TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-185-3p
miRNA Sequence: AGGGGCUGGCUUUCCUCUGGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51177 ------
NM_000033chrX9857 783 732 722 708 635 599 375 102 1313 6983 958 760 714 613 336 --
NM_000035chr9--127 ----
NM_000037chr8122225 2138 2037 1951 1864 1782 1764 1689 1573 1567 180 29 --21695 1605 12256
NM_000038chr51511 ------
NM_000051chr1182755 2435 1363 699 495 329 312 34 ------
NM_000052chrX52438 1301 1289 1041 174 1267 11122 --
NM_000053chr1341792 753 195 93 --11779 --
NM_000061chrX3303 125 88 148 ----
NM_000080chr174591 274 257 175 ----1292
NM_000081chr121609 246 ------
NM_000084chrX97005 6694 6509 6250 5192 4483 2603 1776 1726 --36914 6149 5248 15769
NM_000088chr1751201 1098 502 490 316 ------
NM_000090chr21314 ------
NM_000092chr253795 3311 3180 2956 1058 ------
NM_000109chrX------1903
NM_000115chr1322279 216 ------
NM_000124chr10130 ------
NM_000129chr621047 390 1605 1435 --
NM_000134chr431709 1089 23 --1582 --
NM_000138chr1522461 1780 ----21707 782
NM_000141chr10--11163 --11279
NM_000163chr522214 709 --11623 11802
NM_000165chr62470 112 ------
NM_000168chr773275 2635 2520 2414 2265 693 276 --12627 --
NM_000183chr2198 ------
NM_000192chr121621 1249 1471 1974
NM_000208chr1934649 4569 66 44460 3931 1046 822 1446 --
NM_000214chr202440 300 11735 1284 --
NM_000217chr1284057 3726 3381 3336 1889 825 277 42 131 24653 1599 --
NM_000220chr113917 140 43 1877 ----
NM_000237chr8----1605 1138
NM_000244chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_000248chr31133 13064 --12888
NM_000259chr1565700 4595 4517 2539 1290 1129 --44141 2518 2405 1944 --
NM_000264chr942088 1327 1195 801 --12115 --
NM_000267chr1722740 1218 2987 546 ----
NM_000272chr221436 1281 11155 ----
NM_000278chr1072143 2133 2017 875 710 424 296 --51774 811 430 327 238 31769 925 128
NM_000284chrX31494 385 329 --41866 1610 1248 784 --
NM_000286chr17------196
NM_000291chrX1161 1702 135 --
NM_000304chr173420 311 91 --1252 --
NM_000314chr1023085 2688 --13102 --
NM_000319chr1221090 209 ------
NM_000325chr41160 ------
NM_000330chrX42016 1471 1393 485 11406 2435 343 1707
NM_000332chr676517 5478 5397 4596 1269 787 347 1803 ----
NM_000334chr1792100 1764 699 598 551 506 232 51 42 22005 609 31995 1841 1779 1442
NM_000335chr3102006 1961 1545 1531 766 706 635 587 85 40 1897 2665 128 --
NM_000337chr575781 5465 5348 5114 4466 1599 1347 --14707 15627
NM_000347chr141170 --140 --
NM_000358chr52398 37 ----1365
NM_000361chr2051534 516 437 312 184 1541 ----
NM_000376chr1282632 2566 2394 1241 716 464 404 144 12696 62688 2381 830 472 113 87 1633
NM_000380chr9--1495 ----
NM_000399chr101182 --129 --
NM_000408chr212535 12929 --1520
NM_000411chr2152954 2388 2088 933 228 21147 562 22811 2730 11315
NM_000425chrX4601 548 247 51 1629 ----
NM_000430chr1753032 2436 2403 2306 602 ------
NM_000434chr63406 359 120 ------
NM_000435chr193973 628 163 --1988 2891 730
NM_000442chr1721057 900 --1511 --
NM_000445chr86723 635 329 317 165 35 3784 742 287 3848 789 196 --
NM_000461chr3144490 3353 3335 3329 3230 3205 3194 3154 1321 1145 1115 1062 885 452 --23369 289 --
NM_000462chr1521727 573 11176 1663 --
NM_000476chr9101396 1239 1075 954 570 422 380 244 34 26 --2277 251 --
NM_000477chr4126 ------
NM_000478chr12292 204 --4645 464 101 62 --
NM_000480chr1121583 541 1444 1401 --
NM_000484chr211315 ------
NM_000489chrX33145 2356 658 ----23380 2904
NM_000493chr61193 ------
NM_000494chr101784 1303 123 --
NM_000500chr63426 395 311 --1505 --
NM_000525chr1181479 1282 1264 1050 639 542 300 61 1413 31310 1256 105 195
NM_000533chrX21483 53 1635 ----
NM_000539chr361606 1578 1393 1126 1080 182 21214 223 21437 1019 --
NM_000546chr172872 848 --31019 884 34 --
NM_000555chrX97594 6783 6458 6385 5766 2888 2571 2011 1445 --25750 494 1503
NM_000567chr121225 1169 156 1904 --
NM_000572chr12863 697 --191 --
NM_000578chr271833 1788 1731 1342 1306 1210 327 11159 21318 554 --
NM_000594chr62724 617 ------
NM_000595chr62251 118 2578 532 ----
NM_000599chr294130 3669 3611 3302 2915 1447 1406 1303 460 13404 64080 1273 907 872 419 47 11397
NM_000609chr1042389 1178 940 44 32818 363 101 32158 602 80 1375
NM_000610chr1132874 2199 601 --22036 967 --
NM_000612chr11133755 3662 3548 3291 3211 3191 3080 2630 2604 2506 1486 558 26 --53525 3197 175 134 48 --
NM_000615chr1112009 12810 32323 2003 1965 --
NM_000618chr1262469 2049 1547 1171 1049 288 26204 2416 35544 5410 5182 --
NM_000618chr1262469 2049 1547 1171 1049 288 26204 2416 35544 5410 5182 --
NM_000625chr172153 56 ----1116
NM_000633chr1873865 3386 3188 1955 1685 1318 788 --24236 3198 1275
NM_000635chr1951527 1373 1196 1085 502 31018 317 253 1322 11330
NM_000637chr82476 427 ------
NM_000671chr4----2415 89 --
NM_000678chr205805 613 195 169 82 ----1331
NM_000680chr8172 ------
NM_000686chrX21572 1224 --11325 --
NM_000687chr204530 280 267 208 150 ----
NM_000719chr12206337 6304 6070 5967 5866 5762 4558 4439 4170 2654 2636 2374 2083 834 626 609 477 397 266 257 14522 34471 2046 1272 14466
NM_000721chr1102690 1980 1884 1821 1064 776 712 651 448 78 --32028 1931 660 --
NM_000722chr7158 ------
NM_000725chr121999 --1108 1130
NM_000738chr116966 913 864 647 380 142 2973 773 2778 35 182
NM_000739chr7169 ------
NM_000756chr81439 ------
NM_000757chr16837 594 543 244 162 121 --2889 665 --
NM_000759chr172280 164 3760 97 62 1240 --
NM_000767chr1941451 1403 1243 473 --31149 953 338 --
NM_000780chr821157 431 --170 --
NM_000792chr11999 1745 ----
NM_000793chr1454797 4335 1604 1491 1261 44449 1925 224 89 --1149
NM_000795chr1191050 781 742 719 257 247 236 229 27 --2276 216 162
NM_000801chr20126 1790 11004 --
NM_000806chr5130 ------
NM_000807chr42605 471 ------
NM_000813chr545351 280 246 59 11477 1590 24564 816
NM_000814chr1513125 ----11378
NM_000816chr5----1167 --
NM_000827chr542043 2036 1596 1037 --12008 151
NM_000829chr1142249 1900 1858 178 --162 --
NM_000831chr1175964 5888 5882 5724 5648 5505 5489 5161 5104 4722 4594 4430 4016 1821 1311 355 133 54759 2136 1879 1234 877 44931 4069 580 325 45817 5742 5412 4259
NM_000832chr96809 749 623 597 351 34 1296 1160 1330
NM_000836chr195851 690 345 202 50 --1364 1373
NM_000837chr84480 387 197 111 --1380 --
NM_000840chr7------166
NM_000841chr63760 167 145 1294 1363 1263
NM_000845chr71428 ------
NM_000868chrX1988 ------
NM_000875chr1594625 4370 2108 1588 912 902 620 388 95 42502 1713 942 427 2970 865 34849 1024 965
NM_000883chr74490 448 288 222 --2116 66 --
NM_000883chr74490 448 288 222 --2116 66 --
NM_000891chr1732630 1228 636 2775 162 ----
NM_000901chr422375 545 ------
NM_000903chr16----11354 11140
NM_000908chr5--1697 ----
NM_000918chr171221 --1596 --
NM_000920chr11122 ------
NM_000926chr1188251 8058 7981 7573 7564 5880 2171 1788 39033 8395 7082 27819 3521 --
NM_000939chr2290 55 ------
NM_000945chr2--1141 ----
NM_000949chr51108 --1115 --
NM_000961chr20103809 3282 2531 1499 1333 1203 747 511 53 43 2843 539 32902 473 64 12501
NM_000965chr32992 831 ------
NM_000966chr123916 836 125 --2334 201 --
NM_000977chr163355 153 146 ------
NM_001001132chr2121146 96 11230 ----
NM_001001323chr123651 602 159 196 ----
NM_001001330chr102351 269 ------
NM_001001331chr362261 2207 2036 1894 880 264 --22160 1900 --
NM_001001342chr1031488 1436 1191 --11310 --
NM_001001389chr1132874 2199 601 --22036 967 --
NM_001001390chr1132874 2199 601 --22036 967 --
NM_001001391chr1132874 2199 601 --22036 967 --
NM_001001392chr1132920 2245 647 --22082 1013 --
NM_001001395chr1222656 2537 12578 12085 --
NM_001001396chr1114218 3947 3869 3703 3647 3396 1739 1628 1579 1131 255 --33821 1699 239 --
NM_001001419chr564490 4342 3781 1547 1381 773 31458 1221 1056 11167 --
NM_001001420chr564490 4342 3781 1547 1381 773 31458 1221 1056 11167 --
NM_001001438chr21----1363 --
NM_001001481chr82828 181 32193 918 292 ----
NM_001001484chr1072441 2379 1826 955 941 192 67 1204 1978 --
NM_001001485chr32169 142 ------
NM_001001486chr32111 84 ------
NM_001001487chr32111 84 ------
NM_001001521chr2--1281 ----
NM_001001522chr112355 30 --3157 102 42 --
NM_001001523chr13943 543 117 1900 11096 2987 222
NM_001001549chr772552 2340 2267 944 937 921 433 12215 3850 599 579 11987
NM_001001550chr772552 2340 2267 944 937 921 433 12215 3850 599 579 11987
NM_001001555chr772552 2340 2267 944 937 921 433 12215 3850 599 579 11987
NM_001001557chr871636 1527 693 536 193 167 129 ------
NM_001001664chr223427 2554 1310 14034 --
NM_001001669chr552726 2178 1051 908 543 22643 1680 ----
NM_001001701chr432219 1867 664 --12314 --
NM_001001791chr1041587 440 389 305 --11089 --
NM_001001890chr2164198 4138 3098 2975 222 28 --23912 175 1271
NM_001001924chr811313 --2619 461 --
NM_001001925chr811313 --2619 461 --
NM_001001931chr811313 --2619 461 --
NM_001001995chrX139 ------
NM_001002033chr17--1339 ----
NM_001002814chr8133264 3151 2759 2510 1557 1358 1263 1097 1002 811 770 590 385 ------
NM_001002838chrX2341 161 --21444 704 --
NM_001002860chr141911 1997 1562 --
NM_001002901chr11434 ------
NM_001002909chr1752028 1555 1400 1376 902 --11627 11669
NM_001003396chr63252 167 54 --1500 148
NM_001003397chr63252 167 54 --1500 148
NM_001003398chr123105 42 31 --171 --
NM_001003407chr1064305 2044 1442 1142 608 561 2925 792 11793 14042
NM_001003408chr1064305 2044 1442 1142 608 561 2925 792 11793 14042
NM_001003652chr1896930 6325 5963 5835 5654 2442 1950 866 733 28187 7586 18664 --
NM_001003674chr18136464 5559 4353 2505 2480 2305 2218 2101 1808 1278 1220 550 63 --16304 15585
NM_001003675chr18136464 5559 4353 2505 2480 2305 2218 2101 1808 1278 1220 550 63 --16304 15585
NM_001003676chr1141040 658 314 176 1679 1769 --
NM_001003677chr114596 214 175 162 1235 273 53 1130
NM_001003678chr111124 ------
NM_001003679chr132077 534 522 ------
NM_001003681chr2231642 1543 668 ----11925
NM_001003682chr151371 1218 1154 1097 363 2279 73 1259 --
NM_001003683chr2137 ------
NM_001003694chr31405 1242 ----
NM_001003712chr1222713 527 ------
NM_001003789chr223133 66 30 1457 --1806
NM_001003792chr321206 1156 ------
NM_001003793chr321206 1156 ------
NM_001003799chr71209 --1578 --
NM_001003800chr982281 1307 972 604 447 303 214 196 1745 1597 1879
NM_001003810chr41127 ------
NM_001003845chr2------1484
NM_001003894chrY188 --1208 --
NM_001003940chr15113473 3384 3149 3127 2976 2932 2886 2502 1046 857 841 43769 3572 2553 731 53547 3033 2820 1305 609 23134 541
NM_001003942chr15113473 3384 3149 3127 2976 2932 2886 2502 1046 857 841 43769 3572 2553 731 53547 3033 2820 1305 609 23134 541
NM_001003943chr15113477 3388 3153 3131 2980 2936 2890 2506 1050 861 845 43773 3576 2557 735 53551 3037 2824 1309 613 23138 545
NM_001003945chr941449 1276 316 262 --1143 --
NM_001004051chrX249 30 ------
NM_001004127chr131916 ------
NM_001004304chr12112922 2867 2277 2070 2022 808 761 519 484 243 172 22637 160 22129 2083 --
NM_001004317chr643491 3293 1732 953 13082 13888 13556
NM_001004354chr93729 96 28 1849 3284 227 161 1146
NM_001004356chr431502 1175 147 11463 11101 11214
NM_001004358chr431502 1175 147 11463 11101 11214
NM_001004419chr123793 727 615 2626 92 13596 13591
NM_001004426chr224580 411 242 232 --2548 49 126
NM_001004439chr1551128 919 854 526 46 178 21289 1157 --
NM_001005209chr26542 188 176 106 46 37 --177 --
NM_001005271chr177815 736 396 367 339 57 33 --2147 83 --
NM_001005273chr177815 736 396 367 339 57 33 --2147 83 --
NM_001005335chr19--123 ----
NM_001005336chr93559 449 62 156 2482 174 1163
NM_001005366chr121647 ------
NM_001005375chrY31784 1154 660 --11188 --
NM_001005408chr17------1175
NM_001005415chr191459 ------
NM_001005416chr191459 ------
NM_001005417chr13251 135 60 1653 1284 2521 258
NM_001005463chr102250 185 ------
NM_001005473chr565651 5540 4565 1681 848 328 16137 ----
NM_001005474chr331603 432 52 ------
NM_001005502chr12145102 4185 3914 3666 3478 1712 1697 1537 1368 1036 996 945 570 497 13187 14931 11882
NM_001005505chr331266 1220 91 1166 1497 --
NM_001005609chrX153476 3469 3428 3386 3201 2410 2353 1525 1505 1480 1072 1060 1029 811 464 22734 215 ----
NM_001005612chrX2445 292 1356 ----
NM_001005732chr21239 31 1493 --1474
NM_001005733chr21239 31 1450 --1431
NM_001005909chr31104 ------
NM_001005910chr3------1207
NM_001005911chr3------1207
NM_001005920chr164181 149 126 98 --11001 --
NM_001006115chr3102603 2234 2168 2148 2033 1789 1107 1068 389 371 12179 42273 2070 942 681 --
NM_001006600chr51352 12198 ----
NM_001006617chr921070 160 --21081 108 --
NM_001006619chr921070 160 --21081 108 --
NM_001006620chr921070 160 --21081 108 --
NM_001006621chr921070 160 --21081 108 --
NM_001006626chr7169 ------
NM_001006627chr7169 ------
NM_001006628chr7169 ------
NM_001006629chr7169 ------
NM_001006630chr7169 ------
NM_001006631chr7169 ------
NM_001006632chr7169 ------
NM_001006636chr2131 ------
NM_001006641chr961776 1574 1364 610 455 50 --21319 370 --
NM_001006642chr961776 1574 1364 610 455 50 --21319 370 --
NM_001006643chr961776 1574 1364 610 455 50 --21319 370 --
NM_001006946chr261681 1675 780 546 311 45 41566 1532 1525 168 2295 121 --
NM_001007023chr1454797 4335 1604 1491 1261 44449 1925 224 89 --1149
NM_001007097chr994918 4804 4545 4488 4265 1864 1417 1185 1050 ----13599
NM_001007098chr12283 274 ----1642
NM_001007156chr1521682 1536 --31839 1611 246 21270 392
NM_001007226chr1751341 1316 1155 1021 951 1136 ----
NM_001007227chr1751341 1316 1155 1021 951 1136 ----
NM_001007228chr1751341 1316 1155 1021 951 1136 ----
NM_001007229chr1751341 1316 1155 1021 951 1136 ----
NM_001007230chr1751341 1316 1155 1021 951 1136 ----
NM_001007246chr211378 11733 ----
NM_001007257chr11453 ------
NM_001007271chr1051114 954 363 288 139 ----1862
NM_001007273chr102209 49 ------
NM_001007277chr114822 175 52 42 --1391 --
NM_001007279chr223853 775 718 3758 692 589 1287 --
NM_001007471chr9------144
NM_001007553chr121081 211 ------
NM_001007559chr1841988 1687 1352 151 --11736 --
NM_001007565chr31365 ------
NM_001007794chr1--1181 ----
NM_001008220chr5133599 3570 3454 3402 3273 784 735 620 575 412 255 151 21 43501 2993 954 918 43869 2530 599 369 33654 3492 2568
NM_001008222chrX51252 1242 1176 1132 1068 11208 1316 --
NM_001008392chr352997 2798 1437 1361 354 --32278 1139 75 13194
NM_001008407chr781801 1793 585 496 262 242 229 192 --61688 675 562 529 97 62 --
NM_001008408chr7106061 5682 5555 3961 3912 2514 2349 2339 1892 1859 --41716 1378 760 474 21605 1030
NM_001008529chr1721332 1321 --1531 --
NM_001008541chr1051574 742 628 494 192 1811 1757 --
NM_001008541chr1051574 742 628 494 192 1811 1757 --
NM_001008660chr112451 311 ------
NM_001008701chr19152630 2602 2489 2396 2016 1906 1009 999 770 736 730 610 405 301 222 --42958 1226 1084 144 --
NM_001008707chr1411316 --1694 --
NM_001008711chr841338 1187 1078 48 --1226 --
NM_001008738chr552098 1872 1049 505 333 --11920 --
NM_001008777chr17------1189
NM_001008801chr1931529 1446 1414 ------
NM_001008860chr153808 748 677 ------
NM_001008892chr153808 748 677 ------
NM_001008894chr153808 748 677 ------
NM_001009184chr84480 387 197 111 --1380 --
NM_001009555chr41484 --1568 --
NM_001009566chr141129 1056 315 270 ----2201 67
NM_001009813chr191107 --127 148
NM_001009899chr355212 5146 2273 1397 543 32088 1647 1410 32093 2054 1446 --
NM_001009955chr13525 501 417 ------
NM_001009955chr13525 501 417 ------
NM_001009958chr73218 115 33 --167 --
NM_001009993chr244139 3355 1300 142 24245 153 ----
NM_001010844chr6--1168 ----
NM_001010846chr174222 3816 3570 888 826 551 21 11106 1256 --
NM_001010861chr132359 1893 171 1857 ----
NM_001010862chrX62962 2824 2418 2143 870 835 11037 12516 12933
NM_001010867chr1176115 5958 5644 5207 5097 4956 4617 4451 4089 2617 2272 1603 1387 1267 652 135 113 4372 221 180 161 95403 5256 4119 2667 2227 2099 1457 874 786 55789 5219 1536 1370 1077
NM_001010891chr525640 5625 --36357 5199 2616 --
NM_001010908chr101748 ------
NM_001010924chr10198 --1773 --
NM_001010926chr14285 186 146 28 2158 133 1721 --
NM_001010935chr12799 21 ------
NM_001010938chr33742 159 89 1643 1214 --
NM_001010986chrX41915 1551 831 716 ------
NM_001011513chr473760 3671 3279 2941 1388 777 611 11300 ----
NM_001011537chr332403 914 562 ------
NM_001011546chr201600 ----1156
NM_001011551chrX1458 ------
NM_001011658chrX22020 1447 --31404 700 369 --
NM_001011666chr765685 4891 1697 1619 486 310 36257 5775 4551 14491 --
NM_001011708chr282742 2654 2611 2401 2216 1117 1109 423 22304 2092 ----
NM_001012267chr991969 1907 1893 1736 1564 1554 1252 1232 447 ----21924 313
NM_001012329chr1112282 2224 2126 1935 1866 1812 1688 1638 1480 863 829 21823 975 185 --
NM_001012393chr1175001 3976 3851 1753 1337 1275 604 23519 370 ----
NM_001012415chr95589 253 242 206 77 3649 575 58 1659 --
NM_001012420chr1532795 2569 567 ----12618
NM_001012423chr1542795 2569 1994 567 ----12618
NM_001012426chr6132478 2414 2382 2091 1326 1261 1108 894 875 433 392 336 321 32898 94 60 93351 2797 2659 941 914 563 505 140 82 43193 2792 2402 1095
NM_001012427chr6132478 2414 2382 2091 1326 1261 1108 894 875 433 392 336 321 32898 94 60 93351 2797 2659 941 914 563 505 140 82 43193 2792 2402 1095
NM_001012614chr4----123 1592
NM_001012755chrX65030 4615 4551 3141 1252 1106 1232 21482 1301 --
NM_001012756chr191756 --12454 --
NM_001012758chr1124 ------
NM_001012979chrX149 ------
NM_001012980chrX----1184 --
NM_001013031chr1032666 2414 965 --1399 --
NM_001013415chr41597 ------
NM_001013635chr122959 776 11022 ----
NM_001013690chr1292280 2230 2156 2117 1931 1677 1566 701 483 --21756 35 --
NM_001013693chr192375 2199 1130 966 915 780 712 305 28 32437 2294 1878 32687 439 403 --
NM_001013693chr192375 2199 1130 966 915 780 712 305 28 32437 2294 1878 32687 439 403 --
NM_001013839chr17111701 981 655 642 630 528 432 394 357 182 149 21678 800 42217 1809 1591 1030 22102 663
NM_001013843chr151327 ------
NM_001014443chr12210 31 151 1227 1188
NM_001014797chr1087995 7756 7657 6280 5866 2884 706 366 67705 7681 7531 6020 2811 2321 --12395
NM_001014831chr196671 572 527 286 95 34 --2622 589 1770
NM_001014832chr196671 572 527 286 95 34 --2622 589 1770
NM_001014834chr196671 572 527 286 95 34 --2622 589 1770
NM_001014835chr196671 572 527 286 95 34 --2622 589 1770
NM_001015045chr462382 2278 1584 914 83 70 1499 3959 581 113 --
NM_001015053chr1781181 1133 1075 338 291 172 146 111 31465 1362 1285 31478 219 153 1431
NM_001015508chr81267 ------
NM_001015877chrX1165 1620 11974 --
NM_001015881chrX2511 240 --1861 --
NM_001015887chr321200 595 ------
NM_001015892chr51163 ------
NM_001017392chr1941348 1180 309 247 --1332 --
NM_001017395chr362445 2316 2247 673 649 263 22468 1371 ----
NM_001017396chr241600 1505 1396 397 1283 11637 --
NM_001017424chr131203 737 449 ------
NM_001017425chr131203 737 449 ------
NM_001017440chr7147908 7438 6697 6603 5906 4989 3259 2710 2634 2245 1878 1825 1713 33 46716 5593 2970 2872 57492 7223 5646 2843 571 15891
NM_001017535chr1282632 2566 2394 1241 716 464 404 144 12696 62688 2381 830 472 113 87 1633
NM_001017924chr103931 414 44 2912 468 1952 171
NM_001017926chr82579 349 ------
NM_001017970chr1421887 1879 1630 ----
NM_001017979chr4----1165 --
NM_001018009chr321102 232 ------
NM_001018050chr22113108 3086 2785 2518 2509 2190 1256 1170 1075 861 32 12314 32712 2559 2435 --
NM_001018052chr22113108 3086 2785 2518 2509 2190 1256 1170 1075 861 32 12314 32712 2559 2435 --
NM_001018054chr121128 1008 ----142
NM_001018057chr11----2550 162 --
NM_001018060chr222237 114 ----186
NM_001018108chr153923 772 171 12095 1891 21758 59
NM_001018111chr732649 1335 1064 141 41200 570 542 446 13254
NM_001020658chr121380 1175 --11051 --
NM_001020658chr121380 1175 --11051 --
NM_001020818chr1931326 551 443 1652 2639 400 --
NM_001020819chr1931326 551 443 1652 2639 400 --
NM_001020820chr1931326 551 443 1652 2639 400 --
NM_001020821chr1931326 551 443 1652 2639 400 --
NM_001023567chr1532187 2011 570 ----11778
NM_001023587chr33940 917 42 ------
NM_001024218chr141665 1577 ----
NM_001024226chr13946 733 149 1751 1896 --
NM_001024227chr13946 733 149 1751 1896 --
NM_001024228chr13946 733 149 1751 1896 --
NM_001024380chr861987 1803 777 625 326 42 ----12034
NM_001024381chr861987 1803 777 625 326 42 ----12034
NM_001024401chr16132707 2591 2213 2168 1850 980 730 678 618 530 370 133 35 22786 2778 52791 2207 2174 967 911 --
NM_001024455chrX52585 1707 760 601 252 11860 1997 --
NM_001024460chr621216 1109 ------
NM_001024463chr153396 226 106 ------
NM_001024649chr582700 2537 2469 2269 2109 976 951 831 12990 ----
NM_001024807chr19176 157 ----
NM_001024808chr1262506 1052 799 594 587 247 12257 42291 2126 699 684 --
NM_001024845chr13882 674 283 2845 26 2943 395 1357
NM_001024858chr1462527 977 956 339 123 54 2549 132 62688 2270 1900 620 504 236 22586 2475
NM_001024912chr1931542 1196 484 --21555 81 --
NM_001024937chr174635 597 274 41 --1772 --
NM_001024948chr122296 2244 ------
NM_001025076chr1085703 4974 4628 4376 2323 2301 2016 2005 12204 25044 2249 25163 2192
NM_001025077chr1067061 6332 5986 5734 4880 65 154 16402 16521
NM_001025105chr51195 --11340 --
NM_001025108chr254077 3126 2756 1217 211 --32836 1112 705 22799 716
NM_001025161chr22124 ------
NM_001025205chr34354 315 126 21 --2390 178 --
NM_001025233chr1252142 486 441 309 48 11059 ----
NM_001025266chr3104876 4222 3793 3555 1910 1049 762 677 570 370 --43831 3543 1698 26 --
NM_001025366chr641478 695 131 23 --1682 --
NM_001025366chr641478 695 131 23 --1682 --
NM_001025367chr641478 695 131 23 --1682 --
NM_001025367chr641478 695 131 23 --1682 --
NM_001025368chr641478 695 131 23 --1682 --
NM_001025368chr641478 695 131 23 --1682 --
NM_001025369chr641494 711 147 39 --1698 --
NM_001025369chr641494 711 147 39 --1698 --
NM_001025370chr641478 695 131 23 --1682 --
NM_001025370chr641478 695 131 23 --1682 --
NM_001025389chr1121583 541 1444 1401 --
NM_001025390chr1121583 541 1444 1401 --
NM_001025579chr173815 411 98 --5931 805 748 252 173 --
NM_001025580chrX84024 3484 3441 3298 2962 2913 1367 575 ----13314
NM_001025596chr111450 ----1400
NM_001025780chr9----11031 --
NM_001029858chr653182 1261 851 781 731 1488 11310 --
NM_001029859chr1152174 1957 1652 753 434 135 1999 --
NM_001029863chr632622 2035 544 22259 452 ----
NM_001029864chr2052389 2171 1592 367 350 11566 3966 832 30 188
NM_001029875chr532405 2011 1998 12196 ----
NM_001029882chr12207 105 ------
NM_001029882chr12207 105 ------
NM_001029989chr152961 664 1870 ----
NM_001030001chr142398 361 ------
NM_001030007chr1642664 524 301 80 13691 1766 --
NM_001030055chr1434418 1633 379 ------
NM_001030272chr111369 ------
NM_001030273chr111369 ------
NM_001031679chr1283169 2802 2656 2642 2599 1104 926 152 42517 1187 1015 837 12593 --
NM_001031680chr192233 1839 983 764 624 447 230 211 148 2683 403 3616 469 275 --
NM_001031685chr12380 336 ------
NM_001031690chr762607 2403 2156 810 293 129 1463 33045 1133 722 11157
NM_001031695chr2295420 4885 4671 4067 3901 3562 2019 1137 654 --24991 34 --
NM_001031716chr22898 308 ------
NM_001031723chr4--1401 ----
NM_001031732chr423494 246 --1481 --
NM_001031735chr191228 --157 --
NM_001031740chr161664 588 272 144 132 77 11575 --1600
NM_001031804chr1643906 1506 140 131 14287 ----
NM_001032221chr931196 701 679 --31291 498 104 --
NM_001032279chr111291 --147 --
NM_001032280chr6----3198 75 42 --
NM_001032288chr2031581 473 124 --1422 --
NM_001032289chrX2274 219 --1232 --
NM_001032296chr1352604 2547 2495 2464 1143 --42565 2509 2169 211 12319
NM_001032380chr1011841 ----11371
NM_001032999chr2095167 4242 3886 3474 1718 1070 441 402 220 --95075 4871 4641 4221 3428 1480 310 286 160 34989 3933 451
NM_001033044chr121502 29 11769 ----
NM_001033045chr263309 1632 1278 601 433 325 33220 1378 108 ----
NM_001033056chr121502 29 11769 ----
NM_001033059chr62797 400 1124 ----
NM_001033081chr151583 1219 682 353 187 --11390 11278
NM_001033082chr151583 1219 682 353 187 --11390 11278
NM_001033087chr2072839 2237 1118 956 892 502 331 22593 102 22072 1261 --
NM_001033117chr3104392 4161 3898 1961 1935 1855 1442 1257 165 50 31664 936 235 21863 1669 1244
NM_001033551chr17183526 3489 3427 3390 3270 2976 2935 2615 2553 2523 1452 1430 1349 1022 724 615 424 238 33080 1271 932 103777 3709 3671 3538 3478 3248 2686 1643 1635 362 2287 90
NM_001033557chr21564 ------
NM_001033566chr173956 691 371 ------
NM_001033568chr173956 691 371 ------
NM_001033677chr123376 347 34 --1387 --
NM_001033723chr8112550 2403 2331 2317 2194 2161 2066 1038 849 686 119 32379 630 591 ----
NM_001033756chr631412 629 65 --1616 --
NM_001033756chr631412 629 65 --1616 --
NM_001033952chr112241 219 ------
NM_001034837chr5125 ------
NM_001034838chr5125 ------
NM_001034954chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_001034955chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_001034956chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_001034957chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_001035chr1----1363 --
NM_001035256chr2290 55 ------
NM_001035260chr10176 ----11634
NM_001035511chr12578 245 1869 ----
NM_001035512chr13685 352 81 ------
NM_001035513chr13685 352 81 ------
NM_001035534chr941175 485 288 68 --31354 1253 1045 --
NM_001037131chr23500 269 86 --148 --
NM_001037163chr7----193 --
NM_001037174chr231936 1875 1512 ------
NM_001037290chr11--1654 ----
NM_001037317chr132359 1893 171 1857 ----
NM_001037324chr34557 206 116 50 --1526 --
NM_001037331chr182926 649 1129 ----
NM_001037334chr1832396 2197 546 12440 ----
NM_001037339chr161620 1499 1153 646 169 70 ------
NM_001037340chr161620 1499 1153 646 169 70 ------
NM_001037341chr161620 1499 1153 646 169 70 ------
NM_001037341chr161620 1499 1153 646 169 70 ------
NM_001037494chr12291 56 ------
NM_001037495chr12291 56 ------
NM_001037582chr461431 1142 1112 657 589 577 11132 3626 321 283 --
NM_001037639chr31145 153 ----
NM_001037666chr22196 --125 --
NM_001037954chr1143119 2747 802 151 22830 417 ----
NM_001038640chr151638 ------
NM_001038707chr151763 431 261 185 54 --1559 --
NM_001038707chr151763 431 261 185 54 --1559 --
NM_001039140chr203420 36 29 1373 2466 459 --
NM_001039141chr2272270 2227 1981 1814 1094 1039 731 22303 624 32541 2420 631 1959
NM_001039199chr20134807 4304 4017 3717 3550 1893 1740 1683 1625 1509 1035 702 128 21420 529 --11643
NM_001039350chr741722 701 387 168 1313 51437 1430 1279 338 271 --
NM_001039360chr1881563 1526 1478 1403 475 273 40 24 1410 2623 33 --
NM_001039459chr74403 304 239 145 --2768 162 1353
NM_001039569chr243141 2975 1218 953 188 22483 2445 --
NM_001039574chr14932 874 413 310 11032 ----
NM_001039577chr184416 3313 3301 3290 3070 2771 1370 371 14217 13708 1862
NM_001039590chrX63226 3123 2606 1383 1160 54 --22959 397 --
NM_001039591chrX63226 3123 2606 1383 1160 54 --22959 397 --
NM_001039619chr142366 307 ----1254
NM_001039690chr1642198 1964 1939 1490 2933 378 22159 1811 --
NM_001039709chr2095167 4242 3886 3474 1718 1070 441 402 220 --95075 4871 4641 4221 3428 1480 310 286 160 34989 3933 451
NM_001039711chr1----21125 821 --
NM_001039712chr1----21125 821 --
NM_001039715chr11999 1745 ----
NM_001039716chr111063 2809 57 ----
NM_001039771chr1441091 893 857 386 1413 135 1254
NM_001039775chr1----126 --
NM_001039802chr13934 506 167 ------
NM_001039840chrX33886 1807 1588 ------
NM_001039846chr191228 --157 --
NM_001039888chr1167 ----1590
NM_001039905chr154572 348 264 200 1180 2403 254 11564
NM_001039916chr121845 1418 4486 433 237 190 --
NM_001039917chr121845 1418 4486 433 237 190 --
NM_001039918chr121845 1418 4486 433 237 190 --
NM_001039919chr121845 1418 4486 433 237 190 --
NM_001039920chr121845 1418 4486 433 237 190 --
NM_001039937chr1323801 3699 ------
NM_001040001chr622032 1663 ------
NM_001040002chr1731226 514 39 --3200 189 103 --
NM_001040108chr14102985 2972 2952 2582 2239 2052 1266 1166 104 89 ----12616
NM_001040110chr731470 1377 751 --11451 --
NM_001040134chr19131464 1394 1193 978 963 916 577 506 424 361 351 168 53 11162 51243 1040 341 59 24 21515 94
NM_001040142chr231584 947 46 ----1882
NM_001040143chr231584 947 46 ----1882
NM_001040144chr1642198 1964 1939 1490 2933 378 22159 1811 --
NM_001040146chr1642198 1964 1939 1490 2933 378 22159 1811 --
NM_001040151chr1164536 4253 4237 3586 3196 3076 23551 101 11251 --
NM_001040152chr785016 4460 4090 4041 3640 3524 1447 693 1821 11068 --
NM_001040202chr41427 --11868 --
NM_001040214chr661590 765 353 270 136 26 ----2708 608
NM_001040284chr1624521 136 192 ----
NM_001040402chr43970 361 154 ------
NM_001040424chr212908 671 ------
NM_001040429chr1332292 2251 691 ------
NM_001040431chr172354 40 ------
NM_001040436chr122623 457 ------
NM_001040439chr1661266 1204 566 262 139 65 --31210 965 245 1899
NM_001040446chr532173 102 80 1749 --1676
NM_001040450chr1532732 2465 1119 --1540 --
NM_001040453chr1532732 2465 1119 --1540 --
NM_001040653chr351733 1624 1010 343 332 --2964 115 --
NM_001040665chr764499 4077 3734 3173 1356 1148 13907 ----
NM_001040715chr1661174 1168 791 390 243 54 144 1179 --
NM_001040716chr11122 ------
NM_001042355chr1665314 3583 1620 1544 836 330 --11745 --
NM_001042361chr101177 ------
NM_001042364chr101177 ------
NM_001042365chr101177 ------
NM_001042368chr9195 1620 1539 1609
NM_001042371chr1642101 1869 1656 674 21386 441 1378 11619
NM_001042387chr101177 ------
NM_001042388chr182745 394 ------
NM_001042393chr101177 ------
NM_001042396chr101177 ------
NM_001042397chr101177 ------
NM_001042403chr1211017 ------
NM_001042412chr1665314 3583 1620 1544 836 330 --11745 --
NM_001042413chr963830 3130 2926 832 603 99 2755 260 13903 32508 1606 1389
NM_001042424chr492471 2394 2066 1027 1008 922 212 98 51 22059 931 --22990 236
NM_001042425chr6----3198 75 42 --
NM_001042427chr101247 ------
NM_001042453chrX1564 290 46 ----
NM_001042459chr3123 ------
NM_001042471chr172167 30 ------
NM_001042476chr1682013 1931 1883 1834 1640 415 405 194 1386 1773 --
NM_001042479chrX1408 21324 401 31711 1676 26 1128
NM_001042480chrX1408 21324 401 31711 1676 26 1128
NM_001042486chr2061329 1318 1261 387 376 297 --51550 1172 1106 525 303 --
NM_001042492chr1722740 1218 2987 546 ----
NM_001042494chr1543039 2852 167 69 1145 22624 574 --
NM_001042495chr1543039 2852 167 69 1145 22624 574 --
NM_001042496chr1543039 2852 167 69 1145 22624 574 --
NM_001042497chr1543039 2852 167 69 1145 22624 574 --
NM_001042506chrX2998 916 --178 --
NM_001042510chr82704 218 ------
NM_001042511chr82704 218 ------
NM_001042537chrX--178 ----
NM_001042539chr164418 290 237 223 1183 2961 98 1956
NM_001042555chr1221284 356 --1551 --
NM_001042603chr1231381 1025 127 23850 3806 1976 --
NM_001042604chr323513 1826 14793 ----
NM_001042610chr1681343 1195 1088 304 291 271 235 142 2967 256 2154 24 21331 542
NM_001042632chr206950 891 767 583 488 33 22094 285 1883 --
NM_001042633chr206950 891 767 583 488 33 22094 285 1883 --
NM_001042663chr161435 1216 1184 1049 249 51 --21323 219 1354
NM_001042664chr161435 1216 1184 1049 249 51 --21323 219 1354
NM_001042665chr161435 1216 1184 1049 249 51 --21323 219 1354
NM_001042681chr122075 558 --1218 --
NM_001042682chr122075 558 --1218 --
NM_001042682chr122075 558 --1218 --
NM_001042683chr611211 ------
NM_001042728chr123916 836 125 --2334 201 --
NM_001043318chr14103825 3213 1353 986 917 720 662 497 484 248 23588 931 43409 2723 1453 1374 --
NM_001043351chr12350 64 --11512 --
NM_001044305chr6--11181 ----
NM_001071775chr131226 ------
NM_001079874chr151941 497 281 219 135 --12087 11797
NM_001083621chr1134613 4548 1538 1528 1437 900 846 781 653 613 518 496 189 154 43845 3268 1519 1491 --
NM_001087chr2----1127 --
NM_001092chr17112269 2214 1989 1833 1672 1021 499 379 328 306 50 22543 2028 41564 617 461 42 42036 2018 195 189
NM_001095chr12101349 1257 1245 746 620 491 472 290 284 61 21700 412 21512 702 1544
NM_001099678chr355181 4987 4821 4026 4009 14898 12557 1180
NM_001100108chr1107467 6861 6298 6138 5934 5902 5663 1792 892 292 15574 --11708
NM_001106chr388149 8009 7278 6898 6213 3830 3170 3141 26724 299 38132 2641 823 17311
NM_001113490chrX23347 2581 ------
NM_001116chr1622332 1158 12761 22238 584 22609 131
NM_001117chr183720 688 584 11555 135 1998
NM_001121chr101652 1423 ----
NM_001122679chr51177 ------
NM_001126chr1--1118 ----
NM_001127chr22253 27 --2348 339 --
NM_001128chr1642664 524 301 80 13691 1766 --
NM_001148chr4--11837 1125 --
NM_001149chr102923 410 11097 ----
NM_001150chr151133 --128 1287
NM_001157chr102709 98 --1224 --
NM_001163chr91888 --1971 2931 793
NM_001172chr14--1520 ----
NM_001173chr1434418 1633 379 ------
NM_001174chrX6932 814 799 612 474 27 --4754 527 402 182 --
NM_001178chr111369 ------
NM_001189chr43891 733 255 --2765 131 1126
NM_001191chr2051428 1060 1019 328 102 1935 ----
NM_001196chr222890 81 ------
NM_001204chr266336 5377 5077 1788 1460 1238 14985 12009 --
NM_001206chr912809 22852 86 ----
NM_001219chr731810 1616 1460 21992 1858 ----
NM_001222chr1041652 595 589 90 --41639 466 298 163 11782
NM_001225chr11122 --128 --
NM_001241chr221813 870 ------
NM_001241chr221813 870 ------
NM_001265chr132327 247 ------
NM_001267chr172215 23 --2451 100 1178
NM_001278chr101193 ------
NM_001280chr191147 1524 1529 --
NM_001292chr154700 245 206 159 11001 2986 972 --
NM_001293chr112448 384 ------
NM_001299chr192334 320 --1109 --
NM_001304chr1721027 671 --12501 --
NM_001310chr1222989 467 --11128 --
NM_001328chr4----123 1592
NM_001329chr1021280 409 11604 1301 --
NM_001331chr1112645 1681 --22281 133
NM_001343chr511247 11465 ----
NM_001351chr331156 1124 565 ------
NM_001356chrX----2941 187 --
NM_001364chr1173799 3527 3509 3460 3039 388 292 34717 3681 1665 --12944
NM_001365chr174549 250 141 78 ------
NM_001386chr821992 1541 1161 2848 298 --
NM_001387chr563094 2867 2776 2433 2267 1278 22950 125 22069 557 --
NM_001389chr21--1195 ----
NM_001396chr2132435 913 793 1385 ----
NM_001397chr192501 2406 2168 1982 1921 1706 879 691 85 3752 482 275 72232 2002 1718 996 606 584 67 1938
NM_001399chrX153476 3469 3428 3386 3201 2410 2353 1525 1505 1480 1072 1060 1029 811 464 22734 215 ----
NM_001400chr141170 314 294 146 ------
NM_001406chr1731523 637 338 --61644 550 271 115 97 36 --
NM_001407chr371672 1664 1568 1341 1333 624 126 --197 --
NM_001408chr11618 --51460 1239 1193 1120 399 --
NM_001412chrX43068 2395 1248 361 ------
NM_001417chr1241476 1462 553 170 1484 1517 --
NM_001419chr1994401 4381 3516 3420 3291 3274 3049 3017 1713 1728 63726 3651 3487 3232 527 276 --
NM_001420chr1972807 2796 2741 2438 1183 775 500 1129 42928 2826 2370 1169 1109
NM_001427chr751715 1659 606 423 31 1302 --1676
NM_001431chr62360 174 ----11190
NM_001433chr174900 843 183 140 2220 32 ----
NM_001438chr1--11204 2746 582 --
NM_001447chr541196 167 119 113 1200 31238 525 325 1397
NM_001449chrX21052 861 ------
NM_001453chr631207 442 160 ------
NM_001454chr17--1632 --3273 228 150
NM_001458chr71699 --3500 153 31 126
NM_001465chr5--11584 --11327
NM_001478chr124879 815 747 113 ------
NM_001494chr101716 ------
NM_001495chr831186 1162 201 --1494 --
NM_001497chr962583 2056 1708 1081 1008 573 11834 11802 --
NM_001530chr142761 203 ------
NM_001533chr19--123 ----
NM_001543chr5114549 4414 4148 3584 3349 3030 1577 1279 1083 524 500 43647 1793 1105 687 24300 545 1817
NM_001552chr177717 393 380 280 264 237 112 ------
NM_001555chrX------189
NM_001560chrX2600 123 1887 ----
NM_001567chr113670 459 37 168 1695 1296
NM_001610chr11181 --1777 --
NM_001616chr232729 1367 265 22847 849 ----
NM_001619chr111892 1116 2255 131 1886
NM_001620chr113287 213 51 ------
NM_001634chr62797 400 1124 ----
NM_001642chr11----123 1413
NM_001658chr13946 733 149 1751 1896 --
NM_001659chr1272459 2415 2248 1657 378 268 68 22004 1707 ----
NM_001660chr31693 1309 ----
NM_001663chr141620 12048 ----
NM_001664chr3----2218 23 1780
NM_001668chr1--12026 1498 --
NM_001670chr224637 609 591 99 --2523 29 --
NM_001678chr1741740 1445 1424 158 1127 21670 747 --
NM_001681chr121234 ------
NM_001682chr122365 316 ------
NM_001683chr362261 2207 2036 1894 880 264 --22160 1900 --
NM_001684chr1103935 3664 3586 3420 3364 3113 1456 1345 1296 848 11590 23538 1416 --
NM_001693chr831057 926 801 ------
NM_001695chr821111 338 24310 3273 23127 2993 12950
NM_001701chr911011 ------
NM_001706chr3----2182 34 --
NM_001707chr72792 775 --1604 --
NM_001709chr1132007 1149 781 12073 ----
NM_001717chr1521150 211 --3540 420 190 --
NM_001722chr82512 116 ------
NM_001731chr121662 ------
NM_001737chr5--124 ----
NM_001741chr112241 219 ------
NM_001743chr21242 ------
NM_001746chr582700 2537 2469 2269 2109 976 951 831 12990 ----
NM_001754chr2164198 4138 3098 2975 222 28 --23912 175 1271
NM_001755chr1662097 1880 1783 779 621 339 ------
NM_001759chr1274711 4690 4362 4310 3738 3554 1868 ------
NM_001761chr1651531 411 341 304 159 11754 11354 1331
NM_001773chr151350 1316 1151 1045 115 1958 31361 1272 141 --
NM_001783chr192286 61 --2324 91 149
NM_001789chr321122 28 --11402 --
NM_001791chr13934 506 167 ------
NM_001810chr201631 3712 682 104 1560 1182
NM_001823chr14----128 --
NM_001829chr41614 --1388 --
NM_001830chrX43503 899 861 593 ------
NM_001833chr9--1234 ----
NM_001838chr173728 139 118 ------
NM_001842chr91400 --3534 457 171 --
NM_001858chr631501 1412 1121 ------
NM_001859chr9103934 3815 3649 3125 3051 2659 2610 2495 1258 763 11472 ----
NM_001865chr6144 ------
NM_001866chrX143 ------
NM_001873chr41153 ------
NM_001874chr12145102 4185 3914 3666 3478 1712 1697 1537 1368 1036 996 945 570 497 13187 14931 11882
NM_001892chr51195 --11340 --
NM_001893chr17----1297 --
NM_001895chr20----11162 1327
NM_001901chr61817 3897 718 397 ----
NM_001904chr31301 ------
NM_001907chr162294 25 --1277 --
NM_001923chr11----1586 --
NM_001927chr24517 456 169 67 --1118 199
NM_001936chr741722 701 387 168 1313 51437 1430 1279 338 271 --
NM_001938chr1--1691 ----
NM_001939chrX63571 1342 1058 350 274 68 42715 1490 622 100 31495 627 250 1547
NM_001946chr122442 252 195 ----
NM_001949chr651152 1040 615 526 220 --21297 976 11105
NM_001957chr421581 1411 ------
NM_001962chr51139 --1220 --
NM_001968chr4173 ----1908
NM_001969chr1432710 1157 486 12577 12936 --
NM_001970chr174414 187 169 57 --1455 --
NM_001978chr83917 852 787 1397 3423 146 28 --
NM_001981chr11233 2639 601 ----
NM_001987chr1263779 3230 1294 1111 1030 36 --31666 1632 699 --
NM_002006chr465086 2160 1485 1100 578 500 1738 ----
NM_002010chr13127 ----1100
NM_002015chr1393078 2924 2575 2359 2234 2070 1350 542 70 13112 12117 12898
NM_002017chr1111214 ------
NM_002023chr181568 1549 1410 1151 1081 391 175 35 --11067 --
NM_002025chrX68726 8617 6202 3093 1985 1471 43526 2907 2820 1342 22852 279 --
NM_002035chr1863386 3211 2891 2560 1291 1272 --2796 588 12603
NM_002039chr41227 ------
NM_002040chr21--1298 ----
NM_002041chr151114 ------
NM_002045chr32139 89 ----177
NM_002046chr12169 ----122
NM_002048chr921118 193 2531 246 ----
NM_002061chr141951 1786 1476 1311 ------
NM_002062chr621025 464 11353 21274 227 --
NM_002065chr121502 29 11769 ----
NM_002071chr183575 467 134 1270 --159
NM_002072chr9------1211
NM_002077chr942032 1333 387 26 21831 1497 --1263
NM_002080chr16----2861 47 --
NM_002083chr14143 --1115 --
NM_002086chr1762005 1902 1412 878 535 88 21453 790 11494 11919
NM_002092chr454219 3632 3249 854 808 --44642 4230 3801 3113 --
NM_002101chr22491 424 ------
NM_002114chr6------1159
NM_002126chr1753126 2930 524 299 237 11633 ----
NM_002129chr4185 ------
NM_002138chr41127 ------
NM_002145chr17168 ------
NM_002146chr172564 139 --21317 927 --
NM_002156chr21371 ------
NM_002158chr2----1275 --
NM_002161chr9----132 --
NM_002168chr15--183 190 --
NM_002181chr23634 282 52 ------
NM_002187chr53942 865 214 --21096 357 --
NM_002193chr241819 1175 570 494 --41655 276 66 45 --
NM_002196chr2031018 307 104 --123 --
NM_002196chr2031018 307 104 --123 --
NM_002202chr5--1435 ----
NM_002205chr125817 631 406 126 114 1262 2267 42 1381
NM_002211chr101983 ------
NM_002214chr774949 4890 4300 2186 1970 1887 1057 11497 11280 --
NM_002221chr182312 937 609 411 340 323 308 24 32459 842 789 32789 2697 2336 1565
NM_002236chr21302 ------
NM_002241chr192413 2277 2129 2115 1140 955 798 659 388 1884 ----
NM_002247chr101100 11923 ----
NM_002249chr12470 359 ------
NM_002254chr251903 1865 769 292 268 22328 548 62333 1857 1723 567 430 370 1527
NM_002264chr364443 4347 1086 627 222 74 14123 ----
NM_002265chr172825 421 ------
NM_002267chr133856 749 436 1728 ----
NM_002268chr31739 ------
NM_002270chr543940 1907 1011 68 ----126
NM_002271chr133938 439 214 --1587 --
NM_002272chr122337 23 ------
NM_002282chr122217 29 --1225 --
NM_002285chr254077 3126 2756 1217 211 --32836 1112 705 22799 716
NM_002290chr62979 480 ------
NM_002293chr152700 1786 966 456 344 22530 1084 ----
NM_002309chr22122970 2945 2796 2565 2452 2423 2144 898 735 344 293 146 22465 1029 22953 389 --
NM_002310chr532334 1090 669 ------
NM_002312chr133933 176 28 ------
NM_002313chr1064305 2044 1442 1142 608 561 2925 792 11793 14042
NM_002319chr751075 797 251 209 172 2201 145 2741 179 2770 94
NM_002332chr125588 309 96 70 35 --3701 641 85 1515
NM_002333chr1961165 979 962 812 804 129 --21102 32 --
NM_002334chr1151748 1490 500 260 83 1303 --21736 535
NM_002336chr1223721 1539 23385 857 24941 630 --
NM_002343chr3159 138 124 --
NM_002351chrX--1339 ----
NM_002355chr122519 456 --388 36 24 --
NM_002359chr17154247 3848 3789 3381 3276 3260 3253 3196 3154 3133 715 535 464 454 167 1442 53979 3929 3814 2801 1373 13659
NM_002372chr5----1285 --
NM_002373chr15--11279 21165 43 --
NM_002382chr142168 78 --41103 1046 352 343 --
NM_002383chr166379 345 241 113 60 46 --1784 1779
NM_002387chr584726 4535 3929 3666 1473 1053 517 266 14103 14443 1612
NM_002390chr1791887 1646 1634 1442 640 360 296 240 45 11595 21661 215 --
NM_002397chr521412 812 ------
NM_002398chr231100 160 70 21188 259 ----
NM_002401chr17102373 2332 1827 1772 871 551 457 205 199 117 41972 533 289 224 21894 1717 22229 185
NM_002406chr52389 25 --2930 64 --
NM_002419chr111485 128 2380 81 --
NM_002429chr1251385 1346 1336 628 261 11192 21038 294 --
NM_002442chr1261154 658 596 409 248 32 1525 51404 1165 617 292 158 --
NM_002466chr201259 --1120 --
NM_002473chr223861 398 328 --4414 282 204 51 --
NM_002479chr14494 283 114 35 --1479 --
NM_002480chr121393 11000 --1292
NM_002481chr1207745 7510 7092 7081 7027 6825 6606 6361 6215 5680 5517 5290 3184 2724 2299 1716 1443 1184 888 68 23051 2210 ----
NM_002486chr921903 384 11814 ----
NM_002499chr151186 ------
NM_002500chr211180 --179 --
NM_002501chr19174042 3911 3702 1571 1515 1456 862 850 807 779 689 397 240 223 193 126 23 2928 213 123724 3713 3640 3396 3374 3362 3055 1492 1402 950 654 178 1138
NM_002507chr17101854 1813 1692 1590 1401 565 508 183 173 117 41877 1553 384 147 41607 487 311 160 --
NM_002508chr131765 315 118 21721 131 41602 661 414 383 --
NM_002509chr202765 202 142 1793 129
NM_002515chr14--1701 11602 --
NM_002519chr1111129 ------
NM_002522chr17113811 2656 2613 2579 1268 1079 948 911 819 794 139 43648 3278 964 199 43192 2844 2506 170 --
NM_002533chr12178 33 ------
NM_002545chr1175001 3976 3851 1753 1337 1275 604 23519 370 ----
NM_002547chrX33273 2886 1153 --23961 111 --
NM_002553chr71412 --1368 --
NM_002569chr1551434 1342 1219 472 343 11057 31324 309 267 1274
NM_002576chr111831 --1862 21172 22
NM_002577chr332555 502 256 --12604 --
NM_002578chrX1367 ------
NM_002579chr19131464 1394 1193 978 963 916 577 506 424 361 351 168 53 11162 51243 1040 341 59 24 21515 94
NM_002581chr9104503 3985 1534 1492 1235 973 959 563 441 259 --1758 43654 1815 1379 252
NM_002585chr11243 ------
NM_002588chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_002594chr2022080 751 1580 143 1790
NM_002595chr12136 1692 130 --
NM_002599chr1141041 926 899 460 1829 2968 46 --
NM_002600chr161620 1499 1153 646 169 70 ------
NM_002607chr7----141 --
NM_002609chr581576 1340 1220 737 658 614 483 35 --3666 571 206 --
NM_002611chr173689 287 176 1759 2771 764 --
NM_002613chr16125207 4821 4507 4274 3871 3662 1915 1152 1112 623 479 354 43945 2160 1795 855 21447 302 1283
NM_002616chr174478 366 205 148 --1435 --
NM_002628chr31775 ------
NM_002629chr101247 1637 1690 --
NM_002642chr1147 ------
NM_002645chr1122425 2400 ------
NM_002646chr12593 116 11922 21509 223 --
NM_002653chr56935 764 669 660 324 81 2685 96 3841 640 133 1897
NM_002655chr834182 1189 1059 11717 24765 977 --
NM_002657chr2093552 3062 2980 2944 1131 1045 708 688 22 1195 22881 1483 --
NM_002660chr203310 199 111 --21033 82 --
NM_002663chr172503 408 1214 1458 --
NM_002668chrX1153 ------
NM_002698chr19102493 2453 1904 1193 1029 1023 841 721 690 52 32869 2567 2104 4815 808 159 42 --
NM_002699chr151097 578 203 179 52 --1946 --
NM_002707chr2144 ------
NM_002709chr211276 --12268 --
NM_002710chr12--1376 ----
NM_002717chr81436 ------
NM_002721chr91375 ------
NM_002730chr1951305 1043 1028 970 280 3892 423 95 4387 272 264 256 --
NM_002731chr11704 12505 --12566
NM_002733chr122236 221 ------
NM_002737chr17105345 5320 4364 4037 2626 2555 2124 1792 1185 1074 16455 85762 4796 2509 2398 1043 527 42 35 --
NM_002740chr322684 995 --12332 --
NM_002753chr43289 103 94 ------
NM_002755chr152571 30 ------
NM_002760chrY105771 5661 5495 5146 5137 3942 1319 1183 1159 63 31258 1095 951 --25742 4669
NM_002763chr11552 --144 --
NM_002776chr1921336 586 1661 31995 1628 276 1595
NM_002779chr101196 1483 2552 353 --
NM_002791chr141100 ------
NM_002811chr16------1509
NM_002822chr122662 585 ------
NM_002824chr122308 142 1444 --1339
NM_002827chr2051440 1278 1254 487 120 --21168 359 --
NM_002830chr21389 ------
NM_002833chr1541342 496 148 34 ------
NM_002834chr1272495 1496 1268 1071 1063 988 912 13593 ----
NM_002840chr161334 1245 543 366 322 124 --3602 89 59 --
NM_002842chr192422 27 ------
NM_002844chr621379 1063 ------
NM_002846chr2128 --5479 420 168 116 34 --
NM_002847chr731079 610 31 --2589 543 --
NM_002849chr121256 --1167 --
NM_002850chr1941105 408 164 37 --2176 155 --
NM_002855chr11143621 3429 3373 3166 2757 2529 2390 1459 1337 1235 1179 752 430 296 2839 268 51452 1443 348 127 45 12363
NM_002857chr142126 1826 617 470 31775 1037 30 1700 --
NM_002859chr1291631 1546 1219 1183 1173 635 277 196 188 11523 11637 --
NM_002866chr194258 225 203 116 --2408 75 --
NM_002868chr1262318 2009 1947 1760 405 108 --3757 391 138 1940
NM_002869chr1161863 1752 1619 440 368 49 ------
NM_002880chr33752 719 255 --1640 1312
NM_002884chr12799 21 ------
NM_002885chr161018 942 921 398 238 117 2998 659 2989 380 --
NM_002886chr351683 1297 1212 1021 334 ------
NM_002892chr1431123 1049 209 ------
NM_002896chr11----1113 --
NM_002906chr111774 --2955 803 --
NM_002911chr1951613 446 316 253 225 --21250 1052 --
NM_002918chr1971026 916 424 400 382 350 262 1293 51037 704 417 312 268 194
NM_002923chr1196 ------
NM_002957chr9163035 2991 2865 2648 2583 1501 1349 1233 1053 812 616 470 223 127 79 72 21285 331 42907 1488 802 336 --
NM_002959chr183633 3409 3357 2806 517 487 397 109 --34112 3163 545 --
NM_002971chr3--1329 --1206
NM_002972chr223229 119 112 --2257 88 --
NM_002977chr2131 --12729 12694
NM_002996chr1681719 1594 1469 1447 1300 355 173 148 1142 2787 320 4801 481 289 232
NM_002997chr261681 1675 780 546 311 45 41566 1532 1525 168 2295 121 --
NM_002998chr8--1737 ----
NM_003000chr1135 ------
NM_003001chr13685 352 81 ------
NM_003011chr931425 680 344 --152 --
NM_003012chr872894 2157 1278 1080 870 736 32 22740 2267 ----
NM_003013chr41115 --175 --
NM_003016chr1711377 --1746 --
NM_003020chr15177 --1388 --
NM_003026chr9------1123
NM_003027chr151427 ------
NM_003028chr9173733 3495 3383 3233 2848 2665 1539 1270 1156 958 845 470 461 418 340 74 60 23071 799 93346 3086 3014 1514 1404 1338 836 309 218 23472 831
NM_003029chr151333 1261 1117 1107 237 --11374 --
NM_003035chr13343 278 227 ------
NM_003036chr13457 238 94 1373 2811 71 --
NM_003038chr272689 2519 1916 1680 691 636 368 12228 21695 781 --
NM_003045chr13104300 4209 3654 3493 1783 1695 1079 979 755 290 33567 1306 860 43413 491 296 36 43473 434 313 153
NM_003047chr161328 1213 1080 1039 515 247 --2157 140 1987
NM_003074chr3------1116
NM_003075chr122123 92 --163 --
NM_003076chr1231478 1314 1129 21171 564 31073 581 574 --
NM_003077chr17----128 --
NM_003079chr173807 331 220 1239 1376 --
NM_003081chr202107 49 ------
NM_003091chr20130 --1198 --
NM_003098chr204541 522 350 22 --1449 --
NM_003108chr252867 2688 2551 2028 885 11342 32812 1960 1832 --
NM_003110chr176872 338 214 176 78 61 --137 1108
NM_003113chr21174 ------
NM_003131chr662246 1650 859 832 459 142 --51872 536 427 404 198 --
NM_003136chr141347 ------
NM_003137chr61730 12187 1257 --
NM_003139chr112792 46 1369 ----
NM_003145chr12190 114 ----1172
NM_003146chr111340 --195 --
NM_003153chr12134 ------
NM_003155chr822035 1042 12689 11942 --
NM_003156chr111913 2557 90 1285 1293
NM_003161chr172956 556 ------
NM_003162chr211057 ------
NM_003164chr113537 471 464 --1571 1403
NM_003173chrX41407 1080 459 181 1315 11110 2326 201
NM_003174chr10--125 ----
NM_003178chr3----1153 --
NM_003179chrX51352 1273 263 224 172 --1904 --
NM_003181chr61689 1176 --1120
NM_003185chr202987 135 ------
NM_003186chr112355 30 --3157 102 42 --
NM_003187chr51163 ------
NM_003189chr183312 2623 2399 2188 740 542 397 356 1481 22437 729 31096 910 265
NM_003199chr1824948 283 ------
NM_003200chr1972136 1978 1953 1605 763 656 189 42129 1920 1464 55 141 --
NM_003201chr102930 135 ------
NM_003202chr581481 1327 1176 695 507 157 147 82 --2131 22 --
NM_003214chr621118 225 1901 51388 1053 906 311 268 --
NM_003215chr421556 1029 1284 21158 146 --
NM_003216chr2283245 3163 2970 2895 1020 584 354 247 --32882 973 529 --
NM_003217chr1261929 1276 652 524 379 245 11235 21624 1296 1483
NM_003220chr6----3198 75 42 --
NM_003221chr663072 3031 1638 826 820 592 11299 43085 1644 617 464 13135
NM_003234chr342412 1957 1883 703 ----12087
NM_003236chr272696 2524 2383 2232 1028 540 135 ------
NM_003253chr211545 ------
NM_003255chr1772361 1755 640 570 535 67 43 1602 21688 290 1699
NM_003269chr61987 171 ----
NM_003285chr11394 1437 ----
NM_003286chr20--171 ----
NM_003289chr9129 ------
NM_003290chr1951083 967 809 221 43 1878 --1333
NM_003292chr11525 ------
NM_003317chr14125 --2712 705 --
NM_003320chr1161466 898 853 721 528 34 --172 --
NM_003322chr62160 88 ------
NM_003325chr222224 143 --1149 1284
NM_003326chr12102 95 --22175 658 22130 945
NM_003340chr4----11172 11088
NM_003342chr17----12110 --
NM_003344chr741496 1118 393 274 ------
NM_003345chr16--1459 ----
NM_003348chr1231551 246 126 --1558 --
NM_003349chr2031581 473 124 --1422 --
NM_003369chr1152089 1917 712 550 263 --12163 --
NM_003371chr982064 1940 1546 1484 670 444 177 74 1238 31586 432 55 --
NM_003374chr52231 118 1641 ----
NM_003376chr641478 695 131 23 --1682 --
NM_003376chr641478 695 131 23 --1682 --
NM_003387chr251168 1141 495 355 225 1546 ----
NM_003390chr112405 238 ------
NM_003392chr353762 1554 1036 936 701 --125 11093
NM_003394chr123656 459 296 --162 --
NM_003404chr2011461 ----1127
NM_003405chr223717 532 209 ------
NM_003406chr811886 ------
NM_003411chrY----11710 --
NM_003412chr31916 22565 2537 ----
NM_003413chrX1810 ------
NM_003430chr191647 148 --1333
NM_003439chr753333 3161 2494 2329 1001 1410 23379 196 193
NM_003445chr196746 712 629 576 330 229 --2546 524 1771
NM_003455chr114460 176 80 69 --2390 36 --
NM_003458chr393186 2934 1610 1234 1126 874 728 476 86 --63729 3573 3289 2868 1618 309 --
NM_003459chr21499 1468 --6716 165 159 153 147 47
NM_003462chr141221 674 278 87 ------
NM_003466chr2101965 1613 1531 895 780 618 459 445 283 48 2227 61 42453 976 866 511 1742
NM_003468chr243660 1106 641 188 1553 ----
NM_003470chr1651397 639 525 57 47 --31565 609 376 --
NM_003478chr11--11026 12445 --
NM_003482chr1271109 901 734 396 212 130 32 11720 42111 2037 1023 370 1241
NM_003483chr1222409 1901 12537 12922 2842 218
NM_003485chr1491388 1176 972 941 904 415 172 105 48 --11045 --
NM_003489chr2121194 379 ------
NM_003498chr1662158 1843 1124 822 368 346 --11112 --
NM_003502chr163522 245 207 ------
NM_003512chr6261 21 ------
NM_003557chr121331 1043 --165 --
NM_003559chr17143649 3409 3266 3084 3035 2884 2841 1441 1326 1272 1099 821 404 142 23427 807 --12572
NM_003560chr224580 411 242 232 --2548 49 126
NM_003563chr1751341 1316 1155 1021 951 1136 ----
NM_003564chr13533 132 105 190 1269 --
NM_003566chr1242376 2156 894 220 ------
NM_003576chr1352604 2547 2495 2464 1143 --42565 2509 2169 211 12319
NM_003583chr1233615 1049 951 1717 1383 --
NM_003587chr6----134 --
NM_003590chr233958 3794 311 --1900 12549
NM_003603chr421623 1509 --1348 --
NM_003607chr163916 3736 2937 1271 585 177 --33802 3456 2706 --
NM_003612chr15288 40 1177 2510 495 --
NM_003615chr313922 --12478 --
NM_003617chr144481 3776 1792 681 --14450 --
NM_003624chr1941282 1276 966 354 --31289 425 335 11209
NM_003626chr1131216 983 490 ------
NM_003627chr11----3482 416 221 --
NM_003629chr122280 341 13159 1623 12976
NM_003632chr17150 2266 189 2668 33 --
NM_003633chr552377 2143 2137 1972 431 1369 32351 1881 298 --
NM_003644chr17165485 5398 5243 4095 2642 2099 2052 1337 1218 998 948 878 843 762 463 154 36137 658 343 3783 493 205 --
NM_003654chr111128 ------
NM_003656chr3153 ------
NM_003659chr21364 1957 ----
NM_003660chr191728 ------
NM_003671chr962770 2689 2553 2443 270 209 ----11081
NM_003682chr114785 121 49 30 1665 1578 1824
NM_003684chr12352 312 1980 195 --
NM_003707chr3160 ------
NM_003709chr21392 ------
NM_003714chr562787 2049 837 807 677 347 --32234 1972 408 --
NM_003735chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_003736chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_003737chr112179 21 2124 59 3360 151 84 --
NM_003743chr231833 779 369 1389 1473 --
NM_003746chr12291 56 ------
NM_003749chr133519 453 80 ------
NM_003758chr151359 ------
NM_003758chr151359 ------
NM_003759chr453928 3720 3228 1557 577 ------
NM_003778chr32151 104 ------
NM_003780chr13251 135 60 1653 1284 2521 258
NM_003787chr181217 ------
NM_003800chr652216 2107 1872 237 155 1611 ----
NM_003806chr122269 217 ------
NM_003822chr133200 595 483 2577 507 12550 1235
NM_003861chr1432103 2054 540 22537 2382 ----
NM_003872chr272378 2214 2186 947 685 603 474 ------
NM_003873chr1051906 1751 1713 819 562 1539 1889 --
NM_003887chr241718 915 430 103 1556 --11787
NM_003888chr1551578 1563 1149 72 31 ------
NM_003893chr101456 --2375 108 2486 58
NM_003895chr2141887 805 590 274 --1355 --
NM_003896chr22104 59 ------
NM_003908chr2011131 ------
NM_003930chr71957 --183 1868
NM_003938chr192892 223 --158 --
NM_003939chr10103921 3864 3742 3642 3394 3374 1121 567 520 181 --13415 2812 527
NM_003941chr742248 2190 670 446 ------
NM_003947chr33446 128 30 1914 ----
NM_003949chr1792019 1764 1495 1438 1300 637 380 46 22 11242 51851 1711 1546 717 512 1728
NM_003951chrX136 1316 128 --
NM_003954chr17101439 1410 1361 1215 952 534 385 360 190 42 11292 31416 393 108 --
NM_003955chr1761479 1125 1056 987 136 49 1461 11135 --
NM_003957chr117834 300 239 192 183 152 102 --2143 130 1922
NM_003958chr663699 1193 968 617 557 143 12743 33196 2481 174 --
NM_003966chr575861 5568 4901 4759 1242 1194 773 27506 3077 26968 1068 --
NM_003975chr11102 ------
NM_003987chr1072143 2133 2017 875 710 424 296 --51774 811 430 327 238 31769 925 128
NM_003988chr1072220 2210 2094 952 787 501 373 --51851 888 507 404 315 21846 205
NM_003989chr1072079 2069 1953 811 646 360 232 --51710 747 366 263 174 31705 861 64
NM_003990chr1072079 2069 1953 811 646 360 232 --51710 747 366 263 174 31705 861 64
NM_003993chr1152 ------
NM_004006chrX------1903
NM_004007chrX------1903
NM_004009chrX------1903
NM_004010chrX------1903
NM_004011chrX------1903
NM_004012chrX------1903
NM_004013chrX------1903
NM_004014chrX------1903
NM_004015chrX------1903
NM_004016chrX------1817
NM_004017chrX------1903
NM_004018chrX------1817
NM_004020chrX------1903
NM_004021chrX------1817
NM_004022chrX------1817
NM_004023chrX------1817
NM_004035chr1731965 1659 1247 23436 1876 35053 4422 3627 --
NM_004036chr26462 243 231 127 68 24 ------
NM_004050chr1411777 --21873 317 --
NM_004056chr8--11085 ----
NM_004060chr5--1101 ----
NM_004068chr34354 315 126 21 --2390 178 --
NM_004073chr11201 1273 ----
NM_004075chr121486 ------
NM_004077chr1241043 462 384 280 11142 1190 11272
NM_004081chrY31784 1154 660 --11188 --
NM_004082chr2----283 40 --
NM_004083chr12----121 --
NM_004085chrX1575 1289 ----
NM_004089chrX2511 240 --1861 --
NM_004090chr1752669 2261 1096 487 143 1418 32210 1257 513 --
NM_004093chr134946 760 625 591 13206 11076 --
NM_004096chr1021518 756 11633 2266 109 --
NM_004098chr101434 ------
NM_004100chr61463 --1385 --
NM_004104chr173539 495 113 --3778 578 523 --
NM_004112chr1751516 1435 1283 549 73 11569 ----
NM_004114chrX172 1177 ----
NM_004117chr661412 1368 672 622 609 268 21742 27 3639 157 41 --
NM_004119chr131607 ------
NM_004124chr1412263 ------
NM_004132chr1081101 1050 1019 975 750 382 148 90 --1771 --
NM_004145chr194945 331 188 86 --2203 41 1144
NM_004162chr331121 318 80 ------
NM_004171chr11128500 7726 6867 6353 6013 3765 3591 3544 3464 2005 1258 461 26294 2794 28591 2059 --
NM_004172chr52658 76 1581 11540 --
NM_004185chr13213 170 39 ------
NM_004187chrX41103 1036 227 140 --2201 187 --
NM_004193chr101377 1157 ----
NM_004200chr1182759 2233 942 515 435 190 154 87 13026 42148 1234 394 196 1177
NM_004225chr811103 ----11338
NM_004227chr793042 2658 2619 2508 2445 2197 2066 944 746 42559 2318 856 399 43060 2650 719 65 --
NM_004228chr191119 ------
NM_004229chrX165 --11708 --
NM_004236chr151595 ------
NM_004241chr10----1172 --
NM_004247chr17123 ------
NM_004248chr102622 131 134 1137 --
NM_004253chr91870 ------
NM_004261chr11833 ------
NM_004263chr281670 1648 1604 1578 1460 1240 372 281 11588 31418 1376 97 --
NM_004267chr3178 1452 ----
NM_004269chr91331 ----123
NM_004272chr51764 ------
NM_004274chr1412963 12752 ----
NM_004276chr123376 347 34 --1387 --
NM_004279chr732254 1546 697 11916 ----
NM_004286chr2262416 2364 2113 883 840 122 11119 42838 2804 2247 96 --
NM_004293chr933838 3596 2793 --12434 --
NM_004295chr1751239 1223 517 470 181 --1175 --
NM_004297chr9------196
NM_004302chr12162776 2680 2610 2563 2521 2480 2216 2114 1015 855 791 460 402 280 118 27 --2445 101 --
NM_004308chr1191712 1580 1472 631 379 153 141 82 39 3716 487 285 51697 1660 1373 1192 25 31771 1587 1400
NM_004311chr1052243 2212 2146 854 490 --12691 1107
NM_004321chr283180 2949 2711 2453 2319 420 102 37 53527 2265 2256 1148 597 32539 1024 84 23255 1338
NM_004329chr1021082 451 ------
NM_004337chr832101 737 328 2469 114 ----
NM_004338chr18136464 5559 4353 2505 2480 2305 2218 2101 1808 1278 1220 550 63 --16304 15585
NM_004339chr2151488 1299 162 120 55 --31821 437 22 --
NM_004346chr441304 1298 1014 966 ------
NM_004349chr82962 846 --11018 11013
NM_004350chr192233 1839 983 764 624 447 230 211 148 2683 403 3616 469 275 --
NM_004370chr6--21528 285 --11649
NM_004379chr241764 1597 650 356 --1390 --
NM_004380chr1632332 2288 1853 12540 22111 1628 --
NM_004383chr152443 136 1101 1152 1471
NM_004385chr52271 230 ------
NM_004387chr5196 --150 --
NM_004389chr22554 90 ------
NM_004392chr1312409 ------
NM_004393chr362233 883 802 717 699 574 --42095 1864 1845 354 --
NM_004398chr111152 --1441 --
NM_004405chr26429 360 267 244 174 86 ------
NM_004408chr92483 373 --2406 98 187
NM_004416chr124408 197 184 81 --1966 11053
NM_004418chr23566 416 133 --187 --
NM_004419chr102271 23 ----130
NM_004420chr11112379 2358 2330 2207 2097 1867 1568 967 830 733 282 32161 2051 780 92413 2367 2271 2218 2189 2108 2079 539 22 1551
NM_004421chr15746 627 334 228 147 1783 2162 23 --
NM_004423chr392661 2097 1949 1787 1050 848 623 542 388 32709 2333 207 4931 903 870 187 123
NM_004426chr1271684 1677 1380 1223 326 301 26 ------
NM_004427chr16996 891 876 470 397 277 2925 265 ----
NM_004428chr14837 248 191 90 --197 1143
NM_004429chrX21142 24 --41330 1075 454 299 --
NM_004431chr13624 282 272 124 --1720
NM_004432chr91631 ------
NM_004433chr131462 214 86 --1624 --
NM_004434chr1411316 --1694 --
NM_004436chr12172 141 --1517 --
NM_004437chr162761 2278 799 605 306 300 11148 53600 1418 1153 538 484 12939
NM_004438chr252606 2152 2135 1113 1102 42878 2711 2622 640 1853 --
NM_004441chr31440 --2514 299 --
NM_004444chr72354 74 --2283 81 1891
NM_004450chr141275 ------
NM_004451chr113672 557 101 1148 3546 508 133 160
NM_004459chr171141 --1473 --
NM_004463chrX4255 86 71 26 --1403 1501
NM_004468chr12215 200 1177 185 1559
NM_004474chr1----144 --
NM_004475chr1741115 942 804 40 --11092 1486
NM_004485chr174238 3268 1715 1693 1364 622 46 --52738 1412 1200 1164 671 23502 1700
NM_004491chr1993403 3099 2655 1649 1338 1007 943 651 487 11490 64219 3726 3145 2758 1504 308 --
NM_004494chr151234 1105 499 151 25 ------
NM_004500chr1421981 607 1173 ----
NM_004501chr112673 ------
NM_004502chr173438 371 60 1480 --1547
NM_004503chr122536 156 ------
NM_004508chr10--1739 ----
NM_004514chr1752679 2538 2101 1900 570 --22532 1879 --
NM_004519chr8----1157 --
NM_004527chr1731226 514 39 --3200 189 103 --
NM_004528chr1------1107
NM_004529chr911447 ----1218
NM_004530chr164998 976 407 106 --1284 --
NM_004535chr204719 639 275 30 --41654 1146 701 592 11705
NM_004549chr1141074 1057 1006 407 --11307 --
NM_004555chr163209 143 96 ------
NM_004560chr92147 37 --1959 --
NM_004576chr5----1156 --
NM_004580chr152504 198 ------
NM_004583chr172643 486 --1520 --
NM_004586chrX74014 3549 3468 1735 1568 947 606 --11363 14356
NM_004588chr1143638 2933 1373 473 23120 2859 53193 2908 1052 258 23 1716
NM_004596chr19184 --169 --
NM_004598chr572767 2394 1012 898 569 400 260 1330 ----
NM_004606chrX246 29 ------
NM_004608chr16166 --158 185
NM_004613chr20121530 1389 1377 1304 1244 1070 545 531 355 236 118 32 193 41521 1179 413 165 1458
NM_004621chr112447 424 21248 145 ----
NM_004626chr111239 1656 ----
NM_004630chr1151020 881 860 853 427 ----1386
NM_004631chr121128 1008 ----142
NM_004634chr31405 1242 ----
NM_004646chr192358 70 2436 96 ----
NM_004654chrY21344 1173 ------
NM_004656chr361225 1139 1016 934 849 27 21082 103 2962 860 21093 191
NM_004660chrY12145 ----1181
NM_004673chr1151 --11480 11017
NM_004675chr1124 ------
NM_004686chr81339 ------
NM_004687chr1741639 1562 759 499 --1268 --
NM_004698chr12163 50 ------
NM_004703chr1762423 2077 1757 1680 1563 191 11694 --12415
NM_004709chrX21494 438 ------
NM_004711chr22123564 3511 3193 3144 2530 2521 2279 1415 1019 508 371 155 11126 73371 3353 2701 1306 746 103 61 1823
NM_004715chr181504 1127 2522 71 --
NM_004723chr14910 763 416 125 --11008 --
NM_004726chrX45118 4474 1442 731 --11947 --
NM_004729chrX52208 1993 410 251 42 --11895 11669
NM_004730chr532129 737 209 --21925 1516 1174
NM_004734chr1343231 2449 2210 71 --128 --
NM_004736chr11382 ----1738
NM_004742chr331816 1686 178 --169 --
NM_004745chr885497 5038 5006 4960 4607 1840 1635 1600 24637 1811 34375 4288 1590 16035
NM_004747chr1021385 60 --1389 --
NM_004748chr1533744 3174 1141 11039 ----
NM_004758chr175864 308 256 94 69 2815 130 1180 --
NM_004762chr1751339 750 562 106 43 1685 31424 1308 268 --
NM_004768chr13879 132 106 ------
NM_004772chr51375 --1345 --
NM_004774chr1732741 2209 981 --22095 1926 --
NM_004783chr163626 212 83 1656 1119 --
NM_004786chr18----148 --
NM_004788chr1132274 2180 1053 ------
NM_004801chr241425 1071 586 432 ------
NM_004805chr241091 881 202 129 --1567 --
NM_004807chr2102242 1050 769 697 546 530 524 479 410 199 31695 1669 680 22228 599 2949 463
NM_004808chr1053157 2992 2748 2143 964 33013 2623 876 --12155
NM_004815chr164605 4556 4221 4146 4128 3438 11026 11460 14482
NM_004822chr1773526 3324 2815 1043 747 576 345 23984 392 82836 1429 1384 1032 947 627 536 165 23678 2498
NM_004834chr211222 22746 2444 13347 22591 316
NM_004836chr22361 263 ------
NM_004841chr1171 ------
NM_004844chr321102 232 ------
NM_004845chrX41583 511 426 108 --44100 3081 3043 547 --
NM_004850chr221760 1595 ------
NM_004854chr241248 1121 922 293 ------
NM_004856chr15----1399 --
NM_004860chr171223 ------
NM_004863chr14145227 5131 4967 4910 4410 4286 4212 3591 3508 2024 1601 395 242 49 14136 --14501
NM_004865chr6--1138 1143 --
NM_004879chr112700 53 --1269 --
NM_004884chr1561662 1566 1159 547 176 156 11616 1506 11143
NM_004887chr51967 ------
NM_004891chr21230 ------
NM_004896chr10------11549
NM_004898chr422616 436 12489 12534 --
NM_004904chr765685 4891 1697 1619 486 310 36257 5775 4551 14491 --
NM_004911chr71625 --1474 2610 582
NM_004924chr192885 109 1394 --268 60
NM_004926chr142449 247 1275 2487 38 --
NM_004930chr13699 485 264 ------
NM_004932chr52226 126 11433 ----
NM_004943chr1981151 1053 920 767 454 200 185 150 1329 4394 383 123 43 --
NM_004948chr1831443 1231 1135 --1960 --
NM_004956chr733905 3252 1831 --13575 --
NM_004958chr1----1652 --
NM_004961chrX41279 1006 415 57 --1302 1434
NM_004962chr104227 197 182 102 ------
NM_004964chr13555 143 36 ------
NM_004965chr211629 ------
NM_004969chr101367 ------
NM_004974chr1128 ------
NM_004975chr203366 238 118 --1345 --
NM_004976chr11195059 4872 4510 4332 4288 4273 4174 4048 3935 3699 3440 3284 3216 1887 1701 585 555 383 237 21998 1666 84055 3873 3767 3298 3251 2016 1569 829 24989 1295
NM_004977chr193449 223 152 --5593 586 533 393 191 --
NM_004978chr161595 1537 1076 447 423 399 21695 1091 21268 56 --
NM_004980chr11206 ------
NM_004981chr22139 ------
NM_004992chrX228256 8169 8096 7655 6914 6689 6545 6441 6119 5860 5273 3265 3177 3137 2870 2498 1500 1414 1163 1061 673 647 47362 6671 2963 576 117970 6493 6468 5963 5919 2999 2974 1795 1351 436 427 21398 587
NM_004992chrX228256 8169 8096 7655 6914 6689 6545 6441 6119 5860 5273 3265 3177 3137 2870 2498 1500 1414 1163 1061 673 647 47362 6671 2963 576 117970 6493 6468 5963 5919 2999 2974 1795 1351 436 427 21398 587
NM_004995chr1431327 233 102 1447 4469 437 244 116 1288
NM_004996chr1641231 637 380 88 --1670 1270
NM_004998chr151208 139 1929 --
NM_005011chr731470 1377 751 --11451 --
NM_005023chr511422 ------
NM_005027chr1951134 888 387 352 215 1952 21026 976 1404
NM_005029chr10----2231 53 --
NM_005044chrX74327 4217 3665 3656 1666 1491 1045 1820 14051 24298 3188
NM_005045chr71125 ------
NM_005052chr17--1270 2340 44 --
NM_005053chr197514 492 463 221 169 142 28 1394 ----
NM_005056chr1253482 1625 1269 371 171 24094 4050 11220 --
NM_005060chr13943 543 117 1900 11096 2987 222
NM_005065chr1464804 4583 4530 4299 1359 539 --24868 3308 --
NM_005066chr1--1804 ----
NM_005068chr61554 11052 --11318
NM_005072chr162438 391 --2101 76 --
NM_005073chr134860 821 235 88 --1284 --
NM_005080chr22130 --1107 --
NM_005093chr2095167 4242 3886 3474 1718 1070 441 402 220 --95075 4871 4641 4221 3428 1480 310 286 160 34989 3933 451
NM_005095chr151790 1425 842 590 401 ------
NM_005103chr11----2287 22 --
NM_005109chr341975 1950 547 303 ----1533
NM_005110chr53709 574 275 --1623 --
NM_005116chr2083855 3019 1757 1708 1656 391 264 200 13655 --24080 1694
NM_005121chr1721421 1123 ----11386
NM_005126chr352317 2278 2037 1632 708 ------
NM_005133chr111291 --147 --
NM_005134chr182745 394 ------
NM_005135chr1543039 2852 167 69 1145 22624 574 --
NM_005137chr22132326 2109 1879 1734 1012 852 691 626 600 548 156 94 83 1794 32306 731 511 1900
NM_005144chr821012 56 2948 929 31137 408 318 11185
NM_005146chr1151057 381 366 52 22 2968 700 ----
NM_005151chr1832396 2197 546 12440 ----
NM_005155chr61448 1656 2602 462 --
NM_005156chr954912 4738 1422 338 74 11789 11906 --
NM_005161chr1161970 1925 1504 1494 454 36 1665 1648 1241
NM_005165chr171356 --2266 24 --
NM_005166chr19176 157 ----
NM_005169chr113507 250 99 --169 --
NM_005180chr10------11628
NM_005184chr194504 316 300 276 1983 41435 1063 475 393 --
NM_005187chr1661997 1750 1743 1527 1299 277 --41631 1485 1363 1349 31408 1380 56
NM_005188chr11127360 7260 6745 6609 6361 5557 5510 5180 5144 2723 681 287 18004 47667 6781 2363 1271 36590 5569 3104
NM_005197chr1495037 4588 4183 3812 3792 2409 2138 1427 614 12402 25498 1697 11997
NM_005202chr151418 777 743 700 256 --61870 548 428 406 345 262 11435
NM_005206chr1731436 1319 1269 ------
NM_005216chr11510 1421 ----
NM_005219chr521276 328 11325 41563 344 232 27 --
NM_005220chr1731447 566 457 11402 21249 486 --
NM_005225chr2061006 909 399 221 88 63 21170 817 155 --
NM_005229chrX31157 441 416 11264 21002 217 --
NM_005230chr121476 ------
NM_005238chr1112904 ------
NM_005242chr53410 170 144 ------
NM_005258chr153333 305 71 ----1132
NM_005263chr11319 --153 1337
NM_005264chr101765 ------
NM_005271chr105977 819 280 259 147 ------
NM_005274chr11141 ------
NM_005275chr61112 ------
NM_005277chr42223 213 ------
NM_005281chr14964 852 805 232 2893 287 1702 2843 88
NM_005308chr10276 39 1511 1201 --
NM_005311chr772552 2340 2267 944 937 921 433 12215 3850 599 579 11987
NM_005312chr992491 2213 2085 1977 1874 1829 860 735 99 22173 395 42324 615 129 52 22592 2019
NM_005324chr1731721 1667 1298 --11379 --
NM_005329chr1662038 1643 896 390 272 170 2823 325 ----
NM_005336chr281997 1592 1561 676 603 448 314 31 --72108 1850 1611 1454 862 472 263 --
NM_005359chr1865296 4823 3973 2148 1165 297 16450 12197 --
NM_005370chr1961133 1070 815 64 34 25 1366 1444 --
NM_005374chr17112246 2184 2141 1842 1820 1581 926 799 769 534 97 1833 62155 2119 725 611 604 128 22350 2344
NM_005376chr1--1111 187 --
NM_005381chr21113 ------
NM_005382chr81323 ------
NM_005384chr9158 ------
NM_005388chr92520 107 ------
NM_005389chr61104 ------
NM_005392chr991350 1261 597 328 292 283 242 178 50 11635 21589 416 1385
NM_005397chr732649 1335 1064 141 41200 570 542 446 13254
NM_005400chr2--1110 1946 22657 116
NM_005406chr181394 ------
NM_005407chr1461263 505 359 183 144 82 21364 549 1632 21370 520
NM_005412chr12----1486 --
NM_005415chr22743 200 ------
NM_005418chr113626 127 66 --1530 --
NM_005426chr12380 336 ------
NM_005430chr123831 762 44 ------
NM_005433chr1852566 1943 1120 861 686 ------
NM_005436chr1032921 2579 740 ------
NM_005437chr1041363 584 295 26 ------
NM_005440chr1763321 2415 1266 831 487 471 11099 1336 1497
NM_005456chr112524 450 1716 2537 34 1691
NM_005458chr951612 529 501 458 383 --1573 --
NM_005461chr203316 38 21 167 1540 1101
NM_005465chr131910 1700 73 --11803 --
NM_005474chr1781181 1133 1075 338 291 172 146 111 31465 1362 1285 31478 219 153 1431
NM_005477chr1562392 2302 1875 789 752 383 32258 455 406 --1824
NM_005477chr1562392 2302 1875 789 752 383 32258 455 406 --1824
NM_005487chr2231642 1543 668 ----11925
NM_005493chr6164 1583 ----
NM_005494chr72145 134 ------
NM_005497chr17155939 5554 5378 4991 4798 4774 4524 4473 4308 4069 1915 1680 1291 925 53 --54948 4813 1872 1729 1691 --
NM_005501chr1741000 367 340 79 1847 41207 1119 466 310 21114 837
NM_005505chr123693 125 118 --3103 63 55 1112
NM_005506chr42966 667 22636 291 12229 --
NM_005507chr11------140
NM_005522chr751052 882 375 133 27 --11280 --
NM_005529chr16973 949 750 736 314 44 --1348 --
NM_005539chr102255 49 --1149 2172 132
NM_005540chr121447 61 --21153 384 148
NM_005557chr17----126 --
NM_005578chr343860 3353 3175 667 ------
NM_005581chr19----2122 62 --
NM_005595chr11915 ------
NM_005596chr956363 5335 4987 673 661 14703 31102 932 339 13885
NM_005603chr1851658 726 586 458 293 ------
NM_005607chr8------1110
NM_005610chr11137 ------
NM_005613chr13887 850 210 186 1810 --
NM_005614chr74882 819 414 132 ------
NM_005619chr19299 57 1339 249 40 --
NM_005626chr11164 ------
NM_005627chr6--1384 ----
NM_005632chr1661004 848 721 189 152 128 --21041 254 1272
NM_005637chr1841988 1687 1352 151 --11736 --
NM_005638chrX1576 ------
NM_005647chrX82829 2717 2616 2385 1134 274 251 68 --1725 11154
NM_005652chr162796 54 --1203 --
NM_005660chrX1180 --2194 186 1205
NM_005665chr133985 875 792 14016 2749 613 --
NM_005668chr543461 3381 738 726 --1775 --
NM_005677chr341058 569 457 84 --11397 --
NM_005688chr331087 917 65 1846 --1895
NM_005698chr1152 ------
NM_005707chr1521143 454 11053 1385 --
NM_005711chr5------11038
NM_005715chr652726 1897 790 593 305 ----1828
NM_005716chr196467 146 111 92 86 53 --1210 --
NM_005719chr12134 ------
NM_005721chr2----21044 818 --
NM_005730chr1272439 2300 1266 1221 1124 842 107 21425 277 22606 1042 --
NM_005736chr1071546 1448 1351 1325 1195 1073 636 2419 383 11569 --
NM_005737chr282654 2579 2513 2041 1923 770 576 242 ----1340
NM_005739chr1522063 1959 ------
NM_005740chr223703 610 590 1361 3584 575 318 170
NM_005748chr1253445 3172 3043 2975 2749 11103 ----
NM_005754chr521073 68 ------
NM_005764chr12132 72 --1367 1123
NM_005766chr1361166 1095 916 458 199 125 ------
NM_005781chr33742 159 89 1643 1214 --
NM_005785chr1261689 1255 1212 549 250 167 ------
NM_005786chr18174 ------
NM_005792chr162457 214 ------
NM_005795chr222116 168 ------
NM_005801chr172324 195 1287 ----
NM_005803chr6------130
NM_005808chr352997 2798 1437 1361 354 --32278 1139 75 13194
NM_005811chr12284 54 2397 77 ----
NM_005817chr194679 568 109 28 2756 214 1181 --
NM_005822chr651826 587 448 260 133 1672 1728 1345
NM_005828chr1793859 3525 3207 1539 1454 807 777 611 209 33952 956 619 35034 4097 3904 --
NM_005832chr3--1443 ----
NM_005834chrX185 --1234 1201
NM_005839chr11831 1727 ----
NM_005840chrX77310 5535 2618 2595 2578 226 43 46040 2562 2133 1558 ----
NM_005850chr1179 ------
NM_005851chr111311 --1278 --
NM_005852chr177815 736 396 367 339 57 33 --2147 83 --
NM_005853chr16--1585 ----
NM_005857chr121381 65 ------
NM_005864chr142291 46 --1602 --
NM_005868chr71202 ------
NM_005870chr1331272 264 187 ------
NM_005871chr101759 ------
NM_005877chr2262130 1848 1038 268 78 26 11891 1685 --
NM_005884chr196671 572 527 286 95 34 --2622 589 1770
NM_005885chr51426 ------
NM_005896chr22237 150 ------
NM_005898chr1142990 2776 2503 1997 --1377 --
NM_005899chr17180 11009 ----
NM_005901chr1896930 6325 5963 5835 5654 2442 1950 866 733 28187 7586 18664 --
NM_005902chr15124638 4451 4231 3704 3562 1762 1635 1438 1300 497 452 347 34279 3413 221 2503 296 --
NM_005903chr564490 4342 3781 1547 1381 773 31458 1221 1056 11167 --
NM_005904chr182582 571 --1973 1459
NM_005907chr611217 --1501 --
NM_005909chr553924 3760 3548 3270 689 1760 14028 --
NM_005910chr1783742 3101 2847 2596 1526 1503 1114 749 43999 3951 3929 2868 31624 1348 81 22686 1238
NM_005911chr21408 1592 2430 109 --
NM_005920chr1152802 2622 2561 2509 2413 1420 1326 1173 1147 870 826 693 587 384 370 --33281 895 28 --
NM_005924chr71825 ----122
NM_005933chr1162848 2702 2185 2020 233 88 4932 461 415 176 ----
NM_005934chr19132507 2013 1983 1950 1767 1693 362 310 299 273 191 133 23 --41049 404 323 114 11734
NM_005935chr441924 716 684 67 2215 57 14385 --
NM_005937chr17144043 3865 3786 3097 1329 1189 1085 1074 904 630 469 195 181 147 11132 53502 3034 2727 2571 611 23057 606
NM_005938chrX41056 440 249 78 --21285 1273 --
NM_005941chr83691 218 109 --12671 --
NM_005943chr691472 1404 1389 1355 1253 1102 438 248 166 21446 616 11284 --
NM_005955chr185200 5190 5111 4843 4597 4287 1484 606 --23799 1961 11074
NM_005957chr1164902 4152 4031 3593 3465 3352 3265 3117 1824 1774 1519 1273 987 805 351 322 74815 3870 1850 1255 925 778 492 53491 1501 1362 560 339 1186
NM_005962chr1051574 742 628 494 192 1811 1757 --
NM_005962chr1051574 742 628 494 192 1811 1757 --
NM_005964chr173978 423 135 ------
NM_005966chr21101 ------
NM_005977chr131794 ------
NM_005984chr223347 331 95 --1430 --
NM_005990chr572486 2477 1744 883 465 393 111 42530 1037 250 40 22010 123 --
NM_005996chr124538 131 98 33 --1166 11241
NM_006007chr953696 3488 3046 1314 805 12934 24225 3745 1191
NM_006011chr15124088 3950 3863 3374 3146 3096 3047 2762 2701 1244 1232 408 53919 2753 1110 1071 551 33470 3452 2646 1315
NM_006015chr11360 ------
NM_006016chr612052 ------
NM_006022chr131397 ------
NM_006030chr331266 1220 91 1166 1497 --
NM_006036chr241855 1022 843 519 1283 ----
NM_006037chr224192 876 11362 --1208
NM_006038chr2061795 1553 1360 639 630 465 --12067 125
NM_006039chr178990 930 768 381 326 320 303 69 1859 1808 2968 434
NM_006047chr2023160 555 --13203 --
NM_006070chr31365 ------
NM_006077chr103541 101 73 --1661 1258
NM_006085chr13290 269 106 ------
NM_006090chr1--1181 ----
NM_006095chr454205 3947 3385 1782 1673 --14269 --
NM_006109chr142366 307 ----1254
NM_006113chr151941 497 281 219 135 --12087 11797
NM_006121chr122145 90 --1331 --
NM_006133chr1192097 1805 1697 1647 925 866 573 280 257 42324 884 204 117 32207 1568 479 --
NM_006135chr121049 340 1132 ----
NM_006141chr1662703 2256 2088 1843 1022 853 ------
NM_006145chr1911063 --2290 258 1844
NM_006154chr15----22555 2475 --
NM_006156chr141204 ------
NM_006157chr11----1376 --
NM_006160chr171150 11022 161 11299
NM_006166chr1242618 2284 2197 2121 ------
NM_006176chr114633 563 318 127 --2694 625 --
NM_006185chr112538 525 126 196 --
NM_006186chr22136 102 ------
NM_006191chr121283 ----1171
NM_006194chr14------11153
NM_006195chr931254 249 86 ------
NM_006201chrX51152 1111 937 872 367 1811 61071 878 832 323 283 65 --
NM_006202chr1921379 1277 --2743 576 1571
NM_006203chr574511 4500 2188 2130 1946 311 144 --44328 4216 4154 2200 15455
NM_006206chr452343 2328 2249 2210 1807 12078 ----
NM_006224chr1752040 2021 855 796 544 11952 12394 32273 2199 63
NM_006228chr8--1282 --187
NM_006237chr131125 ------
NM_006238chr661968 1604 1433 1326 803 191 32025 639 116 51777 1753 1467 590 85 21499 741
NM_006243chr14794 768 691 157 1826 ----
NM_006245chr6132 --2701 42 --
NM_006246chr1411028 --11099 --
NM_006252chr197557 6918 6656 5637 5113 2767 2307 1819 944 35174 2392 2045 25179 878 --
NM_006256chr122688 327 ------
NM_006266chr9195 1620 1539 1609
NM_006268chr1171076 948 914 784 346 165 132 2486 183 2888 292 --
NM_006275chr2031951 916 802 1596 ----
NM_006277chr22238 33 ------
NM_006282chr2043839 1020 859 606 44076 1418 689 25 34284 3152 1257 131
NM_006283chr894794 4552 3554 3434 3319 3170 3116 779 232 24592 1622 24597 169 --
NM_006288chr1131222 996 848 2904 34 41122 1008 974 880 --
NM_006289chr93344 137 33 2416 290 2327 147 1337
NM_006293chr159968 953 644 405 337 239 197 84 69 --1883 --
NM_006301chr123600 519 232 ------
NM_006306chrX74053 3692 1361 1272 1087 969 294 11220 24972 3698 --
NM_006321chr352044 1897 793 646 378 2532 114 ----
NM_006323chr41755 ------
NM_006328chr112530 450 ----1575
NM_006334chr9145 ------
NM_006336chr991357 1344 1209 985 367 299 97 82 68 --31443 1377 613 --
NM_006350chr5----1243 --
NM_006352chr121435 404 11351 ----
NM_006359chrX--178 ----
NM_006361chr1761570 1377 1308 684 206 104 21656 310 ----
NM_006373chr1751147 988 889 467 402 --31338 312 88 1883
NM_006378chr93287 137 113 ----11082
NM_006380chr1773557 2810 2671 1662 1375 730 116 ------
NM_006387chr1961035 872 766 446 350 91 1240 2430 417 1879
NM_006389chr1141091 948 532 162 1458 1557 21173 224
NM_006393chr1053001 1438 1397 883 861 --13151 14266
NM_006401chr91176 ------
NM_006411chr61291 1188 2724 714 --
NM_006421chr81237 1282 1162 --
NM_006424chr441472 1371 496 132 --31889 1546 1298 1471
NM_006434chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_006440chr221308 --148 --
NM_006451chr5------1877
NM_006454chr4143037 2813 2605 2550 2530 2251 2235 2228 995 812 609 467 244 204 22934 121 52622 2139 782 84 55 11951
NM_006457chr473760 3671 3279 2941 1388 777 611 11300 ----
NM_006458chr113330 311 295 ------
NM_006475chr131193 ------
NM_006478chr222265 80 ------
NM_006482chr1233615 1049 951 1717 1383 --
NM_006489chr14--1701 11602 --
NM_006494chr193757 90 64 ------
NM_006500chr1161005 871 355 199 100 77 31135 974 250 148 --
NM_006504chr1042953 2440 1999 1977 22283 1098 12430 12263
NM_006516chr141465 342 272 21 ----142
NM_006517chrX71908 1771 1753 1439 891 721 35 1151 22257 1461 2746 707
NM_006521chrX31081 914 66 21348 141 1484 1282
NM_006526chr2021501 475 --11941 --
NM_006527chr41113 --134 --
NM_006529chr411419 ------
NM_006532chr1941707 1672 1491 177 --61629 582 269 255 201 131 --
NM_006539chr162491 38 --1135 --
NM_006544chr1415469 --31248 901 68 --
NM_006546chr1796015 4862 4488 4093 2666 1372 1134 1029 373 65550 4728 4286 2026 999 285 25509 4733 35613 5279 179
NM_006548chr341457 1440 221 42 ------
NM_006549chr1252511 2304 2271 1910 111 11819 ----
NM_006557chr921155 22 ----1681
NM_006558chr8143 1317 ----
NM_006560chr111450 ----1400
NM_006561chr1085703 4974 4628 4376 2323 2301 2016 2005 12204 25044 2249 25163 2192
NM_006562chr101232 ------
NM_006565chr162216 53 11074 1926 --
NM_006589chr11430 --166 --
NM_006591chr11--1682 ----
NM_006599chr1646323 6300 6202 5240 27866 6260 25648 2586 --
NM_006609chr2136 21939 463 1977 --
NM_006614chr331365 577 282 --11206 --
NM_006618chr121366 105 --11034 --
NM_006621chr151778 595 498 248 26 ------
NM_006622chr52514 365 ------
NM_006624chr101110 11550 ----
NM_006625chr11148 ------
NM_006625chr11148 ------
NM_006625chr11148 ------
NM_006626chr9----22600 955 --
NM_006629chr1832012 497 329 1409 ----
NM_006646chr135956 899 829 705 552 12806 22633 1197 12696
NM_006650chr5133599 3570 3454 3402 3273 784 735 620 575 412 255 151 21 43501 2993 954 918 43869 2530 599 369 33654 3492 2568
NM_006651chr481492 1350 1245 950 515 189 67 32 2227 117 3307 92 22 --
NM_006653chr61153 --147 --
NM_006654chr1221284 356 --1551 --
NM_006662chr161101 --1293 --
NM_006667chrX157 1743 ----
NM_006690chr2092342 2291 2173 2125 782 424 301 219 74 12269 --1346
NM_006695chr17--1258 ----
NM_006698chr2031372 1262 542 --2420 95 --
NM_006700chr123817 735 215 --1259 1703
NM_006709chr6278 44 ------
NM_006720chr1064305 2044 1442 1142 608 561 2925 792 11793 14042
NM_006722chr31133 13064 --12888
NM_006726chr411130 ------
NM_006734chr631226 1048 462 ------
NM_006749chr82989 120 ------
NM_006754chr7----1812 --
NM_006759chr2--1281 ----
NM_006762chr151286 926 260 231 76 11155 21163 1025 122
NM_006764chr31446 --1194 --
NM_006766chr842116 1807 839 534 12438 42100 1030 947 388 --
NM_006769chr1------1115
NM_006772chr641668 1552 1230 1185 ----31713 1319 1085
NM_006775chr61571 --11207 --
NM_006777chrX1228 ------
NM_006791chr151164 ------
NM_006795chr1141456 1212 1176 1145 171 31275 1082 279 --
NM_006803chr8179 --197 --
NM_006805chr531442 1274 55 21331 80 --1212
NM_006807chr172354 145 ------
NM_006809chr203602 268 114 ------
NM_006814chr203200 177 139 --2259 238 12454
NM_006819chr11------1344
NM_006823chr831111 328 291 --11143 --
NM_006825chr122710 683 --2902 225 --
NM_006826chr2--1945 ----
NM_006827chr1412553 --32781 2737 2602 --
NM_006832chr141998 ------
NM_006833chr71366 --1110 --
NM_006836chr122494 249 ------
NM_006839chr2183 ------
NM_006851chr1252281 2077 1832 902 738 ------
NM_006852chr1742777 1152 929 219 12653 1193 --
NM_006853chr19123 --1269 1258
NM_006856chr12--1211 21101 202 --
NM_006861chr1291879 1865 1411 1296 457 393 357 192 49 21593 712 2563 512 21910 1653
NM_006870chr201600 ----1156
NM_006873chr233503 876 28 --13031 --
NM_006874chr41270 ------
NM_006876chr112596 211 --134 --
NM_006885chr1623947 408 1235 1968 --
NM_006888chr1433540 2474 982 21010 530 ----
NM_006892chr202365 226 ------
NM_006892chr202365 226 ------
NM_006896chr741143 716 386 281 --2180 139 21109 360
NM_006897chr121472 --1631 --
NM_006898chr22750 584 ------
NM_006902chr132394 459 59 --1744 --
NM_006904chr81926 --1907 --
NM_006906chr116726 619 235 135 53 41 --1116 --
NM_006908chr71565 1240 1472 --
NM_006920chr2145 --1705 --
NM_006924chr1733896 2802 1644 --12907 --
NM_006927chr16102024 1848 1459 868 795 753 688 99 56 29 --2471 382 1544
NM_006931chr1221452 444 --11549 --
NM_006940chr1211548 146 --1161
NM_006941chr2251131 1110 828 775 48 1199 31057 800 36 1844
NM_006943chr20123138 2892 2657 2145 1050 825 755 388 218 186 110 71 1659 1262 12371
NM_006946chr112611 484 --1175 --
NM_006947chr4--1391 ----
NM_006950chrX2590 368 ------
NM_006981chr912666 12479 1117 --
NM_006988chr2121032 247 ------
NM_006990chr1162497 2489 2418 2398 2041 1970 1952 1716 1705 1637 1590 1540 859 735 592 356 11924 ----
NM_006991chr32393 227 --1909 --
NM_007008chr21365 ------
NM_007011chr15156654 6364 5633 5467 4570 4481 4220 2478 2313 2303 1977 1239 828 788 159 1174 74644 2249 1871 1802 632 462 33 12217
NM_007013chr8--1309 ----
NM_007014chr1681462 1448 1351 1108 468 210 94 75 21205 229 41521 1379 1233 83 --
NM_007017chr5----1178 --
NM_007019chr202150 139 ------
NM_007023chr22337 39 ------
NM_007024chr33226 208 42 --1512 1507
NM_007026chr17127 1460 ----
NM_007030chr5185150 4485 4262 3203 1625 1609 1562 1437 1359 1329 1138 1047 987 950 886 876 631 387 44249 1550 442 209 44312 4283 1789 1510 23441 3260
NM_007032chr2272270 2227 1981 1814 1094 1039 731 22303 624 32541 2420 631 1959
NM_007039chr1431985 1743 1478 ------
NM_007042chr331907 970 400 11061 1467 --
NM_007043chr1222027 363 ------
NM_007050chr20157541 7135 6195 5626 5175 3120 2829 2802 2729 2164 1367 1033 624 560 53 46711 5897 1866 1843 27774 1680 11817
NM_007051chr1148 ------
NM_007067chr1731321 1226 1008 --11434 --
NM_007078chr1053076 2777 2612 748 121 ------
NM_007081chr223133 66 30 1457 --1806
NM_007084chr13----2557 427 --
NM_007096chr9--1234 ----
NM_007114chr312245 ------
NM_007124chr6--192 1635 --
NM_007125chrY21101 537 ------
NM_007126chr92373 101 ------
NM_007144chr1751209 946 397 94 36 ------
NM_007146chr1752728 2210 2177 813 581 1772 ----
NM_007153chr1964279 3088 1489 442 368 30 177 23035 1604 --
NM_007158chr121081 211 ------
NM_007159chr31639 ------
NM_007162chr64456 376 166 136 --2235 200 --
NM_007166chr112451 311 ------
NM_007170chr13219 74 59 ------
NM_007174chr1252215 1990 1779 812 738 --21710 551 --
NM_007175chr852652 1322 1151 562 377 23370 2393 ----
NM_007178chr12167 1132 ----
NM_007181chr192166 67 ------
NM_007189chr771512 1354 1212 439 401 326 311 132 2255 126 --
NM_007191chr121659 ------
NM_007192chr14--2196 26 1892 --
NM_007195chr1832811 2654 1234 11462 32365 1283 398 --
NM_007197chr124397 307 240 223 --2720 280 --
NM_007213chrX5569 219 106 73 52 --1187 3551 256 159
NM_007214chr6------1495
NM_007216chr112940 253 ------
NM_007217chr3----195 --
NM_007219chr20--2696 299 ----
NM_007221chr13382 278 110 1158 1315 --
NM_007222chr82579 349 ------
NM_007243chr63603 463 25 1439 --1159
NM_007245chr163826 587 186 --3604 336 163 --
NM_007249chr1378855 8720 7159 3178 2914 2885 2732 26904 2745 1557 11520
NM_007270chr751489 1332 1164 575 512 1536 ----
NM_007271chr61573 ----1553
NM_007282chr32795 226 ------
NM_007286chr572093 1964 1867 1817 844 673 168 1588 --196
NM_007292chr1731965 1659 1247 23436 1876 35053 4422 3627 --
NM_007294chr1741283 138 96 80 ----1308
NM_007295chr1741283 138 96 80 ----1308
NM_007296chr1741283 138 96 80 ----1308
NM_007297chr1741283 138 96 80 ----1308
NM_007298chr1741283 138 96 80 ----1308
NM_007299chr1741283 138 96 80 ----1308
NM_007300chr1741283 138 96 80 ----1308
NM_007302chr1741283 138 96 80 ----1308
NM_007303chr1741283 138 96 80 ----1308
NM_007304chr1741283 138 96 80 ----1308
NM_007305chr1741283 138 96 80 ----1308
NM_007322chr19----1425 --
NM_007327chr991124 1064 938 912 739 349 321 86 69 1747 3475 188 125 --
NM_007350chr1234456 3803 3656 23672 3129 ----
NM_007353chr792247 2034 1912 1850 1179 668 624 611 523 --33029 734 39 1533
NM_007358chr1--163 ----
NM_007365chr161640 1631 1592 1495 244 198 11700 31677 1457 96 11716
NM_007371chr93671 638 582 ----1563
NM_007373chr1011841 ------
NM_009588chr61205 ------
NM_012064chr121853 1898 165 --
NM_012081chr523334 2358 ------
NM_012082chr83682 156 59 ------
NM_012083chr102321 95 --11106 --
NM_012090chr11967 --11072 --
NM_012095chr1053249 3083 2926 2661 2281 ------
NM_012096chr343212 2631 673 441 --23250 3035 --
NM_012097chr231936 1875 1512 ------
NM_012098chr921115 330 1971 1215 11327
NM_012099chr191476 --41152 1132 805 219 --
NM_012102chr122075 558 --1218 --
NM_012104chr1152446 1404 1239 754 668 1946 22830 288 11371
NM_012104chr1152446 1404 1239 754 668 1946 22830 288 11371
NM_012120chr61872 ----1906
NM_012124chr112780 267 ------
NM_012134chr111559 --21727 1236 21741 368
NM_012137chr122867 418 --11092 --
NM_012141chr1323801 3699 ------
NM_012164chr9126893 6782 6341 6293 5923 5792 4802 4655 2096 1362 694 685 36180 5660 2156 25936 2324 26371 1174
NM_012189chr181462 ------
NM_012193chr1145079 2173 1998 1427 14496 34176 4044 1513 25221 3784
NM_012199chr1104569 4354 4301 4143 3609 3475 3099 1474 1045 364 150 1692 12872
NM_012214chr2105207 4338 4315 4254 4227 2509 2276 1510 1122 231 ------
NM_012215chr10--11450 184 --
NM_012229chr1021244 1076 ------
NM_012233chr21981 1463 1336 --
NM_012234chr321239 1055 1846 22605 595 --
NM_012238chr1011628 11112 ----
NM_012244chr1431600 1473 359 1218 51306 713 688 622 189 --
NM_012247chr1011020 ------
NM_012248chr161144 1632 ----
NM_012249chr213270 --1355 --
NM_012250chr112449 41 ----11348
NM_012259chr61203 ------
NM_012262chr124231 3853 --13902 169
NM_012264chr22111600 1330 1312 796 746 739 664 625 354 346 213 2601 315 21684 836 169
NM_012264chr22111600 1330 1312 796 746 739 664 625 354 346 213 2601 315 21684 836 169
NM_012272chr121323 ------
NM_012286chrX2441 170 ------
NM_012287chr364391 1529 1486 1475 1303 660 13593 21352 1314 --
NM_012288chr6145331 4976 4853 4753 4052 3754 2165 1607 1444 1235 735 701 424 67 34651 4124 1650 54624 4365 2211 2136 984 21058 875
NM_012290chr211678 ------
NM_012294chr763460 2819 2778 2641 1313 287 --13273 --
NM_012297chr4196 1740 ----
NM_012300chr52821 142 --11639 --
NM_012301chr721529 206 31647 1456 143 ----
NM_012304chr572406 2097 694 612 601 311 101 31720 1605 344 ----
NM_012306chr12143507 3429 3405 3032 2283 1147 1139 1102 1005 964 706 353 137 109 33149 2332 361 42587 1309 1225 148 33449 982 949
NM_012307chr1821046 124 ------
NM_012309chr11134136 3542 3351 1760 1636 1566 1408 1384 1122 450 427 410 266 1841 24104 1360 --
NM_012311chr10--1600 ----
NM_012316chr165487 5176 5012 4697 3887 1359 35326 4190 3661 24486 61 12069
NM_012325chr2021281 1104 --11349 --
NM_012330chr1031670 1252 330 ------
NM_012334chr554143 3076 3042 872 526 24236 3405 43090 1711 1594 1556 13054
NM_012343chr5------1275
NM_012382chr544208 3449 2789 1302 ------
NM_012384chr2092119 1721 1700 922 858 817 809 410 21 12091 31821 1708 875 --
NM_012396chr12254 170 --1219 --
NM_012398chr19111983 1928 1891 1112 897 436 343 205 185 175 160 32893 446 35 42618 2611 2014 587 12696
NM_012399chr2231796 1504 1373 1538 ----
NM_012402chr1131390 1264 363 21300 481 --154
NM_012405chr133735 3300 47 31090 718 173 22762 767 --
NM_012408chr203745 210 136 1737 ----
NM_012428chr152634 142 ------
NM_012446chr5----144 --
NM_012448chr172934 907 --42268 2223 1715 843 --
NM_012461chr141665 --2285 188 --
NM_012471chrX11463 21722 327 1426 --
NM_012473chr222645 295 --3135 73 59 --
NM_012475chr12210 31 151 1227 1188
NM_012479chr721762 685 11788 22654 936 1219
NM_012482chr12665 273 ------
NM_013233chr221276 1146 ------
NM_013246chr111109 --4823 331 153 64 1847
NM_013247chr21553 --1571 --
NM_013253chr11----2550 162 --
NM_013261chr463657 2990 2888 1413 1170 624 ----13765
NM_013262chr6--1449 ----
NM_013269chr123720 654 542 1553 13523 13518
NM_013279chr1151736 1443 940 824 103 31667 775 641 42283 1532 730 661 21796 450
NM_013282chr1941145 492 407 387 ------
NM_013305chr185213 200 187 131 73 ----1882
NM_013309chr1552328 2278 2170 1763 144 ------
NM_013312chr19255 24 ------
NM_013313chr2293407 2621 2214 1181 908 774 611 445 88 --23538 2568 11237
NM_013314chr10--173 ----
NM_013316chr72793 64 --179 --
NM_013335chr2121 --269 28 --
NM_013336chr3101849 1838 1737 1632 1444 1416 1375 1215 730 702 21831 1569 ----
NM_013341chr282742 2654 2611 2401 2216 1117 1109 423 22304 2092 ----
NM_013346chrX166 ------
NM_013353chr1186 ------
NM_013381chr121547 1700 ----
NM_013382chr144717 707 135 23 --32009 1618 195 --
NM_013390chr941230 532 475 345 --11451 --
NM_013392chr22288 101 --160 --
NM_013417chr9----132 --
NM_013423chrX4201 51 37 21 ------
NM_013427chrX4201 51 37 21 ------
NM_013433chr1941459 1372 287 256 --11922 1735
NM_013434chr2111995 1868 1634 1614 1535 1504 1461 1325 1244 795 496 41560 1233 689 236 31766 245 74 31511 777 433
NM_013434chr2111995 1868 1634 1614 1535 1504 1461 1325 1244 795 496 41560 1233 689 236 31766 245 74 31511 777 433
NM_013436chr21732 ------
NM_013438chr911582 ------
NM_013444chrX2936 156 ------
NM_013449chr121768 22923 2176 2826 527 22123 1025
NM_013937chr62448 378 --11042 --
NM_013951chr2101965 1613 1531 895 780 618 459 445 283 48 2227 61 42453 976 866 511 1742
NM_013952chr2102042 1690 1608 972 857 695 536 522 360 125 2304 138 32530 943 588 1819
NM_013953chr2102042 1690 1608 972 857 695 536 522 360 125 2304 138 32530 943 588 1819
NM_013958chr81327 ------
NM_013959chr81327 ------
NM_013961chr81327 ------
NM_013962chr81327 ------
NM_013989chr1454797 4335 1604 1491 1261 44449 1925 224 89 --1149
NM_013992chr2102042 1690 1608 972 857 695 536 522 360 125 2304 138 32530 943 588 1819
NM_013995chrX197 ------
NM_013999chr1731263 551 76 --4237 226 140 21 --
NM_014002chr14619 537 474 108 ----1519
NM_014007chr93817 194 142 --1897 --
NM_014014chr23530 449 437 ------
NM_014016chr32345 86 ------
NM_014023chr1031876 1091 363 --22211 1145 --
NM_014028chr632662 2593 2160 ------
NM_014030chr1751117 1078 984 349 167 --2466 289 1390
NM_014045chr14----2400 82 --
NM_014048chr1675002 3913 3540 3465 1654 1503 817 23674 1844 --24725 401
NM_014071chr202181 131 ------
NM_014079chr35811 747 185 112 21 1214 ----
NM_014106chr1522134 410 1307 1687 --
NM_014112chr854030 3859 3673 1221 855 24717 1301 1639 13758
NM_014141chr754963 1455 582 417 362 24571 3707 24601 3940 14134
NM_014154chr3----1474 --
NM_014155chr1166709 6622 6156 5646 2206 422 35474 5417 2724 26911 1365 --
NM_014157chr16144024 3342 3288 3010 2683 1454 1409 1254 835 826 442 314 180 174 --157 23235 348
NM_014181chr272766 2671 2275 2151 1935 1855 1030 32638 2435 2011 ----
NM_014190chr481440 1290 1281 502 461 359 281 159 3681 567 149 3493 198 175 2534 187
NM_014191chr122738 721 --1757 --
NM_014203chr191290 --146 --
NM_014217chr131203 737 449 ------
NM_014231chr1251891 1361 828 440 108 1277 11678 21811 707
NM_014232chr1731479 339 310 2546 304 31454 1251 88 --
NM_014232chr1731479 339 310 2546 304 31454 1251 88 --
NM_014233chr1741790 373 264 45 --1207 1193
NM_014240chr383760 3597 3327 3085 1659 1538 383 71 --33376 3338 2585 --
NM_014243chr41107 ------
NM_014246chr2252178 1641 859 410 401 1697 3750 354 118 --
NM_014250chr2231642 1543 668 ----11925
NM_014253chrX----1443 --
NM_014263chr1031066 574 248 --11309 --
NM_014272chr15165 ------
NM_014275chr53790 704 589 --5816 615 214 95 36 --
NM_014288chr11111 ------
NM_014289chrX51057 936 488 424 220 ------
NM_014292chr2271607 1489 1388 1182 684 380 233 2463 258 61675 1401 666 602 403 87 11282
NM_014293chr22143986 3736 3679 3592 3431 3168 2720 1506 1309 1022 803 537 77 23 11582 53718 3698 3305 1290 990 43215 821 666 632
NM_014299chr1971755 1665 1381 459 261 183 130 --21944 1544 --
NM_014309chr2295410 4875 4661 4057 3891 3552 2009 1127 644 --24981 24 --
NM_014316chr1682013 1931 1883 1834 1640 415 405 194 1386 1773 --
NM_014319chr1211313 21483 355 ----
NM_014323chr22------1275
NM_014325chr1211539 ------
NM_014333chr1122077 2064 12390 ----
NM_014342chr111961 138 --11280
NM_014360chr142762 192 1612 --2223 112
NM_014368chr971983 1896 1686 1592 1471 1330 260 21861 1825 11725 --
NM_014381chr14102985 2972 2952 2582 2239 2052 1266 1166 104 89 ----12616
NM_014382chr31509 ----1165
NM_014393chr811983 142 ----
NM_014400chr192475 354 --1104 --
NM_014405chr1752135 1885 1682 1511 582 1273 51867 1810 1529 115 31 22036 1631
NM_014409chr12100 46 --2399 156 --
NM_014417chr194856 761 754 48 --1121 1162
NM_014418chr1441864 1450 1298 651 --41968 670 470 410 --
NM_014423chr554970 4583 4472 4302 3754 ------
NM_014445chr31518 ------
NM_014454chr61847 175 1913 --
NM_014469chr111221 ------
NM_014470chr122604 551 1627 --1330
NM_014489chr113553 349 32 2253 227 ----
NM_014491chr71888 1976 1151 1128
NM_014507chr226838 821 753 404 119 80 --11216 --
NM_014517chr32305 231 ------
NM_014520chr172465 170 --127 --
NM_014554chr1252141 689 661 546 45 --2309 92 1300
NM_014563chrX22020 1447 --31404 700 369 --
NM_014567chr161108 --152 --
NM_014569chr731307 1034 139 --11243 --
NM_014574chr14--1420 ----
NM_014591chr1041276 1265 449 222 ------
NM_014592chr5125 ------
NM_014601chr1991393 1377 1295 1284 1272 1187 669 635 450 --51463 646 477 457 321 2220 43
NM_014603chr1751617 224 211 191 166 21597 601 61532 1246 632 281 272 22 --
NM_014615chr1632711 2309 778 --1335 --
NM_014620chr122608 182 ------
NM_014630chr1553906 3456 1079 414 200 1947 43449 2659 841 471 1166
NM_014634chr2293303 3280 3195 2733 2688 2549 1373 501 157 33600 2987 65 53395 3090 2639 1442 260 53119 3113 2678 2394 432
NM_014636chr963132 2868 1195 609 302 73 23024 1113 44231 3420 777 189 23838 924
NM_014640chr23275 65 22 ------
NM_014646chr1893100 2889 2217 2031 1099 1061 673 183 91 11167 32828 2800 189 1600
NM_014654chr1372 58 27 165 152 --
NM_014657chr20--1275 1280 --
NM_014659chr153396 226 106 ------
NM_014660chr72799 21 ------
NM_014661chr10123845 3317 2979 2751 2687 2617 2570 1270 1233 1121 1007 255 33484 2711 2598 62380 902 820 465 202 49 --
NM_014665chr8173524 2792 2764 2560 2523 2378 2329 2291 1231 1159 1042 997 694 645 437 223 150 --42738 2493 1048 673 33325 3099 2908
NM_014667chr342276 1739 1673 929 ------
NM_014670chr221105 466 ------
NM_014676chr121380 1175 --11051 --
NM_014677chr83525 371 308 1556 1495 --
NM_014682chr81673 ------
NM_014686chr1942562 1691 328 204 11602 197 1162
NM_014690chr762607 2403 2156 810 293 129 1463 33045 1133 722 11157
NM_014693chr34557 206 116 50 --1526 --
NM_014701chr15--1640 ----
NM_014702chr62693 530 142 --1844
NM_014705chr712101 11830 1104 --
NM_014709chr2132 ------
NM_014712chr163439 74 57 2152 132 1157 --
NM_014715chr111238 --131 --
NM_014718chr125726 707 656 577 123 --3600 594 184 --
NM_014719chr731007 838 249 ------
NM_014726chr1771378 1165 860 531 510 382 176 11232 2904 876 --
NM_014727chr19183 ------
NM_014730chr12115026 4167 3960 3713 3442 2054 1401 1027 983 232 201 11129 34909 1923 167 --
NM_014730chr12115026 4167 3960 3713 3442 2054 1401 1027 983 232 201 11129 34909 1923 167 --
NM_014731chr2061827 1427 1420 339 190 54 1169 41531 1439 1324 571 --
NM_014733chr521963 1458 ------
NM_014735chrX32106 1375 413 ------
NM_014736chr152986 689 1895 ----
NM_014742chr201469 --31387 583 548 21490 515
NM_014747chr1174210 3951 3739 3682 3626 3540 3521 1954 1928 1770 1473 1193 1158 898 812 635 585 21633 55 35027 3705 1520 --
NM_014748chr21397 ------
NM_014751chr852175 1721 1679 1381 658 ----1810
NM_014752chr1121518 113 ------
NM_014755chr273648 3489 3437 3228 3201 2725 1369 23551 2838 11199 --
NM_014758chr1162002 1964 1785 1736 609 447 ----21644 861
NM_014759chr851649 1062 357 193 60 1436 1221 11259
NM_014761chr1611137 --1400 --
NM_014762chr172314 2210 1988 544 260 165 129 1594 22033 1591 1774
NM_014765chr121704 69 ------
NM_014767chr10153640 3529 3337 3188 3092 3077 2499 2480 2455 1359 1256 916 662 411 288 --73546 3195 2697 2656 2560 1339 417 33264 1325 624
NM_014770chr1231089 461 209 --41166 1142 988 146 11011
NM_014771chr162685 215 185 21011 117 1841
NM_014774chr142641 1154 264 82 22451 832 12545 --
NM_014788chr9102757 2485 2256 1992 993 723 552 418 330 301 --31225 496 25 12060
NM_014797chr652655 2514 2442 1150 50 11225 1529 --
NM_014798chr1781625 1613 1437 1311 725 635 172 77 1757 ----
NM_014800chr74403 304 239 145 --2768 162 1353
NM_014803chr102393 372 ------
NM_014806chr92386 65 --1509 --
NM_014807chr116560 540 323 118 99 37 1310 ----
NM_014810chr132553 1407 172 --13454 --
NM_014819chr522462 452 ------
NM_014824chr1121960 515 --2330 264 --
NM_014826chr163916 3736 2937 1271 585 177 --33802 3456 2706 --
NM_014827chr131469 614 546 ------
NM_014829chr52697 201 --11718 12144
NM_014830chr1292927 2665 1390 1237 1118 1000 902 704 30 11256 41403 512 496 310 3563 367 192
NM_014832chr131721 ------
NM_014836chr1011841 ----11371
NM_014840chr1283331 2483 2172 2116 2094 815 799 145 --12588 --
NM_014841chr611173 ------
NM_014847chr13356 123 51 ----1366
NM_014849chr131199 826 96 41165 841 817 270 21103 520 --
NM_014850chr3104392 4161 3898 1961 1935 1855 1442 1257 165 50 31664 936 235 21863 1669 1244
NM_014853chr1761344 1316 1307 1280 1102 309 2342 287 21322 1288 3471 446 222
NM_014858chr1136 --21087 126 3949 930 202
NM_014870chr1134613 4548 1538 1528 1437 900 846 781 653 613 518 496 189 154 43845 3268 1519 1491 --
NM_014872chr912034 --11924 12186
NM_014873chr143960 1270 906 633 --11319 --
NM_014876chr2231982 1547 42 12117 134 --
NM_014877chr1766828 6773 6431 5831 5365 1698 26964 1665 36999 6021 2077 16849
NM_014883chr462382 2278 1584 914 83 70 1499 3959 581 113 --
NM_014890chr3123 ------
NM_014891chr781619 1552 1538 1489 1322 499 281 117 --2402 100 1589
NM_014893chrY1576 ------
NM_014897chr1713264 --22713 2580 --
NM_014901chr571462 1442 691 630 170 157 144 3478 353 188 11896 1603
NM_014902chr2061329 1318 1261 387 376 297 --51550 1172 1106 525 303 --
NM_014903chr1222135 518 42328 2010 936 240 ----
NM_014904chr1023534 1353 ------
NM_014905chr211837 --21521 682 --
NM_014906chr1721414 1391 --22912 1328 --
NM_014909chr14153590 3158 2606 2577 1109 1007 939 861 763 631 546 417 176 136 67 33739 2645 26 63969 3355 3262 2965 2937 142 1741
NM_014912chr1022850 1245 ------
NM_014914chr23500 269 86 --148 --
NM_014921chr19152630 2602 2489 2396 2016 1906 1009 999 770 736 730 610 405 301 222 --42958 1226 1084 144 --
NM_014923chr1311802 11951 ----
NM_014926chr31784 ------
NM_014931chr193565 485 86 --2661 633 1603
NM_014935chr1123770 3491 3198 3136 3002 2637 2605 1465 1421 1118 455 107 2313 45 22894 217 31358 964 502
NM_014938chr1272007 922 761 393 269 191 125 2959 728 41849 522 98 81 --
NM_014941chr22----122 --
NM_014944chr141129 1056 315 270 ----2201 67
NM_014947chr142594 2182 860 228 --32096 1165 1030 --
NM_014948chr20102346 2337 2082 1955 1789 1551 859 471 315 303 42176 2000 1694 95 1457 1271
NM_014949chr11316 1336 ----
NM_014952chr1551721 489 456 382 146 --11363 11768
NM_014961chr431592 1381 350 11735 ----
NM_014964chr1772087 983 956 400 304 193 186 12171 22214 1744 52379 1881 381 153 119
NM_014974chr1031455 1401 1385 --11534 --
NM_014977chr142424 198 1417 1457 143
NM_014978chr101116 --21390 242 --
NM_014982chr1434767 3634 658 --1854 13550
NM_014988chr412519 12158 11064 --
NM_014991chr42815 617 13022 1913 --
NM_014992chr14----143 --
NM_014994chr1582281 1918 1668 1525 729 361 288 131 --41905 772 222 57 --
NM_014997chr752620 2178 2013 922 624 --22130 1854 11975
NM_014999chr1211575 1315 1351 --
NM_015001chr11212 ------
NM_015002chr1242177 1669 1654 86 ------
NM_015008chr362445 2316 2247 673 649 263 22468 1371 ----
NM_015011chr1321123 235 ------
NM_015017chr11291 --2340 302 --
NM_015020chr1652648 1057 944 805 582 --3404 223 186 --
NM_015023chr131735 556 457 --81447 1295 1249 1206 1189 1175 212 26 --
NM_015024chr811287 --2981 263 --
NM_015026chr1244595 3622 861 468 13351 ----
NM_015033chr9102271 871 745 322 237 178 160 95 46 21 1909 42133 1209 1074 346 22143 112
NM_015035chr20176074 5518 5352 4671 4601 4242 4122 2445 2236 2155 1845 1700 1456 994 969 937 149 35799 5064 4185 25836 4949 --
NM_015039chr193686 3534 2693 2649 1678 1384 937 255 33 24132 3564 23403 51 1616
NM_015040chr253259 2548 1323 1156 677 ------
NM_015042chr1594216 3816 3668 3293 3256 3237 1109 348 317 23158 939 54072 3319 3279 1023 377 --
NM_015051chr952936 2580 2371 855 181 ------
NM_015052chr711372 ------
NM_015059chr1593927 3651 3277 2925 1513 1155 761 595 125 22970 27 33798 2892 2791 12528
NM_015061chr91875 ------
NM_015063chr1971355 1232 519 361 242 205 182 1431 5529 508 495 488 292 11312
NM_015064chr1293646 3486 2757 2525 2449 1381 1373 1033 698 --42222 1458 1015 51 --
NM_015068chr773868 3312 2942 2893 2492 1417 299 21362 1256 11101 --
NM_015070chr1321484 1196 11344 1521 --
NM_015075chrX5884 626 603 577 271 52040 1609 1552 480 279 82083 2071 2045 2004 1993 1852 377 350 2472 427
NM_015076chr653211 1484 1423 1380 27 --12854 --
NM_015077chr17124086 3894 3413 3129 2873 1820 1304 1116 912 894 708 497 1575 104358 3863 3727 3014 1719 874 826 647 67 23 31584 1272 375
NM_015079chr1572841 2544 2470 2462 800 745 404 12287 43198 2759 395 53 12754
NM_015080chr112821 230 --2265 206 --
NM_015082chr511990 11962 11919 22264 60
NM_015090chr1175728 5279 4689 4680 4215 4130 2463 2389 2082 1922 1739 1438 1403 604 433 259 171 21986 1597 41726 1380 611 196 14365
NM_015091chr141134 ------
NM_015092chr1621766 731 11677 14319 166
NM_015093chr631681 1212 146 11605 11169 --
NM_015094chr22254295 4268 3567 3263 3228 2996 2975 2955 2927 2852 1770 1606 1599 1564 1496 1296 1210 830 796 568 236 208 164 130 121 44026 3463 1402 788 63903 3619 3045 1468 442 243 21727 1663
NM_015100chr141865 1774 1641 798 1592 ----
NM_015102chr1195 ------
NM_015103chr36987 664 431 393 379 329 ------
NM_015107chrX101974 1739 1648 1545 1502 987 956 924 573 469 2777 415 32171 1929 1805 --
NM_015113chr17112368 2353 2062 1768 552 494 445 399 274 159 103 22139 1670 ----
NM_015115chr43970 361 154 ------
NM_015120chr21256 ------
NM_015124chr2272179 2105 2049 1646 910 522 327 --11979 --
NM_015125chr192224 165 ------
NM_015133chr1661266 1204 566 262 139 65 --31210 965 245 1899
NM_015138chr1562594 2426 952 852 355 80 21824 213 21006 195 --
NM_015144chr1623656 1042 33492 847 779 --11479
NM_015150chr34923 271 250 148 ------
NM_015155chr1043200 3150 816 308 --1889 --
NM_015156chr1451360 811 318 296 139 2305 205 13497 --
NM_015162chr15154 167 ----
NM_015163chr1441335 1234 247 155 ------
NM_015171chr162412 333 ----155
NM_015176chr11559 ------
NM_015185chrX62623 2476 2094 1926 967 550 --1597 12511
NM_015191chr1132382 2176 67 --32504 1673 803 --
NM_015193chr8101393 1309 1224 593 424 190 126 98 42 24 11068 51281 1107 1087 522 507 21326 602
NM_015194chr17111846 1825 1598 859 735 658 591 456 123 108 58 21855 409 31402 556 443 --
NM_015199chr342191 2150 2130 2067 ------
NM_015200chr411861 ------
NM_015205chr13204742 4489 4467 4271 4212 4009 3970 3945 3939 3892 3734 3697 3607 3410 3203 1562 1404 894 248 112 14258 74104 3520 1970 1923 1111 836 57 14136
NM_015206chr1533737 3025 2606 ------
NM_015213chr11151 ----1525
NM_015215chr122394 708 --12291 12203
NM_015219chr17111701 981 655 642 630 528 432 394 357 182 149 21678 800 42217 1809 1591 1030 22102 663
NM_015221chr105580 518 66 46 25 2973 386 11384 --
NM_015225chr942714 2288 1994 1977 23161 2331 --1754
NM_015229chr175981 920 476 367 357 1215 3879 283 35 --
NM_015234chr631231 1131 255 ------
NM_015247chr1665314 3583 1620 1544 836 330 --11745 --
NM_015250chr92583 33 --2451 50 --
NM_015252chr21643 ------
NM_015254chr882354 2146 917 623 467 427 93 53 32477 2326 362 5846 527 475 68 42 --
NM_015263chr151906 ------
NM_015265chr212050 12058 --11674
NM_015270chr1272134 1577 1554 1547 385 260 97 2679 624 21893 1585 --
NM_015271chr443859 3085 955 558 11305 22944 572 --
NM_015277chr181283 ------
NM_015278chr653327 1374 989 347 180 ----12888
NM_015282chr242351 660 451 266 --12074 --
NM_015284chr1102023 1947 1786 1567 819 783 508 473 335 166 21403 97 51921 1808 772 282 86 21644 1523
NM_015288chr5103858 2593 2494 1405 818 673 597 387 326 56 11209 12749 23832 3789
NM_015293chr62124 104 ------
NM_015296chr132829 106 ------
NM_015299chr14163590 3451 3425 3249 3197 3141 2972 2717 1403 915 648 425 212 191 74 53 --33915 2827 59 139
NM_015305chr143762 615 508 21706 598 31407 415 204 --
NM_015310chr8167874 7818 7709 7633 7521 7202 7107 6780 6584 3344 3205 3058 1943 1396 1260 774 27035 6618 11328 15711
NM_015313chr1133630 1631 1281 1141 --11248
NM_015315chr5112876 2841 2776 2651 2360 1213 987 677 444 422 186 1497 52749 2201 637 511 347 175
NM_015319chr121170 --3327 311 62 --
NM_015326chr1102654 2524 2477 2277 1868 538 302 232 163 131 --1330 --
NM_015327chr151180 955 536 254 244 --31121 514 269 --
NM_015328chr722237 812 ----1754
NM_015331chr13560 442 28 ------
NM_015335chr1252220 473 383 118 55 1259 1356 --
NM_015336chr1222647 730 ------
NM_015338chr2061842 1273 1216 1197 230 149 --11361 --
NM_015339chr20138 ------
NM_015343chr17155 ------
NM_015344chr82420 103 ------
NM_015346chr1441343 1314 462 434 --11695 --
NM_015347chr1232062 760 644 ------
NM_015349chr632510 1189 114 22323 247 22540 603 --
NM_015356chr8------149
NM_015365chrX84024 3484 3441 3298 2962 2913 1367 575 ----13314
NM_015375chr1134692 4599 4368 4202 4044 3979 3771 1986 1812 1800 943 776 197 34279 1174 542 ----
NM_015378chr152319 2162 1018 964 67 21012 886 52759 2717 2619 2338 1822 --
NM_015381chr2251886 1398 585 357 24 --51900 1557 708 333 275 1821
NM_015382chr142631 54 ------
NM_015385chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_015388chr6273 26 --1232 --
NM_015393chr43740 237 107 12951 12375 --
NM_015396chr331475 1399 953 ----168
NM_015401chr123284 128 71 ----1388
NM_015404chr93579 140 79 1556 252 39 --
NM_015435chr81539 ------
NM_015443chr172514 352 ------
NM_015444chr31199 --1225 --
NM_015455chr553889 3578 1130 641 24 12936 ----
NM_015457chr1141005 972 847 837 153 11074 --
NM_015460chr321834 502 ------
NM_015466chr31215 ------
NM_015477chr152675 154 1102 ----
NM_015481chr1261057 842 797 740 266 71 --1310 --
NM_015483chr72739 279 ------
NM_015484chr11770 1725 ----
NM_015493chr1941525 894 796 159 1872 21999 1605 1183
NM_015497chr151783 ------
NM_015503chr163634 571 49 1214 --1597
NM_015509chr1211425 1398 --1605
NM_015526chr19101423 1405 1357 1231 1002 519 480 238 65 34 41256 1200 1093 147 2907 130 11206
NM_015531chr11----143 --
NM_015534chr12800 151 ------
NM_015535chr253735 3064 1601 326 156 24119 1571 33772 1177 854 13951
NM_015537chr961039 973 915 432 424 416 --1197 1812
NM_015542chr10----2882 166 --
NM_015550chr743581 3077 1347 478 22702 2647 ----
NM_015557chr1143512 3399 3170 2967 2787 2684 2216 798 746 584 566 508 469 176 23498 1379 33069 2851 551 23446 629
NM_015564chr523601 2183 13339 12316 --
NM_015568chr20104198 3872 3285 3140 1327 1169 1107 671 286 60 11460 73989 3314 2688 1443 1292 140 69 12787
NM_015569chr134565 1137 480 ----1253
NM_015570chr721336 201 1110 ----
NM_015571chr632339 2304 521 ------
NM_015576chr342222 2136 867 75 2910 448 ----
NM_015605chr101177 ------
NM_015609chr132834 2582 2530 21145 751 42757 2676 2646 2455 --
NM_015635chr912100 --21621 1402 --
NM_015638chr202508 154 1197 1202 --
NM_015678chr13----1385 --
NM_015686chrX72369 2130 1790 821 353 321 252 22052 588 151 2167 46
NM_015694chr71121 --1106 --
NM_015716chr174635 597 274 41 --1772 --
NM_015719chr195788 776 710 558 331 2267 37 1198 --
NM_015726chr141711 547 258 196 11526 ----
NM_015845chr181561 1280 1678 --
NM_015850chr831532 389 164 --160 1608
NM_015855chr113774 573 181 1166 1274 --
NM_015866chr11453 ------
NM_015872chr151363 1254 726 682 141 --31547 584 126 11677
NM_015879chr18117565 7142 6609 5205 2875 2698 1435 887 714 704 337 --48546 8362 6618 2653 15856
NM_015881chr11----2550 162 --
NM_015891chr621343 611 11868 ----
NM_015898chr1962478 2462 1810 893 521 229 --42450 2284 1536 334 --
NM_015902chr81790 ------
NM_015905chr71153 ------
NM_015906chr134468 4160 3342 ------
NM_015955chr2161 ------
NM_015963chr2121 --175 --
NM_015980chr521170 1146 168 --11265
NM_015981chr542652 2459 517 274 --11020 22193 289
NM_015982chr173400 289 170 --1353 --
NM_015984chr11123 ------
NM_015986chr1731088 539 54 ------
NM_016009chr144630 3441 1761 1512 23072 268 ----
NM_016016chr172319 313 1131 ----
NM_016020chr6124 ------
NM_016022chr11184 ----167
NM_016026chr143506 271 122 ------
NM_016032chrX51252 1242 1176 1132 1068 11208 1316 --
NM_016037chr11860 --2897 332 --
NM_016062chr16124 --151 --
NM_016072chr1222193 1995 12371 ----
NM_016073chr15------1759
NM_016076chr122612 132 --1555 --
NM_016083chr643045 2906 1559 741 ------
NM_016096chr82704 218 ------
NM_016131chr22411 248 ------
NM_016132chr1513349 1633 1573 --
NM_016138chr1661505 1469 1135 419 381 210 1397 ----
NM_016147chr1171069 921 751 315 293 257 213 --1409 --
NM_016152chr32992 831 ------
NM_016172chr92423 52 --2106 40 --
NM_016185chr17--1339 ----
NM_016201chr34324 306 260 221 1850 42065 903 882 79 1579
NM_016205chr42185 21 1415 ----
NM_016206chr357082 3297 2566 2491 882 12272 27504 2112 --
NM_016210chr341468 428 271 59 --11361 11592
NM_016231chr17--1559 ----
NM_016235chr1621257 438 --11159 --
NM_016250chr14----2183 35 --
NM_016257chr182705 2521 2470 1018 683 497 137 123 1220 1102 2690 473
NM_016260chr276696 2945 1985 1970 1573 742 262 26134 1852 15619 --
NM_016264chr192504 193 ------
NM_016271chr181735 --11724 --
NM_016272chr2281949 1836 1797 1759 1714 1008 959 139 1700 31734 783 563 --
NM_016277chr6------11244
NM_016284chr162666 85 1379 4951 871 149 105 --
NM_016289chr221559 148 21661 575 ----
NM_016290chr51102 ------
NM_016291chr31104 ------
NM_016340chr541169 1084 111 94 ----11196
NM_016364chr102209 49 ------
NM_016376chr17104350 4282 4230 3316 3304 2917 1506 909 399 68 13276 13714 21027 1009
NM_016396chr1522855 2622 --12614 12288
NM_016418chr22113653 3297 3233 1068 1022 1008 954 531 440 404 34 53384 3260 2752 1001 178 53684 3403 2947 1454 212 --
NM_016423chr141180 1364 --1116
NM_016441chr212050 --21668 1529 --
NM_016453chr31226 1566 --132
NM_016456chr11333 130 2765 675 --
NM_016472chr142450 388 ------
NM_016485chr652242 1823 1495 70 51 ----1168
NM_016486chr11159 ------
NM_016490chr23316 114 22 --1248 --
NM_016496chr191459 ------
NM_016505chr12240 95 ------
NM_016506chr112212 63 173 1126 --
NM_016522chr1141405 1322 428 396 --21182 332 1125
NM_016525chr95804 707 672 646 615 --1272 --
NM_016530chr1523993 2967 --11159 2160 78
NM_016531chr443713 2600 601 462 --13948 --
NM_016532chr175918 864 93 87 50 --11036 --
NM_016538chr172430 151 ------
NM_016542chrX1564 290 46 ----
NM_016559chr32535 125 ------
NM_016563chr1551399 423 408 275 80 1591 1320 --
NM_016569chr124538 131 98 33 --1166 11241
NM_016574chr1191050 781 742 719 257 247 236 229 27 --2276 216 162
NM_016577chr374340 4319 3127 3074 886 662 450 21091 513 44093 2961 674 566 13575
NM_016578chr111549 ------
NM_016596chr123284 128 71 ----1388
NM_016603chr5----1619 --
NM_016605chr582602 2567 2312 1725 330 312 243 69 12069 31679 1034 392 2713 218
NM_016607chrX1293 ------
NM_016621chr11134646 4373 4331 4158 3812 3788 3457 3316 3261 3161 3002 1522 1101 1883 104429 4140 4114 3573 3549 3327 3272 2943 1835 315 --
NM_016653chr221089 1073 ------
NM_016655chr151114 ------
NM_016823chr1731306 1189 1139 ------
NM_016824chr101652 1423 ----
NM_016834chr1783742 3101 2847 2596 1526 1503 1114 749 43999 3951 3929 2868 31624 1348 81 22686 1238
NM_016835chr1783742 3101 2847 2596 1526 1503 1114 749 43999 3951 3929 2868 31624 1348 81 22686 1238
NM_016841chr1783742 3101 2847 2596 1526 1503 1114 749 43999 3951 3929 2868 31624 1348 81 22686 1238
NM_016929chr661566 1397 944 242 222 147 23498 118 --13918
NM_016936chr163426 258 227 --22040 794 --
NM_016946chr162563 1366 890 780 121 65 --13224 --
NM_016952chr1143904 3502 1437 312 14055 22768 555 --
NM_016953chr264402 3700 2330 1844 58 39 12241 14091 24443 1661
NM_017413chrX102326 1678 1627 710 308 275 235 221 136 97 41648 1637 718 266 11875 --
NM_017420chr1443252 2669 2438 192 159 ----
NM_017423chr4--1108 ----
NM_017426chr41180 ------
NM_017432chr193360 46 22 --1314 1181
NM_017450chr1781242 1184 1136 1117 1107 923 234 80 --1558 --
NM_017451chr173220 142 101 31063 904 163 2938 168 --
NM_017455chr152634 142 ------
NM_017456chr1751339 750 562 106 43 1685 31424 1308 268 --
NM_017457chr191119 ------
NM_017488chr231457 1430 591 ----1228
NM_017514chrX4213 157 97 36 ----2871 275
NM_017522chr121128 1008 ----142
NM_017525chr111250 --1185 1217
NM_017550chr1971004 817 786 771 334 169 29 --3831 437 416 1204
NM_017551chr1082582 1844 1818 1684 1655 470 359 307 ------
NM_017553chr1541043 930 921 912 --2811 485 1232
NM_017558chr163412 159 66 ------
NM_017575chr1781585 1471 1384 1360 1082 586 296 176 --1579 --
NM_017582chr131349 322 279 --21742 1324 11578
NM_017590chr2262283 2222 1817 1803 690 206 42394 595 484 462 5600 294 196 126 119 --
NM_017592chr19152509 2488 2122 2069 1809 1073 1030 866 723 633 611 481 311 288 168 61943 1060 895 845 823 693 3900 508 89 1989
NM_017594chr912789 12462 2832 521 --
NM_017596chr1244370 4349 4170 3954 3741 2965 2862 1721 1649 1629 1622 1525 1410 1347 1305 991 941 921 771 691 620 567 370 309 74631 3402 3352 1131 1121 948 217 63773 3689 1760 1752 1433 997 22973 405
NM_017602chrX3875 683 151 ----1337
NM_017607chr193392 154 117 ----1402
NM_017610chr151778 ------
NM_017628chr474620 4058 3806 3752 3564 1866 1004 --24960 3300 11185
NM_017629chr131525 268 118 ----148
NM_017633chr623059 2427 13231 22941 92 --
NM_017634chr811217 --11916 --
NM_017635chr1131540 613 237 ------
NM_017637chr958138 8063 6026 2866 30 47952 7857 7140 341 28949 7910 11729
NM_017643chr1742307 2126 971 562 12077 ----
NM_017649chr104991 820 276 57 11283 31122 840 44 --
NM_017658chr14--24256 3225 ----
NM_017664chr13152 ------
NM_017668chr163806 776 209 1223 1549 --
NM_017670chr115827 696 643 619 306 --1812 --
NM_017672chr152413 180 ----11061
NM_017679chr172603 62 --133 1477
NM_017684chr152700 201 --2661 520 --
NM_017693chr1311259 ------
NM_017709chr153647 2812 876 111 68 ------
NM_017719chr311630 ------
NM_017724chr31220 ------
NM_017728chr17113037 2945 2564 2248 2208 1232 1012 780 656 615 204 72428 2420 2333 2101 1209 577 44 42606 2441 2303 1196 150
NM_017736chr1652050 733 531 370 181 13042 1150 12038
NM_017737chr12715 356 ------
NM_017739chr13582 520 57 ------
NM_017740chr162475 76 --21252 184 --
NM_017741chr462319 2153 1119 423 257 75 ------
NM_017742chr182469 183 ----1454
NM_017744chr132453 2027 925 ------
NM_017763chr1741069 1053 918 478 1390 1932 1191
NM_017778chr851228 1071 513 350 238 --11275 --
NM_017780chr81797 ------
NM_017784chr32317 34 ----1847
NM_017789chr23663 617 46 --1199 1784
NM_017798chr20------176
NM_017799chr1411711 ------
NM_017801chr362072 996 937 557 278 60 ------
NM_017810chr16----183 --
NM_017811chr932870 2034 81 12124 22299 127 22179 540
NM_017813chr825544 1523 --12058 15003
NM_017824chr1021987 1787 ------
NM_017827chr192320 132 --121 1120
NM_017845chr4123 ------
NM_017848chrX43517 3209 1826 1333 14509 23570 1725 --
NM_017849chr2103184 3122 3045 2344 1177 942 896 875 673 74 --73134 2621 2393 928 722 53 33 1350
NM_017851chr1561109 1057 1022 510 296 202 --1836 --
NM_017856chrX1408 21324 401 31711 1676 26 1128
NM_017857chr112457 193 2485 202 1100 2180 126
NM_017860chr11364 --1204 --
NM_017866chr81777 ------
NM_017873chr9133083 2961 2928 2671 2075 2067 1933 1027 551 231 180 49 39 5783 594 513 430 334 62725 2661 2322 2280 1198 788 --
NM_017893chr1061231 1138 466 203 167 39 --21445 997 --
NM_017902chr10134769 4659 3965 3790 3560 1245 1151 1125 1044 903 846 775 438 35635 5406 272 34446 1312 983 1411
NM_017907chr11266 23 ----174
NM_017919chr985522 5167 4838 2332 2263 2105 1278 698 15184 25545 1352 --
NM_017921chr1772014 1441 746 423 358 271 38 --32340 105 44 12080
NM_017933chr21526 1294 ----
NM_017938chrX3597 240 208 --1431 --
NM_017944chr1122675 655 32370 2325 351 12272 --
NM_017946chr731442 1276 413 11353 ----
NM_017955chr1461104 896 841 254 136 89 --1247 1160
NM_017964chr21704 ------
NM_017966chr113469 376 213 2433 35 31128 390 23 --
NM_017987chr102139 81 ------
NM_017994chr742641 389 226 67 --12623 --
NM_017999chr14------157
NM_018003chr1531668 1619 273 21696 1640 ----
NM_018008chr31287 ------
NM_018014chr23338 151 103 ----1238
NM_018017chr1021083 228 --12450 --
NM_018026chr1171209 1132 939 582 293 279 182 21183 1036 61362 1345 1232 1193 410 198 148
NM_018027chr1062788 2444 1006 844 510 113 --1382 12052
NM_018032chr163689 607 42 1713 ----
NM_018045chr172732 2413 2348 2053 687 441 252 12036 22642 1013 --
NM_018051chr71322 ------
NM_018070chr13525 501 417 ------
NM_018071chr144827 759 329 84 --2614 317 --
NM_018072chr11179 ------
NM_018078chr41371 ------
NM_018084chr232697 1306 149 12510 ----
NM_018085chr1137437 7034 6965 6654 6352 6184 5757 1844 1678 854 832 544 282 34977 3063 1935 47772 6994 2273 60 --
NM_018086chr221779 77 21938 200 --11579
NM_018092chr161351 --151 --
NM_018095chr112212 63 173 1126 --
NM_018098chr31400 ------
NM_018107chr1441043 974 885 164 173 ----
NM_018110chr1631205 871 495 --31234 1190 397 179
NM_018116chr1----1463 --
NM_018117chr102271 80 ------
NM_018121chr1063095 3070 2887 2222 2176 1081 ------
NM_018126chr4------11500
NM_018131chr101736 ------
NM_018133chr33476 363 91 ------
NM_018137chr13472 132 38 1250 11272 --
NM_018150chr11246 --3774 316 54 139
NM_018156chr152319 2162 1018 964 67 21012 886 52759 2717 2619 2338 1822 --
NM_018157chr1232180 369 285 2502 59 --1552
NM_018171chr122878 731 ------
NM_018172chr1171555 1548 1530 1491 1252 1051 997 --11430 11447
NM_018178chr142091 1822 1687 419 11670 ----
NM_018182chr1742063 2056 1946 384 --2786 285 --
NM_018191chr13--32065 1521 423 11526 --
NM_018193chr151199 1261 ----
NM_018198chr171394 1355 1193 459 402 316 222 11172 --21349 201
NM_018207chr15470 380 332 87 55 11349 2338 134 11662
NM_018208chr131007 921 65 154 21118 1091 1389
NM_018214chr61441 176 1101 --
NM_018223chr123427 202 188 --2785 96 1849
NM_018240chr13836 690 107 --1192 --
NM_018244chr2041200 255 242 24 1134 1954 --
NM_018246chr842748 2681 2338 313 ------
NM_018247chr642875 1909 286 48 ------
NM_018252chr1----1508 --
NM_018254chr131556 211 200 ------
NM_018256chr2194 ------
NM_018275chr73487 459 409 ------
NM_018293chr31966 ------
NM_018299chr82828 181 32193 918 292 ----
NM_018307chr173956 691 371 ------
NM_018315chr41597 ------
NM_018320chr112997 395 31260 1109 496 1783 11115
NM_018323chr4--188 ----
NM_018325chr921314 575 ------
NM_018327chr2021214 1151 ------
NM_018330chr101620 ----1203
NM_018340chr16104956 4056 3998 3837 3827 3188 1781 1616 609 101 13990 23876 3161 --
NM_018351chr1254195 3543 1745 1525 1359 --24185 3420 --
NM_018354chr201189 135 ----
NM_018358chr32258 111 ------
NM_018362chr1123117 2748 --33286 3243 2776 13466
NM_018364chr123346 2658 ------
NM_018371chr81133 ------
NM_018374chr765064 3604 1672 1449 640 242 1312 ----
NM_018375chr1441712 1352 1185 668 --1639 --
NM_018381chr195641 635 599 573 357 ------
NM_018383chr22182 100 --11333 --
NM_018400chr1164536 4253 4237 3586 3196 3076 23551 101 11251 --
NM_018401chr45685 568 489 122 62 --1456 --
NM_018403chr3123412 3066 2767 2610 2497 1062 817 638 620 467 406 382 22830 33 23924 388 2365 39
NM_018416chr123798 75 27 --22507 2222 --
NM_018419chr20----2122 47 --
NM_018425chr1051953 1676 619 579 112 22470 220 31914 1701 293 --
NM_018426chr64443 201 178 95 --3450 212 110 --
NM_018440chr8117107 6392 5727 5616 2302 2018 1890 1612 1294 574 566 16303 1701 --
NM_018448chr1211246 ------
NM_018449chr92320 258 --1687 --
NM_018462chr33774 767 71 164 179 --
NM_018471chr2135 ------
NM_018482chr83786 468 193 1454 11823 1619
NM_018486chrX1432 ------
NM_018509chr1741645 1316 566 32 21526 1379 ----
NM_018527chr13139 ------
NM_018553chr1721384 480 --1268 --
NM_018566chr134737 4596 3597 13192 ----
NM_018571chr21169 1518 ----
NM_018622chr31145 153 ----
NM_018638chr1214753 ----15492
NM_018640chr1222656 2537 12578 12085 --
NM_018644chr11112255 2002 1711 1546 861 703 529 491 300 146 21 22106 1424 31463 716 637 1814
NM_018650chr111644 ------
NM_018655chr12326 65 --159 --
NM_018660chr842627 2453 1176 347 11014 175 --
NM_018667chr16122258 2064 1992 1936 1879 1808 797 743 590 527 209 47 --22250 33 --
NM_018674chr22663 588 1450 2552 505 1575
NM_018685chr7--1245 ----
NM_018695chr51352 12198 ----
NM_018708chr1941343 1229 577 543 ------
NM_018710chr811107 ------
NM_018712chr11177 11057 ----
NM_018715chr192166 1946 1870 1857 1767 1725 870 595 464 --42003 1929 905 890 11533
NM_018717chr452729 878 714 450 286 22611 431 4932 899 755 375 1165
NM_018718chr751717 1486 831 780 734 ------
NM_018719chr711136 --31266 896 334 --
NM_018844chr72198 61 ------
NM_018890chr71565 1240 1472 --
NM_018896chr17155 ------
NM_018898chr532088 1869 102 --1291 --
NM_018899chr532088 1869 102 --1291 --
NM_018900chr532088 1869 102 --1291 --
NM_018901chr532088 1869 102 --1291 --
NM_018902chr532088 1869 102 --1291 --
NM_018903chr532088 1869 102 --1291 --
NM_018904chr532088 1869 102 --1291 --
NM_018905chr532088 1869 102 --1291 --
NM_018906chr532088 1869 102 --1291 --
NM_018907chr532088 1869 102 --1291 --
NM_018908chr532088 1869 102 --1291 --
NM_018909chr532088 1869 102 --1291 --
NM_018910chr532088 1869 102 --1291 --
NM_018911chr532088 1869 102 --1291 --
NM_018912chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018913chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018914chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018915chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018916chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018917chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018918chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018919chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018920chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018921chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018922chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018923chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018924chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018925chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018926chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018927chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018928chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018929chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_018947chr775035 4381 4216 4077 3406 3162 133 23994 943 --1964
NM_018952chr171251 1500 1169 --
NM_018957chr222103 69 --2141 27 --
NM_018958chr1563697 3494 2895 958 780 700 32985 1619 534 ----
NM_018963chr212156 79 ------
NM_018970chr731977 1098 773 ----12432
NM_018976chr1242104 1940 958 29 --1982 --
NM_018979chr1232012 1009 156 12220 ----
NM_018999chr103524 331 100 1582 1568 --
NM_019001chr323513 1826 14793 ----
NM_019004chr72599 301 ------
NM_019022chr182696 146 ------
NM_019024chr22317 42 ------
NM_019027chr412349 ------
NM_019044chr294657 4649 3665 3131 2995 2943 1399 1222 536 44480 3396 3072 968 1594 11581
NM_019046chr102780 216 1691 1229 --
NM_019062chr13278 154 49 --132 --
NM_019091chr21873 ------
NM_019096chr62388 187 ------
NM_019102chr72323 106 1415 ----
NM_019102chr72323 106 1415 ----
NM_019106chr2263111 2496 2463 2302 2277 243 22660 615 22326 2316 23336 2432
NM_019114chr912542 --11936 --
NM_019116chr1693483 3320 3221 2865 2731 1230 1034 871 796 --1915 1910
NM_019555chr351644 1234 1173 686 375 ------
NM_019593chr2043132 2194 2123 584 --22922 2862 --
NM_019594chr961583 1372 414 289 180 46 --21243 106 --
NM_019595chr22238 33 ------
NM_019596chr2182915 2362 1011 721 681 511 274 75 ----12667
NM_019609chr20--122 ----
NM_019610chr11135 ------
NM_019842chr6174 ------
NM_019845chr2154 ------
NM_019848chrX----135 130
NM_019849chr19--1144 ----
NM_019862chr1641231 637 380 88 --1670 1270
NM_019884chr196533 435 128 98 81 71 142 1147 1163
NM_019885chr262354 2194 1105 234 106 24 3972 627 167 2907 240 --
NM_019891chr111165 ------
NM_019898chr1641231 637 380 88 --1670 1270
NM_019899chr1641231 637 380 88 --1670 1270
NM_019900chr1641231 637 380 88 --1670 1270
NM_019903chr101652 1423 ----
NM_020039chr12101349 1257 1245 746 620 491 472 290 284 61 21700 412 21512 702 1544
NM_020066chr11384 --1875 --
NM_020122chr2115724 5475 5022 4947 4782 3968 3745 2289 1396 668 570 25511 1248 --13992
NM_020123chr101295 ------
NM_020127chr171527 1302 1148 503 453 291 152 --21351 210 1377
NM_020141chr11229 --32358 2020 331 --
NM_020142chr123420 401 46 2216 79 --1556
NM_020144chr7----1768 --
NM_020145chr92536 216 --3430 189 59 --
NM_020150chr1021981 546 ----12111
NM_020151chr241590 161 50 39 ----11530
NM_020160chr191107 --127 148
NM_020178chr1751032 861 788 454 407 1110 ----
NM_020179chr11--1333 ----
NM_020182chr2053351 2466 2445 893 735 11213 --13447
NM_020198chr17175 11542 ----
NM_020200chr102443 276 21077 29 ----
NM_020205chr112474 --176 --
NM_020210chr154649 273 171 116 1204 1866 --
NM_020211chr1561081 1028 978 401 296 107 1512 41373 1236 340 240 31210 1202 1114
NM_020239chr151763 431 261 185 54 --1559 --
NM_020248chr1112282 2224 2126 1935 1866 1812 1688 1638 1480 863 829 21823 975 185 --
NM_020310chr17112270 2261 1989 1953 1809 835 803 589 400 250 23 31110 565 421 72178 1927 922 862 855 848 105 2263 76
NM_020318chr1------1357
NM_020338chr10173448 2921 2740 2483 2434 2416 2343 2336 1315 1217 1027 523 478 458 426 291 132 22575 467 31384 1175 148 --
NM_020341chr2011771 --1250 --
NM_020342chr231755 627 565 ------
NM_020354chr101865 179 ----
NM_020357chr321378 410 ------
NM_020360chr17167 1124 2225 83 1442
NM_020374chr1221499 111 ------
NM_020381chr611501 11969 1649 11419
NM_020390chr374340 3794 1866 1724 612 458 248 --31217 1173 1036 --
NM_020403chr1311795 ------
NM_020408chr61681 1711 --1646
NM_020416chr442002 733 599 154 --32584 793 21 2764 36
NM_020420chrY31784 1154 660 --11188 --
NM_020423chr11184 ------
NM_020429chr762814 2243 2085 1113 435 426 --1323 2833 813
NM_020432chr7128 ----31541 1530 693
NM_020433chr2071731 1567 1470 1370 1250 642 107 ------
NM_020438chr921014 884 --3253 180 27 --
NM_020440chr142917 2690 1186 104 12656 22080 689 --
NM_020443chr1175956 5636 5588 5566 5030 4979 4878 4568 4487 2338 2151 1879 1647 764 743 431 61 22427 1187 46306 5987 5852 1164 1105
NM_020452chr141676 1598 1461 616 11785 21480 454 1250
NM_020456chr1311497 --21881 1748 --
NM_020457chr161457 ------
NM_020463chr21544 ------
NM_020466chr674654 4611 4495 4360 3770 550 383 34723 1811 461 ----
NM_020474chr181178 ------
NM_020475chr8122162 2075 1974 1888 1801 1719 1701 1626 1510 1504 990 117 --21632 1542 12193
NM_020476chr8122162 2075 1974 1888 1801 1719 1701 1626 1510 1504 990 117 --21632 1542 12193
NM_020477chr8122162 2075 1974 1888 1801 1719 1701 1626 1510 1504 990 117 --21632 1542 12193
NM_020478chr8122225 2138 2037 1951 1864 1782 1764 1689 1573 1567 180 29 --21695 1605 12256
NM_020480chr8112162 2075 1974 1888 1801 1719 1701 1626 1510 990 117 --21632 1542 12193
NM_020526chr151745 1544 1485 1220 1186 11335 21428 716 31523 1397 96
NM_020530chr221669 --179 1214
NM_020532chr21365 ------
NM_020631chr161435 1216 1184 1049 249 51 --21323 219 1354
NM_020644chr112823 200 1893 ----
NM_020647chr821886 47 --177 1300
NM_020651chr21557 ------
NM_020654chr34444 370 78 52 11322 --1386
NM_020665chrX----1557 --
NM_020689chr2021191 82 11100 21340 30 1259
NM_020690chr51218 ------
NM_020693chr11161 ----150
NM_020699chr1125069 4989 4893 4769 4626 4284 4251 3838 1512 1270 908 312 34745 3589 1000 ----
NM_020702chr981635 1531 1196 531 492 437 303 32 --21550 687 --
NM_020703chr11233 ------
NM_020704chr71482 ----22213 44
NM_020708chr20101764 988 793 427 351 220 201 117 56 40 --11843 11581
NM_020713chr20113052 2552 2500 2416 1260 1034 983 831 801 328 24 22858 2825 42169 864 785 69 22039 1157
NM_020718chr1634897 2002 75 36191 5870 986 24988 1869 12019
NM_020724chr472518 2080 1948 1940 1896 834 273 1670 ----
NM_020727chr211713 12999 135 --
NM_020728chr782994 2914 2862 2691 2512 2059 1249 910 12773 11119 --
NM_020734chr121458 ------
NM_020737chr61232 ------
NM_020738chr21464 --1192 --
NM_020739chr1533744 3174 1141 11039 ----
NM_020740chr171112 ------
NM_020748chr1711816 1366 ----
NM_020749chr811313 --2619 461 --
NM_020750chr641145 457 307 113 --2404 292 --
NM_020753chr177708 230 179 165 143 129 68 --2507 264 --
NM_020755chr6--126 ----
NM_020760chr211629 1460 --1304
NM_020762chr1241063 748 731 324 ------
NM_020766chrX53745 3519 1737 1520 488 13217 1160 --
NM_020770chr151299 1128 895 522 353 --1938 --
NM_020772chr1777147 6902 5261 2296 1831 1263 525 ------
NM_020773chr4102456 2268 1060 981 945 908 879 742 580 196 142 32060 796 54 --
NM_020777chr482327 717 668 553 525 344 300 99 --21939 470 --
NM_020791chr17--11418 178 1561
NM_020792chr33355 31 24 ------
NM_020794chr1----1214 --
NM_020795chr1751807 1713 1313 364 32 --31942 804 542 --
NM_020796chr542305 2246 766 60 ------
NM_020801chr521664 664 ------
NM_020804chr6152382 2273 2119 1957 1945 1921 1865 1657 1625 956 912 856 697 294 243 32284 2243 214 32225 1015 713 52297 2104 1932 1687 723
NM_020806chr141665 1577 ----
NM_020807chr1681305 1165 731 366 112 76 70 27 2441 104 1543 11387
NM_020813chr19102589 1965 1879 991 833 822 813 539 259 150 ------
NM_020814chr21126 --2981 948 --
NM_020818chr141323 ------
NM_020821chr152700 201 --2661 520 --
NM_020824chr101100 ------
NM_020830chr24918 868 699 57 ----272 43
NM_020834chr142737 725 21482 556 1774 --
NM_020836chr144609 599 498 44 --3202 154 84 --
NM_020839chr331244 1192 546 2233 53 ----
NM_020841chr1222713 527 ------
NM_020843chr151401 ------
NM_020845chr1292371 1984 1955 1934 986 916 595 418 340 32350 2248 1729 72386 1865 1846 1685 875 518 56 3701 403 223
NM_020850chr1692749 2736 2670 2627 2618 2484 1096 735 646 23041 43 11228 --
NM_020854chr181230 ------
NM_020856chr1931237 385 68 ------
NM_020872chr31436 ------
NM_020888chr151909 1624 533 496 121 1252 11850 169
NM_020896chr118914 848 723 425 407 178 39 21 --1868 --
NM_020897chr12169 22 --1978 --
NM_020899chr1761739 727 423 328 126 94 1778 3319 271 67 --
NM_020918chr1031014 192 173 --1222 13167
NM_020920chr141316 ------
NM_020922chrX2341 161 --21444 704 --
NM_020927chr1631873 374 283 1304 1384 --
NM_020935chr22550 118 21743 1060 --2732 691
NM_020939chr691357 1322 1315 1259 1191 1163 903 542 428 21006 67 2379 237 --
NM_020946chr941646 1359 381 198 11582 --21617 666
NM_020951chr1931750 1621 441 --11578 --
NM_020952chr9------144
NM_020956chr19154597 4409 4374 3453 3193 2987 1616 1538 1415 1038 821 663 234 131 30 34463 4193 1063 104401 4362 4261 4001 3729 1584 1351 966 900 545 --
NM_020958chr14------136
NM_020962chr1581738 1574 966 869 391 372 311 109 11883 3525 363 356 1445
NM_020964chr1844178 3125 1461 1194 23913 806 23918 3485 --
NM_020967chr2031146 1082 431 11040 129 --
NM_020971chr192307 93 --3796 314 206 --
NM_020972chr43769 165 144 1871 --122
NM_020974chr114550 540 423 402 ------
NM_020977chr4--11837 1125 --
NM_020983chr1272134 1577 1554 1547 385 260 97 2679 624 21893 1585 --
NM_020987chr102923 410 11097 ----
NM_020988chr164525 370 122 106 --1361 --
NM_020993chr1262506 1052 799 594 587 247 12257 42291 2126 699 684 --
NM_021003chr142159 54 --1588 --
NM_021007chr231584 947 46 ----1882
NM_021020chr8113360 3127 2798 2560 2524 2215 2176 907 870 589 196 43142 2826 2819 1148 93056 2631 2257 1264 727 689 675 552 189 1456
NM_021035chr202905 189 --156 --
NM_021038chr323163 1047 ------
NM_021061chr843313 1505 67 60 24296 3561 ----
NM_021064chr641449 1235 416 26 --11272 --
NM_021069chr421623 1509 --1348 --
NM_021078chr174408 190 179 143 182 123 --
NM_021083chrX43444 2918 2279 678 178 12220 --
NM_021088chr241600 1505 1396 397 1283 11637 --
NM_021090chr22174971 4798 4722 4663 4268 4156 3812 3512 3221 3078 3066 1839 1611 1274 1065 1032 1015 14031 34804 1111 556 --
NM_021097chr241971 818 807 226 ----1943
NM_021120chrX72844 2828 2573 1018 777 449 47 23089 2856 22251 1986 22988 2310
NM_021131chr941466 1287 948 71 21331 937 31433 1396 1071 11006
NM_021132chr1021055 137 21286 38 ----
NM_021136chr14157 ------
NM_021149chr1651029 992 494 92 84 --1149 --
NM_021151chr71202 1267 ----
NM_021155chr1982893 2867 2659 2527 2470 2176 2065 1178 --22967 1028 1688
NM_021159chr421431 1082 21105 422 ----
NM_021165chr12705 71 ----1243
NM_021174chr82659 63 --1135 --
NM_021177chr6--158 1230 --
NM_021183chrX22552 250 ------
NM_021189chr13903 309 118 --31024 434 221 --
NM_021192chr22167 59 ----132
NM_021198chr281268 1059 516 449 414 327 319 200 31481 599 194 31232 1199 475 1147
NM_021202chr20112847 2630 2019 1933 1177 1114 706 523 498 312 251 22647 2553 32709 2295 357 --
NM_021213chr1731092 208 132 ------
NM_021216chr1941089 887 285 195 1182 ----
NM_021218chr92998 831 ------
NM_021222chr131249 511 493 ----21113 285
NM_021238chr1211466 --1195 --
NM_021239chr142450 262 ------
NM_021242chrX2390 286 ------
NM_021253chr63949 903 103 ------
NM_021260chr1451316 550 523 469 436 --11341 --
NM_021569chr991124 1064 938 912 739 349 321 86 69 1747 3475 188 125 --
NM_021627chr3186 ------
NM_021629chr393889 3273 1967 1801 1293 610 462 311 58 ------
NM_021633chr12387 38 1533 ----
NM_021638chr4134917 4335 3960 3875 3712 3586 3063 1925 1768 943 876 491 363 --33996 831 333 33419 1378 26
NM_021639chr11599 --1347 --
NM_021648chr652348 2111 1762 825 739 --21786 909 --
NM_021738chr10--125 ----
NM_021783chrX61655 880 414 344 33 24 --32220 762 748 --
NM_021808chr121686 --2692 482 --
NM_021813chr674840 4378 4091 1883 1866 61 24 31777 1291 299 35401 1824 1447 --
NM_021814chr611306 ------
NM_021908chr71827 --1101 --
NM_021911chr545351 280 246 59 11477 1590 24564 816
NM_021912chr1513125 ----11378
NM_021914chr142159 52 ------
NM_021923chr431502 1175 147 11463 11101 11214
NM_021925chr241461 1316 721 22 11440 ----
NM_021940chr6--11181 ----
NM_021943chr661882 1869 1860 1671 1450 114 2671 456 21812 1775 11401
NM_021945chr6133258 2919 2579 2535 2518 2425 1414 1059 841 824 599 413 116 --32657 1355 1177 --
NM_021954chr1361485 1197 411 401 360 275 3653 125 100 1351 --
NM_021956chr62480 290 ------
NM_021959chr63885 862 186 1747 2169 72 1357
NM_021960chr132634 1841 1771 22341 461 ----
NM_021961chr11125839 4688 4568 2871 2758 2397 2364 1128 383 323 267 124 25473 2135 25643 5291 --
NM_021962chr17112269 2214 1989 1833 1672 1021 499 379 328 306 50 22543 2028 41564 617 461 42 42036 2018 195 189
NM_021964chr326467 5521 ----14227
NM_021984chrX41279 1006 415 57 --1302 1434
NM_021987chrX41279 1006 415 57 --1302 1434
NM_021988chr2031581 473 124 --1422 --
NM_021990chrX41279 1006 415 57 --1302 1434
NM_022003chr113889 208 25 --41133 917 446 104 --
NM_022042chr421004 271 41062 902 460 252 61054 822 815 727 347 26 --
NM_022048chr1556070 5437 4219 2489 1127 25544 5220 25242 61 12274
NM_022060chr1451187 1096 1071 900 553 1927 --1989
NM_022062chr115730 591 353 318 251 1502 31897 1222 468 1200
NM_022064chr3174 ------
NM_022080chr201348 --12621 --
NM_022085chr6----21415 36 165
NM_022090chr51516 ------
NM_022091chr611834 ------
NM_022095chr203289 202 42 ------
NM_022107chr62391 54 --2524 22 1461
NM_022117chrX2473 198 ----188
NM_022121chr6------1896
NM_022130chr511063 --1302 --
NM_022166chr16154532 4293 4206 2522 2482 2274 1943 1689 1524 1428 1281 1025 684 665 621 11817 55223 695 567 449 214 23915 1902
NM_022169chr1161314 1296 1184 380 163 44 3476 356 339 3191 57 29 152
NM_022172chr11122 ------
NM_022343chr931273 931 918 --31286 938 834 11202
NM_022351chr823423 3023 ----1501
NM_022361chr62375 87 ------
NM_022368chrX169 ------
NM_022373chr71917 ------
NM_022442chr2031581 473 124 --1422 --
NM_022458chr772768 2720 2427 2069 1946 972 99 ----12872
NM_022459chr1325126 1099 ------
NM_022461chr3--1200 ----
NM_022462chr1972627 1230 1135 616 233 203 105 23578 2968 83304 3123 3027 2577 1257 963 708 152 --
NM_022463chr1751556 1269 1167 516 41 21394 1379 41117 630 381 120 --
NM_022465chr1292460 2214 2139 2069 808 497 401 99 25 --32497 1105 1049 1386
NM_022469chr183394 2712 2313 1153 681 389 372 21 --2439 27 --
NM_022470chr311253 21164 949 ----
NM_022473chr1584069 2950 1785 1523 1363 1241 151 57 --23585 895 --
NM_022477chr2031586 1459 181 --21347 1212 11487
NM_022484chr71509 11278 ----
NM_022485chr3147 --1112 1141
NM_022488chr31158 ------
NM_022491chr1232287 1101 114 ------
NM_022497chr372871 2643 2472 1214 1048 316 84 21125 592 1909 1613
NM_022557chr171216 ------
NM_022574chr791979 1971 1924 1725 1615 640 476 453 72 41497 856 692 566 52023 1732 1366 593 21 --
NM_022640chr171214 ------
NM_022648chr294070 3238 1573 1330 1099 1067 1054 649 265 33807 3132 1381 43817 3485 3038 1173 --
NM_022652chr122442 252 195 ----
NM_022658chr1231113 402 152 --11320 --
NM_022716chr122238 303 --1588 --
NM_022719chr22123874 3698 3616 3178 3167 889 774 674 513 361 227 78 32528 1462 302 1567 11277
NM_022730chr24944 759 431 396 1781 1371 --
NM_022733chr14916 329 308 229 --262 39 --
NM_022735chr121693 336 11505 1216 --
NM_022737chr192400 134 129 3924 345 278 11153
NM_022739chr17----2446 55 --
NM_022744chr1671309 1025 974 924 857 810 378 31247 317 163 11148 --
NM_022745chr152931 2860 1103 1086 341 1156 22075 40 --
NM_022748chr7102505 2352 2255 2177 1809 919 865 142 76 45 --1374 --
NM_022755chr9102292 2073 1910 1831 1814 1747 1645 930 816 252 --1986 --
NM_022756chr131196 510 40 ------
NM_022758chr682909 2852 2580 2523 2452 2385 1275 1086 --11221 22572 1129
NM_022763chr332283 949 82 ------
NM_022780chr211495 11691 --2608 566
NM_022781chr932537 1304 1149 11065 22778 93 --
NM_022784chr151103 ------
NM_022802chr1021280 409 11604 1301 --
NM_022810chrX136 1316 128 --
NM_022821chr11462 1316 --1201
NM_022822chr113333 164 157 --3710 106 61 1193
NM_022823chr2--1469 1497 --
NM_022824chr51687 ------
NM_022831chr121483 1315 ------
NM_022833chr941175 485 288 68 --31354 1253 1045 --
NM_022841chr1522628 2047 ------
NM_022842chr383178 2845 2735 2459 884 309 256 218 22773 2486 12523 12124
NM_022843chr1311130 ------
NM_022845chr1662051 1834 1737 733 575 293 ------
NM_022893chr211056 1109 --181
NM_022897chr55810 743 379 86 32 2709 132 ----
NM_022898chr1414356 14460 24444 1856 --
NM_022912chr212959 ----1175
NM_022917chr96958 917 876 811 295 252 ----1156
NM_022970chr10--11163 --11279
NM_023000chr1431123 1049 209 ------
NM_023001chr1431123 1049 209 ------
NM_023009chr11526 ------
NM_023015chr13305 183 118 1668 3297 211 177 1595
NM_023019chr2----283 40 --
NM_023067chr341214 440 167 91 1301 161 --
NM_023076chr1672185 1203 1038 764 175 152 118 32825 2359 1114 22632 740 --
NM_023079chr1721781 139 140 1321 --
NM_023105chr831532 389 164 --160 1608
NM_023106chr831532 389 164 --160 1608
NM_023110chr831532 389 164 --160 1608
NM_023111chr831532 389 164 --160 1608
NM_023927chr51145 ------
NM_023929chr82914 221 12469 ----
NM_024003chrX4601 548 247 51 1629 ----
NM_024007chr522604 674 174 ----
NM_024015chr1761108 986 905 883 209 100 --1324 --
NM_024016chr174561 335 302 97 --1154 --
NM_024017chr1771250 1142 603 401 325 288 23 11272 31474 1378 510 11186
NM_024019chr4166 ------
NM_024034chr202843 785 21054 331 1103 --
NM_024043chr1681343 1195 1088 304 291 271 235 142 2967 256 2154 24 21331 542
NM_024046chr341173 1039 902 818 --1220 1215
NM_024061chr73218 115 33 --167 --
NM_024072chr1251226 1118 636 326 178 11464 21330 1071 11312
NM_024076chr19112413 2030 1891 696 552 503 352 330 261 229 129 11983 12245 32051 1952 1586
NM_024077chr91237 1573 ----
NM_024082chrX3431 103 96 ------
NM_024085chr24719 318 276 270 2223 104 --2283 172
NM_024086chr17123702 3383 2861 2697 1197 1152 1115 701 293 286 243 87 --23693 1485 --
NM_024090chr431482 1280 724 1645 --1746
NM_024106chr191348 ------
NM_024117chr921070 160 --21081 108 --
NM_024293chr23653 322 269 ------
NM_024294chr682909 2852 2580 2523 2452 2385 1275 1086 --11221 22572 1129
NM_024297chr173556 444 72 159 ----
NM_024306chr169963 773 401 330 264 129 121 45 33 1366 1836 --
NM_024312chr1241233 1188 207 153 ------
NM_024328chr142513 161 --1238 --
NM_024345chr966060 5151 4842 1792 1626 1056 35687 3941 1396 14915 --
NM_024411chr2041248 1087 137 105 --11402 --
NM_024423chr1821513 669 11400 --14197
NM_024494chr13213 170 39 ------
NM_024503chr11301 ----2127 93
NM_024511chr442500 2385 2160 692 --22936 433 --
NM_024522chr1111792 1674 1657 1202 770 515 498 413 283 201 112 --41759 1747 1710 320 --
NM_024525chr11242 1571 ----
NM_024528chrX1137 ------
NM_024541chr1051828 1555 1465 1199 1160 1344 51179 673 635 272 24 --
NM_024545chr21310 ------
NM_024551chr1242240 633 231 132 2719 97 32071 2042 113 12256
NM_024551chr1242240 633 231 132 2719 97 32071 2042 113 12256
NM_024556chr111322 ------
NM_024567chr81163 --1239 --
NM_024581chr6122 ------
NM_024586chr11211 ------
NM_024595chr131227 904 796 ----192
NM_024607chr894020 3380 3356 2952 2912 1667 1638 841 113 23389 1113 --1382
NM_024617chr92867 836 ------
NM_024624chr23651 638 534 ------
NM_024626chr11416 --11545 --
NM_024628chr311097 --2406 273 --
NM_024639chr621174 731 2748 451 1329 --
NM_024659chr2131 ------
NM_024665chr334455 344 105 186 ----
NM_024666chr1551578 1448 1175 520 67 ------
NM_024674chr143089 2682 2430 898 11015 22205 2167 1826
NM_024689chrX41510 1320 1186 233 --1143 --
NM_024698chr1191237 1079 1029 514 355 316 250 168 69 21101 1051 31016 450 103 1365
NM_024701chr1051411 1404 1287 400 123 1421 --1588
NM_024704chr201345 --172 --
NM_024713chr1511191 ------
NM_024721chr812435 --12300 --
NM_024735chr1661874 1855 1188 704 487 132 11633 21200 728 11443
NM_024740chr11103758 3482 3319 3223 2995 2829 1473 1423 507 414 13663 23044 459 --
NM_024742chr1681900 1626 1281 737 628 586 384 132 11909 31515 1359 211 141
NM_024753chr21691 --1514 --
NM_024755chr151327 ------
NM_024759chr83761 194 156 --1802 --
NM_024761chr961817 1601 1495 505 279 192 11826 34265 1831 239 --
NM_024770chr2146391 5762 5639 4852 2377 2166 1997 1718 1484 1363 846 729 593 137 --26281 1533 11497
NM_024780chr1631069 903 449 ------
NM_024785chr22283 257 1219 1499 --
NM_024786chr54827 240 153 98 ------
NM_024804chr12346 23 ------
NM_024807chr651691 1194 713 240 173 21762 45 31599 733 343 1167
NM_024811chr1161556 1536 1225 671 274 177 --1535 --
NM_024817chr15185322 5289 4949 4785 4294 3702 2392 1321 1138 1130 854 765 736 608 598 483 202 92 11814 25246 306 --
NM_024828chr9--1131 ----
NM_024830chr562074 1720 885 453 120 59 1763 41590 802 333 29 --
NM_024834chr1021306 576 ------
NM_024854chr1281594 1513 1472 1082 988 574 552 534 ------
NM_024873chr42953 788 ------
NM_024874chr151257 1088 869 222 52 21040 848 1312 1121
NM_024884chr1474472 815 796 627 414 395 293 1708 31220 1176 483 --
NM_024887chr152102 1565 739 672 130 11710 11355 --
NM_024909chr6--127 1517 --
NM_024911chr11784 --146 --
NM_024915chr882833 2197 2136 1111 1060 885 370 213 3316 155 69 22170 1012 175
NM_024920chr411187 1401 ----
NM_024921chrX21450 676 11369 ----
NM_024922chr1681495 739 732 675 658 567 348 72 21317 60 51442 837 809 321 111 31595 1536 1340
NM_024923chr371297 1288 1171 1058 977 94 42 2995 559 11135 1117
NM_024927chr17140 ------
NM_024930chr522689 1880 --11786 --
NM_024939chr164670 568 424 281 21019 144 2498 237 1150
NM_024944chr2131009 876 120 ------
NM_024946chr1651386 1369 517 497 27 ----21649 1537
NM_024948chr10----1692 --
NM_024949chr484225 4184 3986 3113 1711 1688 1278 793 14347 ----
NM_024969chr2--1309 ----
NM_024971chr9------144
NM_024989chr233116 2246 1345 16853 22295 1470 --
NM_024991chr10103011 2748 1187 740 605 513 418 359 348 259 12644 1433 12359
NM_025054chr814030 ------
NM_025076chr21166 ------
NM_025099chr173350 249 161 --1455 --
NM_025104chr1751780 1614 1460 517 427 --11159 --
NM_025129chr19----181 --
NM_025133chr231040 869 319 ----1976
NM_025134chr1612388 --1369 --
NM_025137chr151123 ------
NM_025138chr131334 ------
NM_025140chr122450 398 --1412 --
NM_025146chr332636 1982 1873 ------
NM_025154chr721227 356 ------
NM_025164chr1151957 1781 1730 1613 1364 11880 1785 --
NM_025165chr152361 26 ------
NM_025179chr144476 4445 3199 1292 31535 1514 95 44390 3007 1813 982 11658
NM_025181chr21237 ------
NM_025182chr91110 ----1946
NM_025187chr1621253 854 --1888 11105
NM_025191chr11914 --11364 --
NM_025208chr1121995 142 22094 1624 ----
NM_025209chr10125 ------
NM_025224chr20151854 1811 1767 1752 1660 1600 825 551 524 432 389 380 313 298 267 --62027 1862 687 654 152 108 11880
NM_025235chr1051863 1698 1427 813 426 ------
NM_025248chr17113020 3006 2778 2752 2353 1307 846 566 356 343 139 12970 32895 2132 2119 --
NM_025251chr87486 428 214 137 130 111 97 11107 41112 439 275 103 --
NM_025256chr6278 44 ------
NM_030576chr17102310 2184 2040 1948 1750 840 496 387 358 283 12603 62530 2459 2015 826 296 246 2662 634
NM_030594chr152987 61 ------
NM_030621chr1443435 2833 2605 440 --1387 --
NM_030625chr1012012 ------
NM_030627chr51975 21456 830 ----
NM_030629chr1631361 1343 1203 --21401 182 --
NM_030634chr132348 878 599 ----1236
NM_030647chr775946 4912 4553 3973 2368 2312 2158 --14413 --
NM_030648chr425180 4724 11510 --1569
NM_030650chr244259 4094 3974 446 ------
NM_030664chr1072441 2379 1826 955 941 192 67 1204 1978 --
NM_030665chr1761174 1136 1107 1087 504 445 11023 51168 1098 318 181 83 --
NM_030674chr1233710 393 49 11129 13767 --
NM_030753chr17----192 --
NM_030758chr226930 494 362 348 96 39 11379 41191 325 203 108 --
NM_030761chr182619 2493 2033 1928 1845 1785 676 666 1650 22483 566 12453
NM_030767chr982742 2715 2635 2436 2117 1150 1010 182 22629 544 52653 2613 2132 221 151 12536
NM_030784chr6172 ------
NM_030795chr8----169 253 44
NM_030798chr73687 643 230 --3601 79 27 1596
NM_030802chr175602 306 286 218 142 --1171 1618
NM_030806chr1199214 8647 8232 7470 7430 7417 7259 7042 6880 6844 6724 6568 5780 5736 1572 1412 1171 837 798 33260 3017 1945 33379 3349 3105 37175 6438 3464
NM_030808chr173729 426 325 --4845 719 166 87 --
NM_030810chr6----21415 36 165
NM_030815chr201184 --1603 1549
NM_030816chr132887 2729 417 12629 ----
NM_030820chr62194 25 --1331 --
NM_030906chr111124 1115 --188
NM_030911chr1331442 1213 64 ------
NM_030912chr10----2771 46 2964 618
NM_030914chr93688 611 128 ----1369
NM_030915chr262181 1785 1651 1535 317 207 1847 ----
NM_030918chr175069 4979 4056 3775 3429 1711 87 34620 4143 943 54493 3897 2081 1120 535 --
NM_030920chr131916 693 289 ------
NM_030922chr153808 748 677 ------
NM_030937chr151380 277 265 254 34 11181 ----
NM_030952chr15979 938 136 105 24 --31018 381 204 --
NM_030957chr192194 78 1616 152 --
NM_030962chr111648 --1129 1198
NM_030964chr573576 3309 3128 2995 1350 628 92 23347 1269 21390 351 --
NM_030980chr12701 533 1475 --290 81
NM_030981chr1141095 969 781 168 ------
NM_031205chr123376 347 34 --1387 --
NM_031216chr182124 72 --11674 --
NM_031231chr203134 73 27 1625 1217 --
NM_031232chr203134 73 27 1625 1217 --
NM_031268chr16125207 4821 4507 4274 3871 3662 1915 1152 1112 623 479 354 43945 2160 1795 855 21447 302 1283
NM_031284chr151129 2875 385 ----
NM_031286chr13340 120 56 --1348 --
NM_031289chr123884 815 124 1283 178 --
NM_031306chr13961 774 277 1852 ----
NM_031309chr892253 1854 891 775 670 517 427 211 99 --52081 1772 449 169 48 11973
NM_031314chr1421981 607 1173 ----
NM_031369chr41127 ------
NM_031370chr41127 ------
NM_031372chr421364 628 ------
NM_031411chr532088 1869 102 --1291 --
NM_031417chr19102790 2232 1029 922 895 607 505 495 138 42 21849 1127 1881 12205
NM_031419chr331603 432 52 ------
NM_031439chr841820 1508 468 209 --41358 252 201 29 1130
NM_031442chrX2472 409 12366 --1666
NM_031445chr272843 2665 2495 1021 731 608 215 --1384 124
NM_031453chr1022266 80 --1810 --
NM_031468chr7147908 7438 6697 6603 5906 4989 3259 2710 2634 2245 1878 1825 1713 33 46716 5593 2970 2872 57492 7223 5646 2843 571 15891
NM_031469chr643789 3666 1342 821 13480 43381 3262 1470 871 11074
NM_031476chr1682651 2481 2440 1961 1095 629 617 491 --12169 --
NM_031477chr163123 101 33 ------
NM_031483chr2082846 2781 2350 2254 825 806 624 402 --13333 --
NM_031492chr111384 --1230 --
NM_031844chr112673 ------
NM_031849chr532088 1869 102 --1291 --
NM_031857chr532088 1869 102 --1291 --
NM_031858chr17180 11009 ----
NM_031860chr532088 1869 102 --1291 --
NM_031862chr17180 11009 ----
NM_031866chr103319 242 199 --1213 --
NM_031886chr1982458 2429 2278 2120 1726 1707 1024 173 22467 2031 ----
NM_031890chr2292869 2523 2338 2005 1911 1891 712 632 41 11096 32591 2077 362 12536
NM_031899chr34639 365 326 64 1389 ----
NM_031922chr62537 83 ------
NM_031934chr171276 --1319 136
NM_031935chr131042 208 60 ------
NM_031938chr11--1654 ----
NM_031940chr861987 1803 777 625 326 42 ----12034
NM_031946chr7--1402 1314 --
NM_031964chr172389 43 --167 132
NM_032012chr974047 3653 3559 1681 1506 125 59 --14685 --
NM_032013chr2031586 1459 181 --21347 1212 11487
NM_032017chr1171903 1822 1809 1732 1315 723 694 667 654 627 603 506 499 456 406 384 135 1419 51990 1752 732 707 468 148
NM_032027chr1131 ------
NM_032028chr53574 170 105 1608 1554 195
NM_032042chr562657 2459 2299 1151 1050 775 --186 --
NM_032050chr22------1275
NM_032052chr224967 920 364 226 --2934 99 --
NM_032088chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_032092chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_032102chr1122102 380 ------
NM_032105chr1197878 7643 7225 7214 7160 6958 6739 6494 6348 5813 5650 5423 2857 2432 1849 1576 1317 1021 201 23184 2343 ----
NM_032108chr194832 168 140 108 1869 1977 1850
NM_032109chr521275 290 1173 ----
NM_032144chr261719 1608 501 334 289 218 ------
NM_032147chr1211017 ------
NM_032153chr322002 1817 --31118 904 404 --
NM_032174chr141463 477 382 73 11091 --1217
NM_032181chr2189 ------
NM_032182chr102427 150 11325 ----
NM_032189chr13184544 4291 4269 4073 4014 3811 3772 3747 3741 3694 3536 3499 3409 3212 1364 1206 696 50 14060 63906 3322 1772 1725 913 638 13938
NM_032195chr211114 ------
NM_032199chr1063025 1503 1274 1255 182 22 ----1123
NM_032208chr243275 3011 2248 1358 11279 12703 --
NM_032214chr2051125 1092 931 272 164 2378 348 21142 61 --
NM_032228chr1122797 201 1248 13222 --
NM_032233chr143805 771 54 --1843 --
NM_032242chr3113268 3041 2943 2190 2059 2023 985 893 878 787 130 32968 2571 1248 42576 906 738 66 22929 1261
NM_032256chr121206 1803 ----
NM_032268chr1683294 3231 2598 2389 2061 866 439 237 --32474 2250 1241 --
NM_032271chr1681523 1374 1329 1278 988 496 234 165 11305 41052 385 199 41 1563
NM_032272chr85471 334 149 117 71 2372 359 1404 --
NM_032281chr1972807 2796 2741 2438 1183 775 500 1129 42928 2826 2370 1169 1109
NM_032288chr332403 914 562 ------
NM_032289chr541602 1306 779 344 2246 93 1487 --
NM_032291chr131719 1522 176 ------
NM_032293chr9----1211 --
NM_032294chr1751870 1434 1166 1152 668 1289 --1113
NM_032316chr382242 2144 2135 2113 938 773 564 181 11732 12057 --
NM_032325chr1121500 42 --31513 1377 787 1452
NM_032348chr13900 362 188 --1597 1346
NM_032353chr173440 425 122 1497 ----
NM_032355chr3124 ------
NM_032364chr122886 641 1694 1225 --
NM_032373chr1085463 5292 5246 4142 3710 2029 833 657 ------
NM_032376chr173713 202 156 1660 ----
NM_032382chr162536 80 ------
NM_032389chr1141148 1013 879 206 --21019 180 --
NM_032403chr581702 1605 1249 1222 1165 641 437 49 21267 1128 1528 --
NM_032408chr72952 303 11233 2930 157 --
NM_032415chr73392 189 149 ------
NM_032431chr115386 290 279 218 116 1340 4240 80 45 26 1184
NM_032432chr491516 1484 1104 1015 452 433 334 296 53 --1149 --
NM_032434chr221520 248 1350 1124 --
NM_032440chr1052967 2232 907 816 386 ----11058
NM_032442chr17------1175
NM_032444chr167854 814 766 753 701 157 132 --3404 241 43 11022
NM_032445chr1542390 2195 2186 2169 --166 1215
NM_032452chr1411203 21265 1052 ----
NM_032457chr442963 645 542 526 ------
NM_032458chrX22133 495 1950 12304 --
NM_032466chr8143 ------
NM_032468chr8143 ------
NM_032508chrX41334 523 417 325 ------
NM_032510chr183982 871 739 131 ----
NM_032512chrX51036 740 174 50 24 21106 927 ----
NM_032538chr6112746 2410 2018 1930 1816 1781 1748 963 798 462 88 12095 72641 2592 2360 515 203 77 45 52026 535 488 284 120
NM_032539chrX1705 ------
NM_032552chr961853 1765 1457 247 126 82 1470 91792 1773 1733 1479 1449 1429 341 324 176 11640
NM_032560chr14----1120 --
NM_032562chr10150 ------
NM_032575chr1681741 1573 1511 1473 762 554 435 229 31728 1689 566 41604 480 171 41 21291 112
NM_032580chr173412 390 53 ------
NM_032581chr761662 1462 610 486 376 105 11714 ----
NM_032595chr1761390 1088 461 425 177 94 --31591 990 222 --
NM_032603chr23787 298 34 1603 ----
NM_032622chr411192 1265 11093 --
NM_032626chr16187 ------
NM_032638chr371298 551 468 144 110 100 63 ----11029
NM_032682chr322872 340 ------
NM_032711chr17154247 3848 3789 3381 3276 3260 3253 3196 3154 3133 715 535 464 454 167 1442 53979 3929 3814 2801 1373 13659
NM_032727chr1041355 245 192 66 ------
NM_032728chr93879 830 26 1625 --1272
NM_032737chr19112545 2510 2068 1933 1890 1862 1038 1031 884 550 343 --52534 2291 901 732 146 1174
NM_032741chr61291 1188 2724 714 --
NM_032765chr521002 918 --1751 --
NM_032781chr116726 619 235 135 53 41 --1116 --
NM_032786chr122529 33 1213 ----
NM_032800chr172610 2519 2507 2430 2082 1689 484 --42488 1706 977 566 1287
NM_032808chr152837 79 --2825 159 --
NM_032809chr961482 1259 1169 1003 360 128 11051 11384 --
NM_032818chr992099 1933 1740 911 888 715 654 264 245 --32251 691 384 --
NM_032828chr1963366 3050 1706 1264 551 416 13788 64415 4116 1752 1313 840 251 --
NM_032832chr63675 425 354 ------
NM_032833chr112221 --21712 184 --
NM_032838chr192186 131 ------
NM_032840chr1281020 987 874 774 312 212 141 100 --2394 198 --
NM_032871chr1181908 1786 1339 712 593 494 212 31 1365 31802 1222 674 --
NM_032873chr1133633 544 100 --11401 1652
NM_032876chr144825 797 672 59 --1565 --
NM_032892chr151137 ------
NM_032906chr43724 232 217 --1172 --
NM_032946chrX3340 93 85 --132 --
NM_032961chr421351 299 ------
NM_032968chrX43283 2614 994 881 ------
NM_032969chrX43283 2614 994 881 ------
NM_032973chrY53278 2613 994 881 763 12807 ----
NM_032983chr773193 2772 2121 2073 1029 1010 352 22702 2086 42847 2496 2257 994 1336
NM_032991chr441304 1298 1014 966 ------
NM_032998chr1----21125 821 --
NM_033018chrX51152 1111 937 872 367 1811 61071 878 832 323 283 65 --
NM_033020chr134468 4160 3342 ------
NM_033027chr331137 795 345 1398 1229 127
NM_033030chr2127 11484 ----
NM_033036chr114315 154 116 92 1354 11077 1374
NM_033044chr11967 --11072 --
NM_033058chr8168 1244 --134
NM_033071chr62124 104 ------
NM_033089chr203949 497 164 11215 ----
NM_033102chr13980 415 338 170 21171 52 11097
NM_033102chr13980 415 338 170 21171 52 11097
NM_033103chr191903 --21088 952 --
NM_033118chr207763 742 663 599 271 243 64 --3841 305 104 --
NM_033119chr164606 327 300 214 2623 335 1356 --
NM_033127chr11116 --175 --
NM_033129chr20101624 1431 1365 1350 766 704 512 414 133 54 --187 31810 741 735
NM_033132chr1322026 498 1127 ----
NM_033135chr1121995 142 22094 1624 ----
NM_033143chr414371 21432 251 1136 --
NM_033181chr643045 2906 1559 741 ------
NM_033201chr1651057 1016 1006 861 61 ------
NM_033219chr9----125 --
NM_033221chr9102563 2291 2062 1798 799 529 358 224 136 107 --21031 302 11866
NM_033224chr756662 6550 5463 5326 5160 36442 6166 5237 26711 5554 --
NM_033225chr821107 935 1883 1573 --
NM_033226chr161164 --2109 96 --
NM_033240chr15171637 1608 1590 1366 1264 1254 1213 686 640 634 606 591 576 561 551 471 122 --31346 490 63 11271
NM_033244chr15181157 1128 1110 886 784 774 487 429 370 252 206 160 154 126 111 96 81 71 1241 1866 1791
NM_033251chr163355 153 146 ------
NM_033255chr13--151 --189
NM_033259chr34852 661 308 96 --3302 295 38 1257
NM_033274chr5113294 3130 3109 3032 2986 2636 1252 863 337 299 103 ----1239
NM_033278chr113330 311 295 ------
NM_033281chr51860 2900 807 ----
NM_033285chr823649 1097 ------
NM_033300chr121128 1008 ----142
NM_033306chr11122 --128 --
NM_033309chr164916 863 427 24 1393 ----
NM_033310chr11182 ------
NM_033315chr17132028 1781 1733 1542 1422 871 830 708 340 275 252 167 119 --51429 679 460 449 185 11683
NM_033317chr19476 70 57 30 --187 --
NM_033319chr12543 379 ------
NM_033326chr1111673 11995 --11543
NM_033331chr962770 2689 2553 2443 270 209 ----11081
NM_033375chr1751482 1330 1217 1016 541 21301 1161 21117 1022 1247
NM_033389chr1764203 3703 3356 1684 1551 492 33404 3346 3024 33770 1378 510 14257
NM_033401chr162501 158 ------
NM_033419chr1741680 359 172 147 21468 1358 51426 1237 1120 318 229 --
NM_033420chr197977 935 490 379 212 185 89 --3239 171 151 21101 260
NM_033421chr203294 235 111 21438 504 2633 227 --
NM_033425chr1143119 2747 802 151 22830 417 ----
NM_033429chr1551122 340 283 231 22 11998 1962 --
NM_033438chr1123 ------
NM_033449chr571810 1755 1749 1547 690 684 628 32153 2137 1505 31823 1510 1422 --
NM_033503chr15113473 3384 3149 3127 2976 2932 2886 2502 1046 857 841 43769 3572 2553 731 53547 3033 2820 1305 609 23134 541
NM_033512chr831187 828 166 ----1775
NM_033542chr204671 303 83 39 --1778 11452
NM_033549chr55922 283 187 141 25 --2815 289 --
NM_033551chr5112876 2841 2776 2651 2360 1213 987 677 444 422 186 1497 52749 2201 637 511 347 175
NM_033624chr1242177 1669 1654 86 ------
NM_033626chrX51453 680 644 507 342 21282 1166 --11671
NM_033631chr1143918 3670 3653 3622 3534 2791 2395 2374 1052 694 482 302 279 47 53482 2848 1433 943 736 1373 13751
NM_033632chr41597 ------
NM_033637chr10103921 3864 3742 3642 3394 3374 1121 567 520 181 --13415 2812 527
NM_033642chrX172 1177 ----
NM_033644chr52821 142 --11639 --
NM_033645chr52821 142 --11639 --
NM_033656chr2175207 5034 4649 4527 4467 4428 2155 21490 1375 15481 --
NM_044472chr11100 ------
NM_048368chr182623 530 1246 3641 190 65 --
NM_052837chr12179 52 ------
NM_052840chr1511408 11498 184 1517
NM_052845chr12123191 3140 3092 2886 2739 2486 2394 2037 405 391 131 118 12366 32928 2913 2823 22447 980
NM_052847chr1983371 3068 2882 2860 2299 881 783 119 13792 23111 930 22423 2351
NM_052854chr111620 --1138 --
NM_052855chr172191 155 ------
NM_052868chr13176 58 45 ----152
NM_052874chr161552 ----1123
NM_052875chr1152166 835 727 668 267 11345 2465 248 --
NM_052880chr2231172 330 49 --31222 998 252 --
NM_052885chr1223982 104 ------
NM_052897chr122640 66 1565 ----
NM_052898chr831633 722 415 ------
NM_052899chr54912 257 189 65 --5881 251 224 149 117 1622
NM_052901chr961776 1574 1364 610 455 50 --21319 370 --
NM_052905chr231437 1397 86 ------
NM_052910chr1381408 1340 771 412 250 231 179 109 --1313 --
NM_052913chr6------1386
NM_052925chr192795 402 --140 --
NM_052927chr511652 ------
NM_052934chr171832 1775 1450 712 530 274 183 22259 1810 1734 11918
NM_052937chr8----1586 --
NM_052938chr12848 411 150 2451 167 --
NM_052970chr203911 785 280 1679 2130 40 1895
NM_053001chr83268 132 115 ----1163
NM_053016chr9127661 7337 7043 6842 6521 5828 5606 5319 5057 4924 3071 34 37571 6753 1086 ----
NM_053023chr113518 251 32 1784 21006 646 --
NM_053024chr311097 --1330 --
NM_053025chr321764 379 ------
NM_053026chr321764 379 ------
NM_053027chr321764 379 ------
NM_053028chr321764 379 ------
NM_053031chr321764 379 ------
NM_053032chr321764 379 ------
NM_053043chr7106061 5682 5555 3961 3912 2514 2349 2339 1892 1859 --41716 1378 760 474 21605 1030
NM_053046chr192418 54 ------
NM_053056chr1142703 1026 943 931 --22320 76 21948 56
NM_053279chr872482 2186 1948 935 770 737 358 1135 12540 1570
NM_054013chr53790 704 589 --5816 615 214 95 36 --
NM_054016chr12738 572 ------
NM_054016chr12738 572 ------
NM_054016chr12738 572 ------
NM_054025chr11112255 2002 1711 1546 861 703 529 491 300 146 21 22106 1424 31463 716 637 1814
NM_057175chr4--11035 ----
NM_058167chr171165 970 925 853 840 392 371 1185 1190 --
NM_058170chr111113 ------
NM_058240chr1411327 1123 ----
NM_058241chr221713 770 ------
NM_058241chr221713 770 ------
NM_058243chr192673 279 ------
NM_078471chr17----31077 331 24 --
NM_078473chr861987 1803 777 625 326 42 ----12034
NM_078483chr5173695 3372 3066 2903 2853 2661 2634 2615 2604 2581 2530 1395 1367 1325 1121 931 542 23453 72 1261 32493 1267 1058
NM_078487chr953153 2444 1332 912 848 13246 ----
NM_079834chr1941661 1402 1114 415 194 41583 1424 575 219 --
NM_080391chr12574 540 ------
NM_080392chr12623 589 ------
NM_080415chr172909 897 1245 2882 838 --
NM_080538chr341058 569 457 84 --11397 --
NM_080539chr341058 569 457 84 --11397 --
NM_080541chr341058 569 457 84 --11397 --
NM_080599chr10----2882 166 --
NM_080604chr67603 522 445 88 81 67 51 ------
NM_080607chr205980 858 768 372 136 2708 172 3798 782 380 --
NM_080616chr203622 248 52 ------
NM_080621chr2091241 1168 1091 1071 1064 977 419 255 76 1229 11020 --
NM_080645chr6--21528 285 --11649
NM_080647chr224375 366 339 156 --3174 139 42 1106
NM_080669chr17134586 4248 3866 3654 3442 3428 3283 1588 1082 726 469 378 82 21707 805 34135 1852 182 34123 1058 394
NM_080670chr52820 667 --3811 318 97 --
NM_080671chr241919 851 556 337 --11637 --
NM_080672chr20185 ------
NM_080676chr2072839 2237 1118 956 892 502 331 22593 102 22072 1261 --
NM_080717chr121621 1249 1471 1974
NM_080732chr192418 54 ------
NM_080738chr141894 1840 1694 1575 2664 363 21746 1504 --
NM_080743chr621871 1015 ------
NM_080744chr76636 581 236 198 145 69 --1445 --
NM_080759chr1312409 ------
NM_080760chr1312409 ------
NM_080764chr2252605 2317 1064 538 409 11286 1551 --
NM_080792chr2031862 1772 575 22251 1601 1193 --
NM_080832chrX129 ------
NM_080867chr1454398 3600 3195 1278 911 --23813 3680 --
NM_080927chr323005 264 ------
NM_130385chr1153094 2929 2840 2645 2029 33167 2968 2568 1515 --
NM_130386chr18138 ------
NM_130435chr1042953 2440 1999 1977 22283 1098 12430 12263
NM_130436chr2132435 913 793 1385 ----
NM_130438chr2143012 530 205 62 1962 ----
NM_130439chr1051574 742 628 494 192 1811 1757 --
NM_130439chr1051574 742 628 494 192 1811 1757 --
NM_130440chr161334 1245 543 366 322 124 --3602 89 59 --
NM_130442chr74403 304 239 145 --2768 162 1353
NM_130459chr961428 1358 1128 505 215 70 1157 21207 674 --
NM_130466chr1261376 1330 757 644 475 109 1353 21242 55 --
NM_130470chr114785 121 49 30 1665 1578 1824
NM_130471chr114785 121 49 30 1665 1578 1824
NM_130472chr114785 121 49 30 1665 1578 1824
NM_130473chr114785 121 49 30 1665 1578 1824
NM_130476chr114785 121 49 30 1665 1578 1824
NM_130766chr175918 864 93 87 50 --11036 --
NM_130787chr191290 --146 --
NM_130797chr741722 701 387 168 1313 51437 1430 1279 338 271 --
NM_130799chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130800chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130801chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130802chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130803chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130804chr1110689 633 607 589 513 491 303 171 85 53 --1287 --
NM_130807chr1982220 2101 2073 1868 1693 886 496 380 2196 157 41455 757 598 404 11450
NM_130808chr31169 ------
NM_130811chr202107 49 ------
NM_130830chr3143960 3101 2695 1374 1165 1152 789 737 600 408 370 334 316 232 --23659 2953 23900 2965
NM_130838chr1521727 573 11176 1663 --
NM_130839chr1521727 573 11176 1663 --
NM_130846chr121256 --1167 --
NM_133170chr20157541 7135 6195 5626 5175 3120 2829 2802 2729 2164 1367 1033 624 560 53 46711 5897 1866 1843 27774 1680 11817
NM_133264chr1763024 1113 1042 246 148 94 23240 125 33737 3334 998 12950
NM_133265chrX23347 2581 ------
NM_133329chr211545 ------
NM_133330chr492471 2394 2066 1027 1008 922 212 98 51 22059 931 --22990 236
NM_133331chr492471 2394 2066 1027 1008 922 212 98 51 22059 931 --22990 236
NM_133334chr485633 4735 4437 1506 852 807 742 634 36263 2082 1249 55867 5059 3989 708 269 22525 1773
NM_133335chr492471 2394 2066 1027 1008 922 212 98 51 22059 931 --22990 236
NM_133369chr56940 742 384 328 267 113 2790 377 --1222
NM_133370chr423494 246 --1481 --
NM_133372chr552098 1872 1049 505 333 --11920 --
NM_133433chr51166 ------
NM_133445chr953384 2808 1010 326 49 13017 1165 11159
NM_133452chr1961009 922 473 307 246 229 1151 2872 467 1818
NM_133468chr742507 1618 526 366 1958 ----
NM_133476chr121845 1418 4486 433 237 190 --
NM_133478chr242008 1810 979 813 32085 1844 890 ----
NM_133499chrX2660 36 --2629 58 --
NM_133625chr331164 152 28 ------
NM_133634chr2151636 1461 1323 614 107 1498 ----
NM_133638chr53917 440 29 ------
NM_133645chr6--1586 ----
NM_133647chr1543039 2852 167 69 1145 22624 574 --
NM_133650chr62124 104 ------
NM_134268chr1751023 985 819 342 308 1842 3933 868 328 --
NM_134325chr151367 1310 602 247 65 21794 1345 2497 269 11453
NM_134442chr241764 1597 650 356 --1390 --
NM_138270chrX33145 2356 658 ----23380 2904
NM_138281chr175539 397 197 61 32 --1504 199
NM_138292chr1182755 2435 1363 699 495 329 312 34 ------
NM_138300chr151617 1333 1326 473 237 --11455 1398
NM_138316chr101923 --126 --
NM_138328chr1783029 2801 2271 1201 1161 802 427 84 --22411 790 12536
NM_138338chr22113108 3086 2785 2518 2509 2190 1256 1170 1075 861 32 12314 32712 2559 2435 --
NM_138340chr18152 ------
NM_138350chr161402 1324 986 575 510 423 --181 --
NM_138356chr154719 702 488 231 --3559 290 41 --
NM_138370chr22558 193 1694 ----
NM_138373chr1931326 551 443 1652 2639 400 --
NM_138396chr12--1136 3313 297 214 1322
NM_138426chr7--12038 ----
NM_138437chrX249 30 ------
NM_138444chr1353124 774 699 69 37 ------
NM_138453chr5------126
NM_138457chr6132478 2414 2382 2091 1326 1261 1108 894 875 433 392 336 321 32898 94 60 93351 2797 2659 941 914 563 505 140 82 43193 2792 2402 1095
NM_138459chr632607 412 321