TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-187-3p
miRNA Sequence: UCGUGUCUUGUGUUGCAGCCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542108 1271 190 59 11346 --1795
NM_000092chr252965 1275 1174 1031 222 13567 1960 --
NM_000109chrX22311 1769 ----1731
NM_000189chr252233 1655 959 844 327 --1340 --
NM_000216chrX63024 2925 1396 1316 645 202 --168 --
NM_000217chr1275367 5035 4376 4171 3583 2018 100 11932 ----
NM_000259chr1551896 1309 782 676 392 ----26128 1230
NM_000332chr666769 6733 6138 4481 1805 1388 11074 1559 --
NM_000337chr586551 6436 4271 4222 2507 2046 616 58 --16135 --
NM_000430chr1753324 3234 2833 2742 2331 13558 ----
NM_000461chr364193 3839 3170 2868 1252 340 --2970 142 --
NM_000555chrX106313 6297 5976 3066 1738 1564 1404 1315 1230 665 ------
NM_000618chr12106332 5728 5434 4235 4216 2603 2580 1083 637 32 ------
NM_000618chr12106332 5728 5434 4235 4216 2603 2580 1083 637 32 ------
NM_000633chr1885277 4745 4212 3366 1342 1277 818 150 --11221 --
NM_000719chr12106640 6393 5597 5347 5234 4729 4714 4632 1179 593 --1138 --
NM_000788chr461499 1429 1127 219 203 40 ------
NM_000806chr531924 370 283 --1763 --
NM_000809chr469203 7311 5945 3259 1837 1146 ------
NM_000814chr15104187 3810 3490 3391 3368 1440 818 451 105 93 14159 ----
NM_000826chr462479 2123 1032 923 513 373 ------
NM_000831chr196243 6104 4342 4314 4270 2488 2426 1865 420 ----35341 1480 1296
NM_000833chr1661200 1149 1034 499 275 214 11411 ----
NM_000872chr1021538 1348 --11398 11108
NM_000875chr15146594 6152 5796 5730 5087 4988 4286 2293 2088 1807 991 796 747 233 21532 528 26337 688 11628
NM_000950chrX72766 2673 2360 2227 2211 429 251 ------
NM_001001323chr1253090 2661 1984 753 405 --12632 --
NM_001001419chr541811 830 664 73 11826 --11716
NM_001001420chr541811 830 664 73 11826 --11716
NM_001001664chr274067 3497 2606 1077 994 834 340 12538 ----
NM_001001890chr2164121 3286 3015 1036 788 287 14062 ----
NM_001001974chr1041950 826 658 456 ------
NM_001002860chr1423943 3655 --21306 155 --
NM_001003406chr2293040 2807 2545 2361 2208 2125 1063 653 276 ------
NM_001003712chr1252974 2570 1005 478 424 ------
NM_001003800chr993689 3683 3124 2464 1372 946 640 625 156 --1887 --
NM_001004065chr942432 1450 1143 193 13375 --12543
NM_001004317chr673650 3087 3018 1612 559 294 207 11156 ----
NM_001004419chr12104547 3561 3245 3004 2990 2878 1285 1141 603 25 1610 11689 --
NM_001005473chr586458 6049 5966 5485 5317 2594 2126 2096 ------
NM_001006657chr233148 2641 540 12803 11006 --
NM_001007237chr162013 1982 1919 1857 1083 1068 12663 ----
NM_001007466chr694675 3689 3523 3377 3199 1117 643 449 350 11823 ----
NM_001008392chr382851 2775 2292 2201 2179 487 460 211 13040 ----
NM_001008408chr796211 4800 4369 4310 1259 1101 706 292 183 --26151 1818 --
NM_001009899chr386132 5553 5343 5181 5124 4422 569 163 --21471 73 --
NM_001010891chr575427 5223 5000 4616 1729 857 83 15141 ----
NM_001010922chr144013 2851 2758 299 --13663 --
NM_001012755chrX54467 3506 2025 993 338 --11769 --
NM_001014380chr1375672 4503 2202 1649 1620 1474 1225 ------
NM_001014797chr10117762 6987 6735 6494 6307 5705 2312 2305 1743 1600 870 --13127 --
NM_001017440chr743247 2692 2614 193 --25418 86 15802
NM_001018091chr1551839 596 519 497 62 --1623 --
NM_001024947chr52698 384 --1876 1909
NM_001024948chr143343 2663 1207 1194 --12368 --
NM_001025076chr1065758 4936 4392 4062 1309 432 12398 ----
NM_001025077chr1077116 6294 5750 5420 2667 1790 1406 ------
NM_001025108chr264005 785 695 347 204 63 --12861 --
NM_001025580chrX64181 4072 3817 1234 1052 857 ------
NM_001029858chr652802 2323 1334 920 174 21252 1176 ----
NM_001030055chr1443820 3718 3476 648 --154 --
NM_001031695chr2295116 4793 3651 3415 2005 1181 1162 591 357 --11683 13406
NM_001031732chr483464 3020 1421 965 896 579 260 34 --23077 2585 --
NM_001031804chr1654268 3678 1237 998 960 ------
NM_001032380chr1021768 803 ----198
NM_001032394chr652049 1082 1033 428 108 ------
NM_001033507chr141932 462 290 271 --11734 --
NM_001033551chr1784063 3657 2998 2713 1513 1262 747 57 --13400 --
NM_001033925chr104646 314 155 79 ----169
NM_001037553chr2164823 4092 3792 3700 3304 1775 1544 11764 --
NM_001039569chr262821 1106 749 488 319 93 ------
NM_001039577chr194187 4108 3742 3234 1566 723 631 578 405 ------
NM_001039618chr1154424 3712 2305 558 92 11182 ----
NM_001039840chrX55035 1624 1013 473 458 ------
NM_001039937chr1353818 2836 1389 791 93 1886 ----
NM_001040001chr671757 1654 1632 1400 1354 1302 510 ------
NM_001040101chr441490 1363 1167 1157 ------
NM_001040113chr166906 659 625 295 110 101 --1856 --
NM_001040152chr774839 4732 4393 4379 1263 660 104 21822 1598 ----
NM_001040429chr1353331 948 912 686 651 ------
NM_001040712chr952471 2440 964 523 256 --12457 --
NM_001042555chr1253984 3298 3284 2967 268 ------
NM_001042599chr275674 5184 2484 2358 1066 125 32 16384 17235 --
NM_001042601chr342543 2300 2142 298 ----12533
NM_001042604chr384547 4099 3917 3257 1901 975 360 146 ------
NM_001083620chr462477 2121 1031 922 512 372 ------
NM_001106chr389500 8042 6597 5887 3600 3208 2769 237 18607 --1964
NM_001173chr1443820 3718 3476 648 --154 --
NM_001174chrX82183 1645 832 495 386 177 110 33 ------
NM_001204chr287708 7211 6310 5934 4971 2938 2036 454 ------
NM_001218chr1542714 637 605 73 --1734 1941
NM_001241chr262190 1648 820 767 61 51 ------
NM_001241chr262190 1648 820 767 61 51 ------
NM_001390chr1853577 3451 3395 2748 764 ------
NM_001402chr651872 1501 1485 342 327 ------
NM_001419chr1954704 1675 662 637 162 --1734 13408
NM_001420chr19112341 2056 1278 1149 1088 1043 953 857 848 838 826 1121 32253 899 868 --
NM_001542chr162013 1982 1919 1857 1083 1068 12663 ----
NM_001650chr1843644 2651 2613 971 --1331 --
NM_001668chr152046 2031 1993 1885 120 1806 ----
NM_001682chr1242804 2375 467 119 --12346 --
NM_001695chr853558 2769 1173 927 397 --11676 --
NM_001709chr1152487 2442 2147 660 166 ------
NM_001754chr2164121 3286 3015 1036 788 287 14062 ----
NM_001759chr1254570 1272 1150 735 662 25187 481 132 --
NM_001830chrX53346 3181 2716 756 478 --1998 --
NM_001879chr331706 1620 732 ----11835
NM_001969chr1473897 1290 1213 1004 926 251 168 ------
NM_002006chr455223 4749 4451 3589 2077 ------
NM_002015chr1353227 2077 1070 349 174 ------
NM_002025chrX118137 7920 6801 6779 6766 3385 2766 2539 2240 1376 396 16281 12711 13547
NM_002063chrX------3314 292 270
NM_002126chr1743525 2897 1499 1313 14077 --13034
NM_002130chr541405 510 191 134 11229 ----
NM_002137chr761880 1488 778 426 355 152 ------
NM_002141chr77594 572 558 525 462 150 104 ------
NM_002214chr764050 3652 2088 809 537 406 ------
NM_002239chr21339 ----11105
NM_002285chr264005 785 695 347 204 63 --12861 --
NM_002310chr556402 6152 5718 2554 1860 ------
NM_002336chr1244607 922 778 430 24686 1323 ----
NM_002387chr575144 4810 1117 983 972 617 340 ------
NM_002486chr93681 279 234 ----1554
NM_002581chr975519 5267 4718 3693 3666 1965 547 ------
NM_002737chr17106642 5732 5682 4534 4255 2356 2053 1958 1860 1344 ------
NM_002745chr2254325 4212 2872 1779 44 13444 12865 --
NM_002837chr12104599 4352 4223 4141 3734 3457 3380 3365 1335 1176 --1483 --
NM_002839chr952471 2440 964 523 256 --12457 --
NM_003034chr1277438 7365 2943 2641 1136 982 534 ------
NM_003051chr161484 1420 1414 629 456 106 ------
NM_003108chr285921 5034 4589 4490 2645 2537 1400 1030 --26357 2386 --
NM_003298chr364906 1758 1673 840 721 391 --14132 --
NM_003320chr1164398 4143 3162 3036 3000 757 ------
NM_003373chr1071886 1829 1775 348 318 179 156 ------
NM_003412chr352667 2636 2623 2198 840 ------
NM_003559chr1782777 2666 1086 1015 767 528 458 308 ------
NM_003566chr1233220 1105 95 ----12944
NM_003583chr1263269 2982 2916 2766 894 333 --23676 1424 138
NM_003590chr233201 2907 467 13369 ----
NM_003617chr154824 3153 1061 597 255 14029 13453 --
NM_003629chr193520 3442 3394 2780 2703 2677 2197 2150 283 ------
NM_003873chr1042476 2001 1867 397 11816 1159 --
NM_003916chrX41402 1004 451 223 ------
NM_004006chrX22311 1769 ----1731
NM_004007chrX22311 1769 ----1731
NM_004009chrX22311 1769 ----1731
NM_004010chrX22311 1769 ----1731
NM_004011chrX22311 1769 ----1731
NM_004012chrX22311 1769 ----1731
NM_004013chrX22311 1769 ----1731
NM_004014chrX22311 1769 ----1731
NM_004015chrX22311 1769 ----1731
NM_004016chrX22225 1683 ----1645
NM_004017chrX22311 1769 ----1731
NM_004018chrX22225 1683 ----1645
NM_004020chrX22311 1769 ----1731
NM_004021chrX22225 1683 ----1645
NM_004022chrX22225 1683 ----1645
NM_004023chrX22225 1683 ----1645
NM_004028chr1843644 2651 2613 971 --1331 --
NM_004065chrX2127 53 --3272 254 73 --
NM_004113chr361935 1879 1573 1492 1372 322 ------
NM_004171chr1187076 6200 2754 2083 1721 1272 1142 1019 21996 341 38177 275 170 11745
NM_004227chr7103128 2576 2458 1257 1149 957 701 629 576 52 --1372 --
NM_004232chr1843892 3266 2653 2604 ------
NM_004397chr1173949 3606 2627 2614 860 499 132 --1917 --
NM_004438chr263159 2896 1229 959 340 324 ------
NM_004612chr954876 4821 3503 3482 3327 ----11123
NM_004654chrY41339 1148 555 175 ------
NM_004687chr1761573 1335 1299 659 509 112 12031 ----
NM_004745chr875385 5049 4914 2228 435 147 136 11336 --11169
NM_004822chr17103883 3595 3497 3288 3140 2597 1265 1106 830 501 --21409 297 --
NM_004956chr753295 1440 804 749 56 11631 11025 --
NM_004976chr11104979 4737 4671 4622 3966 1950 1136 885 576 200 --24959 1927 --
NM_004992chrX98227 7726 7233 6946 5458 2682 388 317 287 16648 ----
NM_004992chrX98227 7726 7233 6946 5458 2682 388 317 287 16648 ----
NM_004999chr6103411 3289 2815 1774 1762 1724 1363 489 479 440 ------
NM_005056chr1255300 1159 739 280 270 ------
NM_005057chr161884 491 354 305 243 56 --11866 --
NM_005065chr1454949 888 882 555 276 --24411 110 13530
NM_005233chr34753 345 117 88 ------
NM_005235chr275674 5184 2484 2358 1066 125 32 16384 17235 --
NM_005252chr142776 719 ----1483
NM_005359chr1866230 4740 4477 1945 1255 785 ------
NM_005400chr252613 1226 907 390 71 ----12205
NM_005436chr1043772 2929 562 530 ----13109
NM_005497chr1785896 5880 5611 3937 2403 552 264 194 --24149 2104 --
NM_005504chr1276566 5701 4878 4109 1647 891 307 ------
NM_005578chr354078 1710 1558 1376 1177 --13243 --
NM_005596chr966109 5957 4573 1395 1337 32 ------
NM_005647chrX52890 2318 1065 741 448 1735 13297 --
NM_005665chr184579 4259 3955 3084 1707 1028 460 447 11587 ----
NM_005748chr1252842 1352 1049 565 91 ------
NM_005759chr223657 3381 --14050 1810
NM_005786chr184496 328 305 282 ------
NM_005808chr382851 2775 2292 2201 2179 487 460 211 13040 ----
NM_005822chr651970 1573 959 475 299 ------
NM_005895chr1282835 2815 1628 1580 1509 1190 1182 516 ----194
NM_005898chr1152810 1039 989 839 761 ------
NM_005903chr541811 830 664 73 11826 --11716
NM_005909chr542919 1036 970 451 --14003 --
NM_005910chr1763735 2562 1603 1492 1328 623 14040 13152 --
NM_005964chr1761428 1253 1138 1012 207 196 ------
NM_006007chr963769 3522 1694 1285 590 184 ----14276
NM_006037chr293788 2987 1050 254 246 239 229 180 120 1354 ----
NM_006095chr463502 1432 1309 1232 759 160 ------
NM_006187chr1273131 2970 813 784 762 644 46 ------
NM_006203chr555258 4961 4887 4378 3925 ------
NM_006212chr185270 3957 3814 3721 3308 1743 734 287 ------
NM_006282chr2064630 3833 1841 1758 788 499 ----1815
NM_006298chr663351 3304 3037 1267 733 511 12766 ----
NM_006306chrX105337 4655 4432 4090 4010 2111 791 655 567 126 ----1629
NM_006315chr473807 3692 2844 964 728 707 160 1304 ----
NM_006371chr385117 4833 4557 3971 3947 1100 802 270 ------
NM_006482chr1263269 2982 2916 2766 894 333 --23676 1424 138
NM_006496chr14790 236 192 54 1174 ----
NM_006561chr1065758 4936 4392 4062 1309 432 12398 ----
NM_006629chr1872802 2664 2493 2076 683 300 71 11961 ----
NM_006654chr1253984 3298 3284 2967 268 ------
NM_006717chr932085 446 58 ----12504
NM_006729chrX65393 4940 4614 3894 3768 2023 ------
NM_006750chr1696936 5285 5272 5035 2833 2604 1591 1293 334 ------
NM_006775chr652977 2660 2124 929 120 ------
NM_006873chr262923 1000 755 701 420 262 ------
NM_006888chr1431370 1084 1056 ----11282
NM_006912chr172356 1673 980 858 761 494 114 ------
NM_006996chr1184 ----11238
NM_007030chr5154458 3903 3728 3693 3658 1452 1252 1125 1107 1028 848 601 499 373 289 13722 23223 3186 1835
NM_007038chr2165461 4584 4171 3800 2444 1329 --11406 --
NM_007150chrX82076 2006 1830 1816 1806 1436 855 428 ------
NM_007203chr942432 1450 1143 193 13375 --12543
NM_007249chr1399422 9251 8423 8193 6993 1340 902 316 145 16753 26526 6471 16005
NM_012069chrX52572 2351 1963 144 93 ----12332
NM_012072chr2054027 2791 903 782 23 --11422 --
NM_012137chr142359 1039 714 231 ----12758
NM_012141chr1353818 2836 1389 791 93 1886 ----
NM_012153chr1162186 2169 1692 1580 1023 21 1381 11816 --
NM_012214chr255903 4835 4121 1591 689 15101 12460 --
NM_012219chr363094 2851 2219 1049 1026 177 11013 13001 12958
NM_012234chr353618 2991 2327 1270 1246 ------
NM_012262chr154668 4086 1097 689 156 ------
NM_012294chr764101 3301 1589 1354 339 122 ------
NM_012334chr5123898 3822 3715 3263 3233 3031 2916 1868 1383 1189 1069 241 1545 ----
NM_013230chrY31513 641 309 ----1276
NM_013231chr1463750 3643 3296 3001 1591 1321 --176 13184
NM_013269chr12104474 3488 3172 2931 2917 2805 1791 1212 1068 530 1537 11616 --
NM_013374chr33577 442 334 --21171 317 --
NM_014000chr1071886 1829 1775 348 318 179 156 ------
NM_014028chr632815 2083 52 11083 --12794
NM_014048chr1685320 4986 4678 1686 1490 780 678 487 ------
NM_014155chr1156464 5022 1942 1616 680 --15423 --
NM_014181chr242106 1783 321 170 ------
NM_014309chr2295106 4783 3641 3405 1995 1171 1152 581 347 --11673 13396
NM_014331chr476447 6323 5704 2617 633 511 44 ------
NM_014392chr441490 1363 1167 1157 ------
NM_014418chr1461818 1783 1636 1402 273 55 ------
NM_014423chr554909 4190 3971 3636 410 ------
NM_014616chr343394 3181 785 227 --11054 --
NM_014648chr341354 1333 1049 297 --1940 --
NM_014705chr751882 1483 833 83 70 ------
NM_014707chr751616 1552 1527 899 759 ------
NM_014743chr472846 2544 2016 1932 893 700 631 ------
NM_014747chr185442 5171 4100 4018 3632 1578 1506 1278 1320 ----
NM_014836chr1021768 803 ----198
NM_014864chr184330 4041 4024 3206 2911 1059 529 195 11236 ----
NM_014877chr1776768 5854 5815 5495 4757 1993 1779 1542 ----
NM_014906chr1763864 3660 1545 1136 281 74 12967 ----
NM_014920chr623556 2732 12958 1140 --
NM_014924chr1462956 2921 2595 2004 1009 598 1441 ----
NM_014946chr262878 2123 930 594 363 239 ------
NM_014947chr162946 2711 2251 1259 1247 349 1972 --11191
NM_014962chr2052882 2738 2049 1032 705 ------
NM_014988chr45923 867 835 534 432 --1418 --
NM_015000chr122819 257 ----1863
NM_015055chr1142912 2551 795 37 12415 ----
NM_015059chr1573460 3181 2582 1345 1075 449 315 ------
NM_015068chr763691 3584 3245 3231 1221 115 2674 450 ----
NM_015071chr5136124 5926 5849 5843 5706 5660 5476 4705 4432 2503 1870 607 452 25563 1911 ----
NM_015092chr1674712 3676 1233 923 590 186 43 ------
NM_015192chr2041944 1196 593 579 --11070 --
NM_015215chr152335 2299 2048 281 238 --177 --
NM_015265chr23800 241 224 --11900 --
NM_015285chr1852500 2380 1650 668 125 12421 1198 --
NM_015313chr1174761 4755 4749 4070 1340 912 767 ------
NM_015365chrX64181 4072 3817 1234 1052 857 ------
NM_015375chr194776 4505 3102 1883 1058 859 813 347 94 ------
NM_015381chr2241962 719 402 208 --1574 21702 375
NM_015535chr273839 3796 3607 3450 3109 715 402 ------
NM_015564chr543397 3150 1280 921 1761 11197 --
NM_015886chr864571 4332 1906 1563 866 733 --1775 --
NM_015995chr15115075 4917 4317 4078 3680 3437 1885 1639 285 261 207 ------
NM_016040chr142673 2264 749 694 --12539 --
NM_016072chr1221569 836 --1979 11890
NM_016081chr451998 1430 1380 648 126 ------
NM_016089chr3101442 721 711 697 637 469 459 301 291 133 ------
NM_016248chr1343738 2812 2430 1530 21203 1145 ----
NM_016257chr193244 2957 2872 2788 2653 1267 1259 561 93 ------
NM_016260chr266361 6220 2763 2456 1907 731 ------
NM_016275chr352048 1909 1902 865 485 ------
NM_016396chr1532781 2691 2332 --1687 --
NM_016507chr1752937 2006 1262 1217 246 --22073 675 --
NM_016513chr623556 2732 12958 1140 --
NM_016834chr1763735 2562 1603 1492 1328 623 14040 13152 --
NM_016835chr1763735 2562 1603 1492 1328 623 14040 13152 --
NM_016841chr1763735 2562 1603 1492 1328 623 14040 13152 --
NM_016929chr654529 4422 1773 596 217 --13848 --
NM_016953chr285801 5092 4210 3865 3737 1990 1732 1113 ------
NM_017644chr364313 4304 4257 4052 1818 1705 ------
NM_017650chr735483 5045 765 11792 1736 --
NM_017654chr741440 682 369 96 11471 ----
NM_017737chr122052 1372 ----1130
NM_017787chr1042255 2167 1974 1911 1357 12765 12525
NM_017813chr865733 5319 4928 959 876 612 ------
NM_018027chr1062140 965 751 335 273 183 12664 ----
NM_018045chr172894 2559 2218 737 565 519 320 --2845 543 --
NM_018084chr263235 2738 2414 501 95 24 ------
NM_018172chr117590 538 486 434 382 330 170 ----1248
NM_018243chr464068 3909 3643 2721 1081 956 1346 ----
NM_018374chr744557 3528 3344 508 11823 1969 --
NM_018440chr898679 7883 6927 6913 5642 2727 2292 1180 894 1950 ----
NM_018489chr162175 1935 1681 1456 668 508 ------
NM_018717chr452630 1966 413 246 213 --1542 1568
NM_018999chr1064698 4279 1497 719 251 223 ------
NM_019001chr384547 4099 3917 3257 1901 975 360 146 ------
NM_019022chr1852944 950 452 347 70 ------
NM_019063chr232088 1623 471 11923 1597 --
NM_019072chr574211 3352 3008 2967 1272 767 28 --11635 --
NM_019859chr1021569 1379 --11429 11139
NM_019860chr1021617 1427 --11477 11187
NM_020122chr265777 5641 3891 3642 696 243 ------
NM_020132chr2164823 4092 3792 3700 3304 1775 1544 11764 --
NM_020150chr102458 162 ----11873
NM_020208chr393281 2339 1308 1225 952 772 685 370 38 13385 ----
NM_020245chr694581 3595 3429 3283 3105 1023 549 355 256 11729 ----
NM_020297chr1253348 2590 2573 1018 432 12565 ----
NM_020310chr1752277 2006 1720 1073 638 --11020 12757
NM_020336chr2033544 2735 197 ----13655
NM_020390chr364684 3049 3012 1897 1575 686 ------
NM_020455chr652049 1082 1033 428 108 ------
NM_020466chr673542 3506 3381 3353 1535 1187 257 12008 ----
NM_020718chr1675931 5216 5096 2491 1793 728 677 --15942 14288
NM_020727chr2143385 981 752 381 ------
NM_020774chr1886278 5793 4502 3848 2497 2453 1209 338 --11162 11834
NM_020779chr233148 2641 540 12803 11006 --
NM_020783chr182444 270 ----12427
NM_020841chr1252974 2570 1005 478 424 ------
NM_020844chr887695 7219 7032 2327 1515 1450 660 615 ------
NM_020859chr453368 2825 2771 439 207 13810 ----
NM_020948chr142904 2235 1323 465 ------
NM_020962chr1562016 726 218 209 199 96 ------
NM_020975chr1041595 1559 738 629 --21632 202 --
NM_021032chr361935 1879 1573 1492 1372 322 ------
NM_021096chr2293040 2807 2545 2361 2208 2125 1063 653 276 ------
NM_021255chr1443346 524 167 135 21551 1310 1827 --
NM_021622chr1041950 826 658 456 ------
NM_021643chr241839 1517 626 106 2512 77 ----
NM_021813chr675858 5832 5223 4979 4801 3994 829 --15157 --
NM_021912chr15104187 3810 3490 3391 3368 1440 818 451 105 93 14159 ----
NM_021961chr1177444 5822 5349 4841 1327 850 440 ------
NM_021964chr355938 5346 5134 4306 2033 ------
NM_022166chr1664974 4809 1978 1572 1184 1045 --15833 --
NM_022405chr393281 2339 1308 1225 952 772 685 370 38 13385 ----
NM_022458chr773144 3075 2898 2609 2473 263 235 ------
NM_022459chr1345606 5007 4300 571 --11215 --
NM_022648chr284590 3753 3372 3292 1629 1308 681 536 14570 ----
NM_022716chr162962 2929 2587 2552 528 52 ------
NM_022844chr166906 659 625 295 110 101 --1856 --
NM_022912chr232572 2391 669 --12268 --
NM_023929chr832703 1858 833 1686 ----
NM_024492chr651191 926 583 448 241 21092 437 --11225
NM_024665chr364634 3213 3139 901 719 372 ------
NM_024770chr276684 6437 5372 5041 1108 1068 905 ------
NM_024817chr15115882 5466 4766 4283 4228 3836 3638 1724 591 513 457 --14035 --
NM_024947chr3108660 6443 3763 3488 3007 1717 1708 1158 717 509 16853 11225 --
NM_024989chr265429 2678 2319 1872 1259 1064 17642 --17146
NM_025160chr184091 3682 3483 2660 1132 970 772 215 --2814 104 --
NM_025179chr174934 4400 4084 1088 1015 971 537 ----24326 275
NM_025191chr143307 2475 1167 66 ------
NM_025222chr342941 1212 864 566 --11122 --
NM_030576chr1792525 2493 2400 2394 2171 2072 1869 1661 639 ------
NM_030579chr1653732 2564 927 355 140 12736 13267 --
NM_030647chr765930 5152 4369 4329 4041 4031 ------
NM_030670chr1242289 890 540 430 12209 --1416
NM_030671chr1242289 890 540 430 12209 --1416
NM_030674chr1285273 5252 4827 4388 3591 2284 1696 655 --23779 157 --
NM_030762chr1251838 1488 1309 453 273 ------
NM_030806chr1119196 8811 8766 6585 6335 3742 2584 2340 2171 1091 305 --16024 --
NM_030918chr145350 5147 2183 1182 --13601 13753
NM_031243chr761880 1488 778 426 355 152 ------
NM_031427chr1454112 4014 2266 1193 364 ------
NM_031442chrX43051 2742 2166 213 13193 1625 --
NM_031468chr743247 2692 2614 193 --25418 86 15802
NM_031469chr663816 3204 2843 1624 1098 970 ----13175
NM_031483chr2033042 2488 339 --1351 --
NM_032012chr974844 4669 4403 2095 1700 1572 609 ------
NM_032102chr1122695 2485 12458 22734 397 --
NM_032116chr1375672 4503 2202 1649 1620 1474 1225 ------
NM_032121chrX52767 2166 975 915 25 ----11132
NM_032160chr1854092 4054 3935 3216 3201 ----1718
NM_032281chr19112341 2056 1278 1149 1088 1043 953 857 848 838 826 1121 32253 899 868 --
NM_032445chr1542321 2062 655 256 ----1480
NM_032446chr562837 2489 1539 1104 304 155 1125 ----
NM_032682chr333285 794 356 ----12675
NM_032727chr1051637 1288 1206 493 392 11518 ----
NM_032859chr1353650 3412 3241 2921 2507 ------
NM_032873chr1163739 3522 1413 972 741 574 11561 ----
NM_032968chrX51585 1225 712 120 59 ------
NM_032969chrX51585 1225 712 120 59 ------
NM_032973chrY51584 1225 712 120 59 ------
NM_032975chr1853577 3451 3395 2748 764 ------
NM_032980chr1853577 3451 3395 2748 764 ------
NM_033132chr1341600 1474 1433 906 ------
NM_033224chr756532 6423 6090 5847 837 --13116 --
NM_033285chr863421 866 696 672 309 137 ------
NM_033290chrX33243 3066 1502 13664 13081 --
NM_033326chr113616 249 233 --11786 --
NM_033389chr1764047 3099 1417 1285 861 728 --13129 1597
NM_033512chr862534 2321 989 922 847 320 --12399 --
NM_052834chr1852500 2380 1650 668 125 12421 1198 --
NM_052885chr1241656 1238 621 153 ------
NM_052907chr1284040 3747 3095 3072 1492 416 387 293 ------
NM_053016chr947961 7482 6950 2087 1756 ----
NM_053043chr796211 4800 4369 4310 1259 1101 706 292 183 --26151 1818 --
NM_130391chr952471 2440 964 523 256 --12457 --
NM_130392chr952471 2440 964 523 256 --12457 --
NM_130393chr952471 2440 964 523 256 --12457 --
NM_130847chr1195356 3957 2341 2282 2077 2055 1870 1433 742 --14584 --
NM_130848chr5101984 1880 1535 1406 440 379 354 290 282 40 --2632 549 --
NM_133370chr483464 3020 1421 965 896 579 260 34 --23077 2585 --
NM_133493chr683667 3371 3352 3247 1718 845 565 504 1952 ----
NM_133646chr295015 4963 4904 3792 1942 1275 1269 562 414 --13530 --
NM_138444chr1353836 3376 3134 1051 794 --14807 --
NM_138468chr2116080 5964 4142 1661 1506 1346 1025 935 640 274 37 11096 ----
NM_138473chr1274718 4694 4097 4004 902 784 26 --181 --
NM_138782chr541968 1658 660 110 ------
NM_138959chr1106170 5497 4514 4147 2204 1322 1199 496 421 385 --25665 1712 --
NM_144571chr446774 6746 5864 2444 ----14981
NM_144578chr1485035 4743 4697 4532 4502 4374 3932 3453 ----11063
NM_144599chr1585394 5220 4761 3593 1431 1164 903 564 --15360 --
NM_145176chr6113471 3224 2975 2887 1231 1013 993 428 382 322 124 1401 ----
NM_145259chr276188 5998 5755 1278 1024 678 661 ------
NM_145307chr1064524 4003 3738 3309 3135 1452 --14602 --
NM_145727chr671253 1149 1090 926 896 448 241 1437 ----
NM_145799chrX52269 1940 1208 326 61 12460 ----
NM_147150chr942432 1450 1143 193 13375 --12543
NM_148571chr1741982 721 526 289 --11430 --
NM_152265chr11429 --175 11508
NM_152563chr117590 538 486 434 382 330 170 ----1248
NM_152624chr587396 5917 5891 5443 4950 2523 956 126 ----12794
NM_152673chr354396 4389 3777 1124 614 --12902 11395
NM_152774chr742730 2391 2190 55 ------
NM_152903chr1332448 2377 1162 12140 ----
NM_153619chr1573583 3043 2362 2222 932 715 277 --183 --
NM_153836chr231755 296 209 --12123 --
NM_170665chr1263008 1023 806 773 321 207 13604 24591 905 --
NM_170731chr1152487 2442 2147 660 166 ------
NM_170732chr1152487 2442 2147 660 166 ------
NM_170733chr1152487 2442 2147 660 166 ------
NM_170734chr1152487 2442 2147 660 166 ------
NM_170735chr1152487 2442 2147 660 166 ------
NM_172069chr21280 ----11482
NM_173495chrX62070 1869 1653 1597 532 228 ------
NM_173531chr1963452 1457 1173 853 777 130 ------
NM_173851chr883782 2951 1353 1346 1141 924 886 167 12769 ----
NM_175736chr12137365 6931 6721 6273 5666 5539 5102 4959 2612 1733 1528 1262 1079 --15184 --
NM_175854chr1361790 979 971 762 743 28 ------
NM_175861chr1255324 2364 1552 901 335 --15161 --
NM_177398chr141932 462 290 271 --11734 --
NM_177399chr141932 462 290 271 --11734 --
NM_177972chr1164398 4143 3162 3036 3000 757 ------
NM_177999chr943357 1065 967 593 --12915 13702
NM_178011chr1033188 2995 2315 ----1164
NM_178151chrX106313 6297 5976 3066 1738 1564 1404 1315 1230 665 ------
NM_178152chrX106313 6297 5976 3066 1738 1564 1404 1315 1230 665 ------
NM_178153chrX106313 6297 5976 3066 1738 1564 1404 1315 1230 665 ------
NM_178426chr162146 2131 2093 1985 1466 220 1906 ----
NM_178427chr152046 2031 1993 1885 120 1806 ----
NM_178539chr1221615 1521 ----1182
NM_178554chr383203 3001 2550 2465 2337 1224 755 88 1415 11385 --
NM_178831chr772881 2393 2050 1045 1025 528 122 ------
NM_181443chr2052882 2738 2049 1032 705 ------
NM_181504chr563512 2808 2797 2721 2544 480 --2539 168 --
NM_181521chr16116923 6592 5492 4896 2711 2444 2166 1513 1094 1052 415 --26599 5255 --
NM_181523chr563512 2808 2797 2721 2544 480 --2539 168 --
NM_181524chr563512 2808 2797 2721 2544 480 --2539 168 --
NM_181836chr552340 2102 1817 722 162 ------
NM_182485chr463565 3065 1159 662 76 69 ------
NM_182503chr665505 4189 3991 3454 2118 678 --12228 --
NM_182646chr463565 3065 1159 662 76 69 ------
NM_182972chr172742 2335 1962 1910 761 605 199 --12058 --
NM_183004chr1473897 1290 1213 1004 926 251 168 ------
NM_194071chr765405 3836 3727 3569 1264 1085 --24712 107 --
NM_198225chr1021768 803 ----198
NM_198270chrX53149 3068 2590 508 174 ------
NM_198900chr12137365 6931 6721 6273 5666 5539 5102 4959 2612 1733 1528 1262 1079 --15184 --
NM_198935chr2052324 1108 465 354 89 ----12685
NM_199436chr262878 2123 930 594 363 239 ------
NM_199462chr194776 4505 3102 1883 1058 859 813 347 94 ------
NM_203390chr851726 1394 1150 735 330 ------
NM_206855chr675498 4213 4169 1751 899 756 571 --12116 --
NM_206925chr1542714 637 605 73 --1734 1941
NM_207380chr1573662 3112 2935 2718 2419 2257 724 --13295 --
NM_207406chr466453 4898 2595 1809 633 481 --1382 11344
NM_212558chr993958 3653 3143 3088 2924 2892 510 205 172 --1886 23062 2835
NM_213589chr255149 4592 4551 4036 657 ------