TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-184
miRNA Sequence: UGGACGGAGAACUGAUAAGGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000248chr3------1305
NM_000430chr1773066 2972 2903 2894 2534 2493 1335 13470 --12441
NM_000461chr353295 1637 1226 871 298 --14130 --
NM_000719chr1256417 6038 4477 4425 4206 14241 21385 558 12001
NM_001001502chr54598 161 75 45 --2166 39 1155
NM_001001890chr2154187 1561 1439 206 117 24132 3046 13238 --
NM_001014797chr1058150 6636 5610 2836 1883 --16509 11801
NM_001017440chr776878 6392 6236 5849 5247 1992 665 1128 35562 3026 607 17703
NM_001018111chr711370 --1643 2436 180
NM_001025076chr1064907 4888 4759 4688 3921 118 --13834 --
NM_001033117chr374855 4827 4760 4433 3930 3476 1197 1792 21273 116 --
NM_001037954chr1121331 652 --12771 1193
NM_001040455chr1161336 908 494 368 286 71 --21160 461 11040
NM_001040624chr852636 2290 908 886 109 --12512 --
NM_001042599chr247841 7691 5553 5235 --1553 --
NM_001100108chr168324 6920 6162 5234 1680 811 12650 38244 5685 595 --
NM_001106chr346922 1170 1164 313 ----124
NM_001167chrX34294 4129 1274 ----1507
NM_001419chr1954077 4033 3704 3574 1683 1570 --1777
NM_001543chr551878 1867 584 394 324 --33293 300 238 --
NM_001617chr211149 2943 318 168 11166
NM_001810chr201274 2758 578 --1797
NM_001931chr11------1124
NM_002074chr11601 ----21624 1149
NM_002254chr232041 1566 240 1906 22249 795 --
NM_002359chr1783608 2886 2784 1610 1406 1164 1076 69 --11140 --
NM_002501chr1994046 3946 3785 3022 2639 1563 1170 844 309 11437 13607 --
NM_002515chr1421768 423 11290 --11597
NM_002522chr1732422 1547 649 --1185 12427
NM_002608chr222381 100 11226 1104 1165
NM_002719chr143810 742 117 --21840 1555 --
NM_002745chr2221544 95 11414 42833 1295 1143 568 --
NM_002752chr5------1459
NM_003107chr622431 1945 ----12026
NM_003221chr653729 3321 1570 490 239 ------
NM_003337chr5------1654
NM_003988chr1081917 1761 1732 1726 683 382 139 133 --11743 --
NM_004064chr12------1929
NM_004093chr1322704 2641 ----1641
NM_004302chr1262755 2376 2220 2124 1101 703 12931 --1544
NM_004319chr132102 749 688 --1700 13009
NM_004321chr243498 3478 2854 286 --33384 853 63 13564
NM_004437chr163605 2778 2282 1184 1109 967 12250 --12521
NM_004464chr423926 876 ----1952
NM_004505chr17------11630
NM_004748chr15------14112
NM_004852chr181114200 14157 13859 12712 12136 11352 10956 8836 3106 1719 731 29135 2685 ----
NM_004938chr93776 183 174 --11107 --
NM_004992chrX67733 6810 6016 5654 2403 1899 1420 25431 5190 25676 2089
NM_005157chr9----31952 222 216 1726
NM_005614chr72834 63 ----2916 168
NM_005730chr1253277 3241 1113 1097 1035 --1766 --
NM_005857chr1----146 11149
NM_005866chr91875 ----1869
NM_006644chr13------1466
NM_006690chr204952 926 706 483 22006 1784 1226 --
NM_006852chr1712066 --1698 1921
NM_006888chr141191 ----23074 151
NM_006920chr2------11532
NM_007189chr731104 244 199 --1457 1221
NM_007249chr1358144 3270 829 726 196 17247 18660 18101
NM_013433chr192146 29 --4754 158 154 150 31970 171 163
NM_013438chr9----11141 1292
NM_014117chr1642513 1730 1041 693 --22251 270 --
NM_014181chr212117 ----12518
NM_014190chr44725 696 374 316 1287 2429 73 --
NM_014231chr1242085 2039 1758 95 --41840 1791 1619 163 1593
NM_014231chr1242085 2039 1758 95 --41840 1791 1619 163 1593
NM_014286chr962970 2542 537 463 456 164 --3955 387 305 --
NM_014460chr2241481 384 318 128 1252 2137 133 --
NM_014616chr322744 2227 ----1711
NM_014665chr833312 1328 282 11190 --1572
NM_014730chr1244322 3737 1317 207 25279 654 14676 --
NM_014767chr1083144 2374 2330 1215 1188 945 666 530 --23416 801 --
NM_014810chr122297 1412 ----11400
NM_014820chr312041 ----1355
NM_014997chr712609 12068 21943 1134 --
NM_015090chr175267 4673 4229 4172 2434 2130 303 36146 1031 1011 45796 5160 1784 1355 --
NM_015147chr2------13283
NM_015358chr2121274 532 ----11122
NM_015626chr17------11008
NM_015678chr131103 ----1598
NM_015981chr532082 311 299 12588 41966 404 400 52 --
NM_015995chr1564421 3803 3471 1238 765 604 ----11867
NM_016131chr221494 389 ----175
NM_016598chr341472 1393 277 57 --166 --
NM_017544chrX------1157
NM_018184chr31745 --159 1729
NM_018254chr11738 ----11954
NM_018416chr124282 131 92 79 1269 1553 --
NM_018841chr111008 --23368 1586 23779 2711
NM_018976chr121936 --1781 12392
NM_019106chr2272778 2170 2130 1355 1237 1228 282 22298 273 192 22966 2877
NM_019106chr2272778 2170 2130 1355 1237 1228 282 22298 273 192 22966 2877
NM_019116chr1632702 1352 1260 ----1517
NM_020310chr1792043 2037 1119 909 840 793 777 245 51 --12223 --
NM_020772chr1768273 8214 6683 5668 2579 931 --12347 12585
NM_020909chr223198 52 --21403 41 1162
NM_020956chr194743 554 369 41 1534 1604 13182
NM_021809chr203386 54 42 ----1123
NM_022130chr5------1986
NM_022166chr1656315 6223 6144 5810 1059 21119 795 25529 1032 --
NM_022776chr31387 ----1415
NM_022894chr2------1630
NM_024524chr33989 852 175 ----12050
NM_024554chr141461 1432 174 60 ----11740
NM_025179chr173966 3253 3217 1438 452 169 108 3426 209 40 ----
NM_025248chr1743157 3105 2757 30 1745 --12825
NM_032499chr152246 240 ----1410
NM_032582chr17------11653
NM_033315chr1731407 1378 368 --22096 726 21658 485
NM_033387chr942597 1895 470 316 11700 ----
NM_144582chr242422 979 455 268 ----1439
NM_144628chr2022639 2317 13020 12326 1101
NM_152470chr1864095 3661 2863 573 342 206 --14063 11493
NM_153367chr1053930 3801 3768 1414 1382 --1540 13818
NM_153619chr1542569 1277 1211 1157 ----1450
NM_178839chr2------1278
NM_181784chr2--21832 1696 --12386
NM_198859chr344799 3676 3130 1766 --1693 14061
NM_199000chr71362 ----1652
NM_199245chr1242491 2445 2164 501 --52246 2197 2025 569 364 1999
NM_213589chr2--14787 1927 1398