TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-187-5p
miRNA Sequence: GGCUACAACACAGGACCCGGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000029chr11461 ------
NM_000052chrX42498 2382 864 86 12913 22988 712 12408
NM_000084chrX96927 6292 5745 5486 5105 4902 2447 1644 1430 26280 4726 12552 --
NM_000112chr534912 4084 399 24038 3455 2499 177 14801
NM_000129chr6----146 --
NM_000167chrX1150 ----21672 1438
NM_000176chr543749 3278 2880 2724 11364 13718 12821
NM_000222chr421628 1433 11966 21939 1453 --
NM_000227chr181411 ------
NM_000248chr3--11163 ----
NM_000259chr1565819 5265 5002 2498 2066 2014 22446 799 16321 --
NM_000314chr1022359 205 22990 2758 12685 1425
NM_000332chr697009 6591 6221 5045 2692 1993 1592 771 409 11633 14359 15032
NM_000337chr566513 5283 5166 4930 4821 1655 --35910 2214 633 12013
NM_000430chr171807 ------
NM_000439chr532513 542 408 --12109 1119
NM_000449chr11219 ------
NM_000555chrX76808 6426 5951 5925 1970 1854 1088 16829 36968 6855 2066 155
NM_000574chr1--1902 ----
NM_000610chr11--1556 22705 2196 --
NM_000633chr1884737 4187 3472 3413 1502 1355 1142 333 21714 1333 ----
NM_000813chr535339 4367 196 13887 15369 --
NM_000942chr15149 ------
NM_001001344chrX12559 1774 1784 --
NM_001001389chr11--1556 22705 2196 --
NM_001001390chr11--1556 22705 2196 --
NM_001001391chr11--1556 22705 2196 --
NM_001001392chr11--1602 22751 2242 --
NM_001001394chr21649 ------
NM_001001395chr1222574 161 ----12488
NM_001001483chr11160 --1457 --
NM_001001484chr10------12328
NM_001002233chr831515 1478 487 12022 22177 1498 --
NM_001002257chr233196 785 149 23266 3190 11019 --
NM_001003652chr1886793 6138 3435 2787 2496 1407 653 147 16265 18183 --
NM_001003792chr311128 ------
NM_001003793chr311128 ------
NM_001005353chr1--158 ----
NM_001005353chr1--158 ----
NM_001005476chr21232 ------
NM_001007237chr132324 559 257 22888 2702 1620 --
NM_001007257chr11393 11353 1989 11104
NM_001007278chr1344953 3194 1383 737 --1943 --
NM_001008225chr7----1653 1266
NM_001008239chr1833062 867 114 23821 948 11212 21176 107
NM_001009881chr1----1485 --
NM_001009882chr1----1485 --
NM_001010891chr586213 6193 5406 4931 4534 4299 979 420 26655 723 11309 1748
NM_001010895chr9------1711
NM_001011551chrX------163
NM_001012506chr3--1141 ----
NM_001013699chr12----1538 131
NM_001013746chr721945 928 7742 573 489 409 325 241 157 --11541
NM_001014797chr1097103 6812 6436 6416 5236 2066 1897 884 779 16187 22422 759 --
NM_001015877chrX52335 2266 1202 1030 430 11940 13058 13066
NM_001017405chr4----1883 --
NM_001017523chr12----1536 --
NM_001018072chr12----1536 --
NM_001018074chr543749 3278 2880 2724 11364 13718 12821
NM_001018075chr543749 3278 2880 2724 11364 13718 12821
NM_001018076chr543749 3278 2880 2724 11364 13718 12821
NM_001018077chr543749 3278 2880 2724 11364 13718 12821
NM_001018111chr743306 3181 1354 953 13757 --12628
NM_001020658chr1----1504 --
NM_001020658chr1----1504 --
NM_001020825chr531224 355 199 --11193 1296
NM_001023567chr1542130 1987 1697 243 1728 --12479
NM_001024094chr543749 3278 2880 2724 11364 13718 12821
NM_001024937chr171726 ------
NM_001025076chr1053858 1009 808 614 93 1318 15894 11863
NM_001025077chr1065216 4596 2367 2166 1972 1451 11676 27252 4863 --
NM_001025108chr244046 2903 2754 2541 13752 21485 1355 --
NM_001025201chr2176 ----1151
NM_001025203chr21----2136 43 --
NM_001025204chr21----2136 43 --
NM_001025580chrX13200 23063 2775 12646 14275
NM_001025603chr11219 ------
NM_001025780chr921502 1435 ------
NM_001029858chr662319 1004 848 768 592 389 23367 3135 ----
NM_001030055chr1454131 3590 3469 1005 932 31709 1328 285 24327 656 --
NM_001030059chr10185 ------
NM_001031695chr2234233 1267 529 14199 --13828
NM_001031732chr422861 390 13180 --1476
NM_001031746chr1011166 ------
NM_001031803chr17----1256 --
NM_001033045chr211374 1673 ----
NM_001033057chr352072 2011 442 429 421 11394 ----
NM_001033059chr621940 110 ------
NM_001035260chr1011032 11580 ----
NM_001037225chr11----193 --
NM_001038628chr341347 425 368 44 ----11586
NM_001039479chr1442031 871 750 601 --1698 1923
NM_001039547chr367877 7400 5487 2560 2302 1793 --12482 1236
NM_001039574chr11256 ------
NM_001039580chr444455 4201 1329 386 11801 14845 --
NM_001039618chr1194970 4944 4823 4778 4542 4017 2263 1923 252 15423 14768 25349 4042
NM_001039619chr14--158 ----
NM_001039693chr253889 3597 3138 2955 821 --13713 --
NM_001039840chrX54288 3976 1392 1114 59 13795 11840 --
NM_001040113chr161883 ------
NM_001040114chr161742 ------
NM_001040142chr2----12123 --
NM_001040143chr2----12123 --
NM_001040284chr1665460 4712 4514 4484 4436 3997 --24669 1393 --
NM_001040402chr422054 1187 2408 170 1926 1350
NM_001040876chr4----1164 --
NM_001042355chr1694786 4714 3856 3314 1177 1112 976 316 110 11899 1406 14768
NM_001042370chr11223 ------
NM_001042412chr1694786 4714 3856 3314 1177 1112 976 316 110 11899 1406 14768
NM_001042414chr131271 ------
NM_001042479chrX3601 459 435 --1559 --
NM_001042480chrX3601 459 435 --1559 --
NM_001042555chr1244550 4240 3247 434 13054 11305 34199 3584 1386
NM_001042599chr257286 5211 5069 1995 1079 26634 2931 15957 13139
NM_001042603chr1235155 3782 339 23978 3638 --21347 1082
NM_001042604chr374752 4227 3992 3592 1573 907 585 --12976 --
NM_001048183chr1--1147 33393 1524 1328 1231
NM_001077628chr1----1599 --
NM_001085487chr1----178 --
NM_001106chr3119700 9254 7805 7523 6225 6187 2909 2024 1385 1176 763 49211 7777 3268 2584 19233 11521
NM_001172chr14------1491
NM_001173chr1454131 3590 3469 1005 932 31709 1328 285 24327 656 --
NM_001177chr1222214 1919 ----1138
NM_001204chr267066 5803 5574 4981 2314 2168 --26042 5175 17254
NM_001270chr5----1882 1216
NM_001278chr101385 11031 ----
NM_001326chr11----1458 --
NM_001351chr321568 1401 ------
NM_001391chr181120 ------
NM_001397chr122660 2332 ------
NM_001415chrX31890 1372 781 1633 --11988
NM_001454chr173788 782 773 ------
NM_001493chrX1314 ------
NM_001494chr101643 ------
NM_001542chr132324 559 257 22888 2702 1620 --
NM_001616chr222254 263 --11036 --
NM_001634chr621940 110 ------
NM_001642chr111259 ------
NM_001663chr1422492 948 12216 12743 --
NM_001677chr1--1172 --1283
NM_001759chr1274955 4746 4682 4387 872 767 581 11327 --1391
NM_001822chr2176 ----1151
NM_001859chr91315 13957 1888 --
NM_001903chr51814 ------
NM_001918chr198450 7970 7925 6333 6216 2516 2013 1781 955 37944 7309 1035 18476 15791
NM_001924chr1----162 --
NM_001942chr183743 263 36 21918 1516 ----
NM_001949chr632672 795 697 1847 12810 1772
NM_001951chr81585 ------
NM_002025chrX79122 9101 7209 6916 6719 2694 1555 23675 2462 26273 2304 38550 8215 536
NM_002033chr1173830 3257 2557 1667 483 446 440 12896 1364 --
NM_002092chr464095 3246 1931 1835 1586 1327 11016 ----
NM_002135chr121554 ------
NM_002136chr121495 ------
NM_002210chr233459 2979 891 23409 2927 11343 --
NM_002270chr595129 4963 4743 1341 1085 1042 788 321 226 15628 ----
NM_002285chr244046 2903 2754 2541 13752 21485 1355 --
NM_002310chr596075 5966 5579 1995 1575 1310 548 352 166 ------
NM_002317chr5----1314 --
NM_002336chr1264039 3597 3424 1922 616 441 11684 24028 3999 --
NM_002382chr1411221 ------
NM_002474chr161742 ------
NM_002486chr942256 2219 2112 1810 --1792 193
NM_002489chr71275 ------
NM_002515chr1411965 22073 1919 1290 --
NM_002590chr131172 ------
NM_002595chr12----21561 1336 11415
NM_002613chr16115358 4985 4889 4548 4138 4003 3594 1842 620 500 402 ------
NM_002670chr3172 ------
NM_002709chr2----11227 --
NM_002758chr17----1368 --
NM_002825chr71490 ----1151
NM_002852chr31480 ------
NM_002894chr181218 ------
NM_002940chr4----1164 --
NM_002959chr163946 3407 1409 1292 981 65 12737 11494 --
NM_002970chrX----181 --
NM_002977chr212790 12132 23428 3417 --
NM_003036chr11151 ------
NM_003072chr192320 90 ------
NM_003074chr31213 ------
NM_003100chr5--1344 ----
NM_003108chr287057 6878 6588 6211 5030 4607 1217 1153 14717 168 11473
NM_003112chr733086 2083 903 --21963 234 13236
NM_003199chr1895274 4524 4434 4387 4245 4092 3811 1180 833 24561 3958 ----
NM_003202chr5----11828 --
NM_003262chr355100 1481 1304 526 400 --15308 192
NM_003319chr21926 ------
NM_003342chr1722770 1090 ----22232 347
NM_003390chr111317 1759 ----
NM_003453chr132310 180 --1690 1113
NM_003468chr294240 4015 3960 3772 3421 3296 3090 2742 683 ------
NM_003566chr1213295 1593 ----
NM_003601chr41149 ------
NM_003615chr343886 1244 1005 759 22860 2616 13656 --
NM_003628chr21232 ------
NM_003633chr552375 2313 1978 1819 273 --1767 11962
NM_003663chr332354 2153 549 ----1621
NM_003673chr17----198 --
NM_003685chr191815 ------
NM_003692chr91930 2851 114 ----
NM_003750chr10------1866
NM_003759chr4----1963 23661 726
NM_003781chr341347 425 368 44 ----11586
NM_003794chr31141 2803 157 --1936
NM_003797chr111134 ------
NM_003816chr81393 ------
NM_003822chr121931 849 --21968 935 --
NM_003862chr51228 ------
NM_003877chr12--1623 ----
NM_003913chr632629 1506 439 1677 11299 1617
NM_003966chr567730 7126 3089 3073 2446 462 11059 --27394 2025
NM_004036chr21190 ------
NM_004067chr7----11460 --
NM_004077chr121351 ------
NM_004086chr14----2786 559 --
NM_004097chr21335 ------
NM_004102chr11577 ------
NM_004162chr3----1912 --
NM_004236chr15--1517 ----
NM_004241chr10------1125
NM_004304chr21327 ------
NM_004392chr1341803 1676 547 468 12012 --1392
NM_004429chrX----1117 --
NM_004440chr611626 ------
NM_004458chrX1341 ------
NM_004464chr412756 22999 1417 23679 3249 --
NM_004469chrX1348 ------
NM_004501chr163169 3014 1483 682 495 136 ----23490 881
NM_004505chr1731277 309 100 1246 156 --
NM_004524chr17----1228 --
NM_004576chr5--1348 ----
NM_004612chr934405 790 235 13019 --34237 3221 1007
NM_004642chr121281 ------
NM_004654chrY----11111 --
NM_004730chr5----11934 --
NM_004733chr3----139 --
NM_004734chr13----1256 23129 756
NM_004801chr21998 ------
NM_004859chr1772714 1920 1080 868 795 319 22 --1977 12381
NM_004866chr595010 4679 4546 4462 4259 3983 1762 1491 658 14455 --34838 4812 515
NM_004896chr10--11495 ----
NM_004939chr2145 ------
NM_004953chr31110 ------
NM_004961chrX--11417 1404 --
NM_004967chr41401 ------
NM_005016chr12166 ------
NM_005032chrX--11084 ----
NM_005056chr1235399 4026 583 24222 3882 --21591 1326
NM_005063chr1043286 2773 2560 345 11018 --23222 783
NM_005065chr1434722 4673 1496 34991 4632 4311 --14166
NM_005103chr111273 ------
NM_005104chr6----1625 --
NM_005119chr1--1468 ----
NM_005156chr964693 4310 4265 1785 1120 472 25159 4485 --15375
NM_005157chr9--11961 ----
NM_005180chr101475 --21438 121 --
NM_005188chr11127680 6813 6197 5632 5502 3214 2541 2328 2188 1466 1337 361 15244 15703 18366
NM_005197chr1445481 2284 1064 328 ----33944 541 77
NM_005235chr257286 5211 5069 1995 1079 26634 2931 15957 13139
NM_005245chr41533 ------
NM_005277chr411342 11547 --21841 1515
NM_005324chr1722029 1799 ----2540 31
NM_005358chr13----1156 --
NM_005375chr63951 856 113 --1239 11164
NM_005388chr911202 --2170 104 11536
NM_005397chr743306 3181 1354 953 13757 --12628
NM_005497chr1754874 4689 1799 1209 370 --23763 654 --
NM_005504chr1266450 6260 5409 4852 1582 113 --46079 4153 2196 633 1121
NM_005509chr511677 ------
NM_005575chr51192 ------
NM_005596chr966277 5935 5773 3968 2102 624 15486 14509 --
NM_005648chr8154 ------
NM_005657chr15------1168
NM_005721chr21706 ------
NM_005734chr11--1212 ----
NM_005744chr15--1121 ----
NM_005779chr52970 883 12792 33550 3311 1053 --
NM_005798chr1344953 3194 1383 737 --1943 --
NM_005828chr1764472 4200 3677 3114 1844 196 33825 657 178 11354 24773 4618
NM_005836chr8121 ------
NM_005880chr16----31639 1407 1137 --
NM_005882chr4----1883 --
NM_005901chr1886793 6138 3435 2787 2496 1407 653 147 16265 18183 --
NM_005904chr18----11195 --
NM_006007chr934059 1238 278 24341 730 ----
NM_006039chr1711055 ------
NM_006047chr2033073 2978 2349 ----1908
NM_006060chr743976 3781 3151 1756 --23233 1050 --
NM_006099chr11756 --1889 --
NM_006106chr1133224 2933 691 --2848 829 12552
NM_006109chr14--158 ----
NM_006154chr155988 805 526 92 22 1935 ----
NM_006166chr1252194 760 674 307 124 ------
NM_006195chr941417 941 896 255 --21323 84 --
NM_006252chr166984 6785 4869 2543 2176 181 ----11772
NM_006306chrX75900 4825 3943 3634 1708 1184 110 15561 ----
NM_006330chr811298 11322 --147
NM_006380chr1733894 1588 430 21371 1320 24302 3293 13001
NM_006391chr11----134 --
NM_006393chr1084420 3859 3685 3565 3124 2999 332 295 ----12890
NM_006449chr222183 423 --22097 529 --
NM_006451chr5--1376 --1741
NM_006489chr1411965 22073 1919 1290 --
NM_006496chr121956 314 1760 ----
NM_006530chr121468 ------
NM_006544chr1411256 ----25367 3745
NM_006547chr7----21704 286 --
NM_006558chr81476 ------
NM_006559chr1--1185 1433 --
NM_006561chr1053858 1009 808 614 93 1318 15894 11863
NM_006572chr1731383 764 363 --1163 23415 1011
NM_006599chr1687610 3065 3011 2217 2087 1643 1486 57 26164 932 --11341
NM_006628chr1521730 143 21765 264 11676 12948
NM_006644chr131158 ------
NM_006654chr1244550 4240 3247 434 13054 11305 34199 3584 1386
NM_006722chr3--11163 ----
NM_006726chr41209 --1147 --
NM_006738chr1513451 23881 1099 11595 --
NM_006758chr21----2136 43 --
NM_006775chr632571 898 886 1988 ----
NM_006777chrX1125 12368 --12941
NM_006805chr511250 1359 11440 11089
NM_006806chr211412 ------
NM_006807chr171405 ------
NM_006826chr22941 356 11123 ----
NM_006922chr211913 ----11716
NM_006924chr1764122 3179 3105 412 307 24 --13600 2678 653
NM_006990chr121852 1587 ----22470 1691
NM_007011chr1542528 2425 506 390 26144 4320 46280 5920 4453 1363 --
NM_007038chr2146096 4810 2166 2120 1577 25939 4678 --
NM_007157chrX31100 1032 30 31968 834 339 --12644
NM_007200chr1513451 23881 1099 11595 --
NM_007212chr1--1460 ----
NM_007214chr61111 11217 ----
NM_007276chr71210 ----11058
NM_007282chr31688 ------
NM_007313chr9--11961 ----
NM_007361chr141570 --1138 --
NM_012157chr3--1832 ----
NM_012177chr6--1113 ----
NM_012214chr265709 5657 4866 3888 1270 836 24525 4008 14980 24443 1102
NM_012215chr1041433 1340 605 300 ----2631 491
NM_012262chr123461 534 --34522 4125 4004 --
NM_012301chr742048 1841 288 220 --11474 11730
NM_012322chr7----1277 --
NM_012325chr2011439 --11553 1198
NM_012330chr10------1491
NM_012334chr554232 3401 3206 1864 308 1826 13554 --
NM_012341chr10----1420 --
NM_012347chr633039 813 657 ----11948
NM_012402chr1121296 1288 ------
NM_012479chr722743 453 ----11978
NM_013255chr798823 6696 3356 2767 2321 1816 1675 1050 1018 28473 933 ----
NM_013261chr463703 3592 3460 2631 1072 867 13229 ----
NM_013281chr201200 ----1390
NM_013282chr19----11029 --
NM_013300chr121155 ------
NM_013316chr71938 ------
NM_013410chr1--158 ----
NM_014011chr242301 1682 736 547 --22570 430 12280
NM_014028chr632660 2520 2233 23234 813 ----
NM_014048chr1611746 14066 25259 594 --
NM_014109chr8--2227 80 ----
NM_014112chr874949 3871 3482 3412 2000 1040 785 24879 1638 25316 2146 --
NM_014117chr161232 ------
NM_014141chr764690 4432 4402 1260 752 275 --14396 --
NM_014155chr1146148 2439 1812 1430 --15431 36163 4961 4603
NM_014289chrX2579 171 ----11334
NM_014290chr9--160 ----
NM_014309chr2234223 1257 519 14189 --13818
NM_014363chr131911 --1427 145
NM_014372chr1--31605 1563 1311 ----
NM_014423chr585447 4931 4143 3762 1852 1713 567 458 ----13725
NM_014456chr10------1347
NM_014586chr2174347 3467 3089 1454 1267 849 120 1460 --14479
NM_014607chr2----1479 --
NM_014614chr211033 ------
NM_014615chr16--13593 12356 13077
NM_014616chr333400 1201 21 13450 --23362 113
NM_014661chr1073868 3795 3768 3385 1341 1144 830 --43616 3134 1466 1267 --
NM_014670chr231263 1243 42 --11612 --
NM_014676chr1----1504 --
NM_014736chr151891 ------
NM_014739chr633292 2575 1121 --1963 13939
NM_014747chr165687 3844 2277 1726 1629 157 54425 3597 2285 620 517 ----
NM_014765chr121652 635 22392 556 12150 --
NM_014810chr123243 2399 23103 2287 22995 552 --
NM_014848chr1521119 937 12469 --12761
NM_014872chr962206 2118 1742 1525 853 709 32145 344 149 ----
NM_014950chr141496 ------
NM_014962chr2022744 229 --12448 11009
NM_014988chr412595 ------
NM_014989chr6--31700 613 122 ----
NM_014991chr443092 2694 2229 898 --12631 12110
NM_014996chr31350 ------
NM_015026chr1243673 3500 647 307 24175 1599 --1824
NM_015039chr132800 986 978 --44052 3922 608 559 13960
NM_015040chr252880 2215 821 405 129 --12731 12236
NM_015074chr154244 4000 339 221 106 24264 1542 24629 856 13315
NM_015076chr644346 3128 1670 777 24216 329 ----
NM_015094chr221868 ------
NM_015107chrX4977 842 836 830 --1714 --
NM_015110chr911587 ------
NM_015115chr422054 1187 2408 170 1926 1350
NM_015143chr4----1278 --
NM_015216chr511495 ------
NM_015247chr1694786 4714 3856 3314 1177 1112 976 316 110 11899 1406 14768
NM_015260chr1911574 ------
NM_015269chr1----1485 --
NM_015285chr1862387 1876 1689 926 649 222 2942 442 ----
NM_015310chr888184 8016 7761 7740 6540 5687 3202 399 12644 25663 1940 13282
NM_015336chr1232303 2102 944 ----32219 2205 643
NM_015365chrX13200 23063 2775 12646 14275
NM_015458chr864063 3409 3251 1628 1209 192 --14800 11527
NM_015520chr342770 2709 1127 1119 22092 681 ----
NM_015535chr241479 591 416 274 1726 --32955 1241 313
NM_015550chr743610 3075 2722 358 32615 1400 1272 --12937
NM_015564chr511218 23346 3045 --1772
NM_015569chr123014 1499 --13443 --
NM_015571chr612079 12436 ----
NM_015716chr171726 ------
NM_015852chr723149 1441 101243 1162 1078 826 658 574 490 406 238 70 ----
NM_015866chr11393 11353 1989 11104
NM_015879chr1888509 6541 6096 2667 2216 1605 862 807 --15497 11202
NM_015886chr845725 3607 1890 1492 25628 5132 ----
NM_015906chr154776 4282 3339 3179 2928 --13282 23828 1587
NM_015955chr21152 ------
NM_016022chr1----1991 --
NM_016045chr201453 ----11202
NM_016073chr15----11019 --
NM_016125chr17--1578 ----
NM_016206chr388684 8589 7955 6243 5988 2628 1891 404 --1381 --
NM_016220chr721945 928 7742 573 489 409 325 241 157 --11541
NM_016260chr2107169 6752 5798 2656 2636 1831 781 546 245 144 26791 2600 --12735
NM_016275chr352372 2275 2267 2212 659 12779 ----
NM_016300chr3----1471 --
NM_016472chr14------1432
NM_016587chr71210 ----11058
NM_016621chr1111419 --13211 --
NM_017412chr81984 --31145 454 326 --
NM_017569chr131324 ------
NM_017628chr454935 3843 3836 3817 562 43963 3731 942 868 13582 --
NM_017629chr121454 380 ------
NM_017643chr1712043 ------
NM_017658chr1474634 4469 3875 3221 1771 1520 1389 23697 1826 14417 --
NM_017714chr201149 ------
NM_017730chr31107 ------
NM_017738chr9--1205 --21211 439
NM_017761chr11561 11508 ----
NM_017778chr8----142 --
NM_017801chr332258 1640 48 --12541 12294
NM_017856chrX3601 459 435 --1559 --
NM_017944chr1143071 3015 2606 1061 --11051 --
NM_017946chr711349 ------
NM_018031chr3------1542
NM_018084chr222313 479 22607 471 12671 --
NM_018085chr147191 6096 4973 2131 15003 36777 1948 852 27386 6984
NM_018144chr101363 ------
NM_018155chr353223 2683 1188 743 138 ----12106
NM_018364chr183923 3849 3697 3120 2704 2682 1506 804 --14031 --
NM_018370chr1231903 1719 204 1850 12286 --
NM_018374chr724720 1355 35059 4415 1906 15221 --
NM_018383chr241472 1402 616 57 --198 1624
NM_018386chr13----1142 --
NM_018387chr91467 ------
NM_018403chr353889 3249 3163 2790 987 --12565 11257
NM_018429chr551791 1094 825 678 313 1740 1689 --
NM_018433chr2--1179 ----
NM_018448chr1221263 1243 --11194 1169
NM_018489chr11781 ------
NM_018553chr171281 11450 21410 204 11234
NM_018566chr174506 4128 4037 3162 1304 431 324 14355 13790 --
NM_018638chr1274817 4665 4464 2094 1965 1344 661 ----15160
NM_018640chr1222574 161 ----12488
NM_018650chr152046 2026 1642 1554 192 1772 --1465
NM_018947chr784943 4050 3990 3151 3110 1934 1311 160 11599 11758 11549
NM_019001chr374752 4227 3992 3592 1573 907 585 --12976 --
NM_019028chr11160 --1457 --
NM_019035chr4------1793
NM_019045chrX----1790 --
NM_019046chr101687 ------
NM_019072chr553803 3403 3173 1332 65 ----13795
NM_019605chr1----182 --
NM_019852chr14----1115 --
NM_020134chr21215 ------
NM_020159chr421697 213 ------
NM_020198chr17--2569 535 ----
NM_020337chr412863 --1445 1402
NM_020432chr7125 11551 --12258
NM_020456chr1311576 1671 ----
NM_020466chr684719 4146 3368 1591 1045 720 457 305 14104 --13847
NM_020673chr2045578 1482 382 352 --1889 17379
NM_020703chr1--1462 ----
NM_020718chr1696249 6105 5517 4638 2632 2240 2031 439 255 1865 11029 --
NM_020727chr2193466 2995 2885 2793 2624 1377 882 549 200 ----13550
NM_020748chr1711521 --21813 1644 1226
NM_020772chr1788646 7896 6689 3428 3400 2684 1849 663 58172 6490 5780 3043 1598 11499 --
NM_020818chr14----1378 --
NM_020858chr1552365 465 257 165 27 2534 514 12138 --
NM_020859chr442750 1276 1108 545 --11465 1236
NM_020860chr411130 ------
NM_020861chr6178 1967 ----
NM_020927chr16195 --12326 11462
NM_020948chr111429 1860 23079 673 --
NM_020962chr1521834 65 11817 --22227 1806
NM_020988chr1621344 1021 --1254 --
NM_021007chr2----12123 --
NM_021033chr1312922 11054 33477 1007 578 --
NM_021038chr322994 2636 --33282 2648 936 --
NM_021116chr7138474 8458 7953 6402 3627 3417 3194 3185 2714 2526 1658 387 155 1894 ----
NM_021145chr71204 --21111 386 --
NM_021159chr4----2678 272 --
NM_021222chr111368 11120 --11099
NM_021238chr1232003 1675 587 ------
NM_021255chr1443390 2936 2493 601 --13640 13178
NM_021911chr535339 4367 196 13887 15369 --
NM_021914chr14--12043 12060 1847
NM_021949chrX12854 11069 21815 1079 --
NM_021957chr121504 ------
NM_021961chr1195956 5694 5059 4612 1832 1811 1526 1037 337 --27452 197 --
NM_021964chr324802 4709 ----14621
NM_021984chrX--11417 1404 --
NM_021987chrX--11417 1404 --
NM_021990chrX--11417 1404 --
NM_022037chr2--153 ----
NM_022051chr1----1601 --
NM_022091chr62651 171 11720 1336 12286
NM_022173chr2--153 ----
NM_022373chr7--1269 ----
NM_022483chr511811 --11872 --
NM_022753chr162695 2105 2065 959 746 645 ----12790
NM_022771chr12----1175 --
NM_022831chr12318 215 21727 72 21313 626 --
NM_022841chr1511012 22129 23 ----
NM_022844chr161883 ------
NM_022918chr1132059 1533 230 1471 ----
NM_022977chrX1341 ------
NM_023016chr222023 1833 1679 --11095
NM_023923chr1--1147 33393 1524 1328 1231
NM_023929chr8----11724 --
NM_024624chr2----11441 --
NM_024665chr353774 3234 1336 809 658 --34314 4256 931 13748
NM_024745chr161851 --176 --
NM_024763chr1----129 --
NM_024814chr7151 ------
NM_024852chr1----1273 --
NM_024947chr379598 6126 3822 2317 1833 1461 99 37607 7216 1849 26898 1946 28775 1219
NM_024989chr235882 2542 189 48154 7862 7258 207 15698 --
NM_025054chr823114 1699 ----13870
NM_025073chr134632 3029 1896 13558 ----
NM_025079chr11253 ------
NM_025134chr1622491 2471 ------
NM_025141chr151504 ------
NM_025151chr831515 1478 487 12022 22177 1498 --
NM_025164chr11------12096
NM_025219chr2082422 2356 2266 2129 2122 267 199 72 --12472 1635
NM_025238chr1511165 21426 633 --1610
NM_025260chr6----127 --
NM_030594chr1531358 254 30 --1122 11303
NM_030621chr1421340 868 23072 2887 24236 196 --
NM_030627chr553088 3044 3014 2549 163 --22957 1067 33921 3377 104
NM_030648chr435351 3403 1428 33590 1496 463 15484 1967
NM_030650chr223401 1548 ----13749
NM_030664chr10------12328
NM_030751chr1031431 1416 539 ------
NM_030751chr1031431 1416 539 ------
NM_030912chr101848 ------
NM_030953chr5128 ----11505
NM_030980chr11471 ------
NM_031157chr121495 ------
NM_031268chr16115358 4985 4889 4548 4138 4003 3594 1842 620 500 402 ------
NM_031306chr11848 ------
NM_031427chr1474443 4143 3992 1682 1019 295 267 24896 741 11199 15895
NM_031435chr12----13462 --
NM_031438chr511787 --1516 --
NM_031469chr61151 --11567 23397 995
NM_031844chr163169 3014 1483 682 495 136 ----23490 881
NM_031954chr1282886 2615 2212 2191 1909 977 560 340 --12273 1599
NM_031989chr12166 ------
NM_032012chr974453 3369 3242 1582 1324 472 68 31153 893 805 14983 --
NM_032017chr1184 ------
NM_032021chr111942 --11080 --
NM_032102chr1163099 3073 2388 2235 2014 988 --21204 336 --
NM_032124chr181426 --11157 1996
NM_032128chr42866 738 1964 ----
NM_032149chr4----1191 --
NM_032208chr2------12830
NM_032229chr1321045 402 ----1906
NM_032373chr1065704 5589 1014 625 599 360 11137 --1921
NM_032410chr8----1191 --
NM_032458chrX62665 2596 1360 760 226 147 12270 13388 13396
NM_032491chr1221043 226 ----11068
NM_032582chr1751296 700 321 116 100 --156 --
NM_032632chr1441939 1874 1728 1536 ------
NM_032802chr151225 ------
NM_032810chr1011126 ------
NM_032949chr131172 ------
NM_032978chr181120 ------
NM_032979chr181120 ------
NM_032981chr181120 ------
NM_033020chr154776 4282 3339 3179 2928 --13282 23828 1587
NM_033083chr332996 2280 707 22942 112 32608 1292 646 --
NM_033143chr423087 96 23330 1748 24010 3580 --
NM_033167chr341347 425 368 44 ----11586
NM_033168chr341347 425 368 44 ----11586
NM_033169chr341347 425 368 44 ----11586
NM_033224chr767493 6646 6490 5233 4983 1080 --27595 1848 12978
NM_033227chr5125 ------
NM_033228chr5165 ------
NM_033389chr1754578 3645 1645 1346 1225 33461 3134 3123 11691 --
NM_033480chr633039 813 657 ----11948
NM_033481chr633039 813 657 ----11948
NM_033495chrX129 ------
NM_033505chr276177 5806 5681 5405 4967 2414 770 --35672 4372 1144 --
NM_033656chr2175760 5070 3925 3742 3674 1160 971 25932 4523 35332 1726 1609 1182
NM_052811chr1344953 3194 1383 737 --1943 --
NM_052834chr1862387 1876 1689 926 649 222 2942 442 ----
NM_052905chr211303 ------
NM_052932chr1111867 1539 1401 --
NM_052937chr831820 793 441 157 1307 --
NM_052951chr20------1217
NM_052978chr1411612 1355 --11463
NM_052998chr11180 ------
NM_053016chr967809 7567 6749 5664 1123 489 21377 454 47992 5812 2608 362 --
NM_053056chr1132471 582 536 --22138 892 --
NM_054014chr201300 --1353 --
NM_054026chr81173 --160 1867
NM_078474chr151504 ------
NM_080546chr9----1644 --
NM_080759chr1341803 1676 547 468 12012 --1392
NM_080760chr1341803 1676 547 468 12012 --1392
NM_080867chr1463200 1873 1718 1149 867 710 13368 24563 1863 --
NM_130469chr141871 ------
NM_130782chr11286 ----11199
NM_133370chr422861 390 13180 --1476
NM_133378chr21926 ------
NM_133432chr21926 ------
NM_133437chr21926 ------
NM_138274chr6----127 --
NM_138277chr6----1197 --
NM_138333chr9--1195 ----
NM_138638chr14--12043 12060 1847
NM_138713chr1687610 3065 3011 2217 2087 1643 1486 57 26164 932 --11341
NM_138714chr1687610 3065 3011 2217 2087 1643 1486 57 26164 932 --11341
NM_138735chr21998 ------
NM_138771chr7--11362 --11218
NM_138795chr111287 ------
NM_139279chr242437 1013 1006 124 12519 --12253
NM_139319chr12----31575 1483 74 1432
NM_144571chr444451 4396 2095 1016 14336 36528 5468 1881 26847 4904
NM_144599chr1545442 1859 1511 439 12194 ----
NM_144632chr211643 ----22219 1851
NM_144767chr1513451 23881 1099 11595 --
NM_144770chr21--1117 ----
NM_144949chr242301 1682 736 547 --22570 430 12280
NM_144963chr821700 554 --21779 768 --
NM_144973chr1294761 4363 4089 3432 3309 1125 1013 706 483 34266 1294 447 21414 163 --
NM_144982chr12------1782
NM_145036chr17------1353
NM_145055chr1833062 867 114 23821 948 11212 21176 107
NM_145112chr1411221 ------
NM_145113chr1411493 ------
NM_145307chr1014351 ------
NM_145320chr743610 3075 2722 358 32615 1400 1272 --12937
NM_145321chr743610 3075 2722 358 32615 1400 1272 --12937
NM_145322chr743610 3075 2722 358 32615 1400 1272 --12937
NM_145341chr10------1347
NM_152437chr1222077 1631 --1716 --
NM_152529chr211374 1673 ----
NM_152551chr683023 2502 2294 2234 1960 1112 605 501 21894 1139 --1446
NM_152589chr121113 ------
NM_152622chr51401 1491 --21324 977
NM_152624chr597002 6530 5662 2931 2619 1791 1366 816 624 1721 17074 --
NM_152665chr121144 866 11264 11049 --
NM_152692chrX------163
NM_152758chr811865 --1406 22931 515
NM_152787chrX22991 135 13201 12586 1616
NM_152838chr2033073 2978 2349 ----1908
NM_152896chr9--1155 ----
NM_152924chr1542528 2425 506 390 26144 4320 46280 5920 4453 1363 --
NM_152991chr112664 215 ------
NM_153020chr631438 1220 409 ------
NM_153188chr595129 4963 4743 1341 1085 1042 788 321 226 15628 ----
NM_153607chr521282 1195 12864 --23026 325
NM_153616chr1552365 465 257 165 27 2534 514 12138 --
NM_153617chr1552365 465 257 165 27 2534 514 12138 --
NM_153618chr1552365 465 257 165 27 2534 514 12138 --
NM_153810chr1085112 4568 3296 3212 3105 1599 700 379 31239 1131 709 ----
NM_153827chr171726 ------
NM_170663chr171726 ------
NM_170706chr132800 986 978 --44052 3922 608 559 13960
NM_172193chr14------11206
NM_173157chr121554 ------
NM_173172chr211078 11460 ----
NM_173214chr1687610 3065 3011 2217 2087 1643 1486 57 26164 932 --11341
NM_173475chr161473 --1624 --
NM_173510chr2232632 2507 2372 --21927 583 12437
NM_173519chr821838 1732 1447 --1281
NM_173531chr1933498 2528 289 23785 2925 --1563
NM_173533chr11254 ------
NM_173582chr1196288 5314 5072 4265 3949 1394 896 544 402 16150 ----
NM_173642chr178666 8311 7419 2843 2291 578 168 --21911 1824 --
NM_173797chr5--11219 --1880
NM_173808chr122731 333 11243 1881 11085
NM_173829chr532046 1307 532 12135 35755 2003 981 --
NM_175085chr21124 ------
NM_175866chr121024 277 1539 --1991
NM_175874chr121149 ------
NM_175876chr131009 795 495 1443 12221 12563
NM_175910chr1922207 1940 101756 888 809 725 641 557 473 221 137 53 ----
NM_175920chr51192 ------
NM_177402chr11809 ------
NM_177422chr1----1273 --
NM_177438chr1421340 868 23072 2887 24236 196 --
NM_178151chrX76808 6426 5951 5925 1970 1854 1088 16829 36968 6855 2066 155
NM_178152chrX76808 6426 5951 5925 1970 1854 1088 16829 36968 6855 2066 155
NM_178153chrX76808 6426 5951 5925 1970 1854 1088 16829 36968 6855 2066 155
NM_178585chr443092 2694 2229 898 --12631 12110
NM_181358chr163386 3186 3076 1646 1496 1340 13840 21626 191 --
NM_181443chr2022744 229 --12448 11009
NM_181521chr1646501 5708 1664 1517 11372 16730 15919
NM_181674chr5--1348 ----
NM_181675chr5--1348 ----
NM_181676chr5--1348 ----
NM_181677chr5--1348 ----
NM_181678chr5--1348 ----
NM_181698chr101513 ------
NM_181782chr621953 1454 --11529 1512
NM_181784chr212604 12277 1398 --
NM_181836chr542682 2409 1017 438 --12150 1623
NM_182501chr263264 2610 2479 1296 736 729 1477 --12714
NM_182503chr695408 5226 4914 4498 4296 1959 1605 1250 334 ------
NM_182515chr1996280 5561 4440 4219 4159 4142 1194 1181 553 34941 1273 604 14690 --
NM_182551chr233196 785 149 23266 3190 11019 --
NM_182765chr1022130 430 137 ----
NM_182789chr5--1376 --1741
NM_182917chr31110 ------
NM_182944chr141289 ------
NM_183323chr5--1376 --1741
NM_183381chr31688 ------
NM_183383chr31688 ------
NM_183384chr31688 ------
NM_194247chr243293 398 341 242 11250 22755 285 24410 4000
NM_194282chr452818 1992 1069 976 807 12127 ----
NM_194314chr185294 4848 3682 2199 1968 634 395 74 15346 24145 3929 --
NM_194449chr18----1627 --
NM_197968chr132310 180 --1690 1113
NM_198129chr181411 ------
NM_198158chr3--11163 ----
NM_198159chr3--11163 ----
NM_198177chr3--11163 ----
NM_198178chr3--11163 ----
NM_198215chr101912 ------
NM_198241chr31110 ------
NM_198242chr31110 ------
NM_198244chr31110 ------
NM_198268chr163386 3186 3076 1646 1496 1340 13840 21626 191 --
NM_198269chr163386 3186 3076 1646 1496 1340 13840 21626 191 --
NM_198270chrX22411 1228 ----13082
NM_198324chr121351 ------
NM_198391chr201200 ----1390
NM_198400chr155988 805 526 92 22 1935 ----
NM_198467chr72407 120 --1592 --
NM_198506chr4--11119 ----
NM_198513chr832007 1722 733 ------
NM_198581chr265970 5519 1874 1512 884 811 1202 ----
NM_198859chr363808 3142 1640 1619 1289 546 23494 957 21917 648 11585
NM_198880chr31107 ------
NM_199324chr433115 2736 1282 --13666 --
NM_199421chr1463200 1873 1718 1149 867 710 13368 24563 1863 --
NM_201591chr411342 11547 --21841 1515
NM_201592chr411342 11547 --21841 1515
NM_201632chr5----11828 --
NM_201634chr5----11927 --
NM_203291chr181218 ------
NM_203292chr181211 ------
NM_203364chr1111050 ----1942
NM_203391chrX1150 ----21672 1438
NM_203434chr9----1268 --
NM_203459chr112608 ------
NM_203464chr1--158 ----
NM_205860chr121931 849 --21968 935 --
NM_206853chr632952 1392 599 --13847 23287 649
NM_206854chr624213 1860 --25108 3723 24548 1910
NM_206855chr625178 691 --26073 4688 15513
NM_206876chr2----11227 --
NM_206909chr888184 8016 7761 7740 6540 5687 3202 399 12644 25663 1940 13282
NM_207015chr312200 1554 ----
NM_207292chr322994 2636 --33282 2648 936 --
NM_207293chr322994 2636 --33282 2648 936 --
NM_207294chr322994 2636 --33282 2648 936 --
NM_207295chr322994 2636 --33282 2648 936 --
NM_207296chr322994 2636 --33282 2648 936 --
NM_207297chr323019 2661 --33307 2673 961 --
NM_207406chr466169 5919 1607 1509 1285 731 36113 4400 175 15799 125
NM_207577chr1162871 2782 1173 1118 919 907 12268 22738 2335 --
NM_207645chr11--11345 ----
NM_213590chr1344953 3194 1383 737 --1943 --
NM_213594chr1221043 226 ----11068
NM_213648chr5----11828 --