TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-188-3p
miRNA Sequence: CUCCCACAUGCAGGGUUUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000332chr636422 1994 831 1354 1391 35860 5048 1595
NM_000555chrX56137 2122 2105 1814 1667 15789 --27100 391
NM_001012753chr19------5892 808 370 268 186
NM_017848chrX73544 3451 2956 914 899 893 121 1791 23706 3488 1426
NM_020801chr5132 ----22606 697
NM_021116chr778746 8013 7954 6430 2300 2136 459 38043 515 41 48226 1832 1667 1549 13420
NM_024325chr2021120 1107 11023 --3949 480 277
NM_032788chr21565 --1575 2244 102
NM_152262chr19------3684 351 184
NM_152605chr19--128 --4884 477 142 58
NM_207306chr1154316 1410 1271 1235 1199 1163 1127 1055 1019 771 735 555 519 483 127 13688 13792 --