TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-186-5p
miRNA Sequence: CAAAGAAUUCUCCUUUUGGGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_198503chr172148 2046 1982 1621 1498 558 25 21969 1954 1929 1413
NM_198504chr36909 840 634 593 231 100 ------
NM_198506chr44577 333 275 222 21091 588 21020 187 --
NM_198513chr871916 1546 446 375 359 338 129 1766 121 11761
NM_198521chr121127 ------
NM_198529chr173418 315 308 ------
NM_198549chr152760 2370 2102 2087 449 22774 2305 1771 --
NM_198552chr11597 --1622 --
NM_198566chr52163 148 ------
NM_198567chr51395 1161 ----
NM_198569chr662598 2432 2398 2327 403 155 --32573 2456 2062 1562
NM_198578chr1241312 931 391 137 21509 1451 41448 1177 315 99 --
NM_198581chr2257218 6575 6044 6013 5641 5464 5444 5303 4870 4612 2422 2343 2280 2273 2213 2080 1851 1651 1596 1137 860 848 703 180 94 97470 7226 6941 6061 5448 5142 4830 1989 1384 127522 6432 5479 5312 5152 4817 4782 3000 1479 1380 931 25 26586 5634
NM_198584chr882196 2015 1755 1747 797 717 335 167 42285 351 181 172 32002 344 178 12099
NM_198700chr113329 202 185 --1376 --
NM_198715chr1115638 5610 5067 4322 4312 4170 2170 2100 1603 445 114 33933 2173 1271 34087 1187 676 26039 275
NM_198793chr3164064 3837 3737 3456 3004 2913 2842 2829 2816 2691 2636 1505 943 602 248 236 43913 3843 1389 1246 34127 3780 3288 13259
NM_198794chr1451454 1354 1149 1133 311 2553 271 1550 --
NM_198829chr761176 1043 293 271 144 21 --1161 11419
NM_198830chr171336 1201 1198 --
NM_198844chr172908 228 ----1971
NM_198859chr3114747 4713 4349 4007 3944 3254 792 563 450 353 176 34862 4264 773 54908 4858 4404 1887 769 34847 3277 1728
NM_198880chr34702 645 583 265 197 182 --
NM_198889chr451100 1020 282 227 215 11130 ----
NM_198896chr11102202 2166 2102 1409 1400 1378 819 597 568 430 32207 1416 285 22090 276 12023
NM_198900chr12167734 7550 7205 6126 5325 4847 2293 2207 2183 2093 1896 1890 803 691 673 350 16131 --17021
NM_198901chr71313 11213 1179 1978
NM_198904chr551640 1610 1315 269 30 --1758 --
NM_198925chr15------2991 964
NM_198935chr20143268 3108 2703 2637 2506 2447 2264 2232 2127 2062 1093 1046 997 256 22285 441 13201 --
NM_198955chr1721494 364 11497 1968 --
NM_198956chr751502 1383 787 760 688 --11440 --
NM_198965chr12----1168 --
NM_198966chr12----1168 --
NM_198968chr13133121 2929 2772 2668 2536 1004 996 982 952 888 494 385 269 42574 2496 892 334 53113 2568 2493 331 305 44022 2503 780 320
NM_198990chr7143299 3128 2659 2328 2241 2194 1055 425 384 369 288 207 61 46 11030 51085 1027 975 937 445 12224
NM_198991chr182722 603 --1823 --
NM_198992chr1221266 517 31406 297 134 3891 874 277 1158
NM_198995chr18--1483 ----
NM_199000chr73874 541 413 --12255 --
NM_199003chr841381 1070 998 561 2565 473 2450 409 --
NM_199039chr431035 946 81 11028 ----
NM_199040chr1292599 2390 1409 1247 810 564 297 212 56 33837 2862 163 33659 2549 1541 13559
NM_199054chr1941768 1398 1327 173 31998 1346 62 1206 --
NM_199072chr793080 3044 2804 2515 2179 2090 1150 347 305 33087 2820 1230 ----
NM_199076chr10----2349 270 --
NM_199131chr1083653 3571 2985 2687 2348 1448 1073 195 12706 --12232
NM_199132chr1972185 2056 2013 1856 1762 1469 1457 32141 1984 1771 11628 --
NM_199136chr7299 78 1105 2424 355 --
NM_199138chr131253 1261 ----
NM_199141chr19--1146 ----
NM_199144chr2011411 21422 527 1173 --
NM_199160chr942012 1744 1493 308 ------
NM_199168chr1011220 21247 1237 31429 1233 1207 1357
NM_199169chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199170chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199171chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199188chr1293739 3095 2784 2681 2589 1497 888 265 257 43150 2652 1166 435 73884 3518 2982 1163 858 617 396 23530 1302
NM_199189chr54827 768 697 45 169 ----
NM_199190chr1293739 3095 2784 2681 2589 1497 888 265 257 43150 2652 1166 435 73884 3518 2982 1163 858 617 396 23530 1302
NM_199203chr2011411 21422 527 1173 --
NM_199205chr82741 683 1766 ----
NM_199229chr281746 629 483 476 417 249 189 105 11753 ----
NM_199280chr21133 --142 --
NM_199290chr17121 ------
NM_199297chr111161 ------
NM_199320chr4122703 2475 2161 1859 1789 765 489 388 335 317 164 153 12478 32892 1912 138 --
NM_199320chr4122703 2475 2161 1859 1789 765 489 388 335 317 164 153 12478 32892 1912 138 --
NM_199321chr172908 228 ----1971
NM_199324chr4143647 3053 3027 2872 2601 2520 2340 1449 1069 920 753 675 651 324 22472 852 --43602 3302 1294 277
NM_199327chr451001 762 148 94 58 31028 390 86 ----
NM_199328chr2151230 1107 1032 801 102 ------
NM_199342chr11234 1245 ----
NM_199346chr22162 137 1192 ----
NM_199355chr1621482 1342 31821 1626 1371 11284 --
NM_199359chr20------2584 460
NM_199360chr20------2584 460
NM_199361chr20------2584 460
NM_199362chr20------2584 460
NM_199363chr20------2584 460
NM_199416chr11306 1313 ----
NM_199421chr14174468 4176 4082 3736 3728 3570 3405 2031 1588 1407 1322 599 488 202 147 83 59 34182 1977 1327 44362 1671 256 40 21615 373
NM_199436chr2102474 1072 1053 1006 630 614 530 490 429 398 1279 42961 1975 771 192 12936
NM_199437chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199438chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199439chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199440chr21306 ------
NM_199454chr1104437 4237 3906 3889 3852 1491 1475 1443 1211 415 1540 21428 1382 31584 629 507
NM_199461chr1042919 2880 2738 2223 23223 903 1404 --
NM_199462chr1124722 4569 3829 3785 3673 3338 3044 1429 1338 1137 1116 390 --13901 --
NM_199482chr231673 1393 100 11342 11902 --
NM_199511chr35744 632 622 110 75 --1339 --
NM_199512chr35744 632 622 110 75 --1339 --
NM_201263chr142069 1950 1843 1308 31781 1421 1364 ----
NM_201266chr252978 931 888 870 346 --168 --
NM_201269chr13576 551 328 3579 554 63 41348 1215 1202 56 --
NM_201278chr1141470 528 480 308 --31967 932 873 --
NM_201279chr252978 931 888 870 346 --168 --
NM_201281chr1141470 528 480 308 --31967 932 873 --
NM_201428chr1141463 1053 460 120 31534 530 124 11524 --
NM_201429chr1141463 1053 460 120 31534 530 124 11524 --
NM_201430chr1141389 979 386 46 31460 456 50 11450 --
NM_201434chr17--1226 ----
NM_201436chr73850 153 84 ----1264
NM_201437chr861533 1457 1355 308 279 101 --31130 386 225 --
NM_201438chr124357 322 79 23 ------
NM_201439chr12189 --151 --
NM_201440chr12189 --151 --
NM_201515chr12189 --151 --
NM_201516chr73906 209 140 ----1320
NM_201517chr73850 153 84 ----1264
NM_201532chr11----1600 --
NM_201533chr11----1600 --
NM_201548chr23993 544 119 21060 445 2537 439 11436
NM_201568chr182186 2160 2149 1942 1745 505 452 379 ------
NM_201569chr182186 2160 2149 1942 1745 505 452 379 ------
NM_201570chr1051527 1373 389 182 22 ------
NM_201571chr1051527 1373 389 182 22 ------
NM_201572chr1051527 1373 389 182 22 ------
NM_201590chr1051527 1373 389 182 22 ------
NM_201591chr461641 1509 1287 649 310 228 21694 1609 21359 147 --
NM_201592chr461641 1509 1287 649 310 228 21694 1609 21359 147 --
NM_201593chr1051527 1373 389 182 22 ------
NM_201596chr1051527 1373 389 182 22 ------
NM_201597chr1051527 1373 389 182 22 ------
NM_201613chr121324 --1758 --
NM_201624chr12815 389 --2232 103 11106
NM_201632chr541843 1362 1355 1303 --1477 --
NM_201633chr5----1340 --
NM_201634chr541942 1461 1454 1402 --1576 --
NM_201647chr21597 ----1180
NM_201995chr112712 53 2310 88 164 --
NM_201998chr114777 526 118 74 1153 1129 --
NM_201999chr45963 956 924 385 105 1976 ----
NM_203282chr19141861 1790 1755 1594 1584 1560 1554 1495 1389 1349 1303 1226 687 36 --21715 635 --
NM_203283chr42604 576 1437 ----
NM_203284chr42604 576 1437 ----
NM_203291chr18139 --187 --
NM_203292chr18132 --180 --
NM_203301chr143360 283 61 --21733 321 1651
NM_203304chr192621 298 2650 284 3849 640 631 --
NM_203327chr2074576 4419 4287 4234 3525 1648 1468 14374 14436 --
NM_203341chr181092 1074 1012 1001 857 844 758 743 1913 1893 1270
NM_203342chr1122438 1311 1304 1251 1237 1031 986 867 666 653 360 168 23017 272 33206 3014 2465 --
NM_203343chr1122438 1311 1304 1251 1237 1031 986 867 666 653 360 168 23017 272 33206 3014 2465 --
NM_203349chr1571803 1735 1667 1551 1544 872 524 11557 --22149 1759
NM_203350chr181774 1556 1430 1390 1218 571 294 55 ------
NM_203351chr17--12147 12075 --
NM_203364chr1171056 927 842 319 306 253 155 --1369 --
NM_203370chr3137 ------
NM_203372chr251578 1371 253 190 135 2609 409 --1624
NM_203390chr8101790 1536 1368 567 349 270 224 165 113 81 21356 86 1187 --
NM_203391chrX71865 1775 1405 678 574 470 206 1215 11474 1709
NM_203394chr1272715 2515 2345 2082 1962 1676 349 21976 1688 42702 2689 1037 544 1858
NM_203399chr13673 341 232 --2703 80 --
NM_203401chr13673 341 232 --2703 80 --
NM_203403chr961112 1060 233 182 83 71 ----1205
NM_203406chr5132859 2786 2724 2659 2529 2217 2109 2058 962 850 422 394 173 12132 42254 1055 927 542 32239 802 516
NM_203417chr211299 11555 31552 1366 1227 --
NM_203418chr211299 11555 31552 1366 1227 --
NM_203434chr931204 253 197 ------
NM_203437chr22226 40 --3744 720 241 --
NM_203446chr2132338 2107 2037 --12016 --
NM_203447chr96981 917 819 794 762 186 ------
NM_203451chr1352261 1636 736 353 139 22080 540 12076 --
NM_203453chr921933 475 1575 11309 --
NM_203458chr153707 3541 3044 2765 2416 --13194 --
NM_203459chr192546 2388 2171 1997 974 798 412 388 365 42554 2174 2135 368 12151 --
NM_203463chr294356 4148 4067 3762 1663 1582 1192 609 471 --44934 4913 1210 264 14674
NM_203487chr1381691 1634 1591 1403 669 658 632 374 1249 1246 --
NM_203488chr141332 ------
NM_203499chr173798 223 42 2868 746 1743 1334
NM_203504chr4102078 1997 1924 864 817 754 548 415 112 58 1827 42584 2417 1944 69 --
NM_203505chr4102078 1997 1924 864 817 754 548 415 112 58 1827 42584 2417 1944 69 --
NM_205768chr1122066 1944 1893 1881 1832 1623 1563 505 367 360 352 332 31804 1568 373 2824 434 --
NM_205834chr19--139 133 --
NM_205842chr24763 626 115 35 ------
NM_205852chr1231708 1543 843 --2745 671 --
NM_205860chr173210 3131 2447 1267 1128 1081 328 --13163 12465
NM_206594chr1173497 3247 3111 3098 2243 1015 842 517 505 454 389 338 286 278 260 207 184 1348 21053 245 12857
NM_206595chr1173497 3247 3111 3098 2243 1015 842 517 505 454 389 338 286 278 260 207 184 1348 21053 245 12857
NM_206839chr155427 177 170 53 47 1431 1652 --
NM_206853chr6183745 3693 3683 3329 3281 3212 3030 2650 1663 1598 1562 1471 1437 1007 989 935 847 697 32804 2540 1291 23893 1402 --
NM_206854chr6185006 4954 4944 4590 4542 4473 4291 3911 3541 3429 2108 1958 1212 846 520 477 189 115 24065 3801 15154 --
NM_206855chr6235971 5919 5909 5555 5507 5438 5256 4876 4506 4394 3889 2177 1811 1485 1442 1154 1080 915 717 709 700 375 25 35030 4766 918 16119 13995
NM_206860chr10----1470 --
NM_206861chr10----1470 --
NM_206862chr10----1470 --
NM_206866chr21103228 2931 2438 891 771 558 501 468 408 102 12775 63094 3005 2772 2674 2468 977 12628
NM_206876chr2133627 2857 2541 2390 1294 1282 1170 993 915 909 731 454 269 32755 2291 1300 82970 2752 2422 2404 1392 1183 439 151 --
NM_206886chr14220 197 164 40 ------
NM_206907chr5122767 2729 2666 2289 1191 1015 964 669 660 507 264 24 12678 63182 3168 2962 2705 2606 2531 --
NM_206909chr8228027 6498 6101 5974 5823 5809 5792 5444 3085 2819 2415 1935 1784 1506 1361 1267 1182 898 345 197 181 141 47773 5163 1090 348 46533 5753 3262 126 18119
NM_206914chr1261914 1808 1374 657 389 265 11395 21875 779 --
NM_206927chr114843 699 323 154 --1714 --
NM_206928chr114843 699 323 154 --1714 --
NM_206929chr114843 699 323 154 --1714 --
NM_206930chr114843 699 323 154 --1714 --
NM_206938chr1132045 1907 1335 --21866 1298 --
NM_206939chr1132045 1907 1335 --21866 1298 --
NM_206940chr1132045 1907 1335 --21866 1298 --
NM_206943chr23808 750 639 1309 1374 --
NM_206944chr92676 101 ----1839
NM_206945chr92676 101 ----1839
NM_206946chr92676 101 ----1839
NM_206947chr92676 101 ----1839
NM_206962chr211608 ------
NM_206966chr51183 ------
NM_207012chr1062351 1403 1018 1006 631 160 12878 22438 245 1617
NM_207015chr341697 1602 856 184 12216 31734 667 582 1142
NM_207171chr181599 1584 1463 622 540 398 298 262 32038 1928 270 42021 1925 777 354 1111
NM_207174chr214802 744 516 238 1246 ----
NM_207189chr11152 ------
NM_207291chr191123 2486 111 ----
NM_207299chr941028 918 393 314 130 31042 173 138 --
NM_207303chr1052926 2620 909 889 839 --24036 1445 22793 353
NM_207304chr1392264 1976 1946 1914 1832 1820 1650 1043 656 --22492 1053 12073
NM_207311chr1221293 1266 ------
NM_207313chr1721024 989 ------
NM_207317chr51380 --155 --
NM_207343chr111116 ------
NM_207352chr482084 1879 852 844 377 305 183 117 2508 198 2368 204 21831 990
NM_207371chr1071295 1043 1035 592 545 167 150 1604 ----
NM_207377chr141110 ------
NM_207391chr1921314 856 ------
NM_207396chr141321 1308 266 88 2703 91 2562 258 198
NM_207404chr362081 1762 651 582 442 35 1407 21836 1397 --
NM_207406chr4166438 6391 6205 5272 5061 4674 4648 4506 4333 4309 1940 1760 1529 1419 671 233 56422 6371 5598 4679 1252 56334 5911 4201 1866 1281 11827
NM_207410chr64132 126 120 55 1443 1565 --
NM_207413chr82446 97 1306 1382 --
NM_207418chr1_random51030 1012 244 96 36 1853 21043 267 --
NM_207429chr1172324 2232 2019 1895 553 393 192 22391 1889 ----
NM_207445chr1582151 2007 1655 632 539 438 400 274 32154 1661 446 ----
NM_207481chr241301 1171 1046 521 21341 994 31232 1156 552 1217
NM_207506chr861357 1071 512 460 330 26 ------
NM_207517chr1531877 1812 751 11370 --1196
NM_207518chr1931188 495 31 --1532 --
NM_207520chr21133 ------
NM_207521chr21133 ------
NM_207577chr1152693 1969 411 156 56 162 ----
NM_207578chr13728 237 56 1625 ----
NM_207627chr214802 744 516 238 1246 ----
NM_207628chr214802 744 516 238 1246 ----
NM_207629chr214802 744 516 238 1246 ----
NM_207645chr1171325 1238 1136 1057 989 981 61 ------
NM_207647chr9122391 2353 2135 1860 937 865 754 718 584 513 364 271 1653 31961 999 772 21937 690
NM_207660chr142517 156 ------
NM_207661chr142517 156 ------
NM_207662chr142517 156 ------
NM_212460chr781774 1491 1449 1441 1299 739 536 479 1515 --11354
NM_212471chr1782318 2256 1783 1482 852 582 545 420 1358 21569 353 11683
NM_212472chr1782318 2256 1783 1482 852 582 545 420 1358 21569 353 11683
NM_212554chr1081485 1369 1184 575 423 416 334 306 --21599 1381 --
NM_212558chr9113684 3517 3273 3042 2966 2816 1511 1159 742 670 452 --22713 1467 --
NM_213589chr2105273 4860 4453 4258 4058 3909 3687 2219 1871 1421 35171 5086 3916 11084 --
NM_213590chr13265294 5182 5048 5024 4622 4485 4457 4397 4333 4137 3866 3705 3645 3576 3529 3506 3376 3327 3246 1295 895 539 360 333 195 28 23678 1635 55158 4674 4629 4047 531 --
NM_213594chr1231107 1051 411 --11039 --
NM_213598chr1951419 1252 1086 1004 428 31412 1115 1016 2420 255 --
NM_213606chr1072583 2395 2194 1014 982 546 59 --1587 12208
NM_213609chr341113 769 727 236 ------
NM_213618chr111198 --1472 --
NM_213622chr21597 ----1180
NM_213647chr5----1441 --
NM_213648chr541843 1362 1355 1303 --1477 --
NM_213654chr391447 1437 1350 1255 1100 546 352 209 170 --1386 --
NM_213662chr1752443 2434 1550 604 450 1218 1215 --
NM_198503chr172148 2046 1982 1621 1498 558 25 21969 1954 1929 1413
NM_198504chr36909 840 634 593 231 100 ------
NM_198506chr44577 333 275 222 21091 588 21020 187 --
NM_198513chr871916 1546 446 375 359 338 129 1766 121 11761
NM_198521chr121127 ------
NM_198529chr173418 315 308 ------
NM_198549chr152760 2370 2102 2087 449 22774 2305 1771 --
NM_198552chr11597 --1622 --
NM_198566chr52163 148 ------
NM_198567chr51395 1161 ----
NM_198569chr662598 2432 2398 2327 403 155 --32573 2456 2062 1562
NM_198578chr1241312 931 391 137 21509 1451 41448 1177 315 99 --
NM_198581chr2257218 6575 6044 6013 5641 5464 5444 5303 4870 4612 2422 2343 2280 2273 2213 2080 1851 1651 1596 1137 860 848 703 180 94 97470 7226 6941 6061 5448 5142 4830 1989 1384 127522 6432 5479 5312 5152 4817 4782 3000 1479 1380 931 25 26586 5634
NM_198584chr882196 2015 1755 1747 797 717 335 167 42285 351 181 172 32002 344 178 12099
NM_198700chr113329 202 185 --1376 --
NM_198715chr1115638 5610 5067 4322 4312 4170 2170 2100 1603 445 114 33933 2173 1271 34087 1187 676 26039 275
NM_198793chr3164064 3837 3737 3456 3004 2913 2842 2829 2816 2691 2636 1505 943 602 248 236 43913 3843 1389 1246 34127 3780 3288 13259
NM_198794chr1451454 1354 1149 1133 311 2553 271 1550 --
NM_198829chr761176 1043 293 271 144 21 --1161 11419
NM_198830chr171336 1201 1198 --
NM_198844chr172908 228 ----1971
NM_198859chr3114747 4713 4349 4007 3944 3254 792 563 450 353 176 34862 4264 773 54908 4858 4404 1887 769 34847 3277 1728
NM_198880chr34702 645 583 265 197 182 --
NM_198889chr451100 1020 282 227 215 11130 ----
NM_198896chr11102202 2166 2102 1409 1400 1378 819 597 568 430 32207 1416 285 22090 276 12023
NM_198900chr12167734 7550 7205 6126 5325 4847 2293 2207 2183 2093 1896 1890 803 691 673 350 16131 --17021
NM_198901chr71313 11213 1179 1978
NM_198904chr551640 1610 1315 269 30 --1758 --
NM_198925chr15------2991 964
NM_198935chr20143268 3108 2703 2637 2506 2447 2264 2232 2127 2062 1093 1046 997 256 22285 441 13201 --
NM_198955chr1721494 364 11497 1968 --
NM_198956chr751502 1383 787 760 688 --11440 --
NM_198965chr12----1168 --
NM_198966chr12----1168 --
NM_198968chr13133121 2929 2772 2668 2536 1004 996 982 952 888 494 385 269 42574 2496 892 334 53113 2568 2493 331 305 44022 2503 780 320
NM_198990chr7143299 3128 2659 2328 2241 2194 1055 425 384 369 288 207 61 46 11030 51085 1027 975 937 445 12224
NM_198991chr182722 603 --1823 --
NM_198992chr1221266 517 31406 297 134 3891 874 277 1158
NM_198995chr18--1483 ----
NM_199000chr73874 541 413 --12255 --
NM_199003chr841381 1070 998 561 2565 473 2450 409 --
NM_199039chr431035 946 81 11028 ----
NM_199040chr1292599 2390 1409 1247 810 564 297 212 56 33837 2862 163 33659 2549 1541 13559
NM_199054chr1941768 1398 1327 173 31998 1346 62 1206 --
NM_199072chr793080 3044 2804 2515 2179 2090 1150 347 305 33087 2820 1230 ----
NM_199076chr10----2349 270 --
NM_199131chr1083653 3571 2985 2687 2348 1448 1073 195 12706 --12232
NM_199132chr1972185 2056 2013 1856 1762 1469 1457 32141 1984 1771 11628 --
NM_199136chr7299 78 1105 2424 355 --
NM_199138chr131253 1261 ----
NM_199141chr19--1146 ----
NM_199144chr2011411 21422 527 1173 --
NM_199160chr942012 1744 1493 308 ------
NM_199168chr1011220 21247 1237 31429 1233 1207 1357
NM_199169chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199170chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199171chr2072368 1397 1013 523 453 323 229 --23653 3218 1626
NM_199188chr1293739 3095 2784 2681 2589 1497 888 265 257 43150 2652 1166 435 73884 3518 2982 1163 858 617 396 23530 1302
NM_199189chr54827 768 697 45 169 ----
NM_199190chr1293739 3095 2784 2681 2589 1497 888 265 257 43150 2652 1166 435 73884 3518 2982 1163 858 617 396 23530 1302
NM_199203chr2011411 21422 527 1173 --
NM_199205chr82741 683 1766 ----
NM_199229chr281746 629 483 476 417 249 189 105 11753 ----
NM_199280chr21133 --142 --
NM_199290chr17121 ------
NM_199297chr111161 ------
NM_199320chr4122703 2475 2161 1859 1789 765 489 388 335 317 164 153 12478 32892 1912 138 --
NM_199320chr4122703 2475 2161 1859 1789 765 489 388 335 317 164 153 12478 32892 1912 138 --
NM_199321chr172908 228 ----1971
NM_199324chr4143647 3053 3027 2872 2601 2520 2340 1449 1069 920 753 675 651 324 22472 852 --43602 3302 1294 277
NM_199327chr451001 762 148 94 58 31028 390 86 ----
NM_199328chr2151230 1107 1032 801 102 ------
NM_199342chr11234 1245 ----
NM_199346chr22162 137 1192 ----
NM_199355chr1621482 1342 31821 1626 1371 11284 --
NM_199359chr20------2584 460
NM_199360chr20------2584 460
NM_199361chr20------2584 460
NM_199362chr20------2584 460
NM_199363chr20------2584 460
NM_199416chr11306 1313 ----
NM_199421chr14174468 4176 4082 3736 3728 3570 3405 2031 1588 1407 1322 599 488 202 147 83 59 34182 1977 1327 44362 1671 256 40 21615 373
NM_199436chr2102474 1072 1053 1006 630 614 530 490 429 398 1279 42961 1975 771 192 12936
NM_199437chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199438chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199439chr1162102 1969 1769 932 690 571 1588 1585 22575 1013
NM_199440chr21306 ------
NM_199454chr1104437 4237 3906 3889 3852 1491 1475 1443 1211 415 1540 21428 1382 31584 629 507
NM_199461chr1042919 2880 2738 2223 23223 903 1404 --
NM_199462chr1124722 4569 3829 3785 3673 3338 3044 1429 1338 1137 1116 390 --13901 --
NM_199482chr231673 1393 100 11342 11902 --
NM_199511chr35744 632 622 110 75 --1339 --
NM_199512chr35744 632 622 110 75 --1339 --
NM_201263chr142069 1950 1843 1308 31781 1421 1364 ----
NM_201266chr252978 931 888 870 346 --168 --
NM_201269chr13576 551 328 3579 554 63 41348 1215 1202 56 --
NM_201278chr1141470 528 480 308 --31967 932 873 --
NM_201279chr252978 931 888 870 346 --168 --
NM_201281chr1141470 528 480 308 --31967 932 873 --
NM_201428chr1141463 1053 460 120 31534 530 124 11524 --
NM_201429chr1141463 1053 460 120 31534 530 124 11524 --
NM_201430chr1141389 979 386 46 31460 456 50 11450 --
NM_201434chr17--1226 ----
NM_201436chr73850 153 84 ----1264
NM_201437chr861533 1457 1355 308 279 101 --31130 386 225 --
NM_201438chr124357 322 79 23 ------
NM_201439chr12189 --151 --
NM_201440chr12189 --151 --
NM_201515chr12189 --151 --
NM_201516chr73906 209 140 ----1320
NM_201517chr73850 153 84 ----1264
NM_201532chr11----1600 --
NM_201533chr11----1600 --
NM_201548chr23993 544 119 21060 445 2537 439 11436
NM_201568chr182186 2160 2149 1942 1745 505 452 379 ------
NM_201569chr182186 2160 2149 1942 1745 505 452 379 ------
NM_201570chr1051527 1373 389 182 22 ------
NM_201571chr1051527 1373 389 182 22 ------
NM_201572chr1051527 1373 389 182 22 ------
NM_201590chr1051527 1373 389 182 22 ------
NM_201591chr461641 1509 1287 649 310 228 21694 1609 21359 147 --
NM_201592chr461641 1509 1287 649 310 228 21694 1609 21359 147 --
NM_201593chr1051527 1373 389 182 22 ------
NM_201596chr1051527 1373 389 182 22 ------
NM_201597chr1051527 1373 389 182 22 ------
NM_201613chr121324 --1758 --
NM_201624chr12815 389 --2232 103 11106
NM_201632chr541843 1362 1355 1303 --1477 --
NM_201633chr5----1340 --
NM_201634chr541942 1461 1454 1402 --1576 --
NM_201647chr21597 ----1180
NM_201995chr112712 53 2310 88 164 --
NM_201998chr114777 526 118 74 1153 1129 --
NM_201999chr45963 956 924 385 105 1976 ----
NM_203282chr19141861 1790 1755 1594 1584 1560 1554 1495 1389 1349 1303 1226 687 36 --21715 635 --
NM_203283chr42604 576 1437 ----
NM_203284chr42604 576 1437 ----
NM_203291chr18139 --187 --
NM_203292chr18132 --180 --
NM_203301chr143360 283 61 --21733 321 1651
NM_203304chr192621 298 2650 284 3849 640 631 --
NM_203327chr2074576 4419 4287 4234 3525 1648 1468 14374 14436 --
NM_203341chr181092 1074 1012 1001 857 844 758 743 1913 1893 1270
NM_203342chr1122438 1311 1304 1251 1237 1031 986 867 666 653 360 168 23017 272 33206 3014 2465 --
NM_203343chr1122438 1311 1304 1251 1237 1031 986 867 666 653 360 168 23017 272 33206 3014 2465 --
NM_203349chr1571803 1735 1667 1551 1544 872 524 11557 --22149 1759
NM_203350chr181774 1556 1430 1390 1218 571 294 55 ------
NM_203351chr17--12147 12075 --
NM_203364chr1171056 927 842 319 306 253 155 --1369 --
NM_203370chr3137 ------
NM_203372chr251578 1371 253 190 135 2609 409 --1624
NM_203390chr8101790 1536 1368 567 349 270 224 165 113 81 21356 86 1187 --
NM_203391chrX71865 1775 1405 678 574 470 206 1215 11474 1709
NM_203394chr1272715 2515 2345 2082 1962 1676 349 21976 1688 42702 2689 1037 544 1858
NM_203399chr13673 341 232 --2703 80 --
NM_203401chr13673 341 232 --2703 80 --
NM_203403chr961112 1060 233 182 83 71 ----1205
NM_203406chr5132859 2786 2724 2659 2529 2217 2109 2058 962 850 422 394 173 12132 42254 1055 927 542 32239 802 516
NM_203417chr211299 11555 31552 1366 1227 --
NM_203418chr211299 11555 31552 1366 1227 --
NM_203434chr931204 253 197 ------
NM_203437chr22226 40 --3744 720 241 --
NM_203446chr2132338 2107 2037 --12016 --
NM_203447chr96981 917 819 794 762 186 ------
NM_203451chr1352261 1636 736 353 139 22080 540 12076 --
NM_203453chr921933 475 1575 11309 --
NM_203458chr153707 3541 3044 2765 2416 --13194 --
NM_203459chr192546 2388 2171 1997 974 798 412 388 365 42554 2174 2135 368 12151 --
NM_203463chr294356 4148 4067 3762 1663 1582 1192 609 471 --44934 4913 1210 264 14674
NM_203487chr1381691 1634 1591 1403 669 658 632 374 1249 1246 --
NM_203488chr141332 ------
NM_203499chr173798 223 42 2868 746 1743 1334
NM_203504chr4102078 1997 1924 864 817 754 548 415 112 58 1827 42584 2417 1944 69 --
NM_203505chr4102078 1997 1924 864 817 754 548 415 112 58 1827 42584 2417 1944 69 --
NM_205768chr1122066 1944 1893 1881 1832 1623 1563 505 367 360 352 332 31804 1568 373 2824 434 --
NM_205834chr19--139 133 --
NM_205842chr24763 626 115 35 ------
NM_205852chr1231708 1543 843 --2745 671 --
NM_205860chr173210 3131 2447 1267 1128 1081 328 --13163 12465
NM_206594chr1173497 3247 3111 3098 2243 1015 842 517 505 454 389 338 286 278 260 207 184 1348 21053 245 12857
NM_206595chr1173497 3247 3111 3098 2243 1015 842 517 505 454 389 338 286 278 260 207 184 1348 21053 245 12857
NM_206839chr155427 177 170 53 47 1431 1652 --
NM_206853chr6183745 3693 3683 3329 3281 3212 3030 2650 1663 1598 1562 1471 1437 1007 989 935 847 697 32804 2540 1291 23893 1402 --
NM_206854chr6185006 4954 4944 4590 4542 4473 4291 3911 3541 3429 2108 1958 1212 846 520 477 189 115 24065 3801 15154 --
NM_206855chr6235971 5919 5909 5555 5507 5438 5256 4876 4506 4394 3889 2177 1811 1485 1442 1154 1080 915 717 709 700 375 25 35030 4766 918 16119 13995
NM_206860chr10----1470 --
NM_206861chr10----1470 --
NM_206862chr10----1470 --
NM_206866chr21103228 2931 2438 891 771 558 501 468 408 102 12775 63094 3005 2772 2674 2468 977 12628
NM_206876chr2133627 2857 2541 2390 1294 1282 1170 993 915 909 731 454 269 32755 2291 1300 82970 2752 2422 2404 1392 1183 439 151 --
NM_206886chr14220 197 164 40 ------
NM_206907chr5122767 2729 2666 2289 1191 1015 964 669 660 507 264 24 12678 63182 3168 2962 2705 2606 2531 --
NM_206909chr8228027 6498 6101 5974 5823 5809 5792 5444 3085 2819 2415 1935 1784 1506 1361 1267 1182 898 345 197 181 141 47773 5163 1090 348 46533 5753 3262 126 18119
NM_206914chr1261914 1808 1374 657 389 265 11395 21875 779 --
NM_206927chr114843 699 323 154 --1714 --
NM_206928chr114843 699 323 154 --1714 --
NM_206929chr114843 699 323 154 --1714 --
NM_206930chr114843 699 323 154 --1714 --
NM_206938chr1132045 1907 1335 --21866 1298 --
NM_206939chr1132045 1907 1335 --21866 1298 --
NM_206940chr1132045 1907 1335 --21866 1298 --
NM_206943chr23808 750 639 1309 1374 --
NM_206944chr92676 101 ----1839
NM_206945chr92676 101 ----1839
NM_206946chr92676 101 ----1839
NM_206947chr92676 101 ----1839
NM_206962chr211608 ------
NM_206966chr51183 ------
NM_207012chr1062351 1403 1018 1006 631 160 12878 22438 245 1617
NM_207015chr341697 1602 856 184 12216 31734 667 582 1142
NM_207171chr181599 1584 1463 622 540 398 298 262 32038 1928 270 42021 1925 777 354 1111
NM_207174chr214802 744 516 238 1246 ----
NM_207189chr11152 ------
NM_207291chr191123 2486 111 ----
NM_207299chr941028 918 393 314 130 31042 173 138 --
NM_207303chr1052926 2620 909 889 839 --24036 1445 22793 353
NM_207304chr1392264 1976 1946 1914 1832 1820 1650 1043 656 --22492 1053 12073
NM_207311chr1221293 1266 ------
NM_207313chr1721024 989 ------
NM_207317chr51380 --155 --
NM_207343chr111116 ------
NM_207352chr482084 1879 852 844 377 305 183 117 2508 198 2368 204 21831 990
NM_207371chr1071295 1043 1035 592 545 167 150 1604 ----
NM_207377chr141110 ------
NM_207391chr1921314 856 ------
NM_207396chr141321 1308 266 88 2703 91 2562 258 198
NM_207404chr362081 1762 651 582 442 35 1407 21836 1397 --
NM_207406chr4166438 6391 6205 5272 5061 4674 4648 4506 4333 4309 1940 1760 1529 1419 671 233 56422 6371 5598 4679 1252 56334 5911 4201 1866 1281 11827
NM_207410chr64132 126 120 55 1443 1565 --
NM_207413chr82446 97 1306 1382 --
NM_207418chr1_random51030 1012 244 96 36 1853 21043 267 --
NM_207429chr1172324 2232 2019 1895 553 393 192 22391 1889 ----
NM_207445chr1582151 2007 1655 632 539 438 400 274 32154 1661 446 ----
NM_207481chr241301 1171 1046 521 21341 994 31232 1156 552 1217
NM_207506chr861357 1071 512 460 330 26 ------
NM_207517chr1531877 1812 751 11370 --1196
NM_207518chr1931188 495 31 --1532 --
NM_207520chr21133 ------
NM_207521chr21133 ------
NM_207577chr1152693 1969 411 156 56 162 ----
NM_207578chr13728 237 56 1625 ----
NM_207627chr214802 744 516 238 1246 ----
NM_207628chr214802 744 516 238 1246 ----
NM_207629chr214802 744 516 238 1246 ----
NM_207645chr1171325 1238 1136 1057 989 981 61 ------
NM_207647chr9122391 2353 2135 1860 937 865 754 718 584 513 364 271 1653 31961 999 772 21937 690
NM_207660chr142517 156 ------
NM_207661chr142517 156 ------
NM_207662chr142517 156 ------
NM_212460chr781774 1491 1449 1441 1299 739 536 479 1515 --11354
NM_212471chr1782318 2256 1783 1482 852 582 545 420 1358 21569 353 11683
NM_212472chr1782318 2256 1783 1482 852 582 545 420 1358 21569 353 11683
NM_212554chr1081485 1369 1184 575 423 416 334 306 --21599 1381 --
NM_212558chr9113684 3517 3273 3042 2966 2816 1511 1159 742 670 452 --22713 1467 --
NM_213589chr2105273 4860 4453 4258 4058 3909 3687 2219 1871 1421 35171 5086 3916 11084 --
NM_213590chr13265294 5182 5048 5024 4622 4485 4457 4397 4333 4137 3866 3705 3645 3576 3529 3506 3376 3327 3246 1295 895 539 360 333 195 28 23678 1635 55158 4674 4629 4047 531 --
NM_213594chr1231107 1051 411 --11039 --
NM_213598chr1951419 1252 1086 1004 428 31412 1115 1016 2420 255 --
NM_213606chr1072583 2395 2194 1014 982 546 59 --1587 12208
NM_213609chr341113 769 727 236 ------
NM_213618chr111198 --1472 --
NM_213622chr21597 ----1180
NM_213647chr5----1441 --
NM_213648chr541843 1362 1355 1303 --1477 --
NM_213654chr391447 1437 1350 1255 1100 546 352 209 170 --1386 --
NM_213662chr1752443 2434 1550 604 450 1218 1215 --