TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-188-5p
miRNA Sequence: CAUCCCUUGCAUGGUGGAGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX86759 6089 5472 5312 2808 2460 763 251 12870 26539 2469 --
NM_001031695chr22144445 4368 4298 4162 3665 3546 3505 3426 3410 2001 1667 1652 1502 1012 --13687 14729
NM_004397chr11134154 4093 3986 3922 3829 3397 3375 3367 3096 1212 1083 303 273 13019 11085 --
NM_004852chr181513814 13745 13392 13321 12628 10587 8991 5534 5525 3167 3153 2397 2387 1465 1126 24383 2413 111136 15259
NM_007249chr13109152 6263 6238 3524 3144 2586 2496 2293 1245 883 23043 1462 22704 1083 --
NM_012316chr1104999 3445 1414 1065 791 740 484 223 162 21 1295 127 --
NM_017637chr9169389 8979 8797 8780 8572 7895 7601 7531 6064 3214 3207 2182 1863 1529 841 422 17257 39159 7084 843 --
NM_033224chr767416 7113 319 118 105 97 --22917 2478 --
NM_033656chr2175721 5597 5292 5012 4972 4228 4096 --35048 4600 817 11336
NM_138473chr12114400 4185 3870 3772 3537 3282 3148 1405 1399 874 465 34539 1747 140 14789 --