TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-18b-3p
miRNA Sequence: UGCCCUAAAUGCCCCUUCUGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11----11156 --
NM_000188chr10--1157 ----
NM_000262chr2231568 1338 553 ----21262 200
NM_000555chrX27204 2097 23110 60 26199 2827 1238
NM_000611chr1196793 5876 5369 4995 4397 2614 1911 1858 1658 26657 386 25525 4339 --
NM_000722chr7183 ------
NM_000726chr2------1286
NM_000831chr1115787 4728 2174 2100 2052 1663 1354 1348 633 530 96 34962 1991 1607 ----
NM_000899chr1233330 3150 829 ----12838
NM_000950chrX23615 1203 ------
NM_001001436chr16--1338 ----
NM_001002264chr13--134 ----
NM_001002269chr9----1414 --
NM_001005746chr2------1286
NM_001005747chr2------1286
NM_001007565chr31305 ------
NM_001009554chr4--13153 14177 11090
NM_001009554chr4--13153 14177 11090
NM_001009899chr365627 4457 2524 1318 637 284 16159 16413 --
NM_001010922chr111520 ------
NM_001011553chr71184 ------
NM_001013437chr18----1108 --
NM_001013620chr1256813 2651 2119 1084 1067 25663 5499 ----
NM_001014797chr1047955 6771 2141 1235 36885 6453 5426 23237 2922 --
NM_001014972chr2----141 --
NM_001025077chr1056659 5571 5455 2863 1230 --25145 593 22009 47
NM_001025079chr352801 610 316 264 98 1961 --1673
NM_001025107chr1143 --128 --
NM_001025107chr1143 --128 --
NM_001029875chr512709 1874 --11850
NM_001031812chr511985 ------
NM_001039465chr14----1458 --
NM_001039618chr11------43852 1373 729 694
NM_001039693chr2--13753 --1624
NM_001040020chr7----1373 --
NM_001040057chr7----1490 --
NM_001040110chr7--1469 ----
NM_001040429chr1312601 ------
NM_001040431chr171391 ------
NM_001040446chr51244 ------
NM_001044722chr511985 ------
NM_001044723chr511985 ------
NM_001106chr3119646 6505 6395 6363 3900 3586 3437 3286 2862 2179 661 47932 3580 3047 1067 --12217
NM_001111chr1143 --128 --
NM_001204chr2----27245 6151 --
NM_001257chr16--11292 ----
NM_001351chr311435 ----1646
NM_001438chr1------12963
NM_001620chr11----1536 --
NM_001701chr911398 1139 ----
NM_001777chr352801 610 316 264 98 1961 --1673
NM_001788chr71184 ------
NM_001796chr16153 ------
NM_001904chr3193 1952 ----
NM_001955chr61827 ------
NM_002128chr13----12038 --
NM_002223chr1221417 1405 ------
NM_002381chr2----1659 --
NM_002408chr141202 ------
NM_002487chr151680 ------
NM_002670chr3----11607 --
NM_002787chr71486 ------
NM_003024chr211254 ------
NM_003081chr201873 ------
NM_003211chr121185 ------
NM_003216chr2273183 3123 3060 1233 1088 607 594 --1601 --
NM_003272chr12664 298 ----179
NM_003281chr183622 3331 3320 2189 1827 1090 552 245 11119 34971 4837 441 --
NM_003298chr31986 34644 1870 538 35367 1168 1127 12098
NM_003341chr3--1102 ----
NM_003489chr2111374 --12430 1351
NM_003566chr121723 ------
NM_003620chr171296 ----1194
NM_003668chr12----1130 --
NM_003913chr613364 14188 ----
NM_003994chr1233330 3150 829 ----12838
NM_004085chrX--1567 ----
NM_004290chr5------188
NM_004330chr15----1741 --
NM_004342chr7------12060
NM_004384chr511985 ------
NM_004595chrX----1179 --
NM_004725chr10----1590 --
NM_004726chrX25174 1394 --13769 11372
NM_004730chr51812 11404 11810 11916
NM_004804chr221808 986 ----22769 247
NM_004869chr181366 ------
NM_004906chr61258 ------
NM_004985chr1244057 3728 3129 1257 23626 1115 2763 264 --
NM_004992chrX117581 5986 5150 3387 3275 3199 3036 1149 960 179 76 26463 2909 13053 18208
NM_004992chrX117581 5986 5150 3387 3275 3199 3036 1149 960 179 76 26463 2909 13053 18208
NM_005011chr7--1469 ----
NM_005023chr511086 ------
NM_005045chr71972 ------
NM_005241chr3------1317
NM_005249chr141134 ------
NM_005399chr163291 3282 1441 1404 687 298 --13543 13403
NM_005436chr10----13461 --
NM_005461chr2011318 ------
NM_005748chr12------12535
NM_005778chr3----1115 --
NM_005859chr5--11397 ----
NM_005909chr51209 ------
NM_006070chr31305 ------
NM_006079chr61648 ------
NM_006212chr185191 4469 1381 1361 1013 899 739 381 --21488 300 14794
NM_006226chr211311 ----21127 942
NM_006252chr1--11132 1931 12834
NM_006400chr12170 ------
NM_006413chr101329 ------
NM_006546chr17106548 6042 5629 5483 5251 5039 4716 4060 2556 1912 26559 1076 34080 2573 761 14764
NM_006575chr1411126 ----1139
NM_006599chr1646297 5721 2689 956 ------
NM_006614chr313446 ------
NM_006925chr14----1458 --
NM_007245chr16170 ------
NM_012229chr10----180 21351 601
NM_012250chr111399 ------
NM_012421chr1------1104
NM_014016chr3--11429 ----
NM_014268chr181223 ------
NM_014497chr2----141 --
NM_014504chr7--12106 ----
NM_014730chr1274392 3795 3724 3611 993 871 744 44204 3672 1982 1846 --21521 261
NM_014730chr1274392 3795 3724 3611 993 871 744 44204 3672 1982 1846 --21521 261
NM_014747chr174732 3754 2241 1685 1479 1057 983 35461 398 357 21702 1087 24563 4154
NM_014757chr562221 1949 1885 696 536 253 ----1493
NM_014761chr161814 ------
NM_014871chr121126 ------
NM_014888chr7----1373 --
NM_014923chr1311702 --1218 --
NM_015017chr11804 ----21266 1023
NM_015076chr6----13963 --
NM_015310chr878287 7234 6168 2949 1768 629 46 ----16200
NM_015315chr542854 622 44 21 ----32369 2275 2257
NM_015455chr533224 3060 1123 --1630 12741
NM_015840chr1143 --128 --
NM_015841chr1143 --128 --
NM_016037chr11242 ------
NM_016090chr11132 ------
NM_016147chr11--1286 ----
NM_016230chr6----160 --
NM_016620chr11187 1516 --1467
NM_017676chr561784 1627 1338 1214 542 481 --1554 --
NM_017747chr5----1293 --
NM_017790chr91121 ------
NM_017824chr1012396 1595 21938 1877 21916 144
NM_018092chr16----133 --
NM_018227chr422677 2450 1898 --2931 175
NM_018247chr623053 2855 ------
NM_018448chr121292 ------
NM_018650chr111520 ------
NM_019556chrX1550 ------
NM_020119chr722859 961 ----13352
NM_020122chr265027 4699 2065 1716 1271 1179 --14041 12248
NM_020794chr111573 ------
NM_021220chr201146 ------
NM_021647chr4--13153 14177 11090
NM_021914chr14--1916 ----
NM_021942chr41817 ------
NM_021961chr1132898 2086 1188 14532 25516 524 15546
NM_021964chr3----12248 --
NM_022123chr141454 ------
NM_022374chr2--1129 ----
NM_022459chr1335708 5511 1192 --26262 975 11186
NM_022479chr7----1988 --
NM_022483chr531887 1624 1327 ----1371
NM_022491chr1262616 1354 1212 1165 647 252 --12805 33387 490 151
NM_022716chr111098 23033 1162 11198 13096
NM_022758chr663182 3026 2700 2684 2520 54 ----22827 64
NM_022843chr13----11469 --
NM_023039chr51354 ------
NM_023927chr5------11002
NM_023929chr81134 ------
NM_024294chr663182 3026 2700 2684 2520 54 ----22827 64
NM_024615chr51195 ------
NM_024721chr8----12279 --
NM_024920chr411397 ------
NM_030625chr10--11801 ----
NM_030753chr171263 ------
NM_030784chr6197 ------
NM_030806chr176473 5741 3059 2646 1863 1762 872 12808 38251 7954 5707 28537 3486
NM_030938chr17----1224 --
NM_031216chr18----11913 --
NM_032186chr11187 1516 --1467
NM_032413chr15----1115 --
NM_032457chr413643 ------
NM_033030chr211338 ------
NM_033138chr7------12060
NM_033139chr7------12060
NM_033140chr7------12060
NM_033157chr7------12060
NM_033222chr9----11132 --
NM_033360chr1244178 3849 3250 1378 23747 1236 2884 385 --
NM_033496chr10--1157 ----
NM_033497chr10--1157 ----
NM_033498chr10--1157 ----
NM_033500chr10--1157 ----
NM_033551chr542854 622 44 21 ----32369 2275 2257
NM_052818chr1322174 1689 1238 11854 --
NM_052898chr8--11525 1327 --
NM_052900chr8--1369 ----
NM_052906chr22114951 4079 2029 1965 1763 1730 1683 1493 916 362 55 33778 3190 424 1693 14402
NM_130811chr201873 ------
NM_133329chr2--1117 ----
NM_138292chr11----11156 --
NM_138316chr10------1961
NM_138638chr14--1916 ----
NM_138713chr1646297 5721 2689 956 ------
NM_138714chr1646297 5721 2689 956 ------
NM_138731chr14--1452 ----
NM_138802chr2--163 ----
NM_138927chr21----1954 --
NM_139078chr12----1130 --
NM_144571chr436950 4853 179 ----22607 1074
NM_144604chr16--143 ----
NM_148977chr10------1961
NM_148978chr10------1961
NM_152417chr811299 ------
NM_152688chr6----1390 --
NM_152739chr71915 ------
NM_152756chr5------23891 389
NM_152789chr7----1490 --
NM_153634chr1211392 ------
NM_172344chr2--1117 ----
NM_173054chr71972 ------
NM_173214chr1646297 5721 2689 956 ------
NM_173854chr112202 --1898 --
NM_175607chr311493 ------
NM_175612chr311493 ------
NM_175910chr19------12340
NM_178151chrX27204 2097 23110 60 26199 2827 1238
NM_178152chrX27204 2097 23110 60 26199 2827 1238
NM_178153chrX27204 2097 23110 60 26199 2827 1238
NM_181521chr1686858 2420 1882 1851 1599 1115 927 331 14830 37069 5054 205 12588
NM_181672chrX1746 ------
NM_181673chrX1746 ------
NM_181782chr6----1663 --
NM_182666chr3--1102 ----
NM_182701chr6------1354
NM_183058chr10143 ------
NM_183398chr5------188
NM_183399chr5------188
NM_183400chr5------188
NM_183401chr5------188
NM_194301chr14156 ------
NM_197955chr15----1115 --
NM_197970chr211338 ------
NM_198081chr612491 12120 1681 12462
NM_198123chr8--1369 ----
NM_198124chr8--1369 ----
NM_198793chr352797 606 312 260 94 1957 --1669
NM_198794chr1411126 ----1139
NM_199053chr41839 ------
NM_201269chr11187 1516 --1467
NM_201624chr11804 ----21266 1023
NM_203329chr1196793 5876 5369 4995 4397 2614 1911 1858 1658 26657 386 25525 4339 --
NM_203330chr1196793 5876 5369 4995 4397 2614 1911 1858 1658 26657 386 25525 4339 --
NM_203331chr1196793 5876 5369 4995 4397 2614 1911 1858 1658 26657 386 25525 4339 --
NM_203394chr12--1340 ----
NM_206594chr1------12963
NM_206595chr1------12963
NM_206909chr878287 7234 6168 2949 1768 629 46 ----16200
NM_213651chr11505 --11504 --