TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-186-3p
miRNA Sequence: GCCCAAAGGUGAAUUUUUUGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr842339 2269 383 377 ------
NM_000084chrX24446 622 21505 399 --15944
NM_000104chr262201 2147 1100 378 360 289 ------
NM_000108chr731402 1362 121 ------
NM_000109chrX71953 1947 1867 1832 529 361 31 ------
NM_000115chr1312484 ------
NM_000163chr542284 2276 665 95 ------
NM_000168chr741324 683 477 72 22580 2567 1718 --
NM_000176chr522938 2387 --13368 --
NM_000210chr262235 1724 1713 1655 1587 442 ------
NM_000217chr1263306 2014 1489 1083 343 164 24986 1986 ----
NM_000259chr1524462 165 ----25857 1082
NM_000266chrX4962 375 276 225 ------
NM_000280chr113795 249 225 ------
NM_000332chr666492 2842 2591 2181 1704 1604 --11202 --
NM_000337chr586012 5830 5821 5258 5224 4283 2606 48 --11474 --
NM_000340chr31607 ------
NM_000345chr42902 776 ------
NM_000346chr1731883 682 85 --11497 --
NM_000362chr2263337 3075 1269 947 860 202 --23382 2890 --
NM_000368chr954427 3642 601 165 135 ----23063 695
NM_000369chr1421856 1214 ------
NM_000390chrX3393 342 33 ----11281
NM_000408chr242842 1287 1005 341 11268 ----
NM_000430chr1783351 3012 3003 1445 878 699 596 391 ------
NM_000452chr1321425 74 ------
NM_000484chr212926 212 --1674 --
NM_000489chrX32880 2371 1315 --12284 --
NM_000546chr17274 67 1254 ----
NM_000555chrX87813 7553 6890 6197 6121 4860 2908 2455 --1235 --
NM_000574chr12890 476 ------
NM_000611chr1166691 1788 1714 1656 1527 375 --22820 1910 --
NM_000615chr1152762 2407 2291 980 751 --11001 --
NM_000618chr1266227 5462 4861 4192 2231 79 24285 1033 ----
NM_000618chr1266227 5462 4861 4192 2231 79 24285 1033 ----
NM_000627chr21376 ------
NM_000633chr1894887 4871 4775 4488 1752 1400 1325 813 294 ------
NM_000635chr1921244 312 ------
NM_000706chr123917 640 43 ------
NM_000717chr171117 ------
NM_000801chr203417 297 270 ------
NM_000809chr4119323 7552 7002 6458 5976 5776 3708 2721 2568 2155 432 11283 ----
NM_000813chr575133 4880 2146 1355 1232 634 156 14215 12056 --
NM_000814chr1514144 ------
NM_000824chr41111 ------
NM_000827chr552591 2550 2453 2148 1753 1931 ----
NM_000844chr341115 736 321 78 ------
NM_000855chr111229 ------
NM_000875chr1586527 6008 5121 4870 4360 2594 1962 784 1172 --14544
NM_000895chr121103 ------
NM_000899chr1233390 3015 2823 --23099 2835 --
NM_000922chr111453 ------
NM_000935chr32991 36 --1128 --
NM_000944chr432366 222 193 ------
NM_000945chr221655 1359 ------
NM_000950chrX33640 2590 675 ------
NM_000958chr511331 ------
NM_000965chr3194 ------
NM_000990chr1154008 3826 3635 2471 1488 --13533 --
NM_001001323chr1252516 2461 2085 480 388 ------
NM_001001396chr143968 3226 2927 954 1155 11330 --
NM_001001419chr584220 4046 3803 3690 1846 1762 1756 799 ----11336
NM_001001420chr584220 4046 3803 3690 1846 1762 1756 799 ----11336
NM_001001433chr2032873 2041 397 ------
NM_001001481chr852840 838 787 339 282 ------
NM_001001484chr1021668 619 ------
NM_001001522chr111390 ------
NM_001001549chr742783 2454 2353 784 ------
NM_001001550chr742783 2454 2353 784 ------
NM_001001555chr742783 2454 2353 784 ------
NM_001001664chr223091 1068 ----11145
NM_001001740chr11118 ------
NM_001001740chr11118 ------
NM_001001890chr2173292 3273 1176 666 658 535 428 13396 1722 13228
NM_001001924chr841924 1597 1447 694 ----11326
NM_001001925chr841924 1597 1447 694 ----11326
NM_001001928chr2297954 7066 6983 6407 2912 2728 1923 934 588 18282 --21979 630
NM_001001931chr841924 1597 1447 694 ----11326
NM_001001995chrX21451 499 11478 --1258
NM_001002006chr24338 144 120 59 --1683 --
NM_001002257chr233452 775 42 --11439 --
NM_001002295chr102920 838 ------
NM_001002843chr1531208 1033 431 ------
NM_001002860chr1443995 3414 2951 1346 11698 ----
NM_001002909chr1751744 1434 510 486 133 ------
NM_001003681chr2222009 227 --11530 --
NM_001003712chr1213043 ------
NM_001004065chr963933 3831 1042 251 224 29 ------
NM_001004317chr654168 3747 1438 1009 731 23762 580 ----
NM_001004342chr136055 4378 347 --16024 12130
NM_001004431chr171244 ------
NM_001004720chr211066 --1785 --
NM_001004722chr221235 795 --1954 --
NM_001005158chr32519 342 1444 ----
NM_001005159chr32519 342 1444 ----
NM_001005266chr152629 117 ------
NM_001005267chr152629 117 ------
NM_001005268chr152629 117 ------
NM_001005269chr152629 117 ------
NM_001005366chr122203 171 ------
NM_001005386chr252379 2121 1884 1753 561 12115 1854 --
NM_001005473chr566114 4090 2422 1995 677 533 11118 15142 --
NM_001005609chrX43734 665 503 244 147 --1648
NM_001005743chr1421193 527 ------
NM_001005744chr1421193 527 ------
NM_001005745chr1421193 527 ------
NM_001005753chr232271 2031 99 1145 ----
NM_001005782chr22698 181 ------
NM_001005862chr171608 ------
NM_001006600chr532180 2035 295 11567 ----
NM_001006618chr91200 ------
NM_001006665chr11676 ------
NM_001006684chrX1150 ------
NM_001006946chr231447 1194 340 ------
NM_001007024chr1724401 3920 ----14029
NM_001007025chr1724401 3920 ----14029
NM_001007067chr831065 923 52 ----1963
NM_001007068chr831065 923 52 ----1963
NM_001007069chr831065 923 52 ----1963
NM_001007070chr831065 923 52 ----1963
NM_001007102chr631165 330 216 ------
NM_001007156chr1541447 1404 783 89 1651 11748 --
NM_001007257chr141260 1145 439 317 ------
NM_001007559chr184797 532 271 108 ------
NM_001008225chr72309 212 ------
NM_001008401chr1931438 1378 270 ----11000
NM_001008408chr774751 4444 2190 2142 1886 1199 512 ----1891
NM_001008495chr831993 1424 428 ------
NM_001008539chr875100 4853 4405 2040 1432 1282 1253 ------
NM_001008660chr1141196 1052 399 243 ------
NM_001008801chr1922118 2058 ------
NM_001008925chr443283 3026 1233 431 ------
NM_001009183chr141399 ------
NM_001009555chr431730 1490 1463 ------
NM_001009566chr11964 ------
NM_001009880chr2223559 3340 13185 21296 1270 --
NM_001009899chr366071 5635 5052 4997 4773 1497 ----14595
NM_001009955chr11379 ------
NM_001009955chr11379 ------
NM_001010853chr622994 2145 ------
NM_001010861chr11379 ------
NM_001010862chrX72136 2110 2094 651 464 322 154 ----12264
NM_001010888chrX53874 3822 1802 1796 1497 --24407 1595 --
NM_001010895chr9199 --11762 --
NM_001010984chr132397 1000 762 ------
NM_001011513chr444055 3302 3049 1093 ----21178 564
NM_001011537chr342319 2309 2058 260 11933 ----
NM_001011713chr1441261 1202 215 159 ------
NM_001011722chr11175 ------
NM_001011722chr11175 ------
NM_001012614chr42723 542 ------
NM_001012751chr1011684 ------
NM_001012754chr1332125 2058 580 ------
NM_001013031chr1043453 1177 497 325 12345 ----
NM_001013406chr74646 613 593 86 ----1128
NM_001013620chr1297155 7043 3171 2793 2458 2227 2193 2099 939 ------
NM_001013843chr151152 ------
NM_001014380chr1365107 4787 3985 3705 1457 461 ------
NM_001014449chr161244 ------
NM_001014451chr161244 ------
NM_001014797chr1067310 5138 2876 2799 2674 310 13276 25060 1669 --
NM_001015045chr442066 2003 865 676 ------
NM_001015508chr81210 ------
NM_001015877chrX22015 986 ------
NM_001017371chr22213 106 ------
NM_001017395chr363289 1366 1072 867 474 198 ------
NM_001017415chr11621 ------
NM_001017416chr11621 ------
NM_001017440chr797674 7167 6747 6272 5626 5215 5107 1577 713 15775 1910 --
NM_001017926chr821184 99 ------
NM_001017969chr91602 ------
NM_001017970chr1452474 1905 898 442 59 1649 ----
NM_001017973chr51101 ------
NM_001017974chr51101 ------
NM_001018041chr62368 301 ------
NM_001018050chr2222535 317 --12719 --
NM_001018052chr2222535 317 --12719 --
NM_001018054chr141332 908 566 392 ------
NM_001018064chr92571 198 ------
NM_001018067chr195394 5292 5151 3681 3463 1669 1575 1092 557 24846 1101 ----
NM_001018068chr195394 5292 5151 3681 3463 1669 1575 1092 557 24846 1101 ----
NM_001018069chr195394 5292 5151 3681 3463 1669 1575 1092 557 24846 1101 ----
NM_001018074chr522938 2387 --13368 --
NM_001018075chr522938 2387 --13368 --
NM_001018076chr522938 2387 --13368 --
NM_001018077chr522938 2387 --13368 --
NM_001018108chr1522122 1988 ------
NM_001018111chr734002 3834 3663 --1917 --
NM_001020658chr121699 649 ------
NM_001020658chr121699 649 ------
NM_001020825chr51413 ------
NM_001023560chr62383 168 ------
NM_001023587chr35955 450 169 143 50 --1812 --
NM_001024094chr522938 2387 --13368 --
NM_001024647chr1276890 6162 5638 2632 1638 948 578 ----35174 2761 2127
NM_001024808chr1222774 372 12029 ----
NM_001024948chr163417 3178 2444 1350 1230 535 21200 760 ----
NM_001025076chr1076256 5407 4096 2022 1577 1503 647 11679 14212 --
NM_001025077chr1077614 6765 5454 4974 2935 2861 2005 13037 15570 --
NM_001025580chrX33054 1521 245 1500 ----
NM_001025780chr931590 1242 56 ------
NM_001029858chr633148 2226 1135 1776 --12724
NM_001029863chr682786 2689 2494 2040 1976 788 757 699 ------
NM_001030chr1152 ------
NM_001030007chr1654000 3684 3413 3175 2848 12967 --13342
NM_001030055chr1442876 1221 1078 419 --24709 1060 13971
NM_001031679chr1222946 257 ----1714
NM_001031684chr221385 1077 ------
NM_001031695chr2284678 4665 4545 3878 1710 1603 1149 677 --25024 3672 --
NM_001031700chr441924 1695 719 48 ------
NM_001031710chr73294 98 85 ------
NM_001031712chr61389 ------
NM_001031732chr473595 3415 2943 2755 1285 1278 336 ------
NM_001031801chr221172 ------
NM_001031804chr1674279 3902 1434 1427 1397 1036 824 --11321 --
NM_001031812chr532180 1992 1852 ------
NM_001032289chrX3904 647 120 ------
NM_001032392chr221681 548 1706 ----
NM_001032393chrX2702 574 ------
NM_001032394chr632733 1974 1068 ------
NM_001032395chr632600 1841 935 ------
NM_001033057chr32316 229 ------
NM_001033059chr631988 823 524 ------
NM_001033112chr53808 786 21 ------
NM_001033925chr1082078 1932 1734 1568 707 524 513 145 ------
NM_001034025chr121814 ------
NM_001034845chr441413 1380 1074 451 ------
NM_001034850chr521616 1230 ------
NM_001034852chr143286 254 165 ------
NM_001035chr111023 ------
NM_001035511chr151855 1664 1645 501 208 --1302 --
NM_001035512chr151962 1771 1752 608 315 --1409 --
NM_001035513chr151962 1771 1752 608 315 --1409 --
NM_001037164chr771478 1423 741 675 628 235 221 --11430 --
NM_001037172chr311203 ------
NM_001037317chr11379 ------
NM_001038640chr151684 ------
NM_001039091chrX4538 469 431 185 ------
NM_001039535chr182456 304 ------
NM_001039538chr221177 876 1536 --11406
NM_001039547chr377216 6025 3180 2518 2094 1424 1254 28036 3204 12054 37415 5518 5293
NM_001039585chr133238 3009 2861 1178 ----
NM_001039590chrX53568 1506 1494 1340 994 ------
NM_001039591chrX53568 1506 1494 1340 994 ------
NM_001039618chr11105976 5451 5331 5104 3885 2361 1651 726 422 396 15756 ----
NM_001039693chr243936 3686 1426 1016 1843 --12508
NM_001039802chr121269 440 ------
NM_001039840chrX55291 4411 3720 2418 417 ------
NM_001039937chr1373335 2638 1246 824 438 382 175 ------
NM_001040031chr191273 ------
NM_001040110chr72151 98 ------
NM_001040152chr723864 3686 ------
NM_001040153chr131977 ------
NM_001040158chr53468 420 138 ------
NM_001040202chr421732 1642 ------
NM_001040284chr1695543 5152 4760 4497 4357 4186 2337 1386 1210 ----14887
NM_001040429chr1342392 2276 1130 636 ------
NM_001040633chr711028 ------
NM_001040708chr841054 975 365 340 ------
NM_001040712chr963398 3259 3249 3242 2367 848 ------
NM_001040875chr852534 2422 1825 1044 864 ------
NM_001040876chr41597 ------
NM_001042355chr1635205 1339 294 ----13523
NM_001042361chr1051333 1164 1042 571 26 11030 ----
NM_001042364chr1051333 1164 1042 571 26 11030 ----
NM_001042365chr1051333 1164 1042 571 26 11030 ----
NM_001042387chr1051333 1164 1042 571 26 11030 ----
NM_001042393chr1051333 1164 1042 571 26 11030 ----
NM_001042396chr1051333 1164 1042 571 26 11030 ----
NM_001042397chr1051333 1164 1042 571 26 11030 ----
NM_001042406chr61940 ------
NM_001042412chr1635205 1339 294 ----13523
NM_001042413chr92684 344 --23993 3472 --
NM_001042414chr131297 ------
NM_001042453chrX1102 ------
NM_001042486chr2021118 163 ------
NM_001042494chr151721 ----11397
NM_001042495chr151721 ----11397
NM_001042496chr151721 ----11397
NM_001042497chr151721 ----11397
NM_001042498chrX31041 784 257 1111 ----
NM_001042506chrX1457 ------
NM_001042543chr421379 151 ------
NM_001042555chr1274610 4434 4247 4050 3561 3444 860 1869 ----
NM_001042599chr2107714 7364 6957 6049 5285 2728 2643 1129 700 642 26545 2177 ----
NM_001042601chr332801 2206 915 ------
NM_001042603chr12125371 5311 4780 4706 4621 4017 3942 3574 1693 1291 736 209 122 ----
NM_001042663chr121064 412 --1465 --
NM_001042664chr121064 412 --1465 --
NM_001042665chr121064 412 --1465 --
NM_001044722chr532180 1992 1852 ------
NM_001044723chr532180 1992 1852 ------
NM_001077628chr11236 ------
NM_001079874chr121994 761 ------
NM_001099678chr355843 5667 4731 2354 332 ----14774
NM_001105518chr12882 79 ------
NM_001106chr3119536 9160 9030 8809 6843 6362 6169 3217 2903 183 74 17763 12943 1320
NM_001109977chr43770 533 268 ------
NM_001113490chrX73551 2681 2404 648 632 537 181 11457 --11211
NM_001121chr1031825 1496 416 ------
NM_001128chr1654000 3684 3413 3175 2848 12967 --13342
NM_001146chr852032 1533 926 417 307 ------
NM_001148chr441885 1855 1385 1372 ------
NM_001160chr1222309 588 ------
NM_001167chrX56491 6393 6339 2666 1012 ------
NM_001172chr142626 154 ------
NM_001173chr1442876 1221 1078 419 --24709 1060 13971
NM_001177chr1241572 774 516 54 ------
NM_001206chr962789 2157 1165 281 272 128 ------
NM_001237chr41915 ------
NM_001237chr41915 ------
NM_001253chr61255 ------
NM_001257chr1611506 ------
NM_001258chr174529 387 371 184 ------
NM_001259chr796263 5765 4619 4356 2295 1951 1713 1006 806 15159 ----
NM_001263chr41113 ------
NM_001269chr12929 174 ------
NM_001271chr154713 205 102 54 ------
NM_001275chr141322 ------
NM_001289chrX11446 ------
NM_001304chr1753689 3247 3233 3192 2787 --13204 22718 113
NM_001328chr42723 542 ------
NM_001331chr1141937 1082 824 49 1856 ----
NM_001332chr511105 --11323 --
NM_001351chr321576 90 ------
NM_001356chrX21000 966 11712 ----
NM_001358chr41455 ------
NM_001364chr1164195 1600 1183 999 502 220 ------
NM_001365chr172647 517 ------
NM_001380chr101939 ------
NM_001386chr842056 2047 1823 1620 --11804 --
NM_001390chr1863625 3245 2694 2657 2640 1008 --1726 11347
NM_001396chr2151812 892 832 480 458 ----1822
NM_001399chrX43734 665 503 244 147 --1648
NM_001412chrX32910 2872 142 ------
NM_001419chr1984884 4769 4041 3279 1250 1111 978 468 --14096 --
NM_001420chr191705 ------
NM_001422chr1111362 ------
NM_001423chr1241623 1598 530 505 11482 ----
NM_001431chr61278 ------
NM_001432chr443677 1357 1319 1252 1500 ----
NM_001438chr123041 2325 ------
NM_001451chr1631185 436 138 ------
NM_001453chr621653 1440 --11595 --
NM_001463chr23710 198 155 ------
NM_001482chr152821 242 ------
NM_001527chr644525 3375 1685 102 --14571 1481
NM_001530chr143288 221 30 ------
NM_001541chr111168 ------
NM_001543chr554801 4017 3496 1330 1059 ------
NM_001554chr12551 254 ------
NM_001604chr113795 249 225 ------
NM_001616chr253372 2918 2502 916 288 ------
NM_001634chr631988 823 524 ------
NM_001654chrX2374 346 ------
NM_001655chr1132097 873 236 ------
NM_001662chr71301 ------
NM_001663chr1432427 1767 968 ------
NM_001668chr152186 1736 1401 859 368 ------
NM_001682chr1252230 2175 1799 194 102 ------
NM_001684chr143685 2943 2644 671 --11047 --
NM_001690chr32633 152 ----11702
NM_001730chr1321630 606 ------
NM_001730chr1321630 606 ------
NM_001731chr121901 --159 --
NM_001742chr72733 665 11502 --1177
NM_001754chr2173292 3273 1176 666 658 535 428 13396 1722 13228
NM_001755chr1621770 463 ------
NM_001759chr1273583 3344 1935 1927 1267 1111 908 1530 14719 --
NM_001774chr191273 ------
NM_001791chr121269 440 ------
NM_001792chr1861181 931 925 146 123 25 ------
NM_001806chr1962986 2497 2487 2128 999 826 --1727 --
NM_001821chr134676 710 29 ------
NM_001833chr9196 ------
NM_001846chr13130 ------
NM_001858chr644889 3636 3605 871 1117 1909 --
NM_001894chr221988 --11184 --
NM_001918chr179047 8196 7670 3658 3135 1097 966 13294 --47168 2398 1653 334
NM_001930chr19178 ------
NM_001938chr111309 ------
NM_001946chr1221186 189 --1985 --
NM_001954chr61759 ------
NM_001962chr51104 ------
NM_001964chr54869 747 372 283 ----1882
NM_001967chr3121 ----183
NM_001968chr43876 660 194 157 ----
NM_001969chr1463036 2621 1449 1165 1029 298 1832 1802 --
NM_001980chr1222252 1740 ------
NM_001999chr531542 1476 544 --1350 --
NM_002015chr1352062 878 783 631 374 12987 --1961
NM_002024chrX2457 151 ------
NM_002025chrX48452 6853 2974 103 ----16790
NM_002035chr1843543 2672 2572 75 ----13166
NM_002039chr42874 645 ----1344
NM_002040chr2121971 833 ------
NM_002051chr102920 838 ------
NM_002063chrX41129 850 362 353 ------
NM_002086chr1722125 141 ----1672
NM_002092chr475069 3922 3175 750 744 128 120 1197 13119 --
NM_002126chr1794030 3552 2879 2719 1492 1090 565 132 27 ------
NM_002129chr41316 ------
NM_002130chr541599 1211 430 268 ------
NM_002182chr332285 2206 1022 ------
NM_002193chr221573 740 ------
NM_002196chr204838 700 433 194 ------
NM_002196chr204838 700 433 194 ------
NM_002203chr553790 2817 2675 1608 917 --14167 --
NM_002222chr321054 239 ------
NM_002223chr1243073 1445 600 443 ------
NM_002224chr62734 710 ------
NM_002230chr1731082 180 111 ------
NM_002247chr1031763 1731 1718 1852 1400 --
NM_002264chr343758 3161 768 255 ----11065
NM_002265chr1741174 769 369 340 1103 ----
NM_002270chr575596 5578 3814 3634 2185 1486 703 ------
NM_002332chr121708 ------
NM_002336chr1274882 4543 4125 3826 3352 1854 1516 14054 ----
NM_002356chr6180 --12579 --
NM_002359chr1763785 3497 2989 2749 2742 1268 ----13285
NM_002374chr221177 876 1536 --11406
NM_002387chr542027 705 505 378 --11623 --
NM_002399chr151959 ------
NM_002408chr142591 563 1195 ----
NM_002430chr2231766 931 890 ----12361
NM_002442chr1241459 1363 356 266 ----11654
NM_002444chrX31979 1957 1485 ------
NM_002481chr1107544 6517 6310 5781 5532 5294 4976 951 777 101 27928 5148 14909 --
NM_002482chr1165 ------
NM_002486chr922028 439 ----11691
NM_002515chr1411703 ------
NM_002522chr1763816 3465 3100 1102 981 402 --1462 --
NM_002524chr131065 838 447 ------
NM_002537chr152688 401 ------
NM_002538chr53478 123 76 ------
NM_002541chr71993 ------
NM_002556chr1131932 705 396 ------
NM_002576chr1121116 927 ------
NM_002577chr353867 3455 1563 874 81 11092 1340 --
NM_002581chr955399 4561 2018 1198 55 --11546 1570
NM_002583chr121247 ------
NM_002601chr24373 360 41 33 ------
NM_002607chr711160 ----1445
NM_002610chr23986 796 242 ------
NM_002645chr112207 23 12647 --11240
NM_002648chr611004 ------
NM_002655chr831975 1247 169 21837 1036 --14189
NM_002657chr2093784 3681 3617 3218 2612 826 319 151 31 ------
NM_002665chr221681 548 1706 ----
NM_002670chr32369 174 ------
NM_002689chr111326 ------
NM_002698chr1922511 2206 ----11998
NM_002709chr21863 ------
NM_002714chr621093 993 ----1835
NM_002719chr1442104 2080 1956 1875 ------
NM_002730chr19152 ------
NM_002731chr121014 589 --1243 --
NM_002737chr1765831 5063 2045 1112 422 302 ------
NM_002745chr2224340 3243 --13202 --
NM_002748chr1521216 892 ------
NM_002765chrX4538 469 431 185 ------
NM_002791chr141161 ------
NM_002819chr1911032 ------
NM_002823chr21614 ------
NM_002830chr21295 ------
NM_002839chr963398 3259 3249 3242 2367 848 ------
NM_002848chr1231135 1086 188 ------
NM_002859chr1251617 1423 1304 1278 1145 ------
NM_002865chr81184 ------
NM_002873chr51464 ------
NM_002874chr952308 2273 1833 842 722 ----11608
NM_002886chr3105225 4967 4346 3867 3639 3511 3306 946 442 253 23496 1912 ----
NM_002892chr1421158 1117 ------
NM_002897chr21761 ------
NM_002902chr151144 ------
NM_002906chr1122380 202 ------
NM_002907chr121417 ------
NM_002940chr41597 ------
NM_002941chr31627 ------
NM_002943chr151126 ------
NM_002951chr201281 ------
NM_002953chr11676 ------
NM_002956chr1221335 403 ------
NM_002957chr943345 3283 2539 1455 --1118 --
NM_002959chr194434 4047 2966 1461 1397 1306 1234 1165 653 ------
NM_002968chr163726 248 233 ------
NM_002977chr232991 1229 258 ------
NM_002997chr231447 1194 340 ------
NM_003001chr151962 1771 1752 608 315 --1409 --
NM_003024chr213965 857 372 ------
NM_003046chr875100 4853 4405 2040 1432 1282 1253 ------
NM_003074chr332217 1522 1431 ------
NM_003079chr173204 128 57 ------
NM_003106chr31255 ------
NM_003108chr276041 5565 4654 2048 653 501 211 36829 6674 6033 ----
NM_003111chr22213 106 ------
NM_003129chr8163 ------
NM_003133chr131063 402 203 ------
NM_003137chr641989 774 578 147 --11805 --
NM_003146chr112416 65 ------
NM_003155chr832796 2614 2287 ------
NM_003157chr34767 203 129 54 ------
NM_003174chr10177 ------
NM_003176chr11344 ------
NM_003176chr11344 ------
NM_003185chr202889 341 ------
NM_003186chr111390 ------
NM_003188chr6199 ------
NM_003189chr173103 2504 2265 2240 1205 810 307 1321 --1141
NM_003194chr6170 ------
NM_003199chr18105612 5562 5422 4416 4100 3674 1641 1229 788 346 1935 ----
NM_003204chr1711368 ------
NM_003221chr673574 3308 1507 1356 723 315 95 14040 ----
NM_003239chr1441021 656 325 153 ------
NM_003246chr1521555 243 ------
NM_003253chr2131349 570 119 ------
NM_003263chr4150 ------
NM_003291chr131301 ------
NM_003295chr13121 ------
NM_003298chr385882 5478 3917 2495 1956 1304 227 79 --25365 4256 --
NM_003304chr311148 --11414 --
NM_003320chr1164479 4385 4041 3115 2843 115 --122 --
NM_003338chr1011941 ------
NM_003342chr1723311 1069 --13051 --
NM_003345chr161565 ------
NM_003352chr22698 181 ------
NM_003358chr91111 ------
NM_003360chr41220 ------
NM_003368chr11621 ------
NM_003369chr1132636 2218 2197 ----2410 137
NM_003374chr52602 531 ------
NM_003375chr101415 ----124
NM_003390chr1121072 739 ------
NM_003400chr21190 ------
NM_003403chr141579 ------
NM_003405chr223773 674 628 --1804 --
NM_003406chr831393 1293 276 ------
NM_003407chr191679 ------
NM_003409chr1811291 --1964 --
NM_003410chrX51932 1117 788 634 624 ------
NM_003411chrY1736 ------
NM_003412chr32830 215 ------
NM_003413chrX61926 1753 1426 774 202 149 ------
NM_003428chr121471 ------
NM_003432chr51481 ------
NM_003439chr742636 2614 1301 416 ----23582 2281
NM_003440chr121766 ------
NM_003452chr91864 ----1654
NM_003453chr131496 ------
NM_003468chr231257 934 287 --1310 --
NM_003473chr102763 714 11013 ----
NM_003478chr1163319 2204 2172 2115 989 40 ------
NM_003482chr1252744 2433 2350 2192 1942 ------
NM_003489chr2152843 2309 1239 850 24 ------
NM_003506chr821197 487 --11146 --
NM_003559chr1773790 3131 1340 890 344 285 80 21513 116 --1934
NM_003566chr1243253 2875 278 136 ------
NM_003568chr11308 ------
NM_003574chr1865106 3853 3692 1481 1268 963 1798 ----
NM_003579chr11160 ------
NM_003580chr81436 ------
NM_003581chr211066 --1785 --
NM_003583chr1293303 3259 2858 2670 2616 2592 1494 1260 1121 ------
NM_003590chr243517 1089 975 602 ------
NM_003616chr141368 ------
NM_003617chr144590 4023 1238 164 ------
NM_003618chr231194 1184 1110 ------
NM_003620chr1721035 124 ------
NM_003626chr1121097 76 ------
NM_003644chr1785762 4574 4556 4082 2107 2092 1605 385 --21499 935 --
NM_003651chr121429 ------
NM_003663chr322345 879 --11093 --
NM_003670chr341383 1187 1072 225 1389 ----
NM_003671chr953028 2942 1455 1031 176 ------
NM_003677chr121399 ------
NM_003688chrX2281 265 ------
NM_003692chr92156 97 ------
NM_003701chr1311066 ------
NM_003722chr352689 776 570 459 368 ------
NM_003744chr1421193 527 ------
NM_003749chr1332223 351 105 21809 673 --1786
NM_003750chr101891 ------
NM_003759chr464068 3771 3540 3381 515 242 13024 ----
NM_003760chr11527 ------
NM_003763chr2032873 2041 397 ------
NM_003774chr1252836 2433 1175 1151 146 ------
NM_003787chr1831605 1282 539 ------
NM_003795chr61147 ------
NM_003800chr632183 1670 583 ------
NM_003816chr811240 ------
NM_003818chr201125 ------
NM_003825chr1521168 533 ------
NM_003838chr13333 304 205 ------
NM_003848chr33974 348 186 1703 1270 --
NM_003870chr1521595 326 ------
NM_003872chr232796 348 78 --21200 274 12683
NM_003873chr1041786 1776 388 333 ------
NM_003877chr121825 ------
NM_003887chr232201 1426 780 ------
NM_003895chr2131641 219 37 ------
NM_003902chr12635 105 ------
NM_003909chr832981 243 162 ------
NM_003913chr62661 346 ------
NM_003929chr141501 615 517 60 ----21551 1106
NM_003934chr92311 242 ------
NM_003939chr1054135 2975 2783 1317 616 ------
NM_003945chr53501 199 112 ------
NM_003957chr111775 ------
NM_003961chr161190 ------
NM_003966chr596769 6584 5866 5246 5011 3094 1799 748 341 11332 14914 --
NM_003968chr31168 ------
NM_003994chr1233390 3015 2823 --23099 2835 --
NM_003995chr91248 ------
NM_004006chrX71953 1947 1867 1832 529 361 31 ------
NM_004007chrX71953 1947 1867 1832 529 361 31 ------
NM_004009chrX71953 1947 1867 1832 529 361 31 ------
NM_004010chrX71953 1947 1867 1832 529 361 31 ------
NM_004011chrX71953 1947 1867 1832 529 361 31 ------
NM_004012chrX71953 1947 1867 1832 529 361 31 ------
NM_004013chrX71953 1947 1867 1832 529 361 31 ------
NM_004014chrX71953 1947 1867 1832 529 361 31 ------
NM_004015chrX71953 1947 1867 1832 529 361 31 ------
NM_004016chrX61867 1861 1781 1746 443 275 ------
NM_004017chrX71953 1947 1867 1832 529 361 31 ------
NM_004018chrX61867 1861 1781 1746 443 275 ------
NM_004020chrX71953 1947 1867 1832 529 361 31 ------
NM_004021chrX61867 1861 1781 1746 443 275 ------
NM_004022chrX61867 1861 1781 1746 443 275 ------
NM_004023chrX61867 1861 1781 1746 443 275 ------
NM_004061chr51197 ------
NM_004090chr1732917 2106 698 ----12504
NM_004093chr1362791 2722 2668 2520 1104 833 ------
NM_004099chr911924 ------
NM_004109chr1122147 182 ------
NM_004116chr2186 ------
NM_004124chr1483543 3305 2350 1358 1058 1005 523 432 ------
NM_004161chr211220 ------
NM_004169chr171135 ------
NM_004171chr1179495 8151 6781 6534 3770 1787 917 22825 1495 --12416
NM_004180chr2146 ------
NM_004183chr111506 ------
NM_004199chr51101 ------
NM_004225chr81143 ------
NM_004229chrX3764 351 331 ------
NM_004232chr1863851 3812 2486 886 631 183 21503 1424 --133
NM_004241chr102627 292 ------
NM_004242chr61165 ------
NM_004290chr531335 1201 525 ------
NM_004293chr943376 3316 628 226 ------
NM_004295chr1711283 ------
NM_004299chrX135 ------
NM_004302chr1242676 1159 1143 921 --12318 12604
NM_004311chr1042514 1946 1923 613 ------
NM_004331chr852364 1725 919 587 198 ----11834
NM_004349chr811307 ------
NM_004356chr111134 ------
NM_004359chr192500 122 ------
NM_004384chr532180 1992 1852 ------
NM_004392chr1312297 ------
NM_004393chr341601 892 537 234 --1196 --
NM_004397chr11133657 3431 2927 2759 2657 1513 1268 1161 1059 680 578 102 58 --13779 --
NM_004423chr352673 2645 2018 1846 1668 1322 --11740
NM_004426chr1211648 ------
NM_004437chr193137 2982 1292 1219 881 657 591 454 262 --2842 669 --
NM_004440chr631997 1802 476 ------
NM_004447chr122970 35 ------
NM_004448chr171608 ------
NM_004449chr2121086 540 ------
NM_004451chr112730 621 ------
NM_004454chr36865 816 781 769 752 86 --12152 --
NM_004464chr454281 4128 1558 739 362 11254 ----
NM_004472chr51176 ------
NM_004482chr21367 ------
NM_004501chr133967 2523 1644 11076 --13385
NM_004506chr62501 266 ------
NM_004520chr51252 ------
NM_004529chr931394 65 49 --11152 --
NM_004535chr2051485 1466 1423 323 103 ------
NM_004537chr123967 607 282 --1398 --
NM_004561chr1121538 734 ------
NM_004571chr21130 ------
NM_004575chr441561 1350 1263 80 ------
NM_004586chrX45044 4870 4829 3365 11521 ----
NM_004588chr1154047 3847 3365 2621 977 24007 1289 1922 11168
NM_004593chr31140 ------
NM_004598chr543280 3085 723 229 --1594 --
NM_004622chr242366 1915 614 161 ------
NM_004626chr11----1531 1485
NM_004631chr141332 908 566 392 ------
NM_004654chrY11301 ------
NM_004660chrY11868 ------
NM_004718chr22143 32 ------
NM_004719chr1242693 2326 2220 706 ----1810
NM_004726chrX75733 4716 4462 2172 1413 749 677 ------
NM_004727chr1521735 1641 ------
NM_004739chr111248 ------
NM_004740chr17138 ------
NM_004748chr1551399 1364 899 330 236 ------
NM_004760chr762305 2100 1898 804 446 434 ------
NM_004774chr1732898 516 507 --13079 --
NM_004775chr1811523 ------
NM_004776chr2053005 1205 777 498 68 1564 1530 --
NM_004788chr111377 ------
NM_004798chr2033538 2655 430 ----1602
NM_004804chr232765 2545 265 ----12074
NM_004815chr154815 3819 3657 3517 372 24007 352 ----
NM_004822chr1753921 3816 3759 929 613 ------
NM_004824chr63989 348 305 ------
NM_004860chr171463 ------
NM_004866chr594855 4094 4063 3804 918 870 726 634 245 11612 14056 14136
NM_004869chr181603 11706 11590 1645
NM_004871chr1724401 3920 ----14029
NM_004884chr1521343 441 ------
NM_004888chr941033 845 261 140 ------
NM_004893chr53468 420 138 ------
NM_004897chr102814 596 ------
NM_004902chr201760 ------
NM_004912chr74646 613 593 86 ----1128
NM_004926chr1421380 643 ------
NM_004949chr1851990 759 477 341 155 ------
NM_004956chr773686 3257 1436 1341 818 678 257 ------
NM_004973chr651770 1520 480 297 208 ------
NM_004976chr1175157 5031 3817 3265 1585 1322 711 --14479 --
NM_004985chr1263110 1255 954 760 270 203 14027 ----
NM_004992chrX67946 7127 7025 5149 3273 2739 18291 ----
NM_004992chrX67946 7127 7025 5149 3273 2739 18291 ----
NM_004993chr1421300 76 ------
NM_004996chr1631704 655 322 ------
NM_004999chr66967 952 495 451 177 139 ----13869
NM_005004chr10121 ------
NM_005011chr72151 98 ------
NM_005016chr121243 ------
NM_005022chr172210 86 ------
NM_005036chr2297954 7066 6983 6407 2912 2728 1923 934 588 18282 --21979 630
NM_005054chr221342 379 ----1466
NM_005056chr12125615 5555 5024 4950 4865 4261 4186 3818 1937 1535 980 453 1266 ----
NM_005063chr1023808 3202 13518 12909 --
NM_005065chr1465031 4130 1833 692 507 324 ------
NM_005078chr1531455 1419 1387 ------
NM_005080chr221750 ------
NM_005110chr51722 ------
NM_005113chr141398 ------
NM_005114chr41538 ------
NM_005121chr1733373 3359 3245 23461 2332 ----
NM_005124chr63962 692 122 ------
NM_005131chr18181 ------
NM_005135chr151721 ----11397
NM_005156chr995117 3667 3372 3321 1345 1231 1158 946 325 25060 1276 ----
NM_005164chr1232607 600 369 ------
NM_005168chr22330 145 --11583 --
NM_005178chr191392 ------
NM_005184chr1931533 370 338 ------
NM_005197chr1453859 1549 1448 178 113 ------
NM_005207chr2273690 3059 2400 516 505 424 224 ------
NM_005215chr181631 ------
NM_005224chr191254 ----1563
NM_005235chr2107714 7364 6957 6049 5285 2728 2643 1129 700 642 26545 2177 ----
NM_005238chr1162969 2835 1375 965 806 465 ------
NM_005254chr1531199 929 34 ------
NM_005256chr11195 ------
NM_005261chr82858 277 ------
NM_005264chr10----1173 1227
NM_005275chr6146 ------
NM_005311chr742783 2454 2353 784 ------
NM_005324chr1742023 1622 1598 51 ------
NM_005329chr1622233 1447 --1536 --
NM_005339chr41976 --13902 --
NM_005349chr41584 ------
NM_005359chr1895938 5337 5037 4805 4110 2466 1151 1060 953 --26425 5217 --
NM_005392chr911763 ------
NM_005397chr734002 3834 3663 --1917 --
NM_005400chr232276 1108 597 ------
NM_005402chr71102 ------
NM_005440chr1733082 2858 2213 13307 --22337 977
NM_005442chr31561 ------
NM_005443chr42576 143 ------
NM_005455chr121686 1145 --1465 --
NM_005476chr931188 141 118 1927 --1437
NM_005487chr2222009 227 --11530 --
NM_005503chr1511025 ------
NM_005504chr1244797 1657 1419 93 ------
NM_005517chr131145 1128 159 ------
NM_005520chr52661 544 ------
NM_005526chr81280 ------
NM_005561chr131849 ------
NM_005572chr1195 ------
NM_005575chr54872 534 298 119 --1181 --
NM_005593chr121583 ------
NM_005594chr12124 ------
NM_005596chr936039 1814 1762 --16265 --
NM_005604chr642483 1732 727 612 1599 ----
NM_005610chr11863 ------
NM_005611chr162982 133 ------
NM_005618chr62506 428 ------
NM_005625chr831065 923 52 ----1963
NM_005626chr12444 430 ------
NM_005627chr62988 66 ------
NM_005637chr184797 532 271 108 ------
NM_005644chr11305 ------
NM_005647chrX31281 1004 906 ------
NM_005655chr821027 35 ------
NM_005662chr82387 66 ------
NM_005664chr151200 ------
NM_005665chr154528 4251 4066 3290 67 14317 ----
NM_005668chr521123 548 ------
NM_005684chr1145 ------
NM_005704chr12962 356 ------
NM_005715chr632676 2501 58 --1205 --
NM_005722chr252379 2121 1884 1753 561 12115 1854 --
NM_005731chr21116 ------
NM_005735chr2169 ------
NM_005737chr252752 2700 2300 950 628 ------
NM_005738chr771478 1423 741 675 628 235 221 --11430 --
NM_005756chrX1564 ------
NM_005759chr254061 3762 1737 970 131 ----13523
NM_005767chr13169 ------
NM_005778chr31446 ------
NM_005779chr542931 2887 1454 412 ------
NM_005786chr1821239 815 ------
NM_005819chr163243 3184 2837 2615 660 360 ------
NM_005828chr1764546 3636 1667 1605 1070 254 11473 --14402
NM_005839chr12866 345 ------
NM_005840chrX76638 5938 5154 2118 1503 386 72 15315 ----
NM_005868chr742379 1977 924 601 ------
NM_005871chr101714 ------
NM_005896chr22730 37 ------
NM_005899chr1731085 334 157 ------
NM_005903chr584220 4046 3803 3690 1846 1762 1756 799 ----11336
NM_005911chr221431 1051 ------
NM_005920chr133409 1302 201 --1678 1350
NM_005925chr181148 ------
NM_005935chr464821 4727 3961 1783 1178 442 1485 ----
NM_005937chr1751582 1521 1348 937 286 ------
NM_005943chr611130 ------
NM_005955chr195507 5119 5043 4787 4552 4502 4195 1318 182 --24622 1027 --
NM_005963chr17184 ------
NM_005964chr1751327 1094 1057 592 546 ------
NM_005967chr121729 ------
NM_005975chr203808 781 429 ----1867
NM_005977chr132831 257 ------
NM_005981chr12188 ------
NM_006007chr994011 3806 3432 3081 3056 887 476 365 154 1341 --11702
NM_006011chr1534007 1053 324 --4849 718 361 279 --
NM_006016chr622108 423 1142 ----
NM_006047chr2093323 2688 2547 2156 1217 1106 944 770 231 ------
NM_006064chrX1422 ------
NM_006106chr1172341 1369 1345 856 741 676 265 ------
NM_006107chr172435 56 ------
NM_006108chr1162097 2080 1937 796 740 423 ------
NM_006113chr121994 761 ------
NM_006135chr12576 251 ------
NM_006136chr72924 337 ------
NM_006148chr1772862 2852 2671 2099 2008 1878 876 12145 ----
NM_006157chr112335 163 ------
NM_006166chr121530 ----12073
NM_006180chr92571 198 ------
NM_006186chr21221 ------
NM_006197chr842111 1799 323 229 --12243 --
NM_006203chr544904 4429 3835 3452 ------
NM_006204chr101215 ------
NM_006206chr462431 2015 1817 1135 609 409 ------
NM_006241chr342402 1833 715 677 --1325 --
NM_006246chr141855 ------
NM_006251chr543134 2565 266 115 ------
NM_006256chr142363 1927 853 275 ----11742
NM_006292chr111146 ------
NM_006298chr64972 823 307 158 ------
NM_006310chr171520 ------
NM_006313chr1231450 403 307 --11594 --
NM_006315chr413909 ------
NM_006325chr121215 ------
NM_006336chr92506 196 --11214 21516 1313
NM_006352chr121884 1676 ------
NM_006353chr62297 94 ------
NM_006363chr201208 ------
NM_006367chr131004 300 169 ------
NM_006369chr11455 ------
NM_006379chr71749 --1355 --
NM_006380chr1763363 3207 2731 662 135 80 ------
NM_006390chr1231464 708 396 ------
NM_006393chr1043971 3868 1166 364 13731 ----
NM_006421chr82933 291 ------
NM_006439chr41391 ------
NM_006449chr241647 1612 662 514 --21606 26 --
NM_006451chr51238 ------
NM_006457chr444055 3302 3049 1093 ----21178 564
NM_006460chr1751797 1414 1324 452 133 ------
NM_006464chr264358 3789 922 916 646 237 --2511 218 13304
NM_006482chr1293303 3259 2858 2670 2616 2592 1494 1260 1121 ------
NM_006489chr1411703 ------
NM_006496chr151723 1586 1570 1557 1327 ------
NM_006534chr2033423 1313 246 ------
NM_006537chr151113 ------
NM_006544chr1434487 1598 1347 ------
NM_006546chr1766040 5818 5142 4648 4078 2157 --46547 4761 4059 1911 --
NM_006548chr321521 1162 ----1590
NM_006561chr1076256 5407 4096 2022 1577 1503 647 11679 14212 --
NM_006565chr16188 ----196
NM_006572chr1742168 708 634 155 ------
NM_006584chr171122 ------
NM_006593chr21233 ------
NM_006595chr111256 ------
NM_006599chr16117337 7055 6255 5915 5157 1954 1919 1512 1440 1359 939 16083 --25715 5204
NM_006621chr12799 737 ------
NM_006624chr1021823 1753 ------
NM_006625chr11432 ------
NM_006625chr11432 ------
NM_006625chr11432 ------
NM_006628chr1573877 3788 1843 1522 1109 403 311 ------
NM_006629chr1832119 1091 1076 12544 --1108
NM_006648chr91169 ------
NM_006654chr1274610 4434 4247 4050 3561 3444 860 1869 ----
NM_006660chr151238 ------
NM_006667chrX31183 1016 481 ------
NM_006690chr2011670 ------
NM_006698chr203910 466 128 ------
NM_006717chr942306 987 891 808 --1605 --
NM_006729chrX65260 5083 4740 1066 599 515 11950 ----
NM_006731chr945010 1883 258 35 15825 ----
NM_006732chr1921352 481 --1238 --
NM_006734chr621414 354 ------
NM_006750chr1697677 7634 7612 5318 5312 2585 1265 1102 862 26491 5705 --15773
NM_006766chr862725 843 251 195 172 130 ------
NM_006775chr673026 2983 2941 2474 2152 978 211 ------
NM_006800chrX2641 544 ------
NM_006801chr192585 566 ------
NM_006805chr51323 ------
NM_006814chr2041720 1625 1011 347 ------
NM_006815chr1261136 1065 976 961 945 383 --1899 --
NM_006827chr1443109 3080 2490 136 13324 ----
NM_006838chr1221650 306 --11551 --
NM_006852chr1722577 1125 ------
NM_006854chr741893 1576 1415 452 ------
NM_006868chr1853183 2814 2273 507 479 1693 11960 --
NM_006874chr421134 926 ------
NM_006875chrX3715 578 286 1651 ----
NM_006885chr16103890 3433 2882 2691 1489 1470 1333 1242 850 314 ------
NM_006912chr142499 1701 337 242 2768 542 ----
NM_006920chr231817 1305 308 ------
NM_006924chr17113953 3409 3382 3347 3012 2840 2748 1681 1387 1274 398 ------
NM_006940chr1221634 451 ------
NM_006948chr2142335 1921 949 194 ------
NM_006951chr102243 25 ----1728
NM_006963chr1021202 980 ------
NM_006981chr931095 874 293 ------
NM_006999chr542093 1340 706 679 ------
NM_007005chr92568 398 ------
NM_007006chr1683484 3380 3080 2624 2446 1013 895 94 ------
NM_007011chr1596589 5419 4631 4272 2740 2453 1845 1689 741 --16674 --
NM_007026chr171214 ------
NM_007031chr212470 25 ------
NM_007038chr2145889 4874 3982 2064 15997 --11519
NM_007050chr2067813 1910 1096 913 848 832 --26699 6588 --
NM_007078chr1072966 2473 1909 1231 842 324 125 --1832 22947 2565
NM_007084chr1321405 1227 ------
NM_007096chr9196 ------
NM_007106chr1311771 ------
NM_007114chr322228 673 ----11237
NM_007118chr51829 ------
NM_007124chr621291 476 1741 11435 --
NM_007129chr131400 ------
NM_007137chrX105462 5051 4869 4683 1862 1544 1214 1160 819 617 --11262 --
NM_007146chr1722485 865 12453 --1532
NM_007166chr1141196 1052 399 243 ------
NM_007172chr223662 346 236 ------
NM_007187chr131167 ------
NM_007189chr71374 ----11034
NM_007203chr963933 3831 1042 251 224 29 ------
NM_007212chr131967 637 177 --12101 --
NM_007214chr62902 58 ------
NM_007222chr821184 99 ------
NM_007236chr1552402 2139 897 642 163 ------
NM_007242chr161244 ------
NM_007246chr43841 803 168 ------
NM_007249chr1369427 8581 5794 3697 2579 156 22846 1781 12765 --
NM_007260chr11751 ------
NM_007345chr1842356 2037 1821 1480 ------
NM_007347chr1553175 1955 825 453 432 ------
NM_007358chr131991 1305 664 ------
NM_007363chrX152 ------
NM_007368chr1311429 ----162
NM_007372chr173226 189 55 ------
NM_012081chr542758 1436 409 95 11021 ----
NM_012095chr1032970 1250 233 ----13036
NM_012104chr1153783 3353 2501 2485 60 ------
NM_012104chr1153783 3353 2501 2485 60 ------
NM_012115chr63412 212 105 ------
NM_012120chr632718 758 582 ------
NM_012141chr1373335 2638 1246 824 438 382 175 ------
NM_012158chr1321684 166 ------
NM_012164chr957073 5609 4911 271 54 --36241 2168 33 --
NM_012176chr51237 ------
NM_012193chr1154755 3888 1946 193 56 ----14968
NM_012197chr931643 591 60 --11112 --
NM_012199chr184158 3876 3786 3673 3353 1551 591 391 --1830 --
NM_012214chr286091 5483 5283 5046 2067 1053 562 256 ----11298
NM_012223chr241118 1097 118 71 21142 90 ----
NM_012224chr42867 774 ------
NM_012229chr101164 ----11029
NM_012233chr21445 ------
NM_012234chr353598 3474 2671 2445 1034 ------
NM_012244chr1441768 1741 1703 131 ------
NM_012249chr243353 2490 867 787 ------
NM_012250chr1131076 358 300 ------
NM_012281chr732436 2199 921 ------
NM_012287chr394249 4167 3435 3318 3109 1435 493 455 100 ------
NM_012295chr221404 ------
NM_012297chr462015 1926 1895 132 81 75 ------
NM_012301chr731825 1747 229 ------
NM_012308chr1152197 2177 2170 2004 304 ----22310 2128
NM_012316chr154139 1669 1077 736 259 11650 1205 24965 4652
NM_012330chr1041584 695 265 207 21733 1339 21399 712 --
NM_012333chr121500 1328 --21199 180 --
NM_012334chr554017 1763 1467 1459 952 ------
NM_012345chr1341719 1703 1673 157 ------
NM_012347chr623021 2987 1672 ----
NM_012406chr1221040 25 ------
NM_012412chr72852 832 ------
NM_012419chr6126 ------
NM_012428chr153866 212 79 ------
NM_012479chr772425 2373 2036 1890 779 663 403 ------
NM_013229chr1222309 588 ------
NM_013254chr122613 168 ------
NM_013255chr798759 7041 6893 6508 5991 2744 2089 1511 56 17399 --15804
NM_013262chr631138 1082 995 --11049 --
NM_013286chr383121 2319 975 526 172 123 113 86 1683 ----
NM_013293chr72679 116 ------
NM_013314chr10189 ------
NM_013316chr71689 ------
NM_013323chr1741212 826 805 328 ------
NM_013357chr8195 ------
NM_013372chr1543016 2772 1202 834 ------
NM_013377chr121187 ------
NM_013386chr121740 152 ------
NM_013433chr1921835 1383 --11365 --
NM_013444chrX1371 ------
NM_013445chr21130 ------
NM_013943chr153266 3122 2737 2133 444 12403 --11151
NM_013993chr61759 ------
NM_013994chr61759 ------
NM_014007chr93427 347 331 ------
NM_014021chr122981 187 ------
NM_014023chr1042881 2688 2626 971 --1941 1932
NM_014048chr1653591 3235 613 585 554 ------
NM_014071chr202427 186 ------
NM_014112chr864383 4308 4128 4075 2061 1014 13370 15188 --
NM_014117chr1662492 2085 1994 1787 850 363 ------
NM_014153chr161249 ------
NM_014154chr341465 1199 1102 96 ------
NM_014155chr1187032 6061 1921 1498 1202 848 734 304 --16674 --
NM_014212chr122974 22 ------
NM_014236chr11239 ------
NM_014243chr421376 392 --12062 --
NM_014250chr2222009 227 --11530 --
NM_014253chrX2836 597 ------
NM_014271chrX1152 ------
NM_014278chr41122 ------
NM_014286chr962560 2552 2409 1041 860 547 --12361 --
NM_014294chr831054 1006 473 ------
NM_014305chr131104 ----1162
NM_014309chr2284668 4655 4535 3868 1700 1593 1139 667 --25014 3662 --
NM_014319chr1231353 518 209 ------
NM_014325chr1221547 915 ------
NM_014331chr467731 7688 6304 2586 2067 97 26388 4909 --11385
NM_014332chrX1339 ------
NM_014333chr1151764 833 599 402 171 22247 1930 ----
NM_014335chr15164 ------
NM_014345chr63984 339 258 ------
NM_014372chr13789 421 42 ------
NM_014423chr555098 5087 3491 2269 1597 --15320 --
NM_014456chr1021684 105 ----21471 442
NM_014458chr11203 ------
NM_014488chr111626 ----1539
NM_014494chr1641643 723 366 284 12367 --11872
NM_014504chr772130 1965 1923 1839 1781 1551 298 ------
NM_014515chr122769 703 ------
NM_014516chr192243 223 ------
NM_014517chr341911 1738 769 690 ------
NM_014572chr131568 ------
NM_014574chr1421037 359 ------
NM_014583chr31485 ------
NM_014591chr1011315 ------
NM_014608chr151183 ------
NM_014612chr92335 123 ------
NM_014614chr221054 119 ------
NM_014616chr353383 3164 3092 2414 505 ------
NM_014618chr91409 ------
NM_014620chr122722 282 ------
NM_014635chr221310 343 ----1430
NM_014636chr934255 2864 542 ------
NM_014637chr841450 1265 375 192 ------
NM_014640chr21292 ------
NM_014644chr11982 ------
NM_014646chr1873238 3039 2632 2041 1256 996 888 11005 1620 --
NM_014666chr52981 880 ------
NM_014669chr161106 ------
NM_014671chr721481 318 ------
NM_014676chr121699 649 ------
NM_014677chr81865 ------
NM_014683chr171831 ----155
NM_014702chr622579 1177 ------
NM_014705chr712009 ------
NM_014711chr1651941 1849 688 555 176 ------
NM_014720chr1041505 720 581 433 ------
NM_014723chr2022098 105 --33002 2693 1042 --
NM_014730chr1284391 3695 2023 1756 1217 1072 870 65 --13940 --
NM_014730chr1284391 3695 2023 1756 1217 1072 870 65 --13940 --
NM_014731chr2021377 546 ----11713
NM_014733chr541901 1687 1390 555 ------
NM_014735chrX31543 1302 269 11632 ----
NM_014739chr634047 3909 1057 ------
NM_014742chr2031780 1125 375 ------
NM_014743chr453082 1956 930 677 400 ------
NM_014747chr145803 3582 1085 1056 ----24601 2232
NM_014750chr14174 ------
NM_014755chr244211 4002 3986 1112 ------
NM_014757chr522219 80 ------
NM_014761chr1631033 955 855 148 --11076
NM_014762chr142464 2373 2240 2106 ------
NM_014770chr121819 ------
NM_014774chr173187 3167 3054 2914 2509 2503 2125 12385 ----
NM_014787chr152810 2802 2656 2276 536 --1265 --
NM_014802chr121143 ------
NM_014810chr11859 ------
NM_014811chr91230 ------
NM_014819chr531864 875 567 ------
NM_014830chr1231486 839 594 2456 265 13350 1649
NM_014840chr1233407 3158 214 --11321 --
NM_014841chr61286 ------
NM_014872chr942233 2005 571 56 --177 --
NM_014873chr134793 3154 954 34784 4100 1658 --1146
NM_014877chr17167655 7635 6803 6752 5645 5565 5304 3062 2329 1645 1468 1247 972 945 705 534 27359 1628 26550 2711 --
NM_014883chr442066 2003 865 676 ------
NM_014887chr131763 ------
NM_014897chr1762639 2168 2125 2057 599 450 ------
NM_014900chr231187 456 70 ------
NM_014901chr531984 866 829 ------
NM_014902chr2021118 163 ------
NM_014903chr1211637 ------
NM_014906chr1743898 1565 724 500 1696 ----
NM_014912chr101645 ------
NM_014918chr1531377 1361 1285 ------
NM_014926chr31932 ------
NM_014938chr1222467 170 ----22531 201
NM_014944chr11964 ------
NM_014945chr511869 ------
NM_014946chr232994 2964 1919 ------
NM_014970chr1166 ------
NM_014982chr1485373 4666 4008 3331 2042 2036 1995 1380 ----1651
NM_014988chr42587 185 ----1320
NM_014989chr621731 519 ------
NM_014992chr141738 ------
NM_015000chr1242946 2829 2538 973 --12252 --
NM_015001chr11277 ------
NM_015008chr363289 1366 1072 867 474 198 ------
NM_015023chr1180 ------
NM_015026chr1254708 3784 1761 1146 779 ------
NM_015027chr1631742 352 125 ------
NM_015032chr1352934 2263 139 62 38 ------
NM_015040chr253389 3330 3106 2817 181 ----11109
NM_015045chr1062180 1935 1740 639 541 269 --12240 --
NM_015049chr232905 2472 2265 ------
NM_015051chr942621 2300 538 124 11191 ----
NM_015052chr71101 ------
NM_015054chr122206 190 ------
NM_015055chr1152538 1931 1821 867 717 --185 1129
NM_015057chr131194 ------
NM_015061chr91645 ------
NM_015068chr732716 2538 1044 ------
NM_015071chr546140 5372 1964 799 ------
NM_015073chr1921894 1850 11375 ----
NM_015074chr134794 940 350 ------
NM_015075chrX11687 ------
NM_015079chr1523225 308 12245 ----
NM_015080chr111304 ------
NM_015091chr141549 ------
NM_015092chr1664610 3888 3583 3060 3029 971 ----11552
NM_015097chr331888 780 92 --1565 --
NM_015100chr132026 1962 1841 --1431 --
NM_015101chr152296 2194 601 466 228 ------
NM_015107chrX11691 ------
NM_015110chr922399 109 ------
NM_015116chr1331741 1642 486 --1396 --
NM_015132chr731331 1211 731 11485 ----
NM_015138chr1531035 830 509 --186 --
NM_015144chr1643926 3701 1215 258 ------
NM_015153chr61621 ------
NM_015156chr1442521 1253 864 503 ------
NM_015163chr1411629 ----1542
NM_015170chr832119 1655 1598 ------
NM_015172chr121480 1453 ------
NM_015173chr411750 ------
NM_015176chr121512 500 --1640 --
NM_015185chrX42157 2099 1119 218 --12843 --
NM_015192chr2062905 2658 2608 2224 1929 1897 ------
NM_015196chr41102 ------
NM_015197chr1433391 1019 915 ------
NM_015199chr342976 2581 814 578 --22876 2216 --
NM_015208chr1822888 172 ----13842
NM_015215chr142033 982 187 150 ----1483
NM_015225chr943089 2617 1074 383 ------
NM_015234chr611357 ------
NM_015235chr103492 460 410 ------
NM_015236chr41474 ------
NM_015247chr1635205 1339 294 ----13523
NM_015250chr91121 ----11272
NM_015264chr2223559 3340 13185 21296 1270 --
NM_015265chr252680 558 159 111 101 ------
NM_015271chr484226 3278 2644 1199 960 667 522 492 1764 11629 --
NM_015275chr123854 842 744 ------
NM_015278chr652781 2646 2453 899 789 ------
NM_015282chr242908 2898 377 133 ------
NM_015291chr143446 2695 1404 566 13164 ----
NM_015310chr877916 6968 5976 5122 3264 1850 280 ----12625
NM_015313chr1174513 4367 4243 3226 2931 1462 826 21894 1040 24496 287 --
NM_015317chr252632 2584 2021 1741 173 ------
NM_015335chr1232273 543 388 --11833 --
NM_015336chr121267 ----12368
NM_015339chr201901 ----1409
NM_015344chr82300 198 11640 ----
NM_015346chr1441545 1495 634 400 11705 1558 --
NM_015354chr91370 ------
NM_015358chr2121254 43 ------
NM_015365chrX33054 1521 245 1500 ----
NM_015394chr122813 505 ------
NM_015396chr33579 272 215 ------
NM_015397chr921442 200 1406 --1575
NM_015443chr1731391 1105 139 ------
NM_015455chr544110 3399 3222 1108 ------
NM_015477chr151231 ------
NM_015509chr121255 --11387 --
NM_015517chr111531 ------
NM_015520chr341892 1014 927 321 ------
NM_015541chr341376 1162 432 346 ------
NM_015550chr732952 2495 960 12345 13420 --
NM_015557chr153648 3535 2766 2309 610 12325 12418 13677
NM_015565chr212905 135 ------
NM_015567chr1311025 ------
NM_015571chr631951 723 57 ------
NM_015575chr272788 2455 1482 1442 930 847 62 13230 --1559
NM_015578chr192472 179 ------
NM_015605chr1051333 1164 1042 571 26 11030 ----
NM_015630chr21957 ------
NM_015640chr195394 5292 5151 3681 3463 1669 1575 1092 557 24846 1101 ----
NM_015641chr73962 260 138 ------
NM_015642chr3197 ------
NM_015678chr1331631 632 244 ------
NM_015693chr41250 ------
NM_015695chr621558 1400 11496 ----
NM_015713chr853518 3214 2354 1429 870 1907 --1682
NM_015831chr71240 ------
NM_015850chr832086 1863 1855 ------
NM_015866chr141260 1145 439 317 ------
NM_015872chr11400 ------
NM_015874chr41584 ------
NM_015878chr832223 1429 108 1140 --1591
NM_015879chr1878307 8226 6789 5924 5658 5547 2951 1235 18651 --
NM_015886chr855450 5369 3586 1928 1035 ----14230
NM_015902chr81852 ------
NM_015906chr154828 3108 3012 1000 390 --11745 --
NM_015975chrX2500 460 ------
NM_015980chr521620 561 ------
NM_016010chr81143 ------
NM_016021chr622721 323 22693 832 12251 --
NM_016025chr162510 498 ------
NM_016045chr203542 342 93 11135 ----
NM_016075chr1352701 2418 2040 1142 373 ------
NM_016079chr232271 2031 99 1145 ----
NM_016120chrX11164 ------
NM_016121chr15898 884 421 265 183 ------
NM_016127chr8141 ------
NM_016132chr1563093 2282 1316 1200 424 182 12876 ----
NM_016152chr3194 ------
NM_016157chrX162 ------
NM_016203chr711028 ------
NM_016217chr672589 1354 1200 1051 780 404 225 12540 ----
NM_016224chr631706 840 237 ------
NM_016248chr1383685 2788 2577 1445 1383 890 479 39 ------
NM_016255chr652684 1184 1167 446 351 ------
NM_016257chr133092 1412 481 ------
NM_016258chr13693 259 253 ------
NM_016260chr287060 6842 4940 2671 2309 2218 1665 399 22485 2005 ----
NM_016271chr1831528 1452 740 11932 ----
NM_016282chr921453 141 ------
NM_016287chr1----1604 1548
NM_016298chr342343 1137 945 521 ------
NM_016308chr131895 619 165 ------
NM_016315chr211554 ------
NM_016322chr983239 2827 2750 2708 2487 874 489 327 ------
NM_016329chr32519 342 1444 ----
NM_016331chr3158 ------
NM_016333chr161482 ------
NM_016353chr842080 1646 178 111 ------
NM_016374chr111275 ------
NM_016374chr111275 ------
NM_016376chr1784160 4103 3786 3691 3602 3465 2792 1185 ------
NM_016422chr1132379 644 589 ----1984
NM_016423chr141395 ------
NM_016424chr1741940 1561 381 254 11315 ----
NM_016433chr1231605 328 183 ----1450
NM_016436chr2041922 866 434 165 ----12187
NM_016467chr231297 951 538 ------
NM_016480chr53808 786 21 ------
NM_016485chr6132 ------
NM_016506chr114575 563 157 96 ------
NM_016507chr1752240 1949 496 444 390 12424 ----
NM_016525chr92626 105 ------
NM_016542chrX1102 ------
NM_016575chr1275334 4505 4497 3902 3693 2148 88 11116 14010 --
NM_016604chr51252 ------
NM_016620chr121398 1064 ------
NM_016621chr1154335 1704 1692 116 108 12906 13499 --
NM_016631chr212976 709 ------
NM_016639chr161503 ------
NM_016651chr1441159 955 775 366 1764 ----
NM_016654chr1531199 929 34 ------
NM_016656chrX1422 ------
NM_016824chr1031825 1496 416 ------
NM_016836chr21761 ------
NM_016839chr21761 ------
NM_016931chr111363 ------
NM_017420chr1453518 2909 1397 907 28 ------
NM_017423chr412027 1864 --1319
NM_017447chr2174257 3169 3153 1587 603 202 192 --1966 --
NM_017450chr171134 ------
NM_017455chr153866 212 79 ------
NM_017519chr61331 --1217 --
NM_017522chr141332 908 566 392 ------
NM_017580chr1052400 2141 1684 656 650 ------
NM_017633chr643797 3203 3035 1314 ------
NM_017637chr989386 9322 8476 8340 6866 5703 2591 2472 1225 ----
NM_017638chr13901 68 25 ----1614
NM_017643chr1753007 2508 2499 403 305 1425 ----
NM_017644chr334076 3668 3235 --11087 --
NM_017650chr775940 5304 5024 3765 3675 2161 210 ----12072
NM_017655chr131534 147 82 ------
NM_017658chr1493759 3476 3167 3072 1511 971 636 510 167 ------
NM_017661chr1531208 1033 431 ------
NM_017666chrX42161 1643 791 700 ------
NM_017672chr151418 ------
NM_017673chr12882 79 ------
NM_017684chr1531419 1251 399 ------
NM_017709chr143654 1590 992 339 11285 --13342
NM_017712chr1996022 5191 5118 1675 1474 1319 790 629 603 12176 --24616 4306
NM_017737chr142126 1887 638 59 ------
NM_017738chr921241 810 ------
NM_017740chr1631157 461 54 ------
NM_017742chr1821700 1287 ------
NM_017753chr91187 ------
NM_017754chr664604 4154 3439 3250 472 269 2968 577 --11852
NM_017778chr851435 1112 943 439 290 ------
NM_017799chr1421678 1505 ------
NM_017801chr362512 1849 1000 578 237 109 ------
NM_017822chr123769 683 26 1238 ----
NM_017845chr41281 1668 --1782
NM_017848chrX84486 3773 3522 3320 1554 549 357 116 13054 24548 3284 --
NM_017893chr1011005 ------
NM_017896chr2062523 1272 626 572 551 201 --1780 12483
NM_017902chr1045546 5216 1751 280 25478 1904 ----
NM_017906chr62186 107 ------
NM_017944chr1131990 80 37 11074 ----
NM_017983chr173464 419 51 ------
NM_017987chr1032027 2000 894 ------
NM_017988chr121317 ------
NM_018023chr312033 ------
NM_018036chr1464496 3909 2781 1316 1120 715 --13856 --
NM_018043chr1111036 ------
NM_018045chr133025 2192 1206 --12295 1205
NM_018049chr193106 99 92 ------
NM_018070chr11379 ------
NM_018084chr242498 1321 828 518 ------
NM_018095chr114575 563 157 96 ------
NM_018103chr11219 ------
NM_018110chr1621086 1058 --11316 --
NM_018115chr44715 667 558 158 ------
NM_018120chr831260 1183 222 ------
NM_018121chr1042645 2133 1034 892 --12317 1914
NM_018125chr11175 ------
NM_018131chr102771 345 ------
NM_018133chr362178 1571 1561 1437 831 268 ------
NM_018155chr353270 3012 2799 1164 576 3998 664 103 ----
NM_018178chr13506 292 130 ------
NM_018179chr12147 --1206 --
NM_018181chr1821238 281 11542 ----
NM_018195chr1151763 1642 1489 342 154 21534 1462 ----
NM_018196chrX21307 269 ------
NM_018199chr1421196 189 ------
NM_018214chr621198 435 ------
NM_018217chr20161 ------
NM_018227chr443117 2273 171 42 ------
NM_018247chr631150 1081 906 ------
NM_018279chr1232849 2562 1944 ------
NM_018287chr1021062 83 1935 ----
NM_018293chr312799 --12561 --
NM_018299chr852840 838 787 339 282 ------
NM_018301chrX1142 ------
NM_018302chr422408 1934 ----2970 685
NM_018312chr1132050 801 503 1781 11984 --
NM_018313chr332434 1754 360 --11914 --
NM_018318chr121180 ------
NM_018323chr441359 718 595 570 ------
NM_018325chr941562 1118 400 390 1216 ----
NM_018327chr201106 ------
NM_018330chr102640 414 ------
NM_018334chr71496 ------
NM_018351chr1244528 3162 2909 603 11312 ----
NM_018364chr122635 739 ------
NM_018373chr1445268 2043 1187 762 --14677 11318
NM_018374chr775034 4907 3187 1592 1181 1037 337 ------
NM_018388chrX1338 ------
NM_018394chr311371 ------
NM_018416chr1242176 1672 884 422 --12278 --
NM_018440chr858126 6653 3102 1804 681 ----16176
NM_018509chr1721716 1391 ------
NM_018557chr251663 1337 331 144 85 ------
NM_018566chr141929 1488 451 344 13365 11032 --
NM_018569chr431521 1145 486 ------
NM_018590chr10189 ------
NM_018602chr1531046 158 146 198 ----
NM_018638chr1264519 4260 2230 2103 1833 619 12269 ----
NM_018649chr101527 ------
NM_018657chr34816 655 233 173 ------
NM_018695chr532180 2035 295 11567 ----
NM_018696chr183726 387 99 ------
NM_018700chr511361 ------
NM_018710chr81253 ----1131
NM_018846chr73294 98 85 ------
NM_018847chr911215 ------
NM_018898chr511757 ------
NM_018899chr511757 ------
NM_018900chr511757 ------
NM_018901chr511757 ------
NM_018902chr511757 ------
NM_018903chr511757 ------
NM_018904chr511757 ------
NM_018905chr511757 ------
NM_018906chr511757 ------
NM_018907chr511757 ------
NM_018908chr511757 ------
NM_018909chr511757 ------
NM_018910chr511757 ------
NM_018911chr511757 ------
NM_018945chr652269 1421 1111 566 121 --1643 12814
NM_018957chr221348 ------
NM_018959chr192294 135 --1493 --
NM_018972chr852534 2422 1825 1044 864 ------
NM_018979chr1232248 1826 374 --12515 --
NM_018999chr1054459 3855 2995 1483 374 ------
NM_019000chr521616 1230 ------
NM_019004chr721930 428 --1372 --
NM_019005chr71267 ------
NM_019006chr152281 132 ------
NM_019022chr1833125 2899 408 ----22885 2209
NM_019036chr61940 ------
NM_019045chrX2367 317 ------
NM_019072chr524270 3585 ------
NM_019083chr12337 136 ------
NM_019084chr1031888 1853 1020 12196 12323 --
NM_019091chr231087 1061 997 ------
NM_019095chr20189 ------
NM_019116chr1652926 1428 1006 612 406 13674 1792 --
NM_019593chr20292 26 ------
NM_019597chrX2702 574 ------
NM_019605chr11675 ------
NM_019610chr132176 1885 1586 ------
NM_019857chrX41658 1271 666 223 ------
NM_019862chr1631704 655 322 ------
NM_019898chr1631704 655 322 ------
NM_019899chr1631704 655 322 ------
NM_019900chr1631704 655 322 ------
NM_019903chr1031825 1496 416 ------
NM_020116chr41374 ------
NM_020122chr272417 1970 1855 1291 1270 1177 1166 ----14740
NM_020135chr61410 ------
NM_020139chr421832 1795 --1287 1768
NM_020152chr212820 221 ------
NM_020159chr411304 ------
NM_020193chr1121290 1065 ------
NM_020199chr53486 444 130 ------
NM_020205chr132978 2310 1116 23052 2851 ----
NM_020336chr2032867 1409 1122 23449 39 21049 169 --
NM_020337chr432805 2654 2292 ------
NM_020341chr2011899 ------
NM_020342chr242319 2210 1891 784 --1388 --
NM_020357chr321121 88 ------
NM_020416chr462632 2484 869 560 502 150 --12212 --
NM_020438chr931208 406 379 ------
NM_020443chr155748 5198 1040 988 828 1208 25067 256 14884
NM_020452chr122029 1870 1640 ----
NM_020453chr431349 590 254 ------
NM_020455chr632733 1974 1068 ------
NM_020463chr231353 1326 287 ------
NM_020466chr665044 4326 3829 3620 3288 1986 ------
NM_020478chr842339 2269 383 377 ------
NM_020529chr141460 ------
NM_020631chr121064 412 --1465 --
NM_020640chr34877 517 511 187 --1431 --
NM_020647chr822167 1973 --1215 --
NM_020648chr1842848 2298 239 119 ------
NM_020655chr161186 ------
NM_020661chr1222029 1576 11487 ----
NM_020673chr2067366 7058 5464 4711 2619 843 --15704 --
NM_020717chrX34194 3160 690 ----14722
NM_020718chr1686295 5652 4618 4094 2374 1917 1224 326 14821 14705 --
NM_020732chr61331 --1217 --
NM_020734chr1243154 2904 991 950 ------
NM_020739chr1551399 1364 899 330 236 ------
NM_020747chr51608 ------
NM_020749chr841924 1597 1447 694 ----11326
NM_020752chr1042659 745 583 196 ------
NM_020766chrX63660 2984 2788 1218 870 209 ------
NM_020768chr542107 2082 1207 427 1686 12155 22948 1195
NM_020772chr1777470 7276 5920 2748 1558 1539 505 15824 11243 12799
NM_020774chr1895987 5947 5529 4900 4731 2242 1342 1260 246 15098 ----
NM_020778chr1563810 1868 1531 1410 1262 174 --14333 --
NM_020781chr742822 2398 161 123 ------
NM_020783chr1822343 1750 ----11625
NM_020791chr1731140 382 208 ------
NM_020792chr342026 721 529 56 1759 1308 --
NM_020794chr11980 ------
NM_020796chr512382 ------
NM_020800chr3173 ------
NM_020821chr1531419 1251 399 ------
NM_020825chr1623764 1530 23748 1050 --13159
NM_020830chr221146 153 ------
NM_020839chr341610 1448 1121 1106 ------
NM_020841chr1213043 ------
NM_020844chr887229 5460 4838 2859 2659 1867 1834 113 16188 12815 1709
NM_020854chr183503 306 179 ------
NM_020856chr1911410 ------
NM_020859chr463143 2765 1566 1470 1301 933 ----13670
NM_020860chr421079 82 ------
NM_020865chr3166 ------
NM_020870chr42504 361 11912 --1567
NM_020921chr1463417 3352 795 713 461 310 ------
NM_020940chr1052815 2542 2386 1062 403 ------
NM_020948chr12291 27 ------
NM_020960chr974672 4624 4617 3673 3519 885 512 21519 481 ----
NM_020977chr441885 1855 1385 1372 ------
NM_020993chr1222774 372 12029 ----
NM_021005chr151289 ------
NM_021025chr51349 ------
NM_021033chr1363315 2915 2771 1288 1107 172 ------
NM_021061chr864489 4143 4089 1214 251 108 13987 --14185
NM_021097chr252790 1912 497 435 293 1373 ----
NM_021116chr758646 5994 5968 5796 3634 ----16277
NM_021144chr9122 ------
NM_021145chr71972 ------
NM_021148chr75816 810 804 732 694 ------
NM_021149chr1611158 ------
NM_021155chr1942990 979 275 258 1910 1216 1963
NM_021159chr41430 ------
NM_021161chr141465 ------
NM_021167chr742686 2421 2284 2249 1493 --1663
NM_021174chr81755 ------
NM_021179chr1147 ------
NM_021190chr11112 ------
NM_021194chr11220 ------
NM_021203chr32362 48 ------
NM_021220chr20159 ------
NM_021222chr131306 906 470 ------
NM_021224chr91392 ----1453
NM_021238chr1231865 1718 1380 ------
NM_021239chr1431382 576 134 ------
NM_021620chr62758 752 ------
NM_021629chr394351 4068 3911 3903 3643 3529 3401 1712 666 11754 --13228
NM_021638chr454441 3776 1745 612 212 ------
NM_021643chr221505 1424 ------
NM_021738chr10177 ------
NM_021785chrX1100 ------
NM_021813chr655707 1622 871 783 729 15201 ----
NM_021911chr575133 4880 2146 1355 1232 634 156 14215 12056 --
NM_021912chr1514144 ------
NM_021914chr1421897 80 11819 ----
NM_021931chr2011068 ------
NM_021945chr643347 2221 243 188 --13546 --
NM_021960chr132402 949 561 22445 247 11821 --
NM_021964chr394165 2533 2518 2121 2087 1851 1470 1062 1034 ------
NM_021965chr93172 125 99 ------
NM_022041chr1642065 381 123 107 1169 12739 --
NM_022048chr1576134 6026 4618 4599 4566 2312 1399 12442 35317 4573 95 --
NM_022062chr1111721 ------
NM_022114chr133937 1477 445 ------
NM_022117chrX2208 174 ------
NM_022118chr13196 ------
NM_022130chr52322 262 ------
NM_022133chr811760 ------
NM_022137chr143286 254 165 ------
NM_022138chr631480 1412 1274 ------
NM_022166chr1665771 4881 4537 2072 576 186 15145 12461 12390
NM_022340chr341342 1175 1081 946 --126 22702 813
NM_022351chr833510 2748 771 ------
NM_022353chr21171 ------
NM_022366chr1121 ------
NM_022456chr1276890 6162 5638 2632 1638 948 578 ----35174 2761 2127
NM_022457chr11118 ------
NM_022459chr1365216 5175 4242 4236 113 106 ------
NM_022473chr1564399 3400 2985 2739 1191 875 14032 --21627 1316
NM_022574chr751862 1349 824 432 345 --1660 --
NM_022652chr1221186 189 --1985 --
NM_022659chr82346 79 ------
NM_022716chr142439 2043 1996 1985 ------
NM_022720chr221564 ------
NM_022726chr631177 1104 539 --1260 --
NM_022731chr1195 ------
NM_022735chr131849 1824 1427 --2551 183 --
NM_022737chr1911009 ------
NM_022739chr1721205 822 ------
NM_022753chr12145 97 ----12037
NM_022763chr332235 1172 147 ------
NM_022781chr973307 3095 2924 2756 2737 2391 30 --12995 12438
NM_022843chr1341318 1100 1094 46 ------
NM_022845chr1621724 417 ------
NM_022893chr243137 2508 2354 551 ------
NM_022898chr14124729 4423 3977 3806 3689 1450 968 824 611 598 420 255 11870 ----
NM_022912chr221180 525 ------
NM_023000chr1421158 1117 ------
NM_023001chr1421158 1117 ------
NM_023011chr131846 ------
NM_023035chr191321 --1332 --
NM_023071chr122173 137 ----1735
NM_023105chr832086 1863 1855 ------
NM_023106chr832086 1863 1855 ------
NM_023110chr832086 1863 1855 ------
NM_023111chr832086 1863 1855 ------
NM_023940chr42978 806 ------
NM_024052chr1722486 1029 13089 12404 --
NM_024055chr51647 ------
NM_024086chr1743463 3062 1543 46 ------
NM_024094chr82690 641 ------
NM_024315chr7168 ------
NM_024336chr162348 238 ------
NM_024345chr985425 5157 5069 4658 1861 799 364 101 ----11581
NM_024408chr182951 2646 2572 758 670 627 569 476 12990 22705 2401 --
NM_024423chr1843450 1156 721 624 ----11718
NM_024429chr711028 ------
NM_024496chr141654 ------
NM_024503chr11278 ------
NM_024545chr2170 ------
NM_024551chr1232492 2374 1801 21663 457 --22020 751
NM_024551chr1232492 2374 1801 21663 457 --22020 751
NM_024576chr61153 ------
NM_024586chr11574 ----176
NM_024607chr833904 3183 945 1121 1428 21620 989
NM_024613chr831669 1516 466 --155 --
NM_024630chr62822 259 ------
NM_024645chr831507 197 152 ------
NM_024665chr374155 989 800 698 487 327 261 1836 14352 --
NM_024675chr16159 ------
NM_024702chr171210 ------
NM_024721chr81260 ------
NM_024744chr252478 2301 2189 1647 328 ------
NM_024755chr151152 ------
NM_024757chr931114 973 240 ------
NM_024761chr965225 4914 4538 4054 1764 443 13669 ----
NM_024783chr111376 ------
NM_024785chr221133 445 ------
NM_024789chr102111 68 ------
NM_024837chr1511945 ------
NM_024884chr1454095 3925 3831 3752 1295 ----1370
NM_024900chr411749 ------
NM_024900chr411749 ------
NM_024911chr11175 ------
NM_024917chrX3832 333 117 ------
NM_024926chr71224 ------
NM_024947chr398960 8916 8650 6520 6313 3603 1733 1239 722 ------
NM_024953chr1232166 614 405 2965 789 ----
NM_024969chr22660 317 ------
NM_024989chr268162 3122 1569 520 509 98 16762 ----
NM_025054chr834134 1567 1442 ------
NM_025073chr123581 3501 14347 ----
NM_025076chr2158 ------
NM_025133chr2161 ------
NM_025134chr1642435 770 414 38 ------
NM_025146chr352649 2530 1718 737 626 --1435 1453
NM_025147chr22912 113 ------
NM_025154chr751493 1396 1013 384 346 11390 ----
NM_025160chr164287 3583 2956 2730 1080 1035 ------
NM_025164chr114769 314 289 161 ------
NM_025204chr2211073 ------
NM_025222chr322961 2918 ----12292
NM_025236chr62791 56 ------
NM_025248chr1773237 2477 2301 1290 1254 774 179 ------
NM_030621chr1453318 1278 903 710 183 ------
NM_030627chr553754 3597 3194 2661 336 --11141 --
NM_030634chr132132 671 395 --1759 1170
NM_030647chr795752 5696 5180 5170 5042 2066 1291 184 33 ------
NM_030648chr465341 5081 4973 4172 513 259 ------
NM_030650chr263429 3373 3343 2805 1459 349 ------
NM_030660chr1421300 76 ------
NM_030664chr1021668 619 ------
NM_030667chr1231135 1086 188 ------
NM_030668chr1231135 1086 188 ------
NM_030669chr1231135 1086 188 ------
NM_030670chr1242167 2118 1779 595 ------
NM_030671chr1242167 2118 1779 595 ------
NM_030674chr1254158 2218 734 495 139 15087 --15439
NM_030755chr1463125 2852 2609 2435 897 823 ----11970
NM_030782chr5158 ------
NM_030784chr6125 ------
NM_030791chr1431753 1507 641 ------
NM_030799chr521871 1659 ----1433
NM_030801chrX1170 ------
NM_030806chr176732 2907 1894 1760 1741 1467 501 17312 ----
NM_030877chr202103 82 ------
NM_030885chr362293 2204 1660 1631 695 384 ------
NM_030912chr104604 157 151 139 ------
NM_030937chr141165 1159 975 138 ------
NM_030939chr641143 932 825 793 ------
NM_030940chr921047 200 --154 --
NM_030949chr631228 182 129 ------
NM_030953chr541621 1458 322 180 ------
NM_031244chr611128 ------
NM_031283chr21860 ------
NM_031296chr422596 1733 ------
NM_031371chr111275 ------
NM_031371chr111275 ------
NM_031411chr511757 ------
NM_031422chr181491 ------
NM_031427chr1475808 4842 4821 4023 2164 1933 781 ----24171 1562
NM_031442chrX32146 581 142 ------
NM_031445chr222899 2369 --1613 --
NM_031461chr822229 2192 ----1183
NM_031468chr797674 7167 6747 6272 5626 5215 5107 1577 713 15775 1910 --
NM_031483chr2043592 2520 858 367 ------
NM_031844chr133967 2523 1644 11076 --13385
NM_031845chr221177 876 1536 --11406
NM_031847chr221177 876 1536 --11406
NM_031849chr511757 ------
NM_031857chr511757 ------
NM_031858chr1731085 334 157 ------
NM_031860chr511757 ------
NM_031862chr1731085 334 157 ------
NM_031890chr2242428 1929 1034 29 ------
NM_031899chr331630 167 102 ------
NM_031904chr1151488 1376 751 423 153 1397 --12086
NM_031911chr432817 2640 1825 ------
NM_031942chr21956 ------
NM_031989chr121243 ------
NM_031990chr1911032 ------
NM_031991chr1911032 ------
NM_032012chr974919 4752 4094 3380 1763 1457 301 ------
NM_032047chr332308 2181 338 ------
NM_032102chr1132363 1080 301 ----12055
NM_032116chr1365107 4787 3985 3705 1457 461 ------
NM_032128chr44711 161 152 51 ------
NM_032132chr11133 ------
NM_032138chr131526 ------
NM_032144chr221245 1171 ------
NM_032145chr631428 283 205 ------
NM_032153chr342777 798 548 446 --11849 11716
NM_032160chr1844066 3411 3361 1166 13627 ----
NM_032186chr121398 1064 ------
NM_032189chr1322002 1456 ------
NM_032229chr1311115 ------
NM_032281chr191705 ------
NM_032288chr342319 2309 2058 260 11933 ----
NM_032291chr1174 ------
NM_032317chr721483 1333 ----11343
NM_032329chr254441 4390 3021 2831 2797 ------
NM_032374chr1421576 137 --11240 31650 1363 343
NM_032412chr51242 ------
NM_032413chr151132 ------
NM_032438chr631165 330 216 ------
NM_032440chr1032630 1991 1904 12219 ----
NM_032445chr1521763 423 ------
NM_032446chr553509 2772 2584 1266 119 ------
NM_032457chr433047 1449 1051 1578 ----
NM_032458chrX32345 2144 1316 ------
NM_032466chr811063 ----1115
NM_032468chr811063 ----1115
NM_032491chr1211029 ------
NM_032521chr2022623 174 ------
NM_032574chr2192 ------
NM_032578chr1021001 477 ----1274
NM_032582chr1711339 ------
NM_032595chr1721280 1061 ------
NM_032682chr363184 3050 2338 2268 833 662 1177 ----
NM_032711chr1763785 3497 2989 2749 2742 1268 ----13285
NM_032717chr42927 168 ------
NM_032800chr152530 2388 2160 413 167 ------
NM_032801chr1132475 557 129 ------
NM_032812chr101302 ------
NM_032818chr922144 596 32476 551 408 --1217
NM_032833chr132370 2141 929 --1405 1688
NM_032837chr1711870 ------
NM_032859chr1353344 2949 2474 798 573 --1356 --
NM_032876chr1452038 1727 1428 1380 585 ------
NM_032884chr1163 ------
NM_032892chr151281 ------
NM_032900chr1073827 3458 3447 2597 1261 494 414 ----1545
NM_032932chr1785390 4685 1926 1836 1629 1381 856 488 1804 --24818 4524
NM_032940chr161866 ------
NM_032975chr1863625 3245 2694 2657 2640 1008 --1726 11347
NM_032980chr1863625 3245 2694 2657 2640 1008 --1726 11347
NM_033012chr1311066 ------
NM_033020chr154828 3108 3012 1000 390 --11745 --
NM_033023chr711136 ----1421
NM_033105chr81123 ------
NM_033116chr141202 ------
NM_033117chr91139 ------
NM_033121chr1211193 --11392 --
NM_033132chr1332054 1667 189 ------
NM_033141chr1431711 747 441 ----12000
NM_033143chr454612 4459 1070 693 327 11585 ----
NM_033224chr767412 7125 2678 1770 952 481 27613 6500 ----
NM_033253chr24338 144 120 59 --1683 --
NM_033300chr141332 908 566 392 ------
NM_033326chr1142336 1859 640 325 ------
NM_033331chr953028 2942 1455 1031 176 ------
NM_033360chr1273231 2810 1376 1075 881 391 324 14148 ----
NM_033389chr17104508 3634 3625 3093 3004 2946 1828 1104 139 104 13198 1954 --
NM_033393chr41682 ----22457 430
NM_033426chr1422647 2050 1220 ----
NM_033480chr623021 2987 1672 ----
NM_033481chr623021 2987 1672 ----
NM_033505chr275904 2466 2039 1999 1312 213 160 ----15049
NM_033512chr842917 2205 552 109 ----12564
NM_033637chr1054135 2975 2783 1317 616 ------
NM_033656chr2185638 5576 4280 2335 2194 2042 1681 219 13875 --15593
NM_052818chr1321860 736 1864 --1579
NM_052875chr1132177 1533 1487 ----1514
NM_052879chr1263578 3549 3170 273 137 75 11182 ----
NM_052880chr2221051 121 1471 21310 533 --
NM_052900chr811535 ------
NM_052918chr1043652 1376 696 524 12544 ----
NM_052932chr1162481 2219 387 272 177 59 ------
NM_052937chr832399 2232 1932 ------
NM_052958chr81718 ------
NM_052971chr5181 ------
NM_053016chr945535 5147 5019 3022 --16620 16368
NM_053023chr1142965 2094 1091 884 ------
NM_053043chr774751 4444 2190 2142 1886 1199 512 ----1891
NM_053064chr1452339 2274 2219 2114 989 ------
NM_054033chr21215 ------
NM_078629chrX2641 544 ------
NM_078630chrX2641 544 ------
NM_080422chr181317 ------
NM_080423chr181317 ------
NM_080546chr911984 ------
NM_080647chr221465 ------
NM_080654chr1131281 184 32 --11033 --
NM_080743chr632298 1744 147 --1116 21824 968
NM_080759chr1312297 ------
NM_080760chr1312297 ------
NM_080792chr2022283 1852 ------
NM_080836chr2074101 3768 3073 1712 383 164 22 11728 ----
NM_080867chr1433948 1931 77 --24112 942 --
NM_080872chr833935 3421 235 ----13380
NM_080927chr352987 2371 2082 1020 676 ------
NM_130391chr963398 3259 3249 3242 2367 848 ------
NM_130392chr963398 3259 3249 3242 2367 848 ------
NM_130393chr963398 3259 3249 3242 2367 848 ------
NM_130395chr61410 ------
NM_130436chr2151812 892 832 480 458 ----1822
NM_130438chr2142389 1057 1035 363 ------
NM_130446chr374266 3694 3619 3137 1440 993 162 12861 1137 --
NM_130798chr1521168 533 ------
NM_130808chr31127 ------
NM_133170chr2067813 1910 1096 913 848 832 --26699 6588 --
NM_133171chr203855 110 43 ------
NM_133177chr12962 356 ------
NM_133178chr12962 356 ------
NM_133265chrX73551 2681 2404 648 632 537 181 11457 --11211
NM_133334chr444457 1436 1077 879 15940 24249 2390 14404
NM_133338chr51464 ------
NM_133339chr51464 ------
NM_133340chr51464 ------
NM_133341chr51464 ------
NM_133342chr51464 ------
NM_133343chr51464 ------
NM_133344chr51464 ------
NM_133370chr473595 3415 2943 2755 1285 1278 336 ------
NM_133450chr161374 ------
NM_133486chrX1367 ------
NM_133493chr654450 3050 3037 1522 258 24499 911 ----
NM_133496chr174470 4430 4358 3865 3207 2880 207 ------
NM_133499chrX1142 ------
NM_133631chr31627 ------
NM_133638chr52418 161 ----11379
NM_133647chr151721 ----11397
NM_134260chr151126 ------
NM_134261chr151126 ------
NM_134262chr151126 ------
NM_134428chr91126 ------
NM_138270chrX32880 2371 1315 --12284 --
NM_138317chr141465 ------
NM_138318chr141465 ------
NM_138333chr942043 1000 893 172 ----12330
NM_138338chr2222535 317 --12719 --
NM_138344chr141434 ------
NM_138357chr1011719 ----11399
NM_138369chr5136 ------
NM_138423chr152913 207 ------
NM_138426chr712162 ------
NM_138444chr1354172 1760 1352 1321 207 --13031 --
NM_138468chr296160 5777 5278 4300 2182 514 479 433 341 ----22224 1397
NM_138473chr1245129 3660 3633 1144 35108 3958 684 13862 --
NM_138554chr932111 908 377 ------
NM_138569chr6144 ------
NM_138576chr14124729 4423 3977 3806 3689 1450 968 824 611 598 420 255 11870 ----
NM_138609chr53468 420 138 ------
NM_138610chr53468 420 138 ------
NM_138638chr1421897 80 11819 ----
NM_138713chr16117337 7055 6255 5915 5157 1954 1919 1512 1440 1359 939 16083 --25715 5204
NM_138714chr16117337 7055 6255 5915 5157 1954 1919 1512 1440 1359 939 16083 --25715 5204
NM_138731chr1424151 3753 ------
NM_138732chr111304 ------
NM_138734chr111304 ------
NM_138782chr532311 914 456 ------
NM_138927chr211327 ------
NM_138959chr196741 6295 5572 5560 4577 4232 4205 1637 1214 25592 1898 15514 --
NM_138966chr181618 ------
NM_138971chr1153783 3353 2501 2485 60 ------
NM_138971chr1153783 3353 2501 2485 60 ------
NM_138972chr1153783 3353 2501 2485 60 ------
NM_138972chr1153783 3353 2501 2485 60 ------
NM_138973chr1153783 3353 2501 2485 60 ------
NM_138973chr1153783 3353 2501 2485 60 ------
NM_139047chr10191 ------
NM_139049chr10191 ------
NM_139058chrX1423 ------
NM_139168chr511780 ------
NM_139279chr232839 569 110 ------
NM_139283chr1242352 2066 1817 687 ------
NM_139286chr91250 ------
NM_139321chr2014112 ------
NM_144571chr4106916 5920 5191 2790 2588 2153 1664 1071 673 470 11054 14486 --
NM_144574chr141134 ------
NM_144578chr1455414 1974 1606 1382 509 32151 2103 2071 14355 1778
NM_144595chr131977 ------
NM_144604chr16285 59 ------
NM_144609chr173401 273 173 ------
NM_144632chr242056 1857 1705 1491 ------
NM_144723chr53776 86 27 ----1162
NM_144726chr51775 ----1922
NM_144778chr1322721 1834 ------
NM_144973chr1244194 3525 3244 587 15317 --21671 795
NM_145000chr51499 ------
NM_145014chr111371 ------
NM_145037chr331315 1028 1012 11149 --11582
NM_145049chr52737 359 ------
NM_145060chr182456 304 ------
NM_145117chr1173230 2554 1024 1003 971 862 547 12257 ----
NM_145175chr221415 1325 ------
NM_145176chr652684 2510 2255 1155 58 ------
NM_145251chr1431312 390 271 141 11192 --
NM_145259chr256435 6392 4881 1450 1339 24802 1992 14522 --
NM_145263chr422195 153 ------
NM_145279chr121912 22 --11669 --
NM_145284chrX32487 215 139 ------
NM_145307chr1053795 1732 1556 758 327 --13679 13069
NM_145313chr1041664 1607 457 160 --1216 --
NM_145320chr732952 2495 960 12345 13420 --
NM_145321chr732952 2495 960 12345 13420 --
NM_145322chr732952 2495 960 12345 13420 --
NM_145331chr6199 ------
NM_145341chr1021684 105 ----21471 442
NM_145647chr81159 ------
NM_145658chr151217 ------
NM_145690chr831393 1293 276 ------
NM_145695chr71591 ------
NM_145716chr11379 ------
NM_145793chr10----1173 1227
NM_145808chr73702 621 173 ------
NM_145810chr21956 ------
NM_147150chr963933 3831 1042 251 224 29 ------
NM_147175chrX31671 802 214 ------
NM_148174chr832223 1429 108 1140 --1591
NM_148904chr11574 ----176
NM_148905chr11574 ----176
NM_148906chr11574 ----176
NM_148907chr11574 ----176
NM_148908chr11574 ----176
NM_148909chr11574 ----176
NM_148918chr171135 ------
NM_152221chr221988 --11184 --
NM_152244chr1741212 826 805 328 ------
NM_152261chr123884 775 91 ------
NM_152265chr15608 283 273 238 198 ------
NM_152275chr222121 783 --1309 1925
NM_152280chr133014 2210 1116 --12828 13216
NM_152282chr311203 ------
NM_152298chr1165 ------
NM_152380chr111346 ----176
NM_152407chr5103016 2409 2321 2307 2300 2293 2286 795 400 110 --12533 --
NM_152408chr5166 ------
NM_152409chr52759 505 --1290 1935
NM_152414chr841575 668 276 78 --1196 --
NM_152422chr931726 1703 312 ------
NM_152424chrX32895 730 616 23956 279 44244 4173 4143 113 --
NM_152430chr11167 ------
NM_152448chr153383 159 82 ------
NM_152493chr12328 205 ------
NM_152556chr752352 1876 1838 1008 715 ------
NM_152574chr92371 119 ------
NM_152588chr1231330 627 265 1492 ----
NM_152594chr153697 296 76 ------
NM_152622chr531230 786 500 1954 ----
NM_152624chr5146949 6066 5976 5842 5429 5184 5148 4593 1909 1871 1538 1220 904 475 16594 1758 --
NM_152629chr92684 344 --23993 3472 --
NM_152641chr121988 ------
NM_152660chr13815 384 271 1201 ----
NM_152671chr21163 ------
NM_152678chr312541 ----1814
NM_152705chr132389 338 ------
NM_152716chr11134 ------
NM_152736chr62383 168 ------
NM_152754chr773840 3407 3131 3119 2938 2354 275 13683 1876 --
NM_152756chr543305 2940 899 512 ----13293
NM_152772chr122392 45 ------
NM_152787chrX52842 1457 1438 681 505 ------
NM_152829chr73962 260 138 ------
NM_152835chr152621 2021 1069 949 505 ------
NM_152836chr811760 ------
NM_152837chr811760 ------
NM_152838chr2093323 2688 2547 2156 1217 1106 944 770 231 ------
NM_152862chr21116 ------
NM_152896chr9140 ------
NM_152903chr1372819 2617 2545 2317 1818 978 66 1483 --1566
NM_152924chr1596589 5419 4631 4272 2740 2453 1845 1689 741 --16674 --
NM_152989chr1221634 451 ------
NM_152996chr121762 766 ------
NM_153020chr61210 ------
NM_153181chr181618 ------
NM_153184chr351734 1456 749 565 508 ------
NM_153188chr575596 5578 3814 3634 2185 1486 703 ------
NM_153207chr1263991 3982 3569 3227 1586 267 ------
NM_153223chr521589 1428 ------
NM_153226chr1061067 329 212 206 200 191 ------
NM_153255chr62883 127 ------
NM_153267chr92796 246 ------
NM_153333chrX1150 ------
NM_153341chr1153 ------
NM_153365chr462432 2312 2176 2140 1774 997 ------
NM_153367chr1053186 2942 2910 2570 1055 --1332 --
NM_153371chr1352321 2221 1911 456 65 ------
NM_153453chr62322 225 ------
NM_153607chr553037 2471 1072 613 290 ------
NM_153619chr1521377 39 --13628 --
NM_153633chr122722 282 ------
NM_153645chr223662 346 236 ------
NM_153686chr432363 943 903 ------
NM_153687chr1211457 ------
NM_153689chr262280 1630 884 833 459 107 ------
NM_153705chr113806 452 445 22419 217 ----
NM_153746chr62822 259 ------
NM_153810chr1065053 5038 4077 2011 1435 393 --13271 --
NM_153825chr431586 560 134 11335 11759 --
NM_170606chr731847 1371 325 ------
NM_170674chr151959 ------
NM_170675chr151394 ------
NM_170676chr151394 ------
NM_170677chr151959 ------
NM_170686chr742822 2398 161 123 ------
NM_170751chr63989 348 305 ------
NM_170752chr63989 348 305 ------
NM_170753chr10188 ------
NM_170768chr1121496 1461 ------
NM_170769chr62791 56 ------
NM_172069chr221954 1572 ------
NM_172071chr1147426 7031 6672 6452 6246 5763 2759 2541 2455 2208 2014 1401 385 286 1661 12410 --
NM_172127chr43724 649 443 ------
NM_172128chr44821 680 605 399 ------
NM_172164chr1165 ------
NM_172193chr1421255 997 ------
NM_172315chr151959 ------
NM_172316chr151959 ------
NM_172373chr1321332 1067 ------
NM_173082chr631093 1012 137 ------
NM_173171chr21221 ------
NM_173172chr21529 ------
NM_173173chr21221 ------
NM_173191chr1011315 ------
NM_173192chr1011315 ------
NM_173193chr1011315 ------
NM_173194chr1011315 ------
NM_173195chr1011315 ------
NM_173198chr931095 874 293 ------
NM_173199chr91481 ------
NM_173200chr931095 874 293 ------
NM_173214chr16117337 7055 6255 5915 5157 1954 1919 1512 1440 1359 939 16083 --25715 5204
NM_173354chr2121962 126 11729 ----
NM_173359chr351305 1246 717 242 45 ------
NM_173468chr475452 2439 1216 729 246 126 108 ------
NM_173469chr1521273 1044 ------
NM_173470chrX4366 355 201 58 22891 1998 ----
NM_173473chr1032643 588 260 1752 --12094
NM_173475chr1691767 1608 1487 1245 347 207 192 183 74 ------
NM_173503chr171118 ------
NM_173508chr12273 97 ------
NM_173510chr2262821 2646 2319 834 150 131 ------
NM_173511chr263609 3261 1302 916 488 253 12685 1724 1551
NM_173552chr332381 2057 214 ----22185 1873
NM_173582chr1175773 4223 3866 1536 1233 575 141 ----35134 1627 1276
NM_173595chr1225268 4394 34441 4081 792 --15302
NM_173609chr152629 117 ------
NM_173625chr172891 672 ------
NM_173642chr189180 8551 8254 7650 6306 5773 3366 732 ----11369
NM_173644chr2021910 1724 --2329 107 --
NM_173647chr23970 938 357 ------
NM_173654chr342366 2354 866 295 ------
NM_173698chrX11423 ------
NM_173829chr545465 5094 1663 258 21035 135 ----
NM_173851chr823731 591 ------
NM_173854chr142282 427 421 384 1186 ----
NM_174911chr873400 3351 3343 1367 1081 477 127 ------
NM_174921chr42427 251 ----1959
NM_174938chr92509 465 ------
NM_175056chr321847 527 ------
NM_175061chr71143 ------
NM_175611chr21153 ------
NM_175623chr1276890 6162 5638 2632 1638 948 578 ----35174 2761 2127
NM_175630chr22593 212 ------
NM_175634chr811307 ------
NM_175635chr811307 ------
NM_175636chr811307 ------
NM_175709chr2232051 2038 38 ------
NM_175748chr1412012 ------
NM_175847chr1911032 ------
NM_175854chr1332388 2008 896 3439 382 97 ----
NM_175859chrX41658 1271 666 223 ------
NM_175863chr61331 --1217 --
NM_175873chr52561 492 ------
NM_175907chr182727 533 ----1390
NM_175920chr54872 534 298 119 --1181 --
NM_176814chr711074 ------
NM_177424chr151944 1646 791 511 147 ------
NM_177438chr1453318 1278 903 710 183 ------
NM_177535chrX1170 ------
NM_177553chr11195 ------
NM_177556chrX162 ------
NM_177968chr231895 1547 1431 1614 --11937
NM_177972chr1164479 4385 4041 3115 2843 115 --122 --
NM_177974chr152913 207 ------
NM_177990chr2011899 ------
NM_177995chr931726 1703 312 ------
NM_178010chr1221634 451 ------
NM_178013chr1432719 2653 2218 ------
NM_178151chrX87813 7553 6890 6197 6121 4860 2908 2455 --1235 --
NM_178152chrX87813 7553 6890 6197 6121 4860 2908 2455 --1235 --
NM_178153chrX87813 7553 6890 6197 6121 4860 2908 2455 --1235 --
NM_178423chr73420 370 163 ------
NM_178425chr73420 370 163 ------
NM_178426chr152286 1836 1501 959 468 ------
NM_178427chr152186 1736 1401 859 368 ------
NM_178496chr361433 1399 1290 1048 585 504 ------
NM_178539chr1221899 1567 ------
NM_178578chr2041720 1625 1011 347 ------
NM_178586chr1442104 2080 1956 1875 ------
NM_178815chr1022200 67 --1929 --
NM_178818chr1652255 2075 1955 1547 172 ----1140
NM_178860chr1711031 ------
NM_178864chr112716 142 ------
NM_181054chr144434 367 176 132 ------
NM_181291chr141212 ------
NM_181302chr141134 ------
NM_181308chr141134 ------
NM_181351chr1152762 2407 2291 980 751 --11001 --
NM_181358chr154193 4174 3986 1030 246 ------
NM_181442chr201901 ----1409
NM_181453chr221310 343 ----1430
NM_181504chr583438 3243 2742 1659 1521 1083 242 121 13416 --1564
NM_181521chr16127036 6856 6736 6328 5978 4953 2802 2696 2585 319 203 113 1131 26279 1068 24921 4681
NM_181523chr583438 3243 2742 1659 1521 1083 242 121 13416 --1564
NM_181524chr583438 3243 2742 1659 1521 1083 242 121 13416 --1564
NM_181645chr112500 278 ------
NM_181659chr2033423 1313 246 ------
NM_181659chr2033423 1313 246 ------
NM_181672chrX1374 ------
NM_181673chrX1374 ------
NM_181701chr932010 1854 136 ------
NM_181702chr82858 277 ------
NM_181705chr525740 4920 --14502 33854 1877 1476
NM_181723chr822145 421 ------
NM_181836chr561937 1665 571 289 207 195 ------
NM_181861chr1222309 588 ------
NM_181868chr1222309 588 ------
NM_181869chr1222394 673 ------
NM_181876chr462632 2484 869 560 502 150 --12212 --
NM_182485chr453344 3200 3138 2904 1499 ------
NM_182503chr675598 4215 3868 3490 1975 1899 1725 ----12055
NM_182511chr1821293 172 ------
NM_182515chr1946493 5615 2535 832 --12119 --
NM_182551chr233452 775 42 --11439 --
NM_182645chr62322 225 ------
NM_182646chr453344 3200 3138 2904 1499 ------
NM_182691chr731448 935 323 ------
NM_182692chr731448 935 323 ------
NM_182700chr721768 625 ------
NM_182728chr1441768 1741 1703 131 ------
NM_182757chr633309 2594 1118 --1235 --
NM_182764chr203855 110 43 ------
NM_182767chr1251839 481 262 176 167 ------
NM_182789chr51238 ------
NM_182918chr2121086 540 ------
NM_182943chr32991 36 --1128 --
NM_182948chr121014 589 --1243 --
NM_182964chr1173230 2554 1024 1003 971 862 547 12257 ----
NM_182972chr132099 1967 656 --12248 --
NM_182975chr1147 ------
NM_183004chr1463036 2621 1449 1165 1029 298 1832 1802 --
NM_183006chr2021118 163 ------
NM_183043chr132831 257 ------
NM_183044chr132831 257 ------
NM_183323chr51238 ------
NM_183353chrX11164 ------
NM_183376chr1532515 2436 404 171 1483 --
NM_183398chr531335 1201 525 ------
NM_183399chr531335 1201 525 ------
NM_183400chr531335 1201 525 ------
NM_183401chr531335 1201 525 ------
NM_183416chr141269 482 209 81 ------
NM_184234chr201760 ------
NM_194247chr263692 3515 3046 3011 1532 879 13308 --13177
NM_194259chr161565 ------
NM_194260chr161565 ------
NM_194261chr161565 ------
NM_194283chr554031 2854 2751 1059 148 ----11101
NM_194285chr1153278 2376 2339 2174 1376 ----12742
NM_194314chr175671 5538 4777 3996 2226 574 29 ------
NM_194318chr1321813 680 ------
NM_194328chr973307 3095 2924 2756 2737 2391 30 --12995 12438
NM_194329chr973307 3095 2924 2756 2737 2391 30 --12995 12438
NM_194330chr973307 3095 2924 2756 2737 2391 30 --12995 12438
NM_194332chr973307 3095 2924 2756 2737 2391 30 --12995 12438
NM_194356chr1222375 1863 ------
NM_194434chr1865106 3853 3692 1481 1268 963 1798 ----
NM_194454chr74646 613 593 86 ----1128
NM_194455chr74646 613 593 86 ----1128
NM_194456chr74646 613 593 86 ----1128
NM_197955chr151132 ------
NM_197968chr131496 ------
NM_197977chr91864 ----1654
NM_198047chr22592 478 ----189
NM_198086chr1452038 1727 1428 1380 585 ------
NM_198123chr811535 ------
NM_198124chr811535 ------
NM_198128chr1831528 1452 740 11932 ----
NM_198195chr31168 ------
NM_198240chr1221335 403 ------
NM_198243chr151129 ------
NM_198268chr154193 4174 3986 1030 246 ------
NM_198269chr154193 4174 3986 1030 246 ------
NM_198270chrX43212 3052 3024 2170 ------
NM_198381chr1111362 ------
NM_198485chr321734 79 ------
NM_198513chr811857 ------
NM_198569chr632600 1841 935 ------
NM_198581chr287307 5931 5890 5643 5315 4588 1653 840 ------
NM_198595chr454441 3776 1745 612 212 ------
NM_198681chr121064 412 --1465 --
NM_198715chr185779 5700 4324 1501 1189 926 116 36 11108 ----
NM_198904chr531326 688 174 ----11916
NM_198935chr2043242 2449 1279 208 --1297 --
NM_198956chr721768 625 ------
NM_198971chr111531 ------
NM_198988chr19199 ------
NM_198993chr1711365 ------
NM_199132chr1922118 2058 ------
NM_199188chr1263578 3549 3170 273 137 75 11182 ----
NM_199190chr1263578 3549 3170 273 137 75 11182 ----
NM_199205chr81755 ------
NM_199290chr17124 ------
NM_199324chr442650 2617 684 154 --13393 --
NM_199342chr11236 ------
NM_199421chr1433948 1931 77 --24112 942 --
NM_199436chr232994 2964 1919 ------
NM_199454chr133937 1477 445 ------
NM_199461chr1043306 3190 2955 601 ----12284
NM_201266chr232796 348 78 --21200 274 12683
NM_201269chr121398 1064 ------
NM_201279chr232796 348 78 --21200 274 12683
NM_201403chr121912 22 --11669 --
NM_201413chr212926 212 --1674 --
NM_201414chr212926 212 --1674 --
NM_201432chr1785762 4574 4556 4082 2107 2092 1605 385 --21499 935 --
NM_201433chr1785762 4574 4556 4082 2107 2092 1605 385 --21499 935 --
NM_201436chr72852 832 ------
NM_201516chr72908 888 ------
NM_201517chr72852 832 ------
NM_201633chr51342 ------
NM_201999chr421134 926 ------
NM_203283chr41584 ------
NM_203284chr41584 ------
NM_203329chr1166691 1788 1714 1656 1527 375 --22820 1910 --
NM_203330chr1166691 1788 1714 1656 1527 375 --22820 1910 --
NM_203331chr1166691 1788 1714 1656 1527 375 --22820 1910 --
NM_203342chr193137 2982 1292 1219 881 657 591 454 262 --2842 669 --
NM_203343chr193137 2982 1292 1219 881 657 591 454 262 --2842 669 --
NM_203364chr112488 321 ------
NM_203403chr9173 ------
NM_203406chr522661 2436 ------
NM_203446chr2142451 1029 847 560 ------
NM_203453chr931819 1666 1422 ----1117
NM_203458chr153543 3385 3118 3025 764 --1212 --
NM_203459chr132373 1718 162 ------
NM_203463chr264070 3775 3691 3068 1194 954 ------
NM_203499chr173226 189 55 ------
NM_203504chr462015 1926 1895 132 81 75 ------
NM_203505chr462015 1926 1895 132 81 75 ------
NM_203506chr1722125 141 ----1672
NM_205768chr121884 1676 ------
NM_205852chr122870 188 ------
NM_206594chr123041 2325 ------
NM_206595chr123041 2325 ------
NM_206853chr673362 3199 3138 1257 1177 1092 996 ------
NM_206854chr644623 4460 4399 3431 ------
NM_206855chr665588 5425 5364 4396 726 181 ------
NM_206876chr21863 ------
NM_206886chr12199 42 ------
NM_206907chr543134 2565 266 115 ------
NM_206909chr877916 6968 5976 5122 3264 1850 280 ----12625
NM_206943chr21376 ------
NM_207012chr1032970 1250 233 ----13036
NM_207123chr42874 645 ----1344
NM_207171chr132026 1962 1841 --1431 --
NM_207299chr91187 ------
NM_207303chr1023269 1447 ------
NM_207304chr1322608 1721 ------
NM_207317chr51382 ------
NM_207321chr1021024 840 1380 --11091
NM_207372chr1052317 1909 1680 677 35 ------
NM_207397chr11662 ------
NM_207406chr4105941 5924 5410 5123 2224 1788 1703 1410 1164 193 1164 15335 15720
NM_207491chr411322 ------
NM_207518chr19152 ------
NM_207645chr112971 948 ------
NM_207647chr911727 ------
NM_212460chr771478 1423 741 675 628 235 221 --11430 --
NM_213589chr254521 4441 4069 1969 285 --1942 --
NM_213594chr1211029 ------
NM_213606chr1032607 236 85 32335 1769 204 --11811
NM_213609chr33407 238 186 ------
NM_213651chr121740 152 ------
NM_213654chr341465 1199 1102 96 ------
NM_213662chr1712461 ----1727