 640 185 ------
NM_003505chr721591 79 11743 21295 1270 --
NM_003557chr131430 1398 39 ----11127
NM_003558chr91455 ------
NM_003559chr1743616 3556 2423 381 --1501 --
NM_003563chr171507 ------
NM_003574chr1874687 4640 4198 2281 2113 1654 1634 ------
NM_003575chr751481 1352 1326 1060 408 --11109 --
NM_003576chr1352888 2504 881 642 447 12878 11956 --
NM_003583chr1253578 2835 2494 1029 326 ------
NM_003586chr161626 ------
NM_003589chr1331295 1204 315 --172 --
NM_003590chr233551 3270 3011 13244 13870 --
NM_003592chr71382 ------
NM_003603chr421912 89 11949 ----
NM_003615chr332924 2524 89 11205 ----
NM_003626chr1111165 ------
NM_003628chr22702 508 --1487 --
NM_003633chr542524 2015 1801 1574 ------
NM_003635chr103436 381 213 ------
NM_003648chr242562 661 268 138 ------
NM_003651chr121441 --1457 --
NM_003659chr21234 ------
NM_003663chr343404 2764 324 225 12410 ----
NM_003664chr51525 ------
NM_003671chr952403 2382 2277 1254 415 --11107 --
NM_003672chr111238 ----11763
NM_003677chr1221429 358 ------
NM_003688chrX177 ------
NM_003714chr552341 2091 2080 758 535 --1608 --
NM_003743chr232146 727 451 ------
NM_003749chr1322271 963 12185 ----
NM_003758chr152260 152 --124 --
NM_003758chr152260 152 --124 --
NM_003759chr463118 2650 1171 716 621 185 --11310 --
NM_003760chr11672 ------
NM_003787chr1841475 1344 528 241 ------
NM_003800chr632413 978 461 ------
NM_003806chr121256 ------
NM_003816chr81340 1582 ----
NM_003850chr131113 1610 --143
NM_003872chr242339 2078 662 594 22563 93 ----
NM_003873chr1021805 558 --1656 --
NM_003885chr1732103 2095 1792 1880 12410 --
NM_003887chr252158 2053 1736 459 203 --11858 --
NM_003902chr1--1709 ----
NM_003909chr852412 2237 175 71 43 22908 2735 ----
NM_003913chr684146 3600 3247 3240 1564 952 447 243 1797 ----
NM_003924chr42347 109 11579 ----
NM_003930chr732531 2386 228 --11726 --
NM_003946chr161554 ------
NM_003947chr3----11227 --
NM_003968chr3175 ----1589
NM_003980chr6--174 ----
NM_003983chr1643813 1751 1512 1100 13979 ----
NM_003994chr1253929 3065 1469 1198 504 11225 ----
NM_003998chr42662 600 --1451 --
NM_004006chrX42489 1931 1727 337 12337 ----
NM_004007chrX42489 1931 1727 337 12337 ----
NM_004009chrX42489 1931 1727 337 12337 ----
NM_004010chrX42489 1931 1727 337 12337 ----
NM_004011chrX42489 1931 1727 337 12337 ----
NM_004012chrX42489 1931 1727 337 12337 ----
NM_004013chrX42489 1931 1727 337 12337 ----
NM_004014chrX42489 1931 1727 337 12337 ----
NM_004015chrX42489 1931 1727 337 12337 ----
NM_004016chrX42403 1845 1641 251 12251 ----
NM_004017chrX42489 1931 1727 337 12337 ----
NM_004018chrX42403 1845 1641 251 12251 ----
NM_004020chrX42489 1931 1727 337 12337 ----
NM_004021chrX42403 1845 1641 251 12251 ----
NM_004022chrX42403 1845 1641 251 12251 ----
NM_004023chrX42403 1845 1641 251 12251 ----
NM_004028chr1883937 3038 2965 1628 1548 1379 533 291 1122 ----
NM_004046chr18142 ------
NM_004060chr53929 397 337 ------
NM_004080chr711504 31441 532 432 ----
NM_004093chr1322325 252 23165 1134 22978 2022 13047
NM_004094chr1423030 850 12468 ----
NM_004100chr61177 11685 ----
NM_004109chr1152113 923 640 419 154 11801 --12177
NM_004124chr1473461 3237 2920 2713 2680 2181 697 ----11033
NM_004133chr832693 2240 855 22449 1649 ----
NM_004136chr1562618 2599 2544 2315 1006 979 1529 1196 --
NM_004156chr81559 1482 --1156
NM_004157chr33866 118 100 1831 ----
NM_004161chr211022 ------
NM_004162chr311212 ------
NM_004170chr951671 1529 1355 482 373 ------
NM_004200chr1152837 2691 2385 767 480 195 ----
NM_004207chr17160 --1180 --
NM_004229chrX21940 384 ------
NM_004232chr1883188 1297 1249 621 401 310 158 79 22748 99 13677 --
NM_004241chr102676 106 1318 ----
NM_004253chr92846 741 ------
NM_004277chr641452 1409 480 310 ------
NM_004279chr752283 2069 1503 729 301 --1939 --
NM_004297chr91118 ------
NM_004302chr1262708 1833 993 563 368 250 --22362 597 --
NM_004311chr1032820 2668 973 --12591 --
NM_004319chr152232 744 571 329 265 ----1228
NM_004320chr16134 ------
NM_004321chr283476 3301 3042 2462 1083 284 196 157 13468 12500 --
NM_004327chr2242039 1810 1602 618 ------
NM_004331chr832059 327 309 --12696 --
NM_004337chr831986 190 38 ------
NM_004338chr1876638 5866 5538 5491 1727 1304 510 ------
NM_004342chr732188 774 748 ------
NM_004362chr42737 511 ------
NM_004364chr191352 ------
NM_004370chr641618 729 336 201 11731 ----
NM_004379chr221305 1217 ------
NM_004384chr531776 1670 343 1124 ----
NM_004388chr1--2289 84 --1419
NM_004392chr1321948 1023 ------
NM_004397chr1143544 1700 1665 468 --11451 --
NM_004415chr62668 230 2630 25 ----
NM_004418chr2----1462 --
NM_004426chr122640 169 ------
NM_004430chr811112 12614 12310 --
NM_004432chr932022 1980 1607 --11861 --
NM_004433chr111458 ----1487
NM_004436chr11474 ------
NM_004438chr253237 2640 2214 1173 836 13332 11321 1695
NM_004440chr621709 163 --1602 --
NM_004443chr3--1550 ----
NM_004447chr123988 862 404 ------
NM_004459chr1731993 1532 570 11398 ----
NM_004469chrX131 ------
NM_004481chr172438 2324 1836 1677 790 470 23 1565 11684 --
NM_004483chr161432 --1486 --
NM_004494chr1155 --11076 --
NM_004496chr1421066 885 --1874 --
NM_004499chr51346 ------
NM_004500chr1421803 1493 ------
NM_004501chr143629 2613 2582 235 ------
NM_004504chr21633 1401 ----
NM_004505chr172575 77 ------
NM_004513chr1563114 2522 2383 1060 918 265 --1347 --
NM_004520chr51541 ----1625
NM_004529chr92545 510 11178 11400 --
NM_004537chr1221489 1013 1296 11143 --
NM_004538chrX2269 181 ------
NM_004560chr91824 1346 ----
NM_004566chr10----12353 --
NM_004571chr2142440 1277 685 317 1550 ----
NM_004575chr411644 ------
NM_004586chrX54906 3915 3593 2129 1934 35424 5258 4468 1439 --
NM_004593chr31841 ------
NM_004598chr523175 2336 22840 1039 ----
NM_004607chr5178 ------
NM_004612chr984350 3788 3033 1882 1573 1513 798 652 14399 23152 1688 --
NM_004622chr231796 729 564 --11854 --
NM_004643chr14----1850 --
NM_004655chr1721287 1057 1284 ----
NM_004660chrY2799 251 1866 11455 --
NM_004661chr521209 1020 1984 ----
NM_004663chr1531292 198 83 ------
NM_004686chr82280 102 1316 ----
NM_004703chr1742359 1999 1579 910 ------
NM_004709chrX41475 1396 1230 621 ------
NM_004719chr1241819 1768 1143 1009 ------
NM_004725chr1011505 --126 --
NM_004726chrX55538 5316 4986 2026 101 184 25765 576 --
NM_004730chr541818 1750 197 190 --1823 --
NM_004731chr1231913 1649 598 1223 11708 --
NM_004738chr2032585 1627 293 1934 ----
NM_004740chr17----189 --
NM_004742chr341691 1446 1171 252 1662 ----
NM_004745chr886571 6486 6432 4693 2758 1253 580 452 ------
NM_004760chr751871 1694 794 691 335 ------
NM_004768chr12433 202 1370 21136 46 --
NM_004772chr5----2562 160 --
NM_004774chr1741090 1045 722 228 ------
NM_004775chr1832258 836 90 --11783 --
NM_004779chr51352 ------
NM_004781chr141436 1262 324 298 169 --1263
NM_004781chr141436 1262 324 298 169 --1263
NM_004788chr1152575 2447 2439 795 345 ------
NM_004815chr154873 4639 1598 1578 1523 --13604 --
NM_004822chr1713688 --13010 --
NM_004831chr1921047 852 1957 ----
NM_004834chr233363 2904 382 12776 --1262
NM_004841chr12899 303 ------
NM_004842chr661531 497 444 413 341 324 1635 ----
NM_004845chrX63947 3779 3531 996 957 859 ----13484
NM_004846chr22188 72 ------
NM_004849chr63617 314 204 --11532 --
NM_004856chr151439 1218 ----
NM_004859chr1742374 2197 2170 479 23100 2418 11930 12529
NM_004862chr164321 273 230 33 --21358 1006 --
NM_004863chr1475215 5101 5046 4980 3898 1887 1754 23973 3815 13259 --
NM_004871chr1783700 3497 3197 2910 1441 748 624 514 ------
NM_004879chr112913 737 --1314 --
NM_004887chr511085 ------
NM_004898chr442308 425 397 166 ------
NM_004899chr21132 ------
NM_004902chr201106 ------
NM_004904chr735599 1743 459 ------
NM_004905chr11891 2655 119 2756 92 --
NM_004906chr6----132 --
NM_004912chr711504 --11267 --
NM_004922chr101175 1241 1406 --
NM_004949chr182677 298 12020 ----
NM_004956chr774566 3246 1254 808 732 448 162 11260 ----
NM_004958chr12923 790 ------
NM_004965chr211269 ------
NM_004969chr102508 133 ------
NM_004976chr1175103 5003 4408 3981 3626 1362 1199 --24791 3346 --
NM_004978chr111678 ------
NM_004985chr12114498 4213 3090 2756 1730 1270 1080 858 563 505 185 13917 11815 --
NM_004992chrX68092 6908 6366 5726 5298 2181 --1406 --
NM_004992chrX68092 6908 6366 5726 5298 2181 --1406 --
NM_005006chr22819 367 ------
NM_005010chr7--11568 --1756
NM_005016chr121267 ------
NM_005025chr31197 ------
NM_005032chrX--11022 ----
NM_005054chr211113 11665 ----
NM_005056chr1285394 4757 4643 3775 1913 833 646 562 ------
NM_005057chr141821 693 358 38 ------
NM_005058chrY1212 ------
NM_005063chr1043613 3374 970 253 --12699 --
NM_005066chr12568 267 ------
NM_005068chr631377 1027 976 ------
NM_005079chr833235 821 80 22597 295 ----
NM_005093chr2035250 4668 4166 --1196 --
NM_005096chrX1782 ------
NM_005103chr111232 ------
NM_005105chr121647 1390 11794 11869 --
NM_005109chr332333 2326 147 ------
NM_005112chr42843 69 ------
NM_005116chr2084202 3602 3424 1744 1349 854 807 411 12994 ----
NM_005121chr1753180 3160 2672 2607 169 23746 1106 ----
NM_005126chr32907 51 1741 ----
NM_005130chr4139 ------
NM_005135chr1563408 2654 1085 683 632 65 --11366 --
NM_005155chr61542 ------
NM_005156chr965395 4659 4528 3737 3632 1615 1514 13596 --
NM_005157chr961767 1506 1324 646 451 23 ------
NM_005180chr1021224 63 ------
NM_005188chr1196776 6728 5112 2709 2403 1092 968 672 654 --48083 6703 6239 2385 --
NM_005197chr1485653 5103 3982 2021 1917 1053 690 561 14704 15627 --
NM_005202chr11221 ------
NM_005207chr2253158 3046 2617 1047 409 --11089 13720
NM_005219chr511776 ------
NM_005233chr332441 1909 716 ------
NM_005235chr266404 6299 6127 4881 844 401 12133 ----
NM_005238chr112835 592 ------
NM_005245chr42177 148 --1203 --
NM_005254chr151486 --11110 --
NM_005256chr112833 120 ------
NM_005259chr241363 1256 1064 569 ------
NM_005274chr1------1113
NM_005296chrX2746 431 159 ----
NM_005316chr111147 ----11071
NM_005324chr172668 595 11320 11791 --
NM_005329chr162704 308 ------
NM_005334chrX11314 --11758 --
NM_005338chr753047 2821 2759 128 116 --1596 --
NM_005339chr434039 3722 363 13756 ----
NM_005342chrX32195 1786 601 --11854 --
NM_005359chr1846134 5838 1172 284 --1468 --
NM_005370chr1931126 313 216 --1898 --
NM_005374chr1742273 1905 530 280 --1542 --
NM_005384chr92100 41 ------
NM_005387chr111216 1647 ----
NM_005397chr743499 2731 1523 1280 --163 --
NM_005400chr253036 2999 440 383 257 ------
NM_005402chr731616 1274 64 --11767 --
NM_005406chr1811015 ------
NM_005407chr1431480 1342 402 ------
NM_005410chr5--1161 ----
NM_005415chr22161 27 ----1146
NM_005418chr11----1606 --
NM_005433chr1842699 2184 1083 923 --12018 --
NM_005455chr13404 317 195 ------
NM_005458chr92771 643 ------
NM_005460chr51516 ------
NM_005461chr2011387 ------
NM_005465chr121674 30 ------
NM_005467chr111108 ------
NM_005475chr1232298 661 130 23292 3275 --11113
NM_005477chr1532400 968 377 --1349 --
NM_005477chr1532400 968 377 --1349 --
NM_005494chr71607 1156 ----
NM_005497chr1746049 5992 1759 1282 --1431 --
NM_005499chr19----1450 --
NM_005502chr943010 504 489 435 --32851 612 541 --
NM_005509chr541631 1555 1182 496 1259 --1683
NM_005517chr13973 540 442 ------
NM_005530chr1541489 1103 963 275 ------
NM_005539chr102926 525 11085 ----
NM_005544chr21214 1728 1328 1678
NM_005574chr11----1301 --
NM_005578chr353924 3380 1402 907 112 ------
NM_005587chr151890 ------
NM_005596chr965469 5305 5097 5069 1984 22 --14456 --
NM_005598chr121632 1267 ------
NM_005605chr8------1281
NM_005610chr12852 131 1296 ----
NM_005614chr73866 794 423 ------
NM_005619chr191122 ------
NM_005626chr12405 390 ------
NM_005629chrX21366 1329 ------
NM_005637chr1832052 2022 1368 ----1552
NM_005655chr82904 466 ------
NM_005657chr15135 ------
NM_005662chr8------1374
NM_005664chr152242 51 ----1377
NM_005665chr154870 4738 3875 3150 1338 1208 13869 --
NM_005668chr541530 1214 1084 215 ----13971
NM_005688chr351240 507 450 383 44 ------
NM_005711chr5----1696 --
NM_005715chr61767 1253 1495 12744
NM_005721chr211039 --1711 --
NM_005734chr111263 1736 ----
NM_005738chr731497 405 108 ------
NM_005739chr1521953 228 ------
NM_005746chr732311 1968 201 12618 ----
NM_005748chr1223121 736 22653 827 2730 221 --
NM_005749chr17--1595 ----
NM_005752chr161956 --11006 1433
NM_005759chr284777 4054 3352 3193 3185 1513 402 192 13085 14707 --
NM_005766chr1361342 1144 1052 268 255 237 ------
NM_005778chr31375 ------
NM_005779chr533133 2667 498 ----12772
NM_005780chr131812 --1994 --
NM_005786chr1841011 491 382 350 ------
NM_005789chr1731987 760 393 ------
NM_005792chr16--1409 ----
NM_005795chr222919 2578 31976 1082 111 --1510
NM_005802chr91842 1706 ----
NM_005808chr323068 667 1845 --12631
NM_005822chr612091 ------
NM_005828chr1744246 4168 3193 1698 ------
NM_005833chr9--1169 ----
NM_005840chrX75442 5350 2069 1018 740 244 133 22667 746 13020 12245
NM_005841chr43827 770 230 ------
NM_005843chr231687 1552 1268 1471 ----
NM_005857chr121095 142 ------
NM_005859chr511292 --11157 --
NM_005870chr1321412 84 --1151 --
NM_005871chr101169 ------
NM_005877chr2252338 1778 692 358 32 1986 1492 --
NM_005880chr1621379 660 ------
NM_005884chr191653 ------
NM_005885chr52664 353 ------
NM_005898chr1142958 2019 1208 1025 ------
NM_005899chr17158 ------
NM_005900chr421220 895 ------
NM_005901chr1825768 5379 47655 6189 5470 55 27721 5784 --
NM_005903chr533197 1148 715 44423 3234 734 647 23900 2046 --
NM_005906chr631481 1184 498 --11496 --
NM_005909chr534116 2749 1621 1127 1136 --
NM_005910chr17103963 3712 3355 2855 2628 1175 962 731 419 389 --13370 --
NM_005924chr73456 303 170 ------
NM_005933chr1172373 2358 2310 594 582 570 360 ------
NM_005935chr465200 4946 3754 810 794 758 11293 24018 1510 --
NM_005938chrX41409 1386 1353 231 --1926 --
NM_005940chr222753 672 ------
NM_005941chr853458 3107 1601 1402 236 11153 12878 --
NM_005955chr174949 4831 1767 1549 551 273 68 ------
NM_005962chr1032058 1904 315 --22166 1810 --
NM_005962chr1032058 1904 315 --22166 1810 --
NM_005964chr172993 515 1387 ----
NM_005966chr2--12158 ----
NM_005986chr131826 11843 ----
NM_005996chr1241228 385 155 48 --11193 --
NM_006007chr943174 1598 1438 290 11455 14387 --
NM_006011chr1544016 2768 1186 1021 --1478 --
NM_006016chr641874 633 430 395 --11772 --
NM_006022chr1331048 135 63 ------
NM_006030chr341430 1375 554 299 ------
NM_006036chr242574 2331 1015 498 ------
NM_006037chr244445 4399 3255 75 13928 ----
NM_006038chr2032019 613 578 ------
NM_006040chr1631387 416 100 --1326 --
NM_006047chr2032416 1341 1277 32824 1413 728 --1667
NM_006054chr1141511 1451 600 93 ------
NM_006064chrX1147 ------
NM_006076chr743084 1286 1122 116 13138 1610 --
NM_006079chr61724 ------
NM_006080chr72328 313 22462 321 1731 --
NM_006085chr13255 176 165 ------
NM_006089chrX1698 11792 --11580
NM_006095chr453168 3084 1649 893 307 13253 14445 --
NM_006106chr1132433 305 244 --1569 --
NM_006107chr171496 ------
NM_006113chr151764 1465 468 386 232 ------
NM_006135chr1--1208 ----
NM_006139chr252778 2768 2407 1056 701 12016 1224 12116
NM_006141chr1652548 1989 958 517 91 --22120 1105 --
NM_006154chr1532062 1961 501 137 1408 --
NM_006158chr841587 1559 1393 606 --1161 11833
NM_006164chr21165 ------
NM_006166chr1242581 2499 2392 1916 ------
NM_006186chr21183 21142 329 ----
NM_006187chr1242287 1302 792 578 --1614 --
NM_006194chr141147 1173 ----
NM_006203chr553695 1143 713 188 98 ------
NM_006211chr8185 ------
NM_006224chr1722436 193 --12224 --
NM_006237chr13--11964 ----
NM_006241chr332385 928 918 11905 ----
NM_006242chr2031727 1337 56 ------
NM_006243chr11219 ------
NM_006246chr142440 293 ------
NM_006251chr552835 2577 1273 641 520 ------
NM_006252chr157047 2112 1763 1607 136 12825 17117 --
NM_006256chr142277 2174 415 80 1340 ----
NM_006258chr101535 21608 642 ----
NM_006259chr41930 ------
NM_006265chr821523 1339 ------
NM_006267chr221760 690 ------
NM_006282chr2034575 4487 1283 --1171 --
NM_006283chr854832 4725 4084 1761 724 --14775 --
NM_006294chr81492 ------
NM_006298chr683028 2865 2797 2339 1118 716 278 111 22181 605 ----
NM_006306chrX75004 4960 4790 2077 1817 1745 1011 1694 --12186
NM_006309chr31107 ------
NM_006310chr1711076 --11296 --
NM_006312chr122947 32 ------
NM_006317chr51796 ------
NM_006320chr421075 418 1895 ----
NM_006330chr821526 1420 ------
NM_006332chr191184 ------
NM_006352chr122079 732 ------
NM_006357chr22369 164 ------
NM_006359chrX52377 1771 1665 373 116 --11555 --
NM_006362chr11174 ------
NM_006364chr14----11129 --
NM_006366chr6--11243 --1130
NM_006371chr374617 4521 4496 1074 407 359 150 11585 ----
NM_006377chr93970 282 21 --11255 --
NM_006379chr721803 192 12240 11954 --
NM_006380chr1744266 4199 3995 2783 --23136 1026 1931
NM_006390chr1251789 1528 325 113 30 ------
NM_006391chr111311 ------
NM_006393chr1053211 1352 1294 775 733 14149 11494 --
NM_006415chr931069 1042 133 ------
NM_006416chr6----1623 1613
NM_006420chr2083402 2382 2110 1046 951 287 275 52 ------
NM_006421chr82918 233 ------
NM_006451chr51790 ------
NM_006454chr493082 3000 2969 2443 2386 2341 1153 569 50 --2334 108 --
NM_006457chr453847 3357 2648 1065 499 12878 1894 --
NM_006464chr254649 4110 3501 1770 1125 12999 ----
NM_006466chr202955 130 ------
NM_006467chr542183 1897 1705 218 --11486 --
NM_006469chr111045 ------
NM_006476chr113748 502 76 ------
NM_006478chr221184 ------
NM_006482chr1253578 2835 2494 1029 326 ------
NM_006517chrX2424 360 1652 ----
NM_006519chr61245 ------
NM_006520chrX31689 1071 91 ------
NM_006526chr201499 ------
NM_006534chr2073430 2907 849 621 584 313 146 ------
NM_006544chr1475810 1738 1634 1387 1050 378 29 45509 4238 4083 602 12234 --
NM_006546chr17126428 6133 5851 5133 5019 4427 4264 2433 2375 1941 1485 225 ------
NM_006547chr7--11940 ----
NM_006561chr1086026 4988 1699 1485 1243 1088 994 671 --25627 1811 12129
NM_006572chr1743437 1387 870 333 --11003 --
NM_006595chr1151981 1674 1368 1275 86 ----1552
NM_006599chr1687990 6696 5737 5530 5025 3252 1998 343 --26120 3089 --
NM_006601chr121448 ------
NM_006602chr202655 539 ------
NM_006609chr222066 1866 12528 ----
NM_006614chr333010 2761 2240 13055 ----
NM_006625chr13846 437 401 ----11051
NM_006625chr13846 437 401 ----11051
NM_006625chr13846 437 401 ----11051
NM_006628chr1554291 3717 796 612 138 1919 1714 --
NM_006629chr1832866 2144 1994 1997 ----
NM_006636chr2--2751 735 1342 --
NM_006644chr131592 150 1686 --
NM_006650chr533832 827 278 --23804 1366 11354
NM_006654chr1274636 4409 4323 4179 3671 3139 665 14310 33206 1769 826 --
NM_006658chr73730 146 97 ------
NM_006675chr1263437 3041 2839 2792 173 69 13353 ----
NM_006681chr4137 ------
NM_006682chr732765 2000 873 ------
NM_006690chr2032318 1646 1440 ------
NM_006699chr11720 --12409 --
NM_006714chr61280 ------
NM_006717chr942936 2848 2816 2391 --12767 --
NM_006718chr61168 3290 273 245 ----
NM_006721chr103591 220 95 1668 ----
NM_006722chr332370 2197 1973 ------
NM_006726chr41138 ------
NM_006734chr621313 118 ----11544
NM_006735chr71332 1368 ----
NM_006738chr1524444 771 13964 ----
NM_006742chr1662025 1921 1685 1644 1570 1263 --159 --
NM_006746chrX21001 529 11446 11300 --
NM_006750chr16107359 7251 6270 6100 5974 4885 1572 1531 918 438 15077 ----
NM_006751chr2188 ------
NM_006754chr71929 1341 ----
NM_006756chr811025 ------
NM_006766chr842206 1899 1767 400 --11924 --
NM_006775chr622699 769 --22224 620 --
NM_006777chrX22878 1906 32580 2010 636 ----
NM_006788chr1832161 1433 234 --11557 --
NM_006805chr531340 1308 1180 ------
NM_006806chr21----127 --
NM_006808chr9123 ------
NM_006813chr61307 ------
NM_006814chr202850 539 ----1328
NM_006815chr122930 70 ------
NM_006820chr174225 3950 3236 2934 720 470 50 ------
NM_006823chr81193 ------
NM_006824chr11194 --187 --
NM_006827chr1443285 2311 845 604 13299 ----
NM_006838chr1231428 738 705 2323 242 ----
NM_006846chr5--1111 ----
NM_006852chr1731939 780 517 --1894 --
NM_006856chr1231116 1005 65 ------
NM_006870chr201113 156 ----
NM_006874chr41842 --1452 --
NM_006875chrX1337 ------
NM_006877chr61348 ------
NM_006884chr331960 1300 457 ------
NM_006885chr1653462 2976 2930 2629 438 14175 ----
NM_006888chr141655 22667 434 ----
NM_006894chr1161 ------
NM_006922chr252355 1945 860 421 66 1356 ----
NM_006924chr1722974 894 1199 1502 --
NM_006940chr1251767 720 642 412 374 11514 --11828
NM_006948chr212815 341 2796 526 --1576
NM_006951chr101281 ------
NM_006962chrX21077 49 ------
NM_006981chr922606 303 ------
NM_006997chr101184 ------
NM_007005chr951441 1266 1124 161 56 --11117 --
NM_007006chr1633553 2298 1202 --11057 --
NM_007007chr1254024 3307 2970 1565 1301 11192 11796 --
NM_007008chr22211 178 ------
NM_007023chr23966 379 60 --1258 --
NM_007030chr575202 4232 3711 3404 842 638 333 14031 ----
NM_007034chr11302 1685 ----
NM_007038chr2145438 5011 4913 2265 --12009 --
NM_007039chr14----11468 --
NM_007042chr332027 1856 533 --1547 --
NM_007043chr122552 259 22124 714 ----
NM_007050chr2035579 2872 183 17258 16748 --
NM_007067chr1741452 1366 1241 69 ------
NM_007073chr664238 3109 1341 1326 1224 1041 --14153 24013 3225
NM_007106chr131142 --1908 --
NM_007107chr321732 715 --11474 --
NM_007114chr312581 12565 ----
NM_007124chr631843 1488 646 11691 ----
NM_007125chrY--11310 ----
NM_007146chr17--1492 ----
NM_007159chr3--11511 ----
NM_007166chr1121434 215 --11062 --
NM_007175chr863456 2686 2484 1172 583 306 ------
NM_007176chr1411127 ------
NM_007187chr131262 ------
NM_007192chr144996 432 187 109 ------
NM_007197chr122953 739 1667 ----
NM_007200chr1524444 771 13964 ----
NM_007207chr11182 ----1852
NM_007212chr121990 595 --11567 --
NM_007217chr31140 --1265 --
NM_007218chr83631 315 152 1691 ----
NM_007246chr41947 ------
NM_007249chr13108283 7354 6442 6286 6032 3667 1346 611 603 272 ------
NM_007269chr12164 73 ------
NM_007283chr373010 2316 1133 1127 776 720 259 ------
NM_007287chr321087 945 1546 ----
NM_007288chr321087 945 1546 ----
NM_007289chr321087 945 1546 ----
NM_007313chr961767 1506 1324 646 451 23 ------
NM_007345chr1831911 1738 187 ------
NM_007347chr1553191 2863 2643 1980 336 ------
NM_007358chr12779 759 1177 ----
NM_007361chr141536 ------
NM_007372chr172345 244 ------
NM_007375chr132280 808 449 1607 ----
NM_012081chr533546 1156 992 11070 ----
NM_012089chr1--11101 --11483
NM_012090chr12835 387 ------
NM_012092chr221588 1301 ------
NM_012096chr331214 1009 824 ------
NM_012102chr132561 930 324 ------
NM_012104chr1143688 2993 1058 473 1863 ----
NM_012104chr1143688 2993 1058 473 1863 ----
NM_012117chr12122 ------
NM_012120chr622919 2706 11152 ----
NM_012134chr151512 1401 1298 122 34 ------
NM_012137chr152842 2228 577 105 97 12572 ----
NM_012141chr1344113 966 280 264 ------
NM_012155chr19126 ------
NM_012156chr2043125 2921 2775 702 ------
NM_012161chr431061 1007 286 --11159 --
NM_012164chr985837 5776 2729 2355 1373 667 532 38 36701 2771 1111 1424 --
NM_012183chr1----1529 --
NM_012188chr51869 ------
NM_012193chr1165424 4833 4556 4293 4074 1030 1605 ----
NM_012197chr921553 1534 ------
NM_012199chr133504 321 62 11469 ----
NM_012207chr1011125 1897 ----
NM_012214chr2126373 5932 5757 5676 5088 2454 1603 999 696 609 590 129 26314 2058 ----
NM_012215chr102457 369 --11873 --
NM_012219chr342704 2645 799 577 ------
NM_012223chr221259 397 --11202 --
NM_012238chr1021775 642 ----11564
NM_012243chr12828 703 ------
NM_012247chr102734 341 ------
NM_012249chr233566 2199 1404 1803 ----
NM_012250chr1111389 1860 ----
NM_012252chr765245 4888 4492 4220 3843 2092 --153 --
NM_012255chr20152 ------
NM_012257chr72802 290 --1720 --
NM_012259chr6----11159 --
NM_012262chr145261 4595 4569 3506 --25231 3384 --
NM_012264chr2242056 1589 1336 481 ------
NM_012264chr2242056 1589 1336 481 ------
NM_012266chr91291 ------
NM_012279chr521414 649 --11823 --
NM_012281chr7----11793 1896
NM_012288chr635079 4805 4530 25594 4718 22274 1723 --
NM_012290chr21576 --1164 --
NM_012293chr22725 286 --139 --
NM_012294chr743871 2960 2884 310 ------
NM_012297chr422163 1758 ------
NM_012300chr52960 426 12259 ----
NM_012301chr731802 661 344 1760 ----
NM_012302chr12963 920 ------
NM_012309chr1143769 1779 1768 872 13713 ----
NM_012316chr145172 3428 1936 1229 --11045 --
NM_012319chr18--140 1953 --
NM_012322chr72326 303 ------
NM_012325chr20----21539 619 --
NM_012327chr1831065 549 423 1524 1569 --
NM_012330chr1021311 510 11267 ----
NM_012334chr554311 3101 1775 837 338 14463 175 --
NM_012338chr711250 3226 171 107 ----
NM_012405chr173696 3641 2398 1526 1232 995 108 ------
NM_012416chr93812 336 280 ------
NM_012431chr71562 13258 ----
NM_012434chr631651 675 453 ------
NM_012448chr1752405 1615 1556 810 803 ------
NM_012454chr6--1500 ----
NM_012460chr141119 ------
NM_012464chr442173 2120 948 891 12703 11101 --
NM_012471chrX61484 668 483 474 390 334 21863 699 ----
NM_012479chr762601 2526 1871 1088 959 882 12436 ----
NM_012482chr12563 67 ------
NM_012486chr11164 ----181
NM_013231chr1432821 1637 1032 --1176 --
NM_013233chr23923 908 33 11345 ----
NM_013242chr161142 1164 --1387
NM_013254chr121634 ------
NM_013257chr841526 1502 398 285 ------
NM_013262chr62500 108 ------
NM_013269chr1244390 3200 1583 182 ------
NM_013286chr352800 2534 1452 1265 36 ------
NM_013293chr71201 ------
NM_013336chr331484 1265 145 ------
NM_013338chr132100 42 ------
NM_013348chr1921118 147 --1863 --
NM_013352chr61365 ------
NM_013357chr81809 2649 576 ----
NM_013374chr331122 489 424 ------
NM_013396chr2111335 190 11538 --
NM_013411chr132422 2051 761 ------
NM_013437chr831310 1277 314 ------
NM_013438chr921547 654 ----11765
NM_013444chrX21095 891 --11066 --
NM_013449chr1242614 2023 1019 64 12958 ----
NM_013960chr8131 ------
NM_013989chr1433849 1891 1515 1882 15104 --
NM_013995chrX22374 798 ------
NM_013996chr72151 40 ------
NM_013996chr72151 40 ------
NM_013997chr72151 40 ------
NM_013997chr72151 40 ------
NM_013998chr72151 40 ------
NM_013998chr72151 40 ------
NM_014000chr102723 512 ------
NM_014007chr941017 453 91 83 1398 ----
NM_014011chr212407 ------
NM_014016chr31400 11730 ----
NM_014021chr133074 2267 1081 ----174
NM_014043chr321575 345 1529 1497 --
NM_014048chr1654337 3786 3717 1079 1035 15160 ----
NM_014056chr342255 2116 1446 675 12358 ----
NM_014089chr1342272 2212 1793 1704 1157 ----
NM_014106chr1542635 2515 718 345 1220 22297 950 11041
NM_014109chr83426 174 59 ------
NM_014112chr844933 3969 2188 2085 11748 ----
NM_014117chr1622370 1732 1138 22076 585 --
NM_014141chr764843 4801 4123 3436 1856 1580 11116 14314 14953
NM_014154chr31318 --1180 --
NM_014155chr1196906 5651 5480 5173 4937 2036 816 188 100 26533 1120 37184 1863 1054 --
NM_014159chr31101 --1566 --
NM_014181chr22314 37 ------
NM_014183chr20----126 --
NM_014186chr113568 134 28 11975 ----
NM_014223chr12718 257 148 ----
NM_014231chr1252190 2087 2052 1943 35 ------
NM_014232chr172618 328 ------
NM_014232chr172618 328 ------
NM_014248chr221151 ------
NM_014267chr111149 1573 1889 --
NM_014271chrX1730 ------
NM_014278chr41111 ------
NM_014282chr9----1116 --
NM_014283chr11159 --11527 --
NM_014292chr2271821 1721 1482 1261 722 708 349 --11876 --
NM_014294chr851422 1314 1247 171 117 --11264 --
NM_014299chr1932203 1961 345 ------
NM_014313chr131135 396 85 1321 ----
NM_014317chr101208 ------
NM_014323chr2211007 ------
NM_014325chr122281 104 --11587 --
NM_014333chr1121843 748 ------
NM_014351chr2211169 ------
NM_014372chr11721 11570 21863 1525 1618
NM_014376chr512493 2712 75 1513 --
NM_014382chr321440 1202 --1525 1466
NM_014392chr441462 1210 413 30 ------
NM_014395chr421973 191 --1394 --
NM_014415chr31682 11684 ----
NM_014421chr41255 11867 ----
NM_014423chr575477 4734 4680 4562 4092 1909 48 21089 71 15586 --
NM_014426chr201753 ------
NM_014445chr322165 1632 21782 678 1139 1905
NM_014447chr41630 11336 ----
NM_014454chr63410 220 139 --1118 --
NM_014455chr11314 ------
NM_014456chr1011747 --21670 266 --
NM_014488chr111631 ------
NM_014489chr112633 266 ------
NM_014494chr1631721 1486 453 ------
NM_014548chr1521153 1061 --1573 --
NM_014554chr1232059 720 274 ------
NM_014563chrX42026 1660 1653 398 21704 1491 ----
NM_014574chr1421013 65 ------
NM_014575chr31180 --1506 1383
NM_014584chr1421644 656 ------
NM_014585chr221235 1163 ------
NM_014586chr2144420 4295 3945 365 ------
NM_014592chr52592 499 ------
NM_014600chr221652 1536 --11020 --
NM_014602chr32362 350 ------
NM_014607chr221761 397 ------
NM_014613chr532822 1235 697 --12298 --
NM_014614chr251455 1293 1077 373 173 ------
NM_014615chr1682762 2692 2258 2250 1197 860 385 198 11107 1117 --
NM_014618chr92396 340 ------
NM_014630chr1542977 2836 2713 39 --22967 808 --
NM_014636chr953987 3049 2757 1274 657 --1734 --
NM_014647chr1622000 771 --2376 92 --
NM_014655chr161896 1883 1472 1457 513 409 ------
NM_014659chr153996 386 280 ------
NM_014661chr10103778 3543 3512 2985 2944 2896 2815 2532 414 197 12998 23378 3344 --
NM_014666chr5--1403 ----
NM_014670chr241410 1146 1132 54 11013 11386 --
NM_014671chr721363 129 11231 1232 --
NM_014673chr8----188 --
NM_014680chr174492 432 387 107 ------
NM_014682chr822038 424 41889 903 367 99 --11521
NM_014702chr652713 2707 2487 370 200 122 ----
NM_014705chr71797 11615 ----
NM_014707chr712031 ------
NM_014709chr21601 ------
NM_014715chr112284 199 1924 ----
NM_014717chr191761 ------
NM_014720chr1051359 1330 1256 606 47 ------
NM_014721chr6137425 7381 6525 6348 6280 5577 4968 1800 1617 1558 1340 1087 614 ------
NM_014730chr12104352 3719 3527 2067 1841 1502 1199 639 615 378 ------
NM_014730chr12104352 3719 3527 2067 1841 1502 1199 639 615 378 ------
NM_014732chr1695807 5534 5397 4762 1330 1281 722 263 205 --21576 45 --
NM_014738chr172742 140 ------
NM_014739chr623697 3392 14186 12974 --
NM_014743chr431199 808 364 ------
NM_014746chr264220 3941 1676 1626 904 127 ------
NM_014752chr1121623 653 ------
NM_014757chr512276 --1344 11926
NM_014758chr1132425 624 312 ------
NM_014760chr32639 578 --21827 1796 --
NM_014765chr132542 2240 1894 ------
NM_014770chr1211182 ------
NM_014772chr1822347 1160 ------
NM_014779chr34457 202 171 56 ------
NM_014783chr1531422 334 23 --11235 --
NM_014784chr111004 ------
NM_014802chr1231117 456 61 ------
NM_014803chr1042507 1984 679 179 ------
NM_014810chr123359 32 --12767 --
NM_014812chr11379 ----11405
NM_014819chr511585 3467 120 104 ----
NM_014820chr331974 1628 75 --11961 --
NM_014824chr112206 194 --1649 --
NM_014827chr121253 210 1245 ----
NM_014828chr1412458 22484 319 ----
NM_014829chr512305 ------
NM_014836chr1031645 1381 626 --1662 --
NM_014839chr132537 2078 326 1145 --12485
NM_014840chr1262613 1303 1285 902 626 615 ------
NM_014850chr353932 3561 1920 1110 205 --11195 --
NM_014869chr331230 580 172 ------
NM_014870chr194368 3957 3927 3703 1899 1622 1341 1142 364 13806 24150 792 --
NM_014877chr17107102 6972 6323 5786 3019 2574 2353 2179 931 198 --15515 --
NM_014892chr6143 ------
NM_014897chr173455 192 128 23021 2932 ----
NM_014901chr561832 1797 1447 457 309 134 11789 ----
NM_014903chr1292469 2348 2118 1915 1838 1670 1591 586 438 11871 11945 --
NM_014904chr1053402 2965 2938 2749 648 2720 288 ----
NM_014905chr232055 814 109 11298 12020 --
NM_014906chr1733277 3228 1244 --13083 1576
NM_014912chr102697 306 13307 ----
NM_014913chr182298 245 11387 ----
NM_014914chr21517 ------
NM_014918chr1531488 1403 1187 ------
NM_014920chr643563 2911 2845 743 --23267 3116 --
NM_014923chr1371941 1922 1855 1847 1765 131 45 1417 --1461
NM_014924chr1452785 2127 2011 769 477 ------
NM_014939chr182965 134 --11060 --
NM_014944chr131094 535 50 --11308 --
NM_014946chr232418 1208 516 1730 ----
NM_014947chr133007 295 271 --33094 1267 821 --
NM_014948chr2062064 1591 883 747 618 533 ------
NM_014949chr11962 ------
NM_014969chr11870 1217 11185 --
NM_014974chr1021676 1236 11763 1433 --
NM_014978chr102260 212 1742 11266 --
NM_014982chr1444638 3892 2014 380 1391 ----
NM_014988chr41658 ------
NM_014989chr611317 --1528 --
NM_014991chr462978 2892 2712 1198 1140 633 --12059 --
NM_014994chr151257 ------
NM_014997chr782899 2798 1885 1077 902 668 566 80 1349 --12406
NM_015002chr122232 39 --1512 --
NM_015005chr1441750 1445 602 472 1407 1354 1117
NM_015009chr3------1153
NM_015011chr1331142 917 255 ------
NM_015015chr1941798 1712 696 281 ------
NM_015017chr131153 1060 808 ------
NM_015020chr1653746 3492 2377 595 254 13713 13208 --
NM_015025chr262684 2403 2076 1763 1700 234 12615 12060 --
NM_015026chr1254748 3892 3633 3483 1870 13161 --14803
NM_015027chr1631699 802 79 ------
NM_015032chr1352899 2862 2036 586 573 11881 1472 --
NM_015035chr20106586 6374 6282 5504 5099 4474 1557 1494 371 92 --11761 15993
NM_015039chr124227 3088 ----22754 1119
NM_015040chr233177 2642 572 ------
NM_015045chr1021390 380 ----1704
NM_015046chr932429 2367 174 12627 ----
NM_015057chr131171 ------
NM_015068chr773621 3218 2573 1554 1454 811 77 12565 11580 --
NM_015069chr161142 --192 --
NM_015071chr5136415 6384 5471 5004 4651 4069 2424 1491 1055 694 596 494 155 --35981 5239 2381 14464
NM_015076chr624012 98 ------
NM_015092chr1654176 1883 1792 1752 1335 --14340 14192
NM_015093chr62178 61 --1467 --
NM_015094chr2234170 3872 1780 ----24608 1091
NM_015097chr332300 664 546 11465 ----
NM_015115chr432618 1263 139 ------
NM_015116chr134358 283 271 101 --11648 --
NM_015137chr831812 519 204 12257 ----
NM_015143chr411193 --144 --
NM_015144chr1673404 3238 2977 2628 1048 300 202 ------
NM_015150chr3----2774 205 --
NM_015153chr61673 --193 --
NM_015155chr1022972 2708 23024 2602 13316 --
NM_015156chr1433224 2935 2902 12594 12659 --
NM_015158chr91782 1840 ----
NM_015163chr1452003 1990 1389 1326 191 11481 11749 --
NM_015172chr141392 1371 1226 532 ------
NM_015184chr3--1227 ----
NM_015185chrX22963 406 ------
NM_015191chr1182162 2047 1796 1767 1722 724 696 511 --1380 --
NM_015200chr431951 965 598 --1986 --
NM_015208chr1834043 2657 146 13735 ----
NM_015215chr122869 2803 ------
NM_015225chr952758 2469 2427 1135 775 --1116 --
NM_015245chr61837 11900 ----
NM_015252chr21901 ------
NM_015256chr5--1551 ----
NM_015260chr1971382 1333 1177 1058 345 302 188 ------
NM_015265chr21861 12435 ----
NM_015270chr1252207 833 800 611 337 --12085 --
NM_015271chr473903 3025 1601 1527 1327 1110 976 23611 2814 ----
NM_015272chr1611622 12146 11833 --
NM_015277chr1841882 1698 1363 254 ------
NM_015278chr643445 3090 2254 387 ------
NM_015285chr1822304 1951 --2179 114 --
NM_015286chr152403 47 1557 ----
NM_015288chr543060 1424 1128 71 --23508 720 13849
NM_015291chr173093 2971 2649 2634 2235 943 439 1897 ----
NM_015294chr174929 815 345 76 1961 ----
NM_015296chr131162 ------
NM_015310chr877990 7499 5394 5278 2553 2520 2074 12443 --27828 2286
NM_015313chr1154296 3598 3559 1168 628 ------
NM_015315chr573301 3241 2883 2328 1223 577 533 ------
NM_015317chr232579 2315 1877 ------
NM_015323chr631502 459 374 124 ----
NM_015328chr783010 2834 2589 2447 1149 881 784 112 ------
NM_015335chr1232615 844 565 1624 11696 --
NM_015336chr1252576 2133 574 189 106 11850 11841 --
NM_015344chr8141 ------
NM_015347chr1212100 12556 21109 982 --
NM_015349chr611930 --12386 --
NM_015355chr1761813 1692 1431 672 273 205 ------
NM_015358chr2111084 2942 393 ----
NM_015365chrX73756 3390 3186 1206 1185 567 122 11352 ----
NM_015387chr21584 ------
NM_015393chr483794 3676 3488 3296 2450 1441 1349 1334 12350 ----
NM_015397chr92772 492 11712 --11679
NM_015423chr1131754 1277 306 1702 1615 --
NM_015435chr831378 1311 1275 --1157 --
NM_015436chr43798 241 121 --13016 --
NM_015439chr61487 ------
NM_015446chr131378 530 522 ------
NM_015455chr522683 161 22676 244 21456 1174 --
NM_015458chr865348 3444 1785 293 277 233 ------
NM_015460chr351976 1951 1876 1457 675 --21566 1498 --
NM_015464chr71409 ------
NM_015466chr31223 ------
NM_015483chr7145 ------
NM_015497chr155872 714 361 153 62 ------
NM_015508chr331416 1075 136 ------
NM_015509chr1231168 1039 1024 ------
NM_015520chr332801 1114 732 --12564 11133
NM_015532chr1552453 2110 1011 79 36 22079 1973 ----
NM_015535chr252817 2725 1614 1024 83 --1117 --
NM_015541chr321107 997 127 21218 1116 --
NM_015555chr62726 169 --1565 --
NM_015564chr532834 2248 809 ------
NM_015569chr154199 4123 1572 1337 934 13370 11584 --
NM_015570chr7----31852 1467 518 --
NM_015571chr622362 885 12284 --1801
NM_015576chr352936 2571 2121 345 227 ------
NM_015577chr53220 78 35 --1393 --
NM_015609chr181824 1000 935 818 339 310 75 35 ------
NM_015626chr171801 1266 ----
NM_015646chr1231319 1254 64 ------
NM_015657chr24790 749 670 394 ------
NM_015678chr132295 196 ------
NM_015691chrX52528 1894 1170 561 495 --22918 889 --
NM_015693chr41245 ------
NM_015695chr661431 1340 635 565 412 198 ------
NM_015702chr21257 ------
NM_015713chr822781 36 22887 2488 ----
NM_015726chr131561 1223 417 ------
NM_015833chr212652 425 ------
NM_015840chr122301 587 ----136
NM_015841chr122301 587 ----136
NM_015852chr743325 742 594 510 23180 1026 ----
NM_015866chr111017 --11471 11271
NM_015878chr831662 1460 1434 22008 1896 ----
NM_015885chr112670 309 ------
NM_015886chr875390 4021 4007 3755 3512 1264 103 23937 840 --15457
NM_015888chr132945 2922 543 ------
NM_015891chr621794 1535 149 ----
NM_015902chr8--198 ----
NM_015905chr71570 ------
NM_015906chr144256 3212 529 369 14125 1318 --
NM_015912chr832113 884 488 --22306 236 --
NM_015920chr152523 148 1222 ----
NM_015967chr11165 2811 248 ----
NM_015980chr521518 1259 ------
NM_015981chr593132 2696 2610 2596 1253 1043 965 109 34 ------
NM_015984chr11119 1469 ----
NM_015995chr15115099 4950 4085 4031 3927 3858 2077 1925 1895 1764 131 ------
NM_015999chr12678 669 ------
NM_016009chr124882 4830 21661 1038 23364 1597 --
NM_016018chr832037 1781 713 11827 ----
NM_016019chr72677 274 ------
NM_016021chr652715 2055 1880 1045 474 1675 ----
NM_016037chr13411 362 24 ------
NM_016045chr20--1493 ----
NM_016059chr63972 643 324 ------
NM_016066chr1134 ------
NM_016071chr7190 ------
NM_016072chr1232271 1723 873 --1466 --
NM_016073chr152888 108 ------
NM_016075chr1322637 2503 2437 228 1621 --
NM_016076chr123125 1039 ------
NM_016078chr17--2859 777 ----
NM_016081chr421690 1476 ----11410
NM_016083chr643500 3200 544 312 11131 1469 --
NM_016090chr111235 ------
NM_016118chr771169 1032 1016 472 455 439 44 1771 ----
NM_016125chr17139 ------
NM_016131chr241743 1565 391 27 ------
NM_016133chr22354 336 1310 ----
NM_016144chr51708 1280 ----
NM_016152chr311127 ------
NM_016162chr122188 120 1910 --1894
NM_016200chr7189 ----1325
NM_016205chr42944 540 ------
NM_016206chr3158998 8869 8263 7534 6992 6351 6306 6156 6105 5723 2967 1530 965 753 124 16740 19005 --
NM_016213chr15156 ------
NM_016217chr632292 829 132 --22990 820 --
NM_016224chr63787 501 391 11561 1600 --
NM_016227chr11159 --11527 --
NM_016248chr131234 ------
NM_016258chr11284 ------
NM_016260chr277671 6758 6205 5646 4708 2203 1892 21992 1515 1156 --
NM_016264chr191375 1446 ----
NM_016269chr441211 1138 1123 412 ------
NM_016271chr1821646 455 --142 --
NM_016272chr222467 316 ------
NM_016275chr322367 2343 --1670 11885
NM_016277chr641643 1477 1295 67 1256 ----
NM_016281chr121196 ------
NM_016289chr232273 2006 243 --1220 --
NM_016297chr243384 2564 193 101 ------
NM_016300chr31188 ------
NM_016302chr32608 282 --1245 --
NM_016303chrX1105 ------
NM_016308chr131933 1465 58 ------
NM_016311chr13115 90 35 ------
NM_016315chr23700 95 55 ------
NM_016316chr21151 1736 --142
NM_016322chr942465 2057 1261 997 12446 12170 --
NM_016351chr71176 1405 ----
NM_016353chr842382 2140 1673 83 ------
NM_016377chr661531 497 444 413 341 324 1635 ----
NM_016396chr15175 11167 12749 --
NM_016401chr112301 41 ------
NM_016422chr112127 28 1630 ----
NM_016423chr141410 ------
NM_016424chr1742001 1347 753 329 ------
NM_016427chr18----1142 --
NM_016448chr131819 1336 745 ------
NM_016470chr201393 ------
NM_016485chr621937 1427 1385 ----
NM_016488chr1231697 1290 486 11914 11209 --
NM_016507chr1733047 2996 2010 22932 507 ----
NM_016513chr643563 2911 2845 743 --23267 3116 --
NM_016516chr21183 ------
NM_016530chr1584069 4015 3734 3598 1625 1398 738 560 13069 --23712 1443
NM_016531chr453677 1523 1387 1152 1139 13198 22807 2682 --
NM_016544chr221207 123 1726 --13929
NM_016548chr93637 433 217 ------
NM_016559chr3------1982
NM_016569chr1241228 385 155 48 --11193 --
NM_016578chr11124 ------
NM_016603chr51135 ----12087
NM_016605chr562609 2271 2161 1967 1906 768 ------
NM_016607chrX41667 526 303 246 --11680 --
NM_016621chr1173374 1467 1414 1395 1151 228 145 --21355 1188 --
NM_016628chr101657 ------
NM_016631chr21--2791 216 ----
NM_016652chr2031716 1682 1498 1301 ----
NM_016654chr151486 --11110 --
NM_016656chrX1147 ------
NM_016830chr123552 449 414 ------
NM_016834chr17103963 3712 3355 2855 2628 1175 962 731 419 389 --13370 --
NM_016835chr17103963 3712 3355 2855 2628 1175 962 731 419 389 --13370 --
NM_016841chr17103963 3712 3355 2855 2628 1175 962 731 419 389 --13370 --
NM_016929chr654025 1358 679 619 152 13453 13722 --
NM_016950chr421144 259 ------
NM_017415chr533725 2830 643 24364 765 24174 3783 --
NM_017420chr1411032 22740 2383 ----
NM_017423chr41665 21997 673 ----
NM_017491chr42843 69 ------
NM_017544chrX1924 ------
NM_017551chr1052578 2279 1971 1041 297 ------
NM_017553chr1511189 --21238 512 --
NM_017580chr1021479 882 12156 ----
NM_017582chr121626 336 ------
NM_017596chr154124 3678 3496 1517 231 14685 12828 --
NM_017610chr1531969 1928 1831 1128 ----
NM_017628chr434338 1068 769 --14147 --
NM_017633chr663883 3574 3096 2716 1385 261 22578 349 ----
NM_017634chr81680 ------
NM_017635chr11--11064 ----
NM_017637chr9108521 7799 7294 7089 6982 3704 2283 1483 1114 739 35726 887 63 --17694
NM_017643chr1732540 844 384 ----12684
NM_017645chr912792 --12520 --
NM_017650chr795855 5259 4763 4118 3999 2054 2038 1749 436 11878 14031 --
NM_017651chr621552 416 --11086 --
NM_017657chr21788 ------
NM_017658chr1431177 929 728 13373 14573 11635
NM_017686chr11914 ------
NM_017691chr151396 1297 ----
NM_017709chr174336 3556 3352 575 358 276 210 ------
NM_017730chr3------1233
NM_017736chr1632713 1153 282 11062 11087 --
NM_017737chr11402 1608 11798 --
NM_017745chrX1477 ----161
NM_017746chr9186 ------
NM_017747chr5--1357 ----
NM_017754chr644752 3828 3429 26 14033 14210 --
NM_017761chr131197 951 943 ------
NM_017762chr1542056 1973 1701 211 --2863 379 --
NM_017769chr1432790 1259 43 12355 12258 --
NM_017779chr152777 720 264 135 91 --11767 --
NM_017780chr82891 155 ------
NM_017787chr1042715 2296 997 488 ------
NM_017798chr2061181 956 784 504 474 396 ------
NM_017799chr1441613 1320 1262 178 11299 ----
NM_017801chr362058 1820 1758 1601 303 155 12042 ----
NM_017811chr942319 772 608 35 ------
NM_017813chr895304 5194 5026 3960 3598 1315 1046 723 715 1239 --14959
NM_017831chr1844767 4569 3037 2951 ------
NM_017843chr201634 ------
NM_017848chrX33983 2992 1151 --13743 --
NM_017849chr243061 2187 2053 363 12076 ----
NM_017870chr111167 ------
NM_017880chr21457 ------
NM_017902chr1075226 3517 2034 1339 287 125 39 ------
NM_017913chr9----131 --
NM_017919chr965798 4569 1741 1238 836 28 14135 12017 --
NM_017933chr221423 1083 ------
NM_017938chrX32159 1720 311 ------
NM_017944chr1162599 2488 2267 1950 892 792 --175 --
NM_017954chr741625 1221 502 476 ------
NM_017993chr131281 ------
NM_017994chr742813 2298 2080 1117 ------
NM_018000chr22512 387 ----1308
NM_018027chr1021290 373 --12991 --
NM_018028chr1911037 ------
NM_018030chr181384 2290 205 ----
NM_018045chr142423 1929 1217 162 11062 ----
NM_018046chr541839 737 596 263 ------
NM_018061chr121560 304 --11400 --
NM_018070chr1----181 --
NM_018078chr421015 859 1887 ----
NM_018079chr21506 ------
NM_018092chr1631527 552 529 --1237 --
NM_018094chrX1359 ------
NM_018098chr381146 1136 1064 856 331 270 243 133 ------
NM_018105chr811158 ------
NM_018112chr92305 64 ------
NM_018114chr31115 --1421 --
NM_018120chr821355 1196 ------
NM_018121chr1042375 2249 163 121 --13197 --
NM_018133chr32438 378 11840 11488 --
NM_018155chr352909 1204 1176 976 252 21303 815 ----
NM_018159chrX61235 1118 1086 584 441 425 2691 548 ----
NM_018184chr331490 445 190 ------
NM_018195chr1161849 1724 1452 828 444 387 22131 745 1117 --
NM_018200chr1542260 1805 1795 666 11746 ----
NM_018202chr11122 ------
NM_018211chr142041 1464 864 230 ------
NM_018214chr631256 1084 871 --1901 --
NM_018221chr2164 ------
NM_018227chr432001 1183 242 12909 ----
NM_018241chr41398 --21000 917 1712
NM_018243chr454062 3807 3580 3068 65 23886 978 ----
NM_018245chr101502 --1166 --
NM_018246chr842808 2238 1835 1787 11967 1533 --
NM_018247chr643141 2498 1260 93 12139 ----
NM_018254chr11855 ----11568
NM_018257chr201984 --11763 --
NM_018266chr321067 776 11115 ----
NM_018293chr342461 744 444 81 --1555 --
NM_018299chr833487 398 230 22862 2163 ----
NM_018302chr441921 1696 793 209 1730 137 --
NM_018307chr171842 ------
NM_018313chr331701 766 300 ----12008
NM_018318chr122882 269 ------
NM_018323chr421331 483 11633 --1199
NM_018327chr201558 ----11720
NM_018328chr22382 135 ------
NM_018330chr101345 11650 ----
NM_018334chr7168 ------
NM_018339chr911657 ------
NM_018342chr431715 1357 1232 ------
NM_018348chr1621262 290 ------
NM_018351chr1284399 3883 3523 1835 1796 1511 1274 839 34016 1850 1771 ----
NM_018361chr862748 2586 1233 1186 492 34 --13968 1784
NM_018362chr1143947 3316 2957 128 1267 ----
NM_018364chr122654 1025 33373 882 360 ----
NM_018368chr61201 ------
NM_018369chr5126 ------
NM_018371chr8------1542
NM_018374chr745186 4772 3896 1073 ------
NM_018383chr211756 ------
NM_018400chr1124490 3861 --24164 470 --
NM_018401chr411525 ------
NM_018403chr353291 2723 1114 1103 836 1705 ----
NM_018416chr1242613 2546 732 544 ------
NM_018425chr1032186 1045 497 --12232 --
NM_018429chr542860 2331 2243 283 ------
NM_018440chr887379 6993 5646 2425 2243 2001 1112 373 15681 35934 5793 1706 28341 1464
NM_018469chr1721030 94 --1164 --
NM_018482chr852519 2460 2405 1740 885 11632 ----
NM_018488chr171760 ------
NM_018489chr121948 335 --11512 --
NM_018490chr1141688 1288 537 111 11313 --11847
NM_018557chr211151 21530 1385 --1404
NM_018559chr131224 ------
NM_018566chr165074 5068 4418 4314 3618 1084 14345 14659 13895
NM_018569chr431393 1014 232 11340 ----
NM_018590chr10--11704 --11389
NM_018602chr151325 21646 314 ----
NM_018638chr1265308 5234 5124 4556 3594 192 --14005 --
NM_018660chr872821 2309 2230 2138 2034 331 67 ----12491
NM_018662chr154233 3602 3124 435 255 --1359 --
NM_018685chr761090 817 181 115 41 21 ------
NM_018695chr51484 1724 ----
NM_018704chr131785 1437 293 22023 407 ----
NM_018708chr1951534 1219 533 203 180 11035 ----
NM_018712chr1121568 188 ----1979
NM_018834chr5--1738 ----
NM_018847chr91417 --11862 --
NM_018898chr521701 439 --12363 --
NM_018899chr521701 439 --12363 --
NM_018900chr521701 439 --12363 --
NM_018901chr521701 439 --12363 --
NM_018902chr521701 439 --12363 --
NM_018903chr521701 439 --12363 --
NM_018904chr521701 439 --12363 --
NM_018905chr521701 439 --12363 --
NM_018906chr521701 439 --12363 --
NM_018907chr521701 439 --12363 --
NM_018908chr521701 439 --12363 --
NM_018909chr521701 439 --12363 --
NM_018910chr521701 439 --12363 --
NM_018911chr521701 439 --12363 --
NM_018939chr52606 541 ------
NM_018945chr641347 620 376 305 --13592 --
NM_018951chr72835 272 ------
NM_018953chr12--1843 ----
NM_018970chr762554 1017 619 504 296 283 ------
NM_018976chr1222856 548 1739 1312 --
NM_018977chrX2942 898 ------
NM_018979chr1242370 1601 931 660 --11700 --
NM_018999chr1054685 3809 3537 1550 910 14316 ----
NM_019001chr374488 4011 3654 1865 1477 1321 960 11087 ----
NM_019004chr751767 752 706 681 609 ------
NM_019006chr151108 ------
NM_019044chr284368 3957 3411 1488 900 605 572 27 13560 24086 3019 --
NM_019060chr1--1302 ----
NM_019063chr242267 2035 1465 565 --11441 11896
NM_019071chr7----2633 211 --
NM_019072chr573705 3638 3516 3392 2980 1640 246 11148 1511 --
NM_019073chr1136 ------
NM_019084chr1052559 2093 1989 993 310 1525 12592 --
NM_019087chr521596 1494 1574 ----
NM_019091chr221023 38 --1404 --
NM_019094chr1283758 3547 2733 2537 560 333 235 109 --13348 --
NM_019098chr811756 1234 ----
NM_019102chr73345 156 53 ------
NM_019102chr73345 156 53 ------
NM_019590chr101128 1198 ----
NM_019593chr2052736 2073 817 560 161 23172 2350 1478 --
NM_019600chr151565 ------
NM_019610chr121695 648 --1522 --
NM_019857chrX11763 ------
NM_019885chr22301 291 ------
NM_019891chr141176 943 478 415 ------
NM_019895chr34813 311 201 30 ------
NM_020119chr733915 702 518 133 31415 1222 874 --
NM_020123chr1031353 615 472 11371 --11111
NM_020130chr81929 ------
NM_020134chr21756 ------
NM_020141chr141752 825 783 310 1140 ----
NM_020147chr152843 72 ----132
NM_020148chr18130 ----12886
NM_020150chr1031401 896 270 ------
NM_020159chr41501 ------
NM_020177chr563243 2397 2382 2084 834 776 11129 ----
NM_020193chr111403 ------
NM_020205chr133353 684 478 ------
NM_020210chr151985 ------
NM_020226chr42676 625 ------
NM_020239chr131975 341 26 ------
NM_020309chr19173 ------
NM_020310chr1762075 1873 372 269 257 238 ------
NM_020336chr2041492 1217 1078 508 32477 1543 588 ----
NM_020337chr41777 ----1343
NM_020338chr1043049 2992 693 341 --13319 --
NM_020341chr201491 ------
NM_020342chr211054 11612 12597 --
NM_020346chr1131708 1541 1272 ------
NM_020347chr322120 1923 187 ----
NM_020357chr31551 ------
NM_020362chr12191 35 --1311 --
NM_020366chr14--178 ----
NM_020381chr61391 1458 ----
NM_020382chr1221610 1444 ------
NM_020403chr132399 285 1422 ----
NM_020405chr1774050 3348 2834 1620 1565 1197 394 ------
NM_020425chr651962 1659 1499 1249 532 11365 1244 --
NM_020429chr772926 2803 2207 2069 885 853 778 --1949 --
NM_020431chr1432734 2706 2418 11696 ----
NM_020443chr1127004 6367 6203 5097 2686 2525 2460 2194 1866 1170 1026 1003 ------
NM_020455chr622820 324 --1218 --
NM_020456chr1332356 2041 552 ------
NM_020465chr1631942 1859 1755 ------
NM_020473chrX31693 1674 1559 ------
NM_020474chr1811373 1377 11559 --
NM_020532chr22211 178 ------
NM_020640chr312091 ------
NM_020651chr21477 ------
NM_020653chr17169 ------
NM_020654chr32514 380 1661 ----
NM_020655chr1611021 11450 ----
NM_020673chr2087791 7447 7272 1828 1746 654 644 536 17673 ----
NM_020676chr31826 ------
NM_020686chr1633020 1093 385 --32772 2023 1933 22743 404
NM_020699chr144086 3621 1837 1175 24400 346 ----
NM_020708chr2052411 2325 2070 462 210 ------
NM_020717chrX53363 3334 1998 1872 1011 23585 3546 ----
NM_020718chr1696447 5689 5136 4652 4572 2425 1990 1248 196 --36033 652 635 16054
NM_020727chr2133008 1505 295 13869 --168
NM_020734chr1242685 2280 473 406 ------
NM_020740chr172385 66 ------
NM_020742chrX22535 427 --12134 --
NM_020747chr52342 25 --1705 --
NM_020749chr821823 1499 --1444 --
NM_020750chr63521 419 40 ------
NM_020752chr1022394 657 ------
NM_020755chr631520 1440 144 ------
NM_020762chr121212 ------
NM_020766chrX43764 3561 882 609 --24190 581 --
NM_020768chr532358 500 256 --11238 --
NM_020771chr62420 326 11508 ----
NM_020772chr1778497 7007 5689 5403 3412 1285 359 28480 7529 58517 7217 6036 3239 784 --
NM_020774chr1895272 5207 5069 3941 2132 2116 2019 1872 1656 --14642 --
NM_020783chr1832386 485 288 ------
NM_020791chr1721424 1089 21074 177 ----
NM_020796chr532655 1152 621 1640 ----
NM_020801chr542199 1740 874 271 ------
NM_020809chr1142309 2085 1581 245 ------
NM_020810chr1443389 3026 848 708 --1918 --
NM_020818chr142334 25 ------
NM_020824chr10----1747 --
NM_020839chr3--1465 ----
NM_020841chr1273709 3406 2811 2531 1449 378 217 12864 --13061
NM_020844chr857049 5555 5217 1501 820 15640 --11743
NM_020856chr1911249 11601 ----
NM_020858chr1531488 838 353 --1657 --
NM_020859chr443857 1241 800 519 ------
NM_020870chr421479 1447 ----11894
NM_020871chrX32076 826 541 ------
NM_020872chr32596 368 ------
NM_020873chr31277 ------
NM_020922chrX1383 194 ----
NM_020924chr92434 369 ------
NM_020925chr1--1250 11429 --
NM_020927chr1642135 1806 181 169 ----11748
NM_020935chr274375 4078 3070 860 852 412 170 --11275 14038
NM_020940chr1052845 2785 2734 943 312 22455 2296 ----
NM_020946chr911495 ------
NM_020948chr153710 3575 3144 2730 1407 11021 11391 --
NM_020951chr1932336 2215 1985 --11694 --
NM_020952chr93864 657 195 ------
NM_020956chr19153449 3325 3096 1900 1885 1861 1822 1807 1744 1729 1705 1666 1651 1627 1495 ------
NM_020962chr1541681 913 793 765 ------
NM_020964chr1853855 3150 1913 1335 888 ------
NM_020967chr201351 --2493 119 --
NM_020981chr21235 1129 ----
NM_020987chr1031029 944 338 --1312 11246
NM_021007chr232262 871 69 1385 ----
NM_021033chr1353260 2964 2578 2303 2196 ------
NM_021069chr421912 89 11949 ----
NM_021083chrX53544 2823 2551 1440 454 --43524 3167 3078 1214 --
NM_021090chr2254694 4502 4380 1779 419 --33125 3048 1712 14763
NM_021096chr222615 330 ------
NM_021097chr263056 2556 2119 952 861 89 --11052 --
NM_021111chr921068 477 1250 ----
NM_021116chr798302 7416 6773 5497 2866 2629 2245 2130 1606 27659 7374 48758 5679 2881 874 --
NM_021120chrX43050 1014 1006 210 12675 23065 2636 --
NM_021132chr1011180 --1179 --
NM_021136chr141190 ------
NM_021140chrX3724 140 39 ------
NM_021145chr72824 146 1797 ----
NM_021153chr183709 173 33 ------
NM_021155chr1962301 2145 1095 295 282 131 --1622 --
NM_021161chr14------1141
NM_021167chr732232 1882 862 1176 ----
NM_021176chr2130 --21837 1580 --
NM_021183chrX22529 2138 1141 ----
NM_021184chr61696 ------
NM_021190chr13859 330 47 1198 ----
NM_021191chr1241652 498 301 276 1428 ----
NM_021192chr2--1442 ----
NM_021198chr241353 1180 293 206 --1116 --
NM_021202chr2043068 2976 983 536 12302 ----
NM_021205chr1--12889 1713 --
NM_021218chr92984 68 ------
NM_021219chr211161 ------
NM_021229chr121101 ----11156
NM_021252chr102328 76 ------
NM_021253chr641278 1146 1129 47 11222 ----
NM_021574chr2242039 1810 1602 618 ------
NM_021614chr5139 1211 ----
NM_021629chr374180 4076 3870 3483 2030 1953 1544 2579 374 1900 --
NM_021630chr81331 ------
NM_021638chr473922 3898 3848 3627 694 650 270 24283 1915 13057 11423
NM_021643chr241770 747 691 525 ------
NM_021644chr1011125 1897 ----
NM_021648chr622753 1865 --2568 179 1735
NM_021722chr71135 1364 ----
NM_021723chr71176 1405 ----
NM_021813chr665726 4952 4734 3933 3571 200 --21977 748 --
NM_021911chr585039 4245 4026 3897 2258 1742 1555 432 --1491 --
NM_021912chr1543285 1570 1066 799 24061 1088 ----
NM_021913chr193560 447 378 ------
NM_021914chr1422338 174 21534 231 1570 --
NM_021931chr2031087 1061 716 ------
NM_021946chrX21463 1360 ------
NM_021951chr91838 ------
NM_021954chr132899 380 22693 751 1543 13650
NM_021961chr1187373 7363 6878 6505 5583 2808 1268 367 25042 1180 15270 --
NM_021964chr3106190 5823 5673 5634 5167 4996 1960 1536 730 248 25807 536 --11002
NM_021988chr20------1203
NM_021998chrX1932 21280 371 ----
NM_022037chr23942 856 839 ------
NM_022041chr1632438 1839 292 --1787 --
NM_022048chr1584263 3951 2253 2149 1989 1268 321 67 --35062 951 297 --
NM_022049chr121799 566 11473 ----
NM_022058chr222015 138 ------
NM_022063chr10------11652
NM_022075chr12906 606 ------
NM_022080chr2042121 1131 650 507 --12341 --
NM_022087chr71446 ------
NM_022090chr51203 --1524 --
NM_022114chr184192 4174 4087 1879 1849 1635 1591 844 ------
NM_022130chr521018 241 1216 ----
NM_022138chr611546 ------
NM_022143chr73523 387 259 ------
NM_022144chrX158 ------
NM_022173chr23942 856 839 ------
NM_022336chr262263 2147 2103 2072 921 75 --11941 --
NM_022337chr112560 238 1670 --1531
NM_022351chr812794 1762 1671 --
NM_022373chr71777 ------
NM_022442chr20------1203
NM_022457chr1183 ------
NM_022459chr1395538 5258 4924 3852 2516 1961 1326 987 361 1210 11536 --
NM_022462chr1943533 2445 1031 537 --13648 --
NM_022465chr1242661 2592 2362 2064 ------
NM_022469chr153195 2966 1208 981 753 ----12499
NM_022474chr1452481 2141 2024 970 539 32806 2147 1752 ----
NM_022475chr4157 ------
NM_022650chr52852 282 ------
NM_022658chr1221271 89 1930 ----
NM_022719chr2263527 2826 2803 2462 1438 239 1710 11025 --
NM_022726chr621302 1204 ------
NM_022728chr7--1632 ----
NM_022735chr111800 ------
NM_022737chr193828 393 382 --11167 --
NM_022739chr172232 211 ------
NM_022753chr122807 964 --1954 --
NM_022755chr952534 2483 2190 1847 1041 ----12559
NM_022763chr332677 2618 945 33150 3111 2338 12178 --
NM_022770chr1611283 1289 ----
NM_022780chr231451 360 244 ------
NM_022782chr122139 124 ------
NM_022787chr142391 1880 614 523 --1916 --
NM_022824chr541561 1421 599 169 11955 ----
NM_022826chr21748 1415 ----
NM_022831chr141811 1216 452 366 --11603 --
NM_022843chr1311452 11501 ----
NM_022845chr1631996 327 154 ------
NM_022897chr53848 732 412 ------
NM_022898chr1454781 1582 1496 921 83 11785 23395 912 --
NM_022901chr931931 1823 70 1660 ----
NM_022905chr1521238 45 1208 ----
NM_022910chr1631942 1859 1755 ------
NM_022912chr222640 337 32621 2420 1122 ----
NM_023000chr142488 38 31200 224 215 ----
NM_023001chr142488 38 31200 224 215 ----
NM_023010chrX3651 233 149 ------
NM_023039chr5--1362 ----
NM_023074chr1941112 889 482 54 ------
NM_023076chr1642751 2127 2120 89 ------
NM_023079chr1721700 1412 11753 ----
NM_023928chr122860 21 --11045 --
NM_023929chr81329 ------
NM_023934chrX31621 762 113 31988 1874 1452 ----
NM_024015chr17----11060 --
NM_024052chr1762922 2563 1206 1051 660 578 11935 11943 --
NM_024085chr26702 367 258 149 72 56 ------
NM_024087chrX--1635 --1427
NM_024090chr431506 1326 362 ------
NM_024091chr5------1203
NM_024122chrX1252 ------
NM_024345chr965432 4992 4686 4116 369 243 24289 3902 ----
NM_024421chr183902 435 111 ------
NM_024501chr21270 1722 ----
NM_024524chr331079 1036 80 --1722 12200
NM_024539chrX1401 1139 ----
NM_024541chr1041761 1648 1287 705 ------
NM_024545chr23614 556 494 ----1237
NM_024548chr321275 632 --11439 --
NM_024561chr13--11406 ----
NM_024567chr81583 ------
NM_024582chr42923 721 ------
NM_024611chr1543767 3084 2733 1561 --22558 743 13521
NM_024612chr171305 1204 11161 1432
NM_024613chr821475 1224 ------
NM_024665chr393917 3513 3070 2870 1857 1793 1583 1558 1181 180 ----
NM_024670chr1021419 438 1369 ----
NM_024674chr152896 2124 1220 105 32 1945 ----
NM_024683chr17121 ------
NM_024692chr211862 21216 722 1271 --
NM_024699chr8----1318 --
NM_024713chr1521159 1082 ------
NM_024721chr82731 695 22609 857 ----
NM_024744chr222581 2284 ----1753
NM_024745chr16170 ----1374
NM_024759chr83600 178 149 ------
NM_024770chr242339 1252 407 118 21857 127 21233 43 --
NM_024779chr1221324 1156 ------
NM_024783chr111409 ----1388
NM_024792chr1731177 1127 1022 --1935 --
NM_024812chr832182 1449 452 --11379 1377
NM_024824chr1441347 1080 571 390 ------
NM_024834chr1031577 521 485 ------
NM_024837chr1511874 --1697 --
NM_024900chr442248 742 627 530 ------
NM_024900chr442248 742 627 530 ------
NM_024915chr872824 2816 2684 2323 2316 2300 1077 ------
NM_024920chr43591 473 321 11571 1255 --
NM_024930chr562680 2098 886 757 550 447 ------
NM_024944chr211187 ------
NM_024946chr1631505 570 152 ------
NM_024947chr358315 7914 6782 2553 421 27202 2068 ----
NM_024969chr21655 ------
NM_024971chr93864 657 195 ------
NM_024989chr255555 5250 5237 1445 664 1417 --11785
NM_025040chr1941650 1562 604 483 --132 12494
NM_025054chr894110 3813 3206 2940 2812 1054 419 390 377 12665 ----
NM_025057chr14--1134 --1247
NM_025073chr194702 3570 3247 3201 1880 1439 1402 526 493 31322 651 642 ----
NM_025076chr21690 --1102 --
NM_025134chr162982 431 --1760 --
NM_025138chr1331456 1270 954 ------
NM_025160chr144308 4064 3928 257 11250 ----
NM_025164chr1141376 520 182 80 --12049 --
NM_025181chr21187 ------
NM_025184chrX3878 208 148 ------
NM_025202chr22140 128 21002 324 ----
NM_025221chr421394 1341 ------
NM_025235chr1031566 638 222 ------
NM_025250chr7102460 2291 2189 1141 812 741 464 103 52 33 --12223 --
NM_025268chr141371 ------
NM_030594chr1511188 1460 --11204
NM_030621chr1454144 3600 2613 1182 436 21213 830 11408 13033
NM_030627chr554060 3475 1344 211 175 ------
NM_030637chr14166 ------
NM_030640chr121345 ------
NM_030647chr731758 972 158 ------
NM_030648chr444348 4147 1572 903 25579 1355 --1419
NM_030650chr243953 3557 3296 1202 23437 1522 12902 --
NM_030664chr1012010 22271 644 ----
NM_030667chr1221228 806 ------
NM_030668chr1221228 806 ------
NM_030669chr1221228 806 ------
NM_030674chr1245776 4241 2239 780 --11321 --
NM_030755chr1452656 2587 2202 236 121 ------
NM_030762chr1231925 1517 1492 ------
NM_030786chr141685 555 463 103 ------
NM_030791chr1421763 563 ------
NM_030796chr721971 543 ------
NM_030799chr521646 241 ------
NM_030802chr172302 135 ------
NM_030806chr179118 6780 6387 3403 3300 2137 519 13441 11694 --
NM_030816chr153624 3575 947 431 22 --2699 188 --
NM_030820chr611007 ------
NM_030821chr41758 1769 ----
NM_030922chr151790 ------
NM_030927chr1051176 1038 623 524 61 11437 ----
NM_030934chr111291 --1119 --
NM_030939chr62991 378 1449 ----
NM_030948chr6----125 --
NM_030964chr533433 1424 233 11181 ----
NM_031216chr181539 --11439 --
NM_031266chr51346 ------
NM_031291chr42114 66 ------
NM_031305chr42540 526 ------
NM_031314chr1421803 1493 ------
NM_031362chr232530 2232 928 ------
NM_031365chr242666 2368 1064 89 ------
NM_031366chr242666 2368 1064 89 ------
NM_031369chr41221 --1307 --
NM_031370chr41221 --1307 --
NM_031372chr421472 190 ------
NM_031411chr521701 439 --12363 --
NM_031431chr1331428 1306 490 --1565 --
NM_031435chr1213106 13371 ----
NM_031442chrX43019 3001 1178 1040 ------
NM_031445chr222253 793 --12121 --
NM_031453chr10130 ------
NM_031459chr141438 464 434 322 ------
NM_031461chr82442 121 32212 891 235 ----
NM_031468chr7108018 6800 5462 5149 2961 1700 842 759 634 53 38169 5260 5225 16297 --
NM_031473chr123938 860 429 ------
NM_031483chr2032508 1266 299 ------
NM_031844chr143629 2613 2582 235 ------
NM_031845chr233331 3027 1017 ------
NM_031847chr233331 3027 1017 ------
NM_031849chr521701 439 --12363 --
NM_031857chr521701 439 --12363 --
NM_031858chr17158 ------
NM_031860chr521701 439 --12363 --
NM_031862chr17158 ------
NM_031892chrX3892 239 83 ------
NM_031938chr111818 ------
NM_031989chr121267 ------
NM_032012chr985022 4255 3900 3735 3407 2090 1262 721 ------
NM_032027chr11287 ------
NM_032028chr51644 ------
NM_032050chr2211007 ------
NM_032121chrX72525 2494 2393 2208 2185 1998 675 --1517 --
NM_032124chr182467 77 --1246 --
NM_032132chr11412 2213 145 ----
NM_032139chr1931101 868 354 ------
NM_032174chr121450 1432 ------
NM_032181chr21623 ------
NM_032189chr1364788 3632 653 600 250 206 --14569 --
NM_032195chr211362 ------
NM_032208chr223179 673 13608 22635 2497 --
NM_032221chr20--11990 ----
NM_032229chr131747 1978 188 --
NM_032231chr152295 255 ------
NM_032239chr44980 930 516 158 ------
NM_032242chr333089 592 415 --13015 --
NM_032246chr1511332 --1426 --
NM_032272chr81457 ------
NM_032291chr131430 527 441 21292 429 ----
NM_032315chr11258 ------
NM_032321chr2138 ------
NM_032352chr1421317 368 --158 --
NM_032373chr1085012 4332 3766 2234 1486 1299 914 270 24532 2104 1189 --
NM_032410chr81216 ----11231
NM_032434chr23475 429 203 ------
NM_032438chr6--1561 --1494
NM_032439chr1011375 ------
NM_032440chr1022431 928 1410 12567 --
NM_032441chrX2411 111 ------
NM_032444chr164900 884 321 33 ------
NM_032446chr543851 2851 2367 698 ------
NM_032457chr443910 2582 2391 2385 32859 2492 657 1421 --
NM_032458chrX43135 2730 2190 592 ----12106
NM_032466chr81210 --11653 --
NM_032468chr81210 --11653 --
NM_032505chr342791 2162 723 664 12756 ----
NM_032509chr842331 2313 2258 849 ------
NM_032520chr16--1193 ----
NM_032521chr2032724 2426 37 13081 12195 --
NM_032539chrX2710 657 ------
NM_032557chr41843 ------
NM_032558chr941454 1421 1112 395 ------
NM_032575chr1651869 802 785 194 143 ------
NM_032578chr1031441 597 260 1525 ----
NM_032632chr1411774 ------
NM_032682chr333643 1190 747 --1159 --
NM_032711chr1753569 1408 1321 1233 679 --11154 --
NM_032727chr1031408 1104 300 ------
NM_032782chr54852 182 96 62 ------
NM_032784chr6140 1139 ----
NM_032801chr1121872 654 22256 821 12318 --
NM_032802chr15----129 --
NM_032810chr1041327 1013 565 529 ------
NM_032837chr1752173 2076 1974 826 678 1491 ----
NM_032840chr123925 757 354 1479 ----
NM_032842chr741676 1635 1570 1294 --1286 --
NM_032859chr1343900 2805 1361 610 23885 3838 --13671
NM_032885chr19154 ------
NM_032918chr121180 ------
NM_032932chr1755984 4908 4276 2135 282 15070 16059 --
NM_032947chr521293 104 --1793 --
NM_032949chr133574 543 222 ------
NM_032968chrX43770 3111 819 581 --13253 --
NM_032969chrX43770 3111 819 581 --13253 --
NM_032973chrY33762 3106 581 --13248 --
NM_033020chr144256 3212 529 369 14125 1318 --
NM_033030chr23583 513 238 --11057 --
NM_033031chrX--1168 ----
NM_033044chr12835 387 ------
NM_033056chr10------1561
NM_033083chr342837 2555 606 565 --21181 186 --
NM_033088chr1----1672 --
NM_033089chr2031445 1107 56 11434 ----
NM_033105chr81455 1146 ----
NM_033124chr121112 ------
NM_033127chr12682 112 ------
NM_033131chr1--11780 ----
NM_033132chr1331681 1538 762 ------
NM_033136chr511641 --11843 --
NM_033137chr511641 --11843 --
NM_033138chr732188 774 748 ------
NM_033139chr732188 774 748 ------
NM_033140chr732188 774 748 ------
NM_033157chr732188 774 748 ------
NM_033181chr643500 3200 544 312 11131 1469 --
NM_033224chr756741 6026 5779 5531 3154 35900 2861 1572 16561 15059
NM_033225chr842843 2327 1037 166 --11164 173
NM_033228chr51422 ------
NM_033261chr10--1160 ----
NM_033285chr863655 3645 3538 1352 947 499 ------
NM_033305chr931397 1234 404 11355 ----
NM_033326chr1141849 978 563 393 --1784 --
NM_033331chr952403 2382 2277 1254 415 --11107 --
NM_033360chr12114619 4334 3211 2877 1851 1391 1201 979 684 626 306 14038 ----
NM_033380chrX3394 113 102 1784 ----
NM_033381chrX3394 113 102 1784 ----
NM_033389chr1744357 4238 3855 1153 11674 13913 --
NM_033394chr231447 1158 129 1309 ----
NM_033402chr8184 ------
NM_033425chr113602 328 110 ------
NM_033426chr1442348 2131 919 141 11081 ----
NM_033429chr1552441 1113 1048 559 498 ----11081
NM_033449chr531570 508 231 --1534 --
NM_033495chrX1313 ----151
NM_033505chr2106506 5503 5250 4451 4365 2479 2352 2256 1679 1503 24859 2119 ----
NM_033515chr6--143 11366 --
NM_033535chr431061 1007 286 --11159 --
NM_033551chr573301 3241 2883 2328 1223 577 533 ------
NM_033624chr122232 39 --1512 --
NM_033644chr52960 426 12259 ----
NM_033645chr52960 426 12259 ----
NM_033656chr2155055 4360 1151 1035 201 25462 771 22347 337 --
NM_052827chr1231103 1037 1005 1314 ----
NM_052834chr1822304 1951 --2179 114 --
NM_052840chr1521059 276 ----11312
NM_052875chr1111420 --12100 --
NM_052879chr1232880 569 467 12778 14095 --
NM_052885chr1294951 4945 4348 4108 4008 3133 843 425 352 ------
NM_052886chr811352 --21475 744 11789
NM_052900chr831600 676 477 1646 ----
NM_052903chr152501 37 ------
NM_052905chr22307 69 21445 1340 ----
NM_052917chr252692 2562 961 866 329 43423 1096 1082 293 12179 --
NM_052923chr6174 ------
NM_052927chr522068 522 ------
NM_052940chr11152 ------
NM_052954chr2152234 1818 1415 123 28 ----12097
NM_053002chr321038 266 ------
NM_053016chr9107406 7358 7116 6297 6233 2813 1994 1672 981 393 12677 15481 --
NM_053023chr11--1900 ----
NM_053024chr331314 1129 437 11533 --11288
NM_053035chr7190 ------
NM_053056chr1152528 2083 2041 1192 278 12074 ----
NM_053064chr1442542 1072 268 253 ------
NM_053279chr862656 2606 1821 877 374 58 12035 22781 331 --
NM_054016chr111755 12041 11296 --
NM_054016chr111755 12041 11296 --
NM_054016chr111755 12041 11296 --
NM_054027chr52213 145 --1350 --
NM_054033chr21235 --177 --
NM_057175chr442572 2246 1717 1010 ------
NM_057178chr1732356 2020 136 1611 ----
NM_057182chr19--1494 ----
NM_057749chr83955 365 131 1531 ----
NM_058170chr12360 224 --1602 --
NM_058172chr431275 587 191 ------
NM_058241chr252364 2292 2206 2000 1788 ------
NM_058241chr252364 2292 2206 2000 1788 ------
NM_078470chr1032635 284 259 --12499 --
NM_080546chr91537 --12300 --
NM_080597chr181384 2290 205 ----
NM_080629chr1268 50 11456 ----
NM_080630chr1268 50 11456 ----
NM_080632chrX3651 233 149 ------
NM_080645chr641618 729 336 201 11731 ----
NM_080655chr9------1224
NM_080669chr1773580 3409 3031 1813 592 465 278 21566 687 14039 --
NM_080671chr231882 408 309 ------
NM_080672chr20----1383 --
NM_080676chr2032452 2301 1284 ----13239
NM_080677chr172113 21 ------
NM_080723chr631392 1031 314 21194 440 21038 181 --
NM_080743chr612037 12553 ----
NM_080759chr1321948 1023 ------
NM_080760chr1321948 1023 ------
NM_080792chr201911 --12039 --
NM_080862chr351331 890 818 527 61 ------
NM_080867chr1464793 3709 3110 855 725 427 --13235 --
NM_080872chr823802 1455 23949 903 21037 823 --
NM_080921chr11814 ------
NM_080927chr31158 --12163 --
NM_100264chr101657 ------
NM_100486chr101657 ------
NM_130387chr321016 492 1200 ----
NM_130391chr943339 2762 2683 2385 --22819 1389 12402
NM_130392chr943339 2762 2683 2385 --22819 1389 12402
NM_130393chr943339 2762 2683 2385 --22819 1389 12402
NM_130434chr152867 107 --1142 --
NM_130436chr21------11023
NM_130439chr1032058 1904 315 --22166 1810 --
NM_130439chr1032058 1904 315 --22166 1810 --
NM_130469chr141804 ------
NM_130797chr771666 1646 1377 1351 1294 1253 1158 --1435 --
NM_130808chr3--1403 ----
NM_130809chr542712 2684 320 161 23144 708 22379 970 --
NM_130838chr151461 ------
NM_130839chr151461 ------
NM_130846chr122855 336 ------
NM_130847chr11135627 5207 5175 5058 2364 1884 1812 1653 1353 841 793 466 457 11994 15617 --
NM_133170chr2035579 2872 183 17258 16748 --
NM_133264chr1743213 2570 1480 775 ------
NM_133265chrX23011 1332 33022 2357 1274 13383 1827
NM_133328chr191671 ------
NM_133329chr251618 1612 618 597 102 ------
NM_133334chr476372 5971 5798 5276 4701 4667 1039 12061 26195 829 --
NM_133367chr653344 2437 2170 1331 759 12235 ----
NM_133369chr51870 ------
NM_133370chr453167 644 585 422 357 13260 12295 --
NM_133468chr74770 739 671 340 1208 ----
NM_133476chr122855 295 --1226 --
NM_133478chr232449 2348 112 ------
NM_133496chr154327 3415 3345 1329 823 1511 --1499
NM_133507chr125867 671 367 230 156 ------
NM_133625chr331191 914 383 1494 1306 --
NM_133631chr311324 --11359 --
NM_133638chr51321 ------
NM_133646chr253933 3720 1932 1621 943 --11423 15537
NM_133647chr1563408 2654 1085 683 632 65 --11366 --
NM_134265chr171801 1266 ----
NM_134442chr221305 1217 ------
NM_138270chrX42616 845 839 710 1337 ----
NM_138286chr1973334 3038 2733 1530 1256 812 393 ------
NM_138287chr351867 1033 636 267 156 22003 1969 2549 535 --
NM_138316chr101981 ------
NM_138317chr14------1141
NM_138318chr14------1141
NM_138335chr41112 1864 ----
NM_138340chr181492 ------
NM_138375chr183819 452 440 --1947 --
NM_138391chr1----1260 --
NM_138423chr15--12014 --12154
NM_138426chr742302 1861 1755 762 --1212 --
NM_138444chr1314452 24846 3162 11871 --
NM_138448chr21133 ------
NM_138459chr623019 2550 1928 ----
NM_138468chr221753 1316 1816 ----
NM_138473chr1274775 3591 3552 3174 1326 724 229 ------
NM_138492chr521478 344 1600 ----
NM_138555chr151439 1218 ----
NM_138569chr6157 ------
NM_138576chr1454781 1582 1496 921 83 11785 23395 912 --
NM_138633chr661531 497 444 413 341 324 1635 ----
NM_138638chr1422338 174 21534 231 1570 --
NM_138713chr1687990 6696 5737 5530 5025 3252 1998 343 --26120 3089 --
NM_138714chr1687990 6696 5737 5530 5025 3252 1998 343 --26120 3089 --
NM_138717chr61542 ------
NM_138730chr6133 ------
NM_138731chr1453726 953 857 768 555 11367 ----
NM_138736chr1663466 3365 1592 1513 749 358 14201 21350 255 --
NM_138766chr51437 --1201 --
NM_138773chr52782 55 ------
NM_138782chr5146 ----1502
NM_138799chr232067 335 181 11604 ----
NM_138811chr72967 869 ------
NM_138821chr51437 --1201 --
NM_138822chr51437 --1201 --
NM_138927chr211999 ------
NM_138959chr156650 5863 1938 1841 710 15482 24852 1613 11981
NM_138971chr1143688 2993 1058 473 1863 ----
NM_138971chr1143688 2993 1058 473 1863 ----
NM_138972chr1143688 2993 1058 473 1863 ----
NM_138972chr1143688 2993 1058 473 1863 ----
NM_138973chr1143688 2993 1058 473 1863 ----
NM_138973chr1143688 2993 1058 473 1863 ----
NM_139012chr632217 887 806 12260 ----
NM_139035chrX1183 ------
NM_139048chr311121 ------
NM_139057chr1542610 1083 654 147 --12653 --
NM_139068chr51659 ------
NM_139069chr51659 ------
NM_139070chr51528 ------
NM_139131chr111216 1647 ----
NM_139157chr11----1606 --
NM_139168chr51258 ------
NM_139207chr1232163 1687 1581 --11817 --
NM_139242chr1521510 1001 --1349 --
NM_139276chr171142 --11905 --
NM_139279chr213474 --1205 --
NM_139316chr7----11075 --
NM_139321chr2053573 3266 3113 1074 455 --1476 12582
NM_144567chr122678 1916 ------
NM_144570chr1632348 2293 642 12734 ----
NM_144571chr4116595 6107 5132 4648 2778 1875 1854 900 891 861 38 21769 1398 16517 --
NM_144578chr1465407 4546 3841 3713 1132 653 --11232 --
NM_144590chr1062800 2433 2325 2101 690 514 ------
NM_144598chr151123 ------
NM_144625chr12397 118 ------
NM_144628chr2072957 2847 2319 2188 1959 933 902 --12401 --
NM_144632chr262162 1890 1824 1778 845 116 ------
NM_144633chr33966 543 478 11231 ----
NM_144665chr111108 125 ----
NM_144667chr1211102 ------
NM_144721chr42231 36 11109 ----
NM_144723chr51113 1558 ----
NM_144726chr5------11015
NM_144728chr11182 ----1852
NM_144729chr11182 ----1852
NM_144767chr1524444 771 13964 ----
NM_144778chr1332246 470 168 ------
NM_144949chr212407 ------
NM_144963chr832541 2428 69 11845 ----
NM_144973chr1233781 344 231 ------
NM_144981chr11196 ------
NM_145005chr92926 198 ------
NM_145049chr52883 346 1772 ----
NM_145055chr1832875 1371 1086 179 1911 --
NM_145115chr752024 802 698 470 195 12054 11478 --
NM_145117chr1163219 2576 2366 528 486 383 13270 ----
NM_145176chr6134 11382 1102 --
NM_145206chr1043175 2723 317 267 12525 ----
NM_145251chr1411362 ------
NM_145259chr276272 5662 5330 2428 1517 420 77 14409 14487 --
NM_145284chrX41854 953 557 126 1959 ----
NM_145287chr183173 150 28 ------
NM_145307chr1094021 3603 3272 2940 1783 1681 1232 1186 739 1957 1607 --
NM_145331chr61333 ------
NM_145341chr1011747 --21670 266 --
NM_145686chr233363 2904 382 12776 --1262
NM_145687chr233363 2904 382 12776 --1262
NM_145690chr831846 1712 59 ------
NM_145716chr1----181 --
NM_145728chr152403 47 1557 ----
NM_145735chr1342309 1089 691 379 --22024 436 --
NM_145753chr32658 626 --11173 --
NM_145808chr723164 1953 13045 ----
NM_145858chr21--1423 ----
NM_145859chr31140 --1265 --
NM_145860chr31140 --1265 --
NM_145891chr1611689 21706 1526 --1311
NM_145892chr1611689 21706 1526 --1311
NM_145893chr1611811 21828 1648 --1433
NM_147147chr664238 3109 1341 1326 1224 1041 --14153 24013 3225
NM_147156chr10143 169 ----
NM_147175chrX12095 11486 ----
NM_147181chr421394 1341 ------
NM_147182chr421394 1341 ------
NM_147183chr421394 1341 ------
NM_147223chr232329 910 634 ------
NM_147233chr232146 727 451 ------
NM_148170chr1175424 1744 1523 1463 1278 857 763 1654 --35466 1968 1231
NM_148174chr831662 1460 1434 22008 1896 ----
NM_148571chr1732111 1541 437 ------
NM_148955chr1586163 5985 5830 5701 5561 5159 2578 2105 15021 1353 --
NM_148976chr111112 ------
NM_148977chr101981 ------
NM_148978chr101981 ------
NM_152227chr201753 ------
NM_152230chr10179 ------
NM_152236chr221184 ------
NM_152237chr2211678 ------
NM_152253chr2273328 3220 2886 2618 1627 556 498 ------
NM_152261chr1221918 351 11833 ----
NM_152265chr111440 11329 ----
NM_152272chr84519 288 264 232 ------
NM_152277chr551923 1836 1810 769 61 ------
NM_152280chr143531 2989 983 968 ------
NM_152282chr341345 1302 1217 950 1514 ----
NM_152283chr531118 1044 178 ------
NM_152291chr4130 ------
NM_152317chr122178 165 ------
NM_152330chr14----1651 188
NM_152345chr172925 467 ------
NM_152352chr1842521 2235 1235 216 1646 ----
NM_152400chr431718 1366 710 1774 ----
NM_152409chr532535 2245 1134 22893 156 12823 --
NM_152410chr61420 ------
NM_152414chr811488 11160 ----
NM_152417chr831245 1039 181 ------
NM_152422chr921738 222 1210 ----
NM_152424chrX83774 3321 3315 2969 1706 633 566 170 2873 770 13919 --
NM_152450chr153613 354 118 ------
NM_152496chr12890 357 ------
NM_152519chr241872 1531 729 361 11754 ----
NM_152520chr21787 ------
NM_152538chr341805 1196 356 246 1656 11331 --
NM_152542chr431980 842 274 11693 ----
NM_152546chr521036 983 ------
NM_152549chr51161 ----1120
NM_152556chr72927 134 2305 211 1279 12014
NM_152574chr9--152 ----
NM_152588chr124729 566 545 217 --178 --
NM_152590chr122285 106 ------
NM_152608chr122397 580 22516 2474 1261 --
NM_152609chr11268 --1450 --
NM_152622chr543412 2891 2377 2247 1430 --11246
NM_152624chr545692 4598 1543 1529 --15213 --
NM_152641chr1232911 1975 952 12378 ----
NM_152667chr2021251 1121 --1978 --
NM_152678chr31112 1642 --12292
NM_152692chrX152 ------
NM_152695chrX51837 1791 518 491 397 11863 --1754
NM_152696chr1130 ------
NM_152699chr363625 3562 2879 2433 1057 870 ------
NM_152703chr741007 996 882 869 ----1808
NM_152713chr111210 ------
NM_152733chr6116375 5346 4261 4136 3970 2554 2334 1353 908 766 689 1570 ----
NM_152734chr685277 4905 4619 4372 4197 3421 1276 942 14634 ----
NM_152737chr612059 ------
NM_152744chr752921 2737 1337 1212 649 --13576 --
NM_152754chr733779 3700 288 --1390 --
NM_152756chr533256 3209 3118 --13530 1484
NM_152758chr842857 2249 1204 867 1464 12006 --
NM_152787chrX43155 2810 2661 1400 ----11032
NM_152789chr721418 508 ----11262
NM_152793chr775195 4193 3459 3402 855 591 247 --13572 --
NM_152826chr1586163 5985 5830 5701 5561 5159 2578 2105 15021 1353 --
NM_152835chr152668 2642 2626 2451 918 ------
NM_152838chr2032416 1341 1277 32824 1413 728 --1667
NM_152879chr242562 661 268 138 ------
NM_152903chr1321043 219 ----12489
NM_152989chr1251767 720 642 412 374 11514 --11828
NM_152994chr22413 232 ------
NM_152996chr141821 1412 776 472 12083 11855 --
NM_152999chr7104911 3696 3530 3274 1674 930 885 760 174 47 127 ----
NM_153013chr51521 ------
NM_153020chr631099 469 121 ------
NM_153050chr2254694 4502 4380 1779 419 --33125 3048 1712 14763
NM_153051chr2254694 4502 4380 1779 419 --33125 3048 1712 14763
NM_153184chr341403 607 387 124 ------
NM_153186chr91782 1840 ----
NM_153188chr535505 4120 174 24943 1363 ----
NM_153207chr1223944 541 13196 ----
NM_153226chr10--1457 ----
NM_153235chr632377 937 164 ------
NM_153251chr131269 1255 ----
NM_153256chr1031146 727 311 21831 1689 11426 --
NM_153260chr1531156 403 300 ------
NM_153261chr1641442 1179 429 216 ------
NM_153262chr111187 ------
NM_153267chr91899 ------
NM_153321chr171836 ------
NM_153322chr171836 ------
NM_153332chr8141 1330 ----
NM_153341chr11270 1351 ----
NM_153350chr1621445 557 --11723 --
NM_153365chr442632 2396 1870 718 12485 ----
NM_153371chr1332007 783 614 1421 12035 --
NM_153456chr1366266 5817 4155 3896 2458 511 1401 15361 --
NM_153616chr1531488 838 353 --1657 --
NM_153617chr1531488 838 353 --1657 --
NM_153618chr1531488 838 353 --1657 --
NM_153619chr1552726 2607 1175 946 74 --21254 499 --
NM_153620chr731775 1129 605 ------
NM_153634chr1221286 347 ------
NM_153646chr1462575 954 869 799 430 279 ------
NM_153647chr1462575 954 869 799 430 279 ------
NM_153648chr1462575 954 869 799 430 279 ------
NM_153695chr91106 ------
NM_153715chr72835 272 ------
NM_153812chr151963 1496 345 307 115 ------
NM_153828chr22211 178 ------
NM_170674chr151450 ------
NM_170675chr151126 ------
NM_170676chr151126 ------
NM_170677chr151450 ------
NM_170679chr521070 1014 ------
NM_170692chr12899 303 ------
NM_170695chr18136 ------
NM_170706chr124227 3088 ----22754 1119
NM_170709chr841526 1502 398 285 ------
NM_170710chr453165 2419 2106 369 89 ----13151
NM_170719chr1331456 1270 954 ------
NM_170720chr1921118 147 --1863 --
NM_170721chr1721180 1013 ------
NM_170750chrX----1815 --
NM_170775chr5139 1211 ----
NM_171825chr593132 2696 2610 2596 1253 1043 965 109 34 ------
NM_171999chr181735 ------
NM_172016chr641278 1146 1129 47 11222 ----
NM_172058chr831531 1361 1355 ------
NM_172059chr831531 1361 1355 ------
NM_172060chr831531 1361 1355 ------
NM_172070chr242264 1523 738 426 21793 1653 ----
NM_172071chr177303 5975 4950 4687 2627 1561 1230 ------
NM_172103chr61177 11685 ----
NM_172105chr61177 11685 ----
NM_172217chr1563114 2522 2383 1060 918 265 --1347 --
NM_172240chr1221396 1134 --21166 108 --
NM_172315chr151450 ------
NM_172316chr151450 ------
NM_172344chr251618 1612 618 597 102 ------
NM_172373chr1341281 961 945 459 2861 263 ----
NM_173076chr24790 749 670 394 ------
NM_173078chrX1151 ------
NM_173156chr111421 ------
NM_173171chr21183 21142 329 ----
NM_173172chr22491 260 21450 637 ----
NM_173173chr21183 21142 329 ----
NM_173198chr922606 303 ------
NM_173199chr92463 193 1160 ----
NM_173200chr922606 303 ------
NM_173207chr18136 ------
NM_173208chr18136 ------
NM_173209chr18136 ------
NM_173210chr18136 ------
NM_173211chr18136 ------
NM_173214chr1687990 6696 5737 5530 5025 3252 1998 343 --26120 3089 --
NM_173353chr12--167 192 --
NM_173468chr495874 5701 4212 2139 1670 1638 1481 1189 792 --25601 3856 --
NM_173469chr1521231 139 ------
NM_173471chr321033 115 --1141 --
NM_173475chr1631461 422 287 11473 ----
NM_173478chr171792 1187 ----
NM_173491chr52998 54 ------
NM_173505chr1841208 946 481 438 ------
NM_173508chr1--11124 ----
NM_173510chr2242544 1904 1014 647 ------
NM_173511chr223212 2749 --1972 --
NM_173517chr72416 177 ------
NM_173552chr352278 996 768 530 230 11680 2679 540 --
NM_173582chr1154359 4244 3983 2424 2415 14321 35904 925 477 --
NM_173591chr122881 65 1364 ----
NM_173595chr1275089 5007 4557 4265 1548 1004 854 ------
NM_173602chr1243658 3077 398 309 1407 ----
NM_173609chr151478 ------
NM_173642chr189027 6942 6715 6360 6035 3424 1343 847 11742 47810 6961 5681 1879 --
NM_173644chr2031452 254 121 ------
NM_173647chr221014 314 ------
NM_173653chr321402 1321 ------
NM_173654chr31190 1897 21480 184 --
NM_173681chr721908 160 ------
NM_173694chrX32537 1580 586 ------
NM_173808chr124425 3791 ------
NM_173829chr575493 5134 4987 4782 1333 1083 329 177 14740 1797
NM_173851chr893955 3796 3538 3406 2545 1600 881 109 57 --12515 --
NM_174886chr18136 ------
NM_174890chr101712 --1804 --
NM_174911chr863981 3434 1566 1214 960 375 ------
NM_174916chr1542218 546 535 223 ------
NM_175061chr73649 231 22 --11354 --
NM_175607chr351732 1401 614 578 360 11392 ----
NM_175612chr351732 1401 614 578 360 11392 ----
NM_175624chr1284932 4869 3058 2552 1386 823 785 60 --26362 6236 --
NM_175625chr1284932 4869 3058 2552 1386 823 785 60 --26362 6236 --
NM_175733chr112435 27 --11575 --
NM_175736chr1277591 2848 1483 1072 657 490 152 --16019 --
NM_175768chr62582 92 --159 --
NM_175852chr162611 1947 935 654 312 299 ------
NM_175854chr1342727 2285 409 195 ------
NM_175856chr5--1667 ----
NM_175859chrX11763 ------
NM_175873chr511369 11326 1931 --
NM_175876chr111766 --11989 1664
NM_175884chr7177 ------
NM_175907chr1822789 192 --12833 --
NM_176787chr1831065 549 423 1524 1569 --
NM_176792chr101344 11329 ----
NM_176814chr721140 235 ------
NM_176815chr321027 237 22454 181 ----
NM_176863chr1731987 760 393 ------
NM_177398chr131602 1581 1368 ------
NM_177399chr131602 1581 1368 ------
NM_177438chr1454144 3600 2613 1182 436 21213 830 11408 13033
NM_177524chr72773 362 --1254 --
NM_177525chr72773 362 --1254 --
NM_177553chr112833 120 ------
NM_177937chr93637 433 217 ------
NM_177947chrX41667 526 303 246 --11680 --
NM_177948chrX41667 526 303 246 --11680 --
NM_177969chr21220 ------
NM_177974chr15--12014 --12154
NM_177990chr201491 ------
NM_177995chr921738 222 1210 ----
NM_177996chr2043125 2921 2775 702 ------
NM_178010chr1251767 720 642 412 374 11514 --11828
NM_178011chr1042621 2185 1994 1300 ------
NM_178031chr111167 ------
NM_178123chr21312 ------
NM_178126chr1731725 1483 434 ------
NM_178151chrX57880 7725 6112 2585 264 --16716 --
NM_178152chrX57880 7725 6112 2585 264 --16716 --
NM_178153chrX57880 7725 6112 2585 264 --16716 --
NM_178190chr13296 271 216 ----1200
NM_178191chr141637 1612 1557 1132 ----11541
NM_178232chr151590 --1661 --
NM_178313chr231974 1793 859 11835 11772 1365
NM_178423chr711293 ------
NM_178425chr711293 ------
NM_178496chr32224 69 11175 ----
NM_178526chr1931977 1928 1301 ------
NM_178539chr122735 195 ------
NM_178554chr343436 3326 1285 1279 --1241 13053
NM_178578chr202850 539 ----1328
NM_178585chr462978 2892 2712 1198 1140 633 --12059 --
NM_178586chr1412146 ----179
NM_178812chr821401 556 1466 ----
NM_178815chr1032140 1852 1093 2996 292 ----
NM_178818chr1632493 2307 107 ------
NM_178831chr752601 976 396 157 102 ------
NM_181077chr1542078 849 705 421 ------
NM_181265chr453165 2419 2106 369 89 ----13151
NM_181310chr611876 ------
NM_181332chrX22535 427 --12134 --
NM_181349chr772926 2803 2207 2069 885 853 778 --1949 --
NM_181351chr1132374 1927 558 12242 --12648
NM_181354chr811499 ------
NM_181481chr1876638 5866 5538 5491 1727 1304 510 ------
NM_181482chr1876638 5866 5538 5491 1727 1304 510 ------
NM_181483chr1876638 5866 5538 5491 1727 1304 510 ------
NM_181489chr3125667 5604 5051 4169 2559 2191 1953 1858 1815 1455 761 626 --25339 4250 --
NM_181504chr533479 1508 614 33745 3384 604 ----
NM_181523chr533479 1508 614 33745 3384 604 ----
NM_181524chr533479 1508 614 33745 3384 604 ----
NM_181656chr172688 366 --1960 --
NM_181659chr2073430 2907 849 621 584 313 146 ------
NM_181659chr2073430 2907 849 621 584 313 146 ------
NM_181672chrX2829 771 ------
NM_181673chrX2829 771 ------
NM_181706chr1152241 1496 887 578 264 --1681 --
NM_181712chr132036 1743 728 21317 631 21626 257 --
NM_181714chr641965 1513 1459 357 1700 1268 --
NM_181746chr12906 606 ------
NM_181762chrX177 ------
NM_181777chrX177 ------
NM_181782chr652117 1546 557 405 125 21935 1724 22302 593 --
NM_181809chr133193 860 102 --43354 3337 2974 1599 --
NM_181838chr511234 ------
NM_181839chr81193 ------
NM_181886chr431435 1290 967 ------
NM_181887chr431435 1290 967 ------
NM_181888chr431435 1290 967 ------
NM_181889chr431435 1290 967 ------
NM_181890chr431435 1290 967 ------
NM_181891chr431435 1290 967 ------
NM_181892chr441482 1337 1014 43 ------
NM_181893chr431435 1290 967 ------
NM_182485chr433259 3077 461 3713 606 324 13043 --
NM_182487chr9114378 3842 3737 3420 2973 1699 1485 1052 1016 527 197 --1782 --
NM_182493chr1621901 1672 --12130 --
NM_182509chr1431431 1327 257 ------
NM_182551chr272888 2427 2305 1244 1174 855 111 ------
NM_182641chr1731993 1532 570 11398 ----
NM_182646chr433259 3077 461 3713 606 324 13043 --
NM_182666chr33679 447 209 ------
NM_182678chr22369 164 ------
NM_182691chr71285 ------
NM_182692chr71285 ------
NM_182715chr71929 1341 ----
NM_182752chr111503 ------
NM_182756chr23248 97 69 ------
NM_182758chr1553487 3304 2931 2512 59 ------
NM_182765chr1011887 --1595 --
NM_182767chr1232040 738 402 21484 1444 ----
NM_182789chr51790 ------
NM_182797chr202621 548 1291 1532 --
NM_182798chr51968 2306 79 ----
NM_182799chr51968 2306 79 ----
NM_182801chr51968 2306 79 ----
NM_182898chr735599 1743 459 ------
NM_182899chr735599 1743 459 ------
NM_182948chr122266 137 ----1207
NM_182964chr1163219 2576 2366 528 486 383 13270 ----
NM_182972chr152797 2649 2094 821 411 --11008 --
NM_182976chr11794 ------
NM_183057chr81219 ------
NM_183061chr31129 ------
NM_183227chr641643 1477 1295 67 1256 ----
NM_183244chr20----1383 --
NM_183246chr20----1383 --
NM_183323chr51790 ------
NM_183397chr2054925 4387 3902 1425 1386 --25054 1590 --
NM_183416chr111767 1687 11663 --
NM_183419chr831378 1311 1275 --1157 --
NM_183422chr1331048 135 63 ------
NM_184234chr201106 ------
NM_194071chr744678 1756 300 67 33530 406 241 ----
NM_194247chr233412 1612 246 31003 871 197 ----
NM_194277chrX1258 1792 ----
NM_194278chr1423725 3545 --11549 --
NM_194285chr1142532 540 146 132 --12661 --
NM_194286chr12115397 5332 5261 4913 4837 4636 4561 3935 1665 1178 622 --1924 15828
NM_194298chr1031461 793 30 ------
NM_194314chr164468 3668 1359 990 237 83 ------
NM_194317chr232665 2107 1827 12219 ----
NM_194356chr1252358 2163 849 520 194 12051 ----
NM_194434chr1874687 4640 4198 2281 2113 1654 1634 ------
NM_194442chr141529 1513 309 48 ------
NM_194454chr711504 --11267 --
NM_194455chr711504 --11267 --
NM_194456chr711504 --11267 --
NM_194463chrX1401 1139 ----
NM_197941chr552946 2326 2084 756 32 --21988 1190 --
NM_197956chr941880 1582 271 29 --1397 --
NM_197962chr1134 ------
NM_197970chr23583 513 238 --11057 --
NM_198042chr81435 ------
NM_198074chr12244 146 1223 ----
NM_198123chr831600 676 477 1646 ----
NM_198124chr831600 676 477 1646 ----
NM_198128chr1821646 455 --142 --
NM_198158chr332370 2197 1973 ------
NM_198159chr332370 2197 1973 ------
NM_198177chr332370 2197 1973 ------
NM_198178chr332370 2197 1973 ------
NM_198181chr152715 436 22458 1981 ----
NM_198195chr3175 ----1589
NM_198215chr1031404 565 65 ------
NM_198225chr1031645 1381 626 --1662 --
NM_198236chr111004 ------
NM_198320chr1233178 1820 735 --24871 642 1761
NM_198336chr73698 545 280 1230 ----
NM_198353chr42325 55 ------
NM_198400chr1532062 1961 501 137 1408 --
NM_198401chr81320 ------
NM_198404chr131266 ------
NM_198465chrX11812 ------
NM_198467chr71397 ------
NM_198484chr396383 5697 4621 4473 2244 2187 2056 1713 1411 25633 2138 ----
NM_198503chr1------1401
NM_198504chr3161 --2756 344 --
NM_198513chr841840 1739 1497 1475 ------
NM_198569chr622687 191 --185 --
NM_198570chr7----1232 --
NM_198581chr245284 4987 1891 1498 22250 584 ----
NM_198595chr473922 3898 3848 3627 694 650 270 24283 1915 13057 11423
NM_198597chr101175 1241 1406 --
NM_198715chr196242 5493 4679 4376 4179 1869 766 230 162 21544 1181 --11955
NM_198793chr343709 3335 1019 614 23019 1613 13761 13313
NM_198799chr201561 ------
NM_198859chr3105022 4124 2057 1934 1872 1670 1138 843 819 281 34802 3702 3133 24790 920 --
NM_198880chr3------1233
NM_198900chr1277591 2848 1483 1072 657 490 152 --16019 --
NM_198925chr151985 ------
NM_198935chr2031255 311 114 12568 ----
NM_198993chr1751630 1490 1440 568 125 ------
NM_199003chr821442 1024 ------
NM_199040chr1283758 3547 2733 2537 560 333 235 109 --13348 --
NM_199072chr742701 2099 1127 658 ------
NM_199144chr20------1203
NM_199188chr1232880 569 467 12778 14095 --
NM_199189chr5--1738 ----
NM_199190chr1232880 569 467 12778 14095 --
NM_199191chr2154 ------
NM_199194chr2154 ------
NM_199203chr20------1203
NM_199245chr1282596 2493 2458 2349 1604 441 243 108 ------
NM_199246chr53929 397 337 ------
NM_199320chr432673 2589 2382 ------
NM_199320chr432673 2589 2382 ------
NM_199324chr433189 1407 804 12448 11370 --
NM_199327chr43827 770 230 ------
NM_199415chr2062064 1591 883 747 618 533 ------
NM_199421chr1464793 3709 3110 855 725 427 --13235 --
NM_199436chr232418 1208 516 1730 ----
NM_199440chr21182 ------
NM_199454chr184192 4174 4087 1879 1849 1635 1591 844 ------
NM_199461chr1022554 756 12999 ----
NM_199482chr21584 ------
NM_199511chr32720 232 ------
NM_199512chr32720 232 ------
NM_201266chr242339 2078 662 594 22563 93 ----
NM_201279chr242339 2078 662 594 22563 93 ----
NM_201280chr631033 618 179 21408 411 ----
NM_201428chr1141511 1451 600 93 ------
NM_201429chr1141511 1451 600 93 ------
NM_201430chr1131437 1377 526 ------
NM_201437chr811025 ------
NM_201567chr351397 682 523 259 234 ------
NM_201568chr111421 ------
NM_201569chr111421 ------
NM_201570chr1021675 193 ------
NM_201571chr1021675 193 ------
NM_201572chr1021675 193 ------
NM_201590chr1021675 193 ------
NM_201593chr1021675 193 ------
NM_201596chr1021675 193 ------
NM_201597chr1021675 193 ------
NM_201599chrX1782 ------
NM_201624chr131153 1060 808 ------
NM_201999chr41842 --1452 --
NM_203290chr6------1150
NM_203301chr1421148 329 ------
NM_203304chr191617 ------
NM_203327chr2084202 3602 3424 1744 1349 854 807 411 12994 ----
NM_203350chr13299 212 90 ------
NM_203390chr831871 281 182 ------
NM_203391chrX11249 2274 186 ----
NM_203394chr1231967 702 214 --12491 --
NM_203403chr9--166 ----
NM_203406chr542554 2546 2301 225 --157 --
NM_203437chr21788 ------
NM_203458chr141008 874 855 647 13004 ----
NM_203459chr152590 2358 2213 408 130 12582 ----
NM_203463chr234945 3659 146 11468 24089 388 --
NM_203487chr132399 285 1422 ----
NM_203499chr172345 244 ------
NM_203504chr422163 1758 ------
NM_203505chr422163 1758 ------
NM_205768chr122079 732 ------
NM_205846chr521478 344 1600 ----
NM_205848chr162799 2749 2119 2018 1840 288 ------
NM_206594chr143243 2408 1367 1166 11350 ----
NM_206595chr143243 2408 1367 1166 11350 ----
NM_206809chr651063 800 337 178 106 ------
NM_206852chr141190 ------
NM_206853chr622512 1476 13335 ----
NM_206854chr623773 1085 14596 ----
NM_206855chr624738 2050 15561 ----
NM_206857chr141190 ------
NM_206860chr101184 ------
NM_206861chr101184 ------
NM_206862chr101184 ------
NM_206866chr213695 483 286 22788 2724 ----
NM_206876chr232372 1124 171 12706 ----
NM_206900chr191122 ------
NM_206901chr191122 ------
NM_206907chr552835 2577 1273 641 520 ------
NM_206909chr877990 7499 5394 5278 2553 2520 2074 12443 --27828 2286
NM_206944chr93864 657 195 ------
NM_206945chr93864 657 195 ------
NM_206946chr93864 657 195 ------
NM_206947chr93864 657 195 ------
NM_207042chr11474 ------
NM_207043chr141983 1893 1752 457 ------
NM_207044chr141983 1893 1752 457 ------
NM_207045chr11474 ------
NM_207046chr11474 ------
NM_207047chr141983 1893 1752 457 ------
NM_207123chr41841 ------
NM_207303chr1031569 1508 671 33677 2831 1607 ----
NM_207304chr1332133 357 55 ------
NM_207306chr154529 4321 2991 2894 38 1165 ----
NM_207313chr171427 ------
NM_207317chr51431 ------
NM_207325chr1951959 1556 1415 515 150 --21908 618 --
NM_207337chr121875 --1202 --
NM_207361chr132361 319 1837 13975 --
NM_207390chr192859 23 ------
NM_207404chr342121 1913 765 224 --1571 --
NM_207406chr485438 4410 4212 1754 1332 1200 1110 94 31659 1191 103 14281 --
NM_207422chrX4426 268 157 134 ------
NM_207445chr151185 ------
NM_207481chr221143 242 ------
NM_207517chr1531907 1887 641 ------
NM_207520chr22211 178 ------
NM_207521chr22211 178 ------
NM_207578chr11733 1308 ----
NM_207647chr932447 2151 2026 ------
NM_207660chr1441347 1080 571 390 ------
NM_207661chr1441347 1080 571 390 ------
NM_207662chr1441347 1080 571 390 ------
NM_212460chr731497 405 108 ------
NM_212471chr1722244 800 11856 1279 --
NM_212472chr1722244 800 11856 1279 --
NM_213589chr255292 5004 4827 4486 3459 25140 572 21148 461 1807
NM_213606chr1021745 671 1480 ----
NM_213609chr31793 ------
NM_213618chr11----1606 --
NM_213654chr31318 --1180 --