TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-18b-5p
miRNA Sequence: UAAGGUGCAUCUAGUGCAGUUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51969 ------
NM_000016chr1--2587 222 ----
NM_000037chr842411 2274 808 787 1517 22187 1883 --
NM_000051chr1153328 2320 2209 1305 397 --1263 13488
NM_000052chrX73333 1336 1252 1067 756 72 66 12212 12347 12918
NM_000063chr62265 54 ------
NM_000081chr121854 1637 ----135
NM_000088chr1721323 1115 ------
NM_000089chr72761 702 1619 ----
NM_000110chr12809 448 --21161 1059 --
NM_000111chr71286 ------
NM_000115chr1362356 1986 1829 615 252 231 12567 ----
NM_000125chr654257 3760 3636 3273 172 2533 68 24225 386 --
NM_000138chr1572593 2389 2190 2006 412 223 189 11871 22358 1957 --
NM_000141chr1031360 1222 482 ------
NM_000142chr431382 568 547 --2458 191 --
NM_000151chr1731846 1405 1207 ------
NM_000161chr1451849 1400 614 480 202 --11536 --
NM_000163chr51676 ------
NM_000165chr621545 682 1426 1504 --
NM_000167chrX61666 1321 691 498 359 248 ------
NM_000168chr743297 3104 2600 779 11101 12560 --
NM_000176chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_000188chr102224 38 ------
NM_000189chr252094 838 675 353 147 ------
NM_000208chr19124712 4517 4325 3549 3436 3172 3021 1804 1549 1379 1209 320 24018 145 14188 12885
NM_000212chr1772015 1980 1895 1677 998 738 532 ------
NM_000213chr171240 ------
NM_000214chr201186 --11456 --
NM_000216chrX63870 3238 3145 1339 694 162 --2829 581 --
NM_000217chr1295202 5179 4583 3651 3345 3270 2012 1918 431 15333 54959 4174 2093 2059 1140 1603
NM_000222chr451832 1365 1328 681 667 21357 143 11678 --
NM_000227chr183160 61 34 ----1346
NM_000238chr72289 150 ------
NM_000245chr732259 437 35 ------
NM_000248chr3----12330 1991
NM_000255chr61348 1136 ----
NM_000259chr1554623 4188 3985 1193 163 14871 11078 --
NM_000264chr923070 837 --11261 --
NM_000267chr1762459 2351 2293 2274 1330 102 ------
NM_000276chrX52230 2073 1708 695 478 --3735 588 420 --
NM_000277chr123693 630 218 ------
NM_000280chr111863 ------
NM_000284chrX51842 1552 1348 299 27 ------
NM_000285chr19126 ------
NM_000291chrX4750 166 155 62 ------
NM_000293chr161739 ----1629
NM_000297chr41717 1650 --22054 139
NM_000304chr172822 201 ------
NM_000314chr1082913 2637 2074 1154 965 585 419 224 1748 1278 --
NM_000321chr1311399 ------
NM_000325chr41198 ------
NM_000329chr11328 --1807 --
NM_000330chrX2630 22 --11462 --
NM_000332chr6115669 5551 5113 5041 4860 4725 4635 2587 2450 1398 1044 35005 1191 1142 45798 2009 1391 1156 16815
NM_000333chr331094 978 40 ----1466
NM_000337chr5116533 5788 5273 4590 2644 2492 2165 1313 1276 1249 603 21514 1444 15060 --
NM_000345chr41154 --11047 --
NM_000358chr5--1105 ----
NM_000361chr2042133 1904 1806 428 ----178
NM_000362chr2253613 3418 2895 2258 118 ------
NM_000368chr974481 4186 3955 3582 852 549 366 --23802 873 --
NM_000369chr1421832 1810 11682 ----
NM_000389chr621339 63 --21154 474 --
NM_000393chr241677 808 711 262 ------
NM_000396chr11579 --2532 68 --
NM_000399chr1011039 ----1465
NM_000404chr32288 166 ------
NM_000408chr262775 2118 999 543 524 258 --13006 --
NM_000421chr17--1270 ----
NM_000430chr1733236 2651 1084 --12869 12877
NM_000436chr531531 1429 479 --11558 --
NM_000439chr52810 218 --1123 --
NM_000441chr732018 1985 1796 1164 11669 --
NM_000442chr1731235 848 88 ------
NM_000449chr141505 532 154 71 --31150 569 471 --
NM_000452chr1331756 470 316 ------
NM_000461chr364029 3418 1467 863 813 429 14197 ----
NM_000462chr1521759 334 11795 11643 --
NM_000474chr71455 --1189 --
NM_000484chr211124 --1716 --
NM_000486chr12113219 3083 3062 2453 2324 2311 2236 2159 1027 882 631 ------
NM_000494chr103858 824 54 ------
NM_000495chrX2842 169 21086 713 ----
NM_000508chr41148 --1897 --
NM_000516chr201239 ------
NM_000523chr231166 982 818 ------
NM_000525chr1141526 1202 441 140 ------
NM_000527chr1922430 712 --42169 1635 821 547 --
NM_000533chrX3698 306 188 176 21785 746 --
NM_000555chrX116823 6706 5409 5292 5262 2534 2403 2204 1702 914 373 22411 2181 15345 --
NM_000572chr12765 112 --1646 --
NM_000574chr121153 496 ------
NM_000575chr21863 ------
NM_000578chr261713 1607 1420 522 306 253 ----21266 235
NM_000598chr71204 --1196 --
NM_000599chr243883 2988 1297 64 ------
NM_000601chr71409 ------
NM_000602chr72970 294 11311 11374 --
NM_000609chr1093128 2989 2726 2611 1976 1237 976 616 133 --11101 --
NM_000610chr1153022 2816 2603 698 482 ------
NM_000612chr1163748 3621 3512 3128 2915 2872 --1208 --
NM_000615chr1172945 2787 2246 2198 1042 1015 530 ------
NM_000618chr1286110 5817 5810 2630 2492 2318 1565 426 12220 1187 --
NM_000618chr1286110 5817 5810 2630 2492 2318 1565 426 12220 1187 --
NM_000619chr121458 ------
NM_000633chr1885040 4908 4764 4525 3888 3344 1823 1636 --15184 1782
NM_000639chr11324 1285 ----
NM_000663chr1672827 2778 2138 1252 979 629 257 ------
NM_000668chr41270 1946 ----
NM_000675chr222307 293 --1255 --
NM_000684chr1021227 1104 --1302 --
NM_000689chr9145 ------
NM_000719chr12136348 5385 5243 4953 4914 2484 1747 1065 857 843 724 282 242 --25924 4416 --
NM_000721chr162696 2652 1985 1045 497 317 12418 11671 --
NM_000723chr1741451 1184 305 235 1263 ----
NM_000724chr1051775 1768 594 456 412 ------
NM_000725chr121841 --1256 --
NM_000726chr2--21357 72 ----
NM_000739chr7------2186 99
NM_000756chr81431 ------
NM_000782chr2031284 198 126 --1170 --
NM_000794chr511055 ----1662
NM_000801chr202939 118 ------
NM_000809chr4126609 6539 6509 6258 3557 2998 2907 2641 2621 2303 1614 955 23095 1706 22737 776 16685
NM_000813chr575444 5364 2126 2052 2038 826 367 21148 116 ----
NM_000814chr1533522 3393 723 ------
NM_000816chr52586 491 1455 ----
NM_000817chr21976 1315 ----
NM_000818chr101120 ------
NM_000824chr41821 2739 693 --1146
NM_000826chr462486 2012 1755 1667 336 299 ----12437
NM_000827chr572458 2350 1890 990 973 902 654 1503 12090 --
NM_000829chr1122189 731 21421 643 ----
NM_000833chr1621540 477 ------
NM_000834chr1221190 444 ------
NM_000838chr672685 2210 1871 1119 1013 672 590 22547 2048 ----
NM_000840chr71476 --1105 --
NM_000844chr31424 --1405 --
NM_000855chr111357 ------
NM_000864chr11980 --1763 --
NM_000868chrX1960 1454 ----
NM_000870chr551494 1159 553 381 214 ------
NM_000875chr15136102 5733 4991 4357 2685 2674 2217 2153 1213 515 502 280 103 15132 15534 --
NM_000876chr651077 941 485 286 50 --21228 231 --
NM_000885chr23776 696 419 21940 508 --1852
NM_000891chr1742828 2586 1379 1233 11240 --1852
NM_000899chr122808 120 13616 ----
NM_000901chr432116 1953 1919 ------
NM_000912chr853562 2399 2343 794 210 ------
NM_000919chr5--1129 ----
NM_000922chr1111033 1996 1178 --
NM_000924chr1211157 --1879 1195
NM_000926chr11179407 9235 9064 8357 8344 8226 8014 7133 6411 6398 1939 1433 1376 966 904 842 319 27683 5945 22825 2478 --
NM_000935chr31125 ------
NM_000944chr442043 1769 1477 896 --12054 --
NM_000945chr231604 289 30 1588 --1200
NM_000950chrX43155 2415 2214 757 1516 33335 3202 726 166
NM_000956chr142169 37 1979 ----
NM_000964chr1731357 881 325 ------
NM_000965chr321270 848 --138 --
NM_000971chr8151 ------
NM_001001132chr2121387 305 1180 ----
NM_001001323chr1222783 902 22945 212 12918 --
NM_001001331chr321833 344 --11669 --
NM_001001342chr1031272 482 224 11049 ----
NM_001001344chrX32304 872 336 11965 1478 --
NM_001001389chr1153022 2816 2603 698 482 ------
NM_001001390chr1153022 2816 2603 698 482 ------
NM_001001391chr1153022 2816 2603 698 482 ------
NM_001001392chr1153068 2862 2649 744 528 ------
NM_001001394chr21580 --1568 --
NM_001001395chr1262806 2769 2763 2708 2673 152 1684 1693 --
NM_001001396chr173786 3740 2907 2731 1090 1069 772 ------
NM_001001419chr553704 3592 3480 3351 1967 --31332 942 854 --
NM_001001420chr553704 3592 3480 3351 1967 --31332 942 854 --
NM_001001433chr2053115 2589 2540 1975 480 --11127 --
NM_001001436chr162800 679 ------
NM_001001481chr833146 2435 1084 12312 157 --
NM_001001483chr111417 ------
NM_001001484chr1042083 860 240 26 ------
NM_001001521chr21295 1218 ----
NM_001001522chr111147 --195 --
NM_001001549chr752581 1049 394 278 97 --12614 --
NM_001001550chr752581 1049 394 278 97 --12614 --
NM_001001555chr752581 1049 394 278 97 --12614 --
NM_001001556chr15140 1187 11163 --
NM_001001557chr852176 1595 220 54 21 --1478 --
NM_001001664chr242619 1066 508 442 --23617 845 --
NM_001001701chr441956 1492 1443 142 ------
NM_001001852chr221823 ------
NM_001001877chrY346 40 27 ------
NM_001001890chr2193740 3694 2850 1722 1464 1173 475 250 43 ----1505
NM_001001928chr22127756 7099 7031 6995 6980 6208 5523 5479 1738 1707 1607 24 21188 103 46874 1975 626 422 --
NM_001001933chr12167 125 ------
NM_001001971chr1041363 967 508 26 ----1108
NM_001001974chr1042206 1953 1870 910 22257 2017 ----
NM_001001995chrX21389 231 ------
NM_001002033chr17--1319 --1114
NM_001002233chr851718 1441 1417 669 44 ----12044
NM_001002244chr171115 ------
NM_001002245chr171150 ------
NM_001002246chr171150 ------
NM_001002247chr171150 ------
NM_001002248chr171150 ------
NM_001002249chr171150 ------
NM_001002257chr263413 2935 1271 1142 671 139 11038 ----
NM_001002259chr121250 ------
NM_001002295chr103961 326 145 ------
NM_001002296chr85500 268 262 194 146 ------
NM_001002814chr863941 2907 1441 1417 669 44 13328 11046 --
NM_001002838chrX71895 1673 1537 583 521 355 319 ----11483
NM_001002843chr15--1128 ----
NM_001002860chr1484547 4196 3386 1648 859 398 300 198 --21816 262 --
NM_001002901chr12457 360 ------
NM_001002909chr1741742 657 507 404 ------
NM_001003406chr2293243 2871 2817 2547 2233 1223 1157 818 47 --22810 2004 --
NM_001003407chr1084262 3776 3505 3343 1663 1430 796 490 21586 260 ----
NM_001003408chr1084262 3776 3505 3343 1663 1430 796 490 21586 260 ----
NM_001003652chr18118636 8629 7301 6840 3470 3215 3033 2610 2376 433 118 27614 3308 1143 11514
NM_001003665chr132536 903 159 ------
NM_001003674chr1876345 5594 5461 4918 4904 2644 2634 25307 1048 15289 --
NM_001003675chr1876345 5594 5461 4918 4904 2644 2634 25307 1048 15289 --
NM_001003678chr111105 ------
NM_001003681chr2231415 686 334 --11975 --
NM_001003688chr41172 ----1354
NM_001003698chr621536 1361 ------
NM_001003699chr621536 1361 ------
NM_001003712chr1253762 3053 3039 1008 749 1742 ----
NM_001003760chr622446 2388 11353 11269 --
NM_001003792chr3--1144 ----
NM_001003793chr3--1144 ----
NM_001003800chr943397 2692 2466 485 13511 22853 294 --
NM_001003943chr1533262 1273 580 ------
NM_001004125chr931115 780 112 ------
NM_001004196chr31495 1344 ----
NM_001004303chr13685 326 279 ------
NM_001004303chr13685 326 279 ------
NM_001004304chr1263155 2203 1273 747 676 543 --12109 --
NM_001004317chr674128 4043 3844 3177 2932 2808 489 1813 --1647
NM_001004342chr1106051 5844 5194 4690 4191 2099 1983 1631 1429 537 --11233 --
NM_001004354chr941029 990 421 176 --156 --
NM_001004360chr21348 1423 2582 432 --
NM_001004419chr121928 21470 676 ----
NM_001004439chr153213 145 118 ------
NM_001004441chr521576 23 ------
NM_001004720chr21319 1807 ----
NM_001004722chr22488 120 1976 ----
NM_001005207chr17126 ------
NM_001005209chr21704 ------
NM_001005271chr1741063 928 193 90 --1271 --
NM_001005273chr1741063 928 193 90 --1271 --
NM_001005290chr14445 387 207 22 ------
NM_001005291chr17143 ------
NM_001005335chr191227 ------
NM_001005360chr19----1232 --
NM_001005361chr19----1232 --
NM_001005362chr19----1232 --
NM_001005366chr123900 617 255 1285 ----
NM_001005375chrY21305 489 ------
NM_001005386chr221830 1751 1298 --1504
NM_001005404chr1774428 4381 2880 1562 749 297 145 23619 3328 33581 3209 1072 --
NM_001005417chr11168 ------
NM_001005463chr1042510 2339 2186 590 ------
NM_001005473chr585983 5033 4820 4713 4582 4133 2012 1941 35856 5489 5329 --14217
NM_001005619chr171240 ------
NM_001005739chr21713 ------
NM_001005746chr2--21357 72 ----
NM_001005747chr2--21357 72 ----
NM_001005753chr242302 2041 358 262 11727 ----
NM_001005781chr21520 ------
NM_001005782chr22969 253 ------
NM_001005845chr81362 21478 762 --11292
NM_001005849chr171406 ------
NM_001005861chr34862 698 401 197 ------
NM_001005862chr171585 ------
NM_001005920chr162720 684 ------
NM_001006115chr342405 659 634 617 --12048 --
NM_001006118chrY--1244 ----
NM_001006120chrY--1244 ----
NM_001006600chr552152 1747 1681 1535 539 --11717 --
NM_001006610chr163786 743 399 --1243 --
NM_001006612chrX1141 ------
NM_001006613chrX1141 ------
NM_001006614chrX1141 ------
NM_001006623chr22300 242 --31033 842 504 --
NM_001006626chr7------2186 99
NM_001006627chr7------2186 99
NM_001006628chr7------2186 99
NM_001006629chr7------2186 99
NM_001006630chr7------2186 99
NM_001006631chr7------2186 99
NM_001006632chr7------2186 99
NM_001006634chr161265 ------
NM_001006641chr931628 603 394 --11193 --
NM_001006642chr931628 603 394 --11193 --
NM_001006643chr931628 603 394 --11193 --
NM_001006657chr273201 2646 2585 1238 1222 1037 638 --22335 2069 --
NM_001006665chr11605 --1672 --
NM_001006681chrX1117 ------
NM_001006682chrX1117 ------
NM_001006683chrX1117 ------
NM_001006684chrX2536 137 ------
NM_001006939chr104705 666 645 590 ------
NM_001006945chr13470 216 201 ------
NM_001007024chr1753724 1256 919 840 800 24139 3127 24291 4025 --
NM_001007025chr1753724 1256 919 840 800 24139 3127 24291 4025 --
NM_001007067chr83813 338 165 11041 1399 --
NM_001007068chr83813 338 165 11041 1399 --
NM_001007069chr83813 338 165 11041 1399 --
NM_001007070chr83813 338 165 11041 1399 --
NM_001007102chr61212 --1666 11225
NM_001007156chr1541889 506 396 37 21968 606 21865 304 --
NM_001007226chr1741280 974 578 319 ------
NM_001007227chr1741280 974 578 319 ------
NM_001007228chr1741280 974 578 319 ------
NM_001007229chr1741280 974 578 319 ------
NM_001007230chr1741280 974 578 319 ------
NM_001007246chr2121679 1587 --11820 --
NM_001007257chr131184 289 173 11022 ----
NM_001007271chr103371 176 47 ------
NM_001007277chr111417 ------
NM_001007464chr6144 ------
NM_001007466chr684906 4549 4037 3918 3712 352 285 87 ------
NM_001007471chr91356 ------
NM_001007526chrY--1244 ----
NM_001007527chr52224 185 ------
NM_001007553chr13379 300 142 --1360 1235
NM_001008222chrX21323 1191 --2873 557 --
NM_001008225chr7----2599 591 --
NM_001008239chr1893562 3076 1309 1190 1015 887 797 752 472 1431 12387 --
NM_001008272chr32311 80 ------
NM_001008273chr32311 80 ------
NM_001008392chr322778 463 1729 --12349
NM_001008408chr756225 4640 2029 1271 410 12318 ----
NM_001008495chr862028 1637 1611 1543 617 206 --1357 1245
NM_001008540chr22469 398 ------
NM_001008541chr1021734 943 11697 ----
NM_001008541chr1021734 943 11697 ----
NM_001008564chr1351741 1505 880 660 168 --2545 437 --
NM_001008567chr92100 46 ------
NM_001008660chr1151593 1545 1535 1185 1080 ------
NM_001008701chr1921893 1242 ------
NM_001008707chr142769 189 21913 137 ----
NM_001008726chr1431727 527 424 --1569 --
NM_001008738chr532406 2139 577 --11796 --
NM_001008744chr1421498 206 1414 --11421
NM_001008783chr63368 162 23 ------
NM_001008801chr1941944 483 411 383 --11363 --
NM_001008860chr151641 ------
NM_001008892chr151641 ------
NM_001008894chr151641 ------
NM_001008895chr1331255 964 144 ------
NM_001008897chr61535 --152 --
NM_001008925chr463424 3038 2535 2299 1386 548 ------
NM_001009183chr142128 29 1156 ----
NM_001009554chr484655 4536 3801 3169 1033 548 518 74 33928 278 130 --1751
NM_001009554chr484655 4536 3801 3169 1033 548 518 74 33928 278 130 --1751
NM_001009555chr451367 1243 1087 265 54 11672 ----
NM_001009566chr11262 --11198 --
NM_001009880chr2274237 3656 3556 3345 3227 884 518 13370 ----
NM_001009881chr1179 ------
NM_001009882chr1179 ------
NM_001009899chr3146389 6112 6069 6021 5825 5403 5346 4857 4837 4424 2175 2003 444 295 --34389 4040 1951 15232
NM_001009955chr12156 109 ------
NM_001009955chr12156 109 ------
NM_001009960chr731829 377 52 22388 294 ----
NM_001009993chr293746 3520 3376 3166 3008 2835 1332 476 80 23527 1820 13212 --
NM_001010846chr154259 3223 1671 474 68 --33717 3489 37 --
NM_001010853chr632796 750 268 ------
NM_001010861chr11214 1298 12166 1803
NM_001010888chrX64001 3189 1749 1573 1251 659 21727 1269 11697 --
NM_001010891chr585225 5033 4245 2340 1574 1509 904 754 ------
NM_001010895chr972048 1813 1668 1485 802 626 164 ------
NM_001010908chr101102 ------
NM_001010927chr61230 ------
NM_001010932chr71409 ------
NM_001010938chr32776 203 ------
NM_001010942chr121175 198 ----
NM_001010984chr142327 1700 973 491 ------
NM_001010986chrX22474 560 1415 ----
NM_001011513chr433267 679 339 1277 33326 1174 560 12924
NM_001011515chr4139 ------
NM_001011516chr4139 ------
NM_001011546chr204607 554 318 116 --1654 --
NM_001011553chr7--1777 2722 220 --
NM_001011663chr107737 387 294 270 178 95 57 ------
NM_001011666chr796356 5993 5586 5231 5050 2600 623 561 498 26276 430 11253 14684
NM_001011708chr252165 996 784 484 46 12097 ----
NM_001011713chr141493 --1157 --
NM_001011885chr1551262 462 456 224 159 11462 ----
NM_001012393chr1194221 3239 1801 1650 1622 1316 1255 595 266 --23908 1056 --
NM_001012398chr16----2422 31 --
NM_001012642chr1551936 1746 750 723 524 ------
NM_001012732chr451174 1132 1048 120 71 ------
NM_001012751chr1031866 1575 627 --11247 --
NM_001012755chrX74682 4383 3168 3154 1508 1118 109 14605 ----
NM_001012761chr572732 2128 1870 1817 1765 762 456 1994 1398 1272
NM_001012968chrX62599 2205 1076 403 338 143 ------
NM_001012974chr61194 --153 --
NM_001012977chrX3520 452 446 ------
NM_001012989chrX1120 ------
NM_001013031chr1052978 2971 2513 2381 463 11219 ----
NM_001013398chr71204 --1196 --
NM_001013415chr42457 239 ------
NM_001013438chr31747 1106 1261 --
NM_001013439chr31593 --1107 --
NM_001013620chr1287871 7498 6937 5998 2276 1958 1254 1039 15245 ----
NM_001013622chr481113 812 475 352 290 228 105 43 --21181 958 --
NM_001013624chr172290 69 ------
NM_001013659chr19115379 5345 4568 4390 3557 2161 1142 550 331 287 68 11036 14271 --
NM_001013690chr1222240 1734 ------
NM_001013693chr142566 2392 1991 151 ------
NM_001013693chr142566 2392 1991 151 ------
NM_001013843chr15----1747 --
NM_001014380chr1375821 5309 4891 4098 3664 933 765 14332 25067 1777 --
NM_001014431chr141774 ------
NM_001014432chr141774 ------
NM_001014434chr11150 ------
NM_001014435chr162453 39 ------
NM_001014443chr12250 21 ------
NM_001014449chr161240 ------
NM_001014451chr161240 ------
NM_001014796chr11177 ------
NM_001014796chr11177 ------
NM_001014797chr10128035 7939 7766 7453 7303 7204 7193 6737 3079 2512 1687 1302 33100 2149 1369 15582 13172
NM_001014809chr41661 --1994 --
NM_001014839chr12946 759 --162 --
NM_001014841chr12946 759 --162 --
NM_001015045chr43802 632 603 --1546 11827
NM_001015508chr8----1189 --
NM_001015877chrX22244 1227 ----12007
NM_001015881chrX31197 1190 379 11208 ----
NM_001017369chr41143 --11092 --
NM_001017371chr211053 11346 ----
NM_001017395chr342612 2363 1021 576 --33649 2635 715 --
NM_001017396chr261868 785 692 594 497 486 ----1300
NM_001017406chr11175 --157 --
NM_001017423chr101123 ------
NM_001017424chr12597 208 --1175 --
NM_001017425chr12597 208 --1175 --
NM_001017440chr797956 7098 3238 1472 1069 792 672 307 167 15273 --11054
NM_001017923chr1421663 280 ----11571
NM_001017963chr142938 385 1171 ----
NM_001017973chr54320 270 250 61 ------
NM_001017974chr54320 270 250 61 ------
NM_001017977chr1123 ------
NM_001017979chr42790 204 1115 ----
NM_001017992chr511102 11512 1966 --
NM_001018004chr151225 ------
NM_001018006chr151225 ------
NM_001018007chr151225 ------
NM_001018008chr152461 76 ------
NM_001018009chr3--1404 ----
NM_001018020chr151225 ------
NM_001018025chrX1221 --1332 --
NM_001018037chr93313 247 58 ----11110
NM_001018050chr2272832 2771 2328 1112 973 798 576 ------
NM_001018052chr2272832 2771 2328 1112 973 798 576 ------
NM_001018054chr11229 ----1326
NM_001018056chr91122 --1392 --
NM_001018064chr931943 1833 66 21964 1878 1777 --
NM_001018065chr9105733 5293 4725 3838 3704 1937 1554 699 469 119 24462 224 --11499
NM_001018066chr9105733 5293 4725 3838 3704 1937 1554 699 469 119 24462 224 --11499
NM_001018067chr155181 3920 3505 2073 1491 1781 14622 --
NM_001018068chr155181 3920 3505 2073 1491 1781 14622 --
NM_001018069chr155181 3920 3505 2073 1491 1781 14622 --
NM_001018074chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_001018075chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_001018076chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_001018077chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_001018100chr152539 21 1700 ----
NM_001018108chr1541917 1838 683 284 11613 ----
NM_001020825chr53410 395 68 1182 ----
NM_001023567chr1511768 1440 12388 --
NM_001023587chr31805 1108 ----
NM_001024024chr142903 45 ------
NM_001024070chr142899 41 ------
NM_001024094chr593254 2935 2920 2593 938 851 702 304 198 23357 2707 --11385
NM_001024218chr143612 327 123 ------
NM_001024372chr832268 2203 2089 22056 475 ----
NM_001024647chr12117452 7393 6186 6077 5105 4952 3047 2978 1649 1635 418 36435 4893 3004 36107 5170 2123 16721
NM_001024649chr572886 2228 2018 1919 1043 737 282 183 12867 --
NM_001024680chr221291 104 2670 359 11591 1166
NM_001024688chr862068 1951 1588 893 460 48 1801 1206 --
NM_001024808chr1242599 1983 1914 817 ------
NM_001024809chr1731357 881 325 ------
NM_001024847chr3122429 2047 917 905 816 809 788 779 608 573 368 224 ----1275
NM_001024937chr171662 ----1501
NM_001024947chr5--1897 1429 --
NM_001024948chr132973 944 743 1772 22553 2340 21211 183
NM_001024956chr1185632 4647 4577 4040 2333 1485 979 862 24410 1399 ----
NM_001025068chr331483 1416 183 --1720 --
NM_001025069chr331483 1416 183 --1720 --
NM_001025076chr10206021 5672 5641 5531 4966 4402 4178 4124 2382 2116 1965 1946 1841 1772 1537 1334 675 608 578 51 --12153 --
NM_001025077chr10187379 7030 6999 6889 6324 5760 5536 5482 5050 2895 2692 2033 1966 1936 1409 934 529 278 15112 1345 --
NM_001025079chr352791 2617 1332 1103 862 13554 31307 773 555 --
NM_001025081chr1851231 1214 1188 1176 1073 ------
NM_001025090chr1851231 1214 1188 1176 1073 ------
NM_001025092chr1851231 1214 1188 1176 1073 ------
NM_001025100chr1863673 3584 2804 1128 989 493 --11396 --
NM_001025101chr1851231 1214 1188 1176 1073 ------
NM_001025105chr51608 ------
NM_001025107chr172386 2281 2109 1912 1777 702 286 ----1645
NM_001025107chr172386 2281 2109 1912 1777 702 286 ----1645
NM_001025108chr293878 3037 1382 1318 1253 1104 842 354 226 ------
NM_001025109chr13467 154 57 ------
NM_001025252chr853159 3082 2041 1211 62 23103 2488 ----
NM_001025253chr853159 3082 2041 1211 62 23103 2488 ----
NM_001025266chr374749 4511 4240 4124 1243 690 234 54902 3091 3005 990 261 152 --
NM_001025356chr1262422 2020 678 424 232 92 22697 2117 --127
NM_001025366chr6----1183 --
NM_001025366chr6----1183 --
NM_001025367chr6----1183 --
NM_001025367chr6----1183 --
NM_001025368chr6----1183 --
NM_001025368chr6----1183 --
NM_001025369chr6----1199 --
NM_001025369chr6----1199 --
NM_001025370chr6----1183 --
NM_001025370chr6----1183 --
NM_001025579chr172842 774 --1328 --
NM_001025580chrX64300 3600 2708 799 562 65 1747 ----
NM_001025595chr431084 558 422 ------
NM_001025603chr141505 532 154 71 --31150 569 471 --
NM_001025616chr431203 717 357 ------
NM_001025777chr23511 203 120 ------
NM_001025780chr921199 638 11210 ----
NM_001029858chr6102290 2149 2129 2115 1336 1092 996 965 425 407 ------
NM_001029859chr1192293 2025 963 945 930 916 189 155 70 ------
NM_001029863chr611006 --1103 --
NM_001029875chr532218 2020 665 12190 12994 --
NM_001029884chr612683 2477 314 --1926
NM_001029998chr411302 --2911 297 --
NM_001030006chr1711642 1765 11808 1402
NM_001030007chr1693803 3400 2860 2697 1537 853 463 365 253 23517 1040 21005 473 --
NM_001030055chr1423335 571 24101 300 34301 3851 565 --
NM_001030287chr13354 289 97 --1206 --
NM_001031623chr621323 471 21726 626 11509 --
NM_001031679chr1253497 2625 2237 1230 828 --1710 --
NM_001031684chr221459 1085 1427 ----
NM_001031689chr91121 ------
NM_001031690chr753065 2772 2066 978 879 12451 22690 1114 --
NM_001031695chr2243522 1327 1218 378 1642 35020 4076 1184 --
NM_001031716chr2----165 --
NM_001031723chr4123 ------
NM_001031732chr433630 532 222 1902 13184 11425
NM_001031740chr141566 617 313 283 --11447 --
NM_001031801chr222350 169 ------
NM_001031804chr1673731 3261 3164 1318 1164 552 406 ------
NM_001032221chr931811 1551 299 11731 ----
NM_001032282chr821073 469 --1918 --
NM_001032283chr121205 --11020 1276
NM_001032284chr121205 --11020 1276
NM_001032296chr1352716 1120 1060 961 687 --22798 937 12339
NM_001032363chr13490 259 132 --22040 474 --
NM_001032363chr13490 259 132 --22040 474 --
NM_001032380chr1031640 136 58 11696 ----
NM_001032393chrX1609 ------
NM_001032394chr632415 716 111 12224 1532 --
NM_001033045chr274043 3891 3211 1461 1099 861 719 --33093 2824 1227 12885
NM_001033047chr422583 62 2941 531 ----
NM_001033049chr2182194 1582 569 468 434 231 153 94 11529 11973 --
NM_001033057chr341819 1340 704 96 --1832 --
NM_001033059chr631730 1574 462 --11419 --
NM_001033087chr2012873 --1235 --
NM_001033117chr333048 1677 435 14810 34549 3586 1267 --
NM_001033521chr201158 ------
NM_001033522chr201158 ------
NM_001033564chr63769 669 245 1399 21454 95 1234
NM_001033602chr1352476 2050 1798 846 174 --1568 --
NM_001033723chr822513 828 --42606 1862 1104 549 --
NM_001033756chr6----1117 --
NM_001033756chr6----1117 --
NM_001033925chr10------11841
NM_001034837chr53524 123 114 155 ----
NM_001034838chr53524 123 114 155 ----
NM_001034841chr1694816 4787 4516 3626 3346 839 733 187 154 --25490 2153 1680
NM_001034845chr42167 62 ------
NM_001034852chr1441954 1915 1646 1615 --31996 1404 133 --
NM_001035chr14825 519 424 169 ------
NM_001035003chr431039 545 75 11168 ----
NM_001035004chr431039 545 75 11168 ----
NM_001035260chr1051469 1309 656 578 64 --11402 --
NM_001037131chr231308 1162 32 ------
NM_001037132chr731704 1666 55 ------
NM_001037133chr731704 1666 55 ------
NM_001037164chr731666 606 347 --21403 786 --
NM_001037172chr321038 387 --11082 --
NM_001037174chr252046 1891 1500 854 169 ------
NM_001037317chr11214 1298 12166 1803
NM_001037331chr183863 747 114 ------
NM_001037332chr582563 2535 2136 1945 1810 1698 516 121 ------
NM_001037333chr582563 2535 2136 1945 1810 1698 516 121 ------
NM_001037334chr18--12432 1598 --
NM_001037339chr1--1569 ----
NM_001037340chr1--1569 ----
NM_001037341chr1--1569 ----
NM_001037341chr1--1569 ----
NM_001037535chrX21138 1012 --11360 --
NM_001037536chrX21138 1012 --11360 --
NM_001037540chrX21138 1012 --11360 --
NM_001037582chr411276 11148 11603 --
NM_001037631chr21259 1395 ----
NM_001037639chr3129 ------
NM_001038702chr522545 2187 22063 817 2810 34 --
NM_001038707chr122239 29 --21690 817 --
NM_001038707chr122239 29 --21690 817 --
NM_001039111chr32365 183 ------
NM_001039348chr22911 94 157 ----
NM_001039349chr22911 94 157 ----
NM_001039395chr952294 1918 1704 793 85 ------
NM_001039457chr13248 217 33 ------
NM_001039459chr731137 878 82 --1175 --
NM_001039538chr21297 --1664 --
NM_001039547chr397712 6777 6046 6036 5810 3131 2410 1860 1213 36347 6199 1232 37411 5514 2092 --
NM_001039569chr233250 2610 756 12825 32925 1303 1167 --
NM_001039570chr22104111 4071 3918 3377 3107 2839 1506 914 255 211 1665 11388 --
NM_001039571chr22104111 4071 3918 3377 3107 2839 1506 914 255 211 1665 11388 --
NM_001039580chr485074 4987 4932 4236 3596 3223 1140 1095 43604 1181 841 688 --11539
NM_001039585chr163436 2858 1361 1147 255 39 1597 ----
NM_001039590chrX33962 1086 625 --13833 --
NM_001039591chrX33962 1086 625 --13833 --
NM_001039618chr1175773 4814 4500 1700 991 531 82 170 ----
NM_001039690chr1642060 1707 1598 926 --1252 --
NM_001039711chr13777 326 21 1244 1967 --
NM_001039712chr13777 326 21 1244 1967 --
NM_001039802chr121316 123 1402 ----
NM_001039840chrX105204 4796 4595 4409 1671 1663 1056 1016 825 167 33996 2301 1459 25882 505 --
NM_001039888chr12536 263 ------
NM_001039937chr1363332 3101 2714 2578 1070 854 11381 1495 --
NM_001039960chr1221106 636 11463 ----
NM_001040001chr691831 1686 1634 1449 1405 1307 793 343 22 ------
NM_001040002chr1741480 478 113 71 ------
NM_001040020chr741227 1094 499 103 --135 11404
NM_001040057chr71337 ------
NM_001040101chr421480 222 --1629 --
NM_001040113chr161971 ------
NM_001040142chr232346 1680 420 --11665 --
NM_001040143chr232346 1680 420 --11665 --
NM_001040144chr1642060 1707 1598 926 --1252 --
NM_001040146chr1642060 1707 1598 926 --1252 --
NM_001040152chr784336 3173 2057 1397 1028 914 752 92 21944 1135 ----
NM_001040153chr134759 363 265 169 ------
NM_001040157chr492624 2012 1985 951 528 425 418 207 197 ------
NM_001040159chr411272 --1458 --
NM_001040167chr731001 941 414 ------
NM_001040172chr551494 1159 553 381 214 ------
NM_001040173chr551494 1159 553 381 214 ------
NM_001040181chr32421 204 ------
NM_001040182chr32421 204 ------
NM_001040183chr32421 204 ------
NM_001040199chr32421 204 ------
NM_001040200chr32421 204 ------
NM_001040202chr41521 21596 359 ----
NM_001040214chr63813 434 248 11998 ----
NM_001040260chr441096 368 357 109 ------
NM_001040261chr441096 368 357 109 ------
NM_001040272chr92927 148 --12338 --
NM_001040273chr1052080 1999 1861 657 204 ------
NM_001040284chr1685658 5200 5142 4688 4149 4134 3981 3938 25311 640 14883 --
NM_001040402chr452552 2493 1137 915 714 12010 12712 --
NM_001040429chr1353117 2955 2724 2201 306 --12968 --
NM_001040446chr592042 1932 1105 987 960 903 870 621 197 ------
NM_001040450chr1562800 2186 891 875 556 251 ------
NM_001040453chr1562800 2186 891 875 556 251 ------
NM_001040458chr5------1264
NM_001040619chr12547 126 --1656 --
NM_001040624chr832035 703 146 --1131 --
NM_001040625chr832035 703 146 --1131 --
NM_001040626chr832035 703 146 --1131 --
NM_001040627chr832035 703 146 --1131 --
NM_001040628chr832035 703 146 --1131 --
NM_001040629chr832035 703 146 --1131 --
NM_001040630chr832035 703 146 --1131 --
NM_001040708chr82269 112 173 ----
NM_001040709chr141593 929 364 40 --1774 --
NM_001040712chr943015 2752 234 79 1311 23006 2200 --
NM_001040876chr421450 187 ------
NM_001042361chr10181 ------
NM_001042364chr10181 ------
NM_001042365chr10181 ------
NM_001042368chr92324 42 --177 --
NM_001042383chr353169 2401 828 279 226 ------
NM_001042387chr10181 ------
NM_001042393chr10181 ------
NM_001042396chr10181 ------
NM_001042397chr10181 ------
NM_001042399chr124486 389 352 133 ------
NM_001042403chr122952 791 ------
NM_001042404chr131249 755 237 --1778 --
NM_001042406chr62827 807 ------
NM_001042413chr973769 3645 1449 1281 1184 816 54 --23469 3304 --
NM_001042430chr141175 ------
NM_001042453chrX3632 472 297 ------
NM_001042459chr32248 233 1278 ----
NM_001042473chr1021505 531 --12046 --
NM_001042475chr62204 96 ------
NM_001042479chrX----1676 --
NM_001042480chrX----1676 --
NM_001042481chr1412366 11803 --1168
NM_001042486chr2051366 1336 1090 1003 396 ------
NM_001042492chr1762459 2351 2293 2274 1330 102 ------
NM_001042493chr642041 1897 1662 1541 ------
NM_001042494chr1553637 3393 2762 1023 152 1432 21393 924 13215
NM_001042495chr1553637 3393 2762 1023 152 1432 21393 924 13215
NM_001042496chr1553637 3393 2762 1023 152 1432 21393 924 13215
NM_001042497chr1553637 3393 2762 1023 152 1432 21393 924 13215
NM_001042498chrX161 ------
NM_001042506chrX3520 452 446 ------
NM_001042537chrX42012 1829 1544 752 11861 12219 --
NM_001042539chr16----1728 --
NM_001042555chr1264770 3372 3328 3074 530 310 1730 2137 30 11222
NM_001042599chr2157736 7523 7293 7103 6285 5624 5603 5412 5240 2655 1522 1303 1087 638 312 56977 6920 6895 5927 2904 ----
NM_001042601chr323211 2181 1518 12073 13073
NM_001042603chr1254703 4501 3730 1085 456 1641 14841 --
NM_001042604chr364169 3341 3148 1868 1860 47 --1149 1190
NM_001042610chr1631391 1207 555 ------
NM_001042632chr2021745 541 --11651 --
NM_001042633chr2021745 541 --11651 --
NM_001042669chr431203 717 357 ------
NM_001042681chr122081 914 ------
NM_001042682chr122081 914 ------
NM_001042682chr122081 914 ------
NM_001042683chr6--1701 1589 --
NM_001042724chr191134 ------
NM_001042729chr11540 ------
NM_001042747chr11540 ------
NM_001042749chrX11981 ------
NM_001042750chrX11981 ------
NM_001042751chrX11981 ------
NM_001042762chr74913 794 335 26 --11125 --
NM_001043318chr14104107 3765 3449 3000 2575 1327 1293 1277 869 538 --21660 1467 --
NM_001044305chr6160 11499 ----
NM_001044385chr243746 3538 1062 938 2295 204 12565 --
NM_001046chr532292 1957 664 1436 ----
NM_001048183chr1103523 3492 3430 3178 2395 1201 876 544 198 83 --2761 137 --
NM_001071775chr1321677 214 1206 11540 --
NM_001076chr42123 108 ------
NM_001076chr42123 108 ------
NM_001079874chr152123 1968 774 548 365 ------
NM_001083620chr452484 2010 1666 335 298 ----12435
NM_001092chr174808 634 541 164 --22003 358 --
NM_001095chr1211545 ----1431
NM_001096chr172797 279 ------
NM_001099678chr375190 4274 2473 2208 1710 1704 1060 26056 100 34770 1485 287 15453
NM_001100108chr1106834 6767 6349 6045 5565 5105 3042 2552 2205 125 23012 1113 47868 6087 5447 1093 --
NM_001106chr3159220 8831 7989 7912 7455 7327 7291 6059 3460 2149 2028 1761 1131 458 124 38846 8086 7070 56711 3214 2898 2540 1599 --
NM_001111chr172386 2281 2109 1912 1777 702 286 ----1645
NM_001113490chrX83644 3548 2726 2652 2259 1206 1196 199 ------
NM_001119chr421409 333 ------
NM_001121chr10----11796 --
NM_001122679chr51969 ------
NM_001128chr1693803 3400 2860 2697 1537 853 463 365 253 23517 1040 21005 473 --
NM_001131chr63822 404 336 ------
NM_001135chr153810 724 189 ------
NM_001143chrY--140 ----
NM_001144chr1611348 --1530 --
NM_001148chr452037 1758 1441 721 66 --22121 1851 --
NM_001149chr1021205 220 1416 ----
NM_001153chr24942 593 373 40 1578 ----
NM_001156chr102505 467 --1543 --
NM_001160chr1252305 816 572 255 183 ------
NM_001163chr92985 689 ------
NM_001167chrX86406 4849 2477 2240 2101 1938 1362 831 24931 1234 ----
NM_001169chr161412 ------
NM_001172chr141261 ------
NM_001173chr1423335 571 24101 300 34301 3851 565 --
NM_001177chr1272459 2445 1971 1932 1733 1672 485 ----12378
NM_001186chr2143242 2145 1246 699 12668 ----
NM_001189chr44941 724 705 106 --2828 189 --
NM_001198chr61509 11829 ----
NM_001200chr202951 331 199 ----
NM_001201chr423385 1492 13238 11080 --
NM_001204chr2147575 7379 6937 6283 6264 5811 5541 4976 1600 1416 1270 1058 593 485 16444 44859 4787 1529 212 1809
NM_001206chr942295 2195 1968 492 --1796 --
NM_001219chr752276 2095 2042 830 230 11521 ----
NM_001222chr1071857 1827 1621 1502 1461 1305 527 ------
NM_001237chr411193 ------
NM_001237chr411193 ------
NM_001241chr222403 1712 --1714 --
NM_001241chr222403 1712 --1714 --
NM_001256chr1752170 1017 769 672 134 1530 --12677
NM_001257chr1631391 1182 542 --1184 --
NM_001259chr796395 5852 5148 4903 4840 2456 1134 1116 858 15343 15048 --
NM_001260chr131111 ------
NM_001262chr11354 ------
NM_001270chr54980 950 936 729 ------
NM_001271chr1552822 1180 256 245 142 --1203 --
NM_001273chr123112 97 51 --1448 --
NM_001280chr192109 92 ------
NM_001282chr1711642 1765 11808 1402
NM_001283chr73540 186 122 ------
NM_001284chr5----1501 --
NM_001290chr41834 --1278 --
NM_001299chr19----1481 --
NM_001300chr10------1472
NM_001304chr1773508 2997 2730 1530 1386 1265 238 ----11360
NM_001310chr1282967 2945 2386 2286 2277 1117 902 400 --22779 1960 1311
NM_001313chr41661 --1994 --
NM_001316chr202509 118 ------
NM_001324chr201158 ------
NM_001331chr1152061 2017 1763 1753 1096 --12200 --
NM_001332chr521320 1086 11369 1238 --
NM_001343chr531391 551 173 --21696 464 --
NM_001346chr342550 2084 647 165 1737 ----
NM_001349chr21456 ------
NM_001351chr321279 390 ------
NM_001355chr22127 ------
NM_001356chrX21897 75 ------
NM_001363chrX4556 525 264 175 ------
NM_001364chr1194003 3733 3580 3336 1455 886 554 445 421 31849 1673 1555 21917 1213 --
NM_001378chr2----1173 --
NM_001385chr82434 277 ------
NM_001386chr831926 1598 320 --21873 347 --
NM_001389chr213438 210 62 ------
NM_001391chr181200 ------
NM_001396chr2162226 1825 1011 889 564 204 12338 ----
NM_001400chr11418 1389 1928 --
NM_001401chr931342 1329 204 ------
NM_001407chr331288 1183 163 --1230 --
NM_001408chr1----1222 --
NM_001412chrX63253 2594 2389 1316 200 29 ------
NM_001415chrX31389 703 572 1117 ----
NM_001416chr172130 98 ------
NM_001417chr1251787 1442 776 397 124 ------
NM_001419chr1953965 3611 3142 1236 377 ------
NM_001420chr1922705 417 ------
NM_001421chrX31332 1266 1147 ------
NM_001423chr1241588 1539 1372 1330 ------
NM_001426chr2185 ------
NM_001427chr771551 1456 1375 707 450 323 281 ------
NM_001429chr222970 316 1422 ----
NM_001430chr22260 27 1176 11506 --
NM_001431chr62955 331 ------
NM_001432chr473931 3393 2670 2598 1354 1193 1006 --13654 13824
NM_001438chr163685 2380 1323 1073 512 203 12976 ----
NM_001448chrX31496 353 59 11344 ----
NM_001451chr161182 --1929 --
NM_001452chr62670 636 ------
NM_001453chr61224 11776 ----
NM_001454chr172369 232 ------
NM_001460chr143266 3065 1262 50 ------
NM_001466chr171112 ------
NM_001482chr15--1683 1818 --
NM_001483chr72688 305 1243 ----
NM_001494chr101146 --1650 --
NM_001495chr84487 282 122 94 ------
NM_001530chr1431161 753 402 --2964 269 --
NM_001533chr191227 ------
NM_001546chr621370 1233 1925 ----
NM_001552chr171259 --11035 --
NM_001587chrX52230 2073 1708 695 478 --3735 588 420 --
NM_001604chr111863 ------
NM_001616chr243464 2915 2627 1179 1854 23236 2802 --
NM_001617chr22927 489 --11026 11013
NM_001620chr11------1771
NM_001634chr631730 1574 462 --11419 --
NM_001635chr72991 74 ------
NM_001650chr1873908 3676 1552 887 699 508 261 22955 1383 14119 --
NM_001659chr1272665 2288 1737 1011 898 471 350 ------
NM_001663chr1461765 996 854 826 667 91 11971 11090 --
NM_001664chr34894 854 740 127 ------
NM_001668chr141850 923 636 254 1872 ----
NM_001674chr13354 289 97 --1206 --
NM_001676chr13156 ----1170
NM_001679chr32694 94 ------
NM_001681chr121136 ------
NM_001682chr1222497 616 12659 12632 --
NM_001683chr321833 344 --11669 --
NM_001684chr163503 3457 2624 807 786 489 ------
NM_001688chr12783 311 --1663 --
NM_001693chr851185 1159 972 887 83 --11042 --
NM_001695chr843847 3470 3365 447 --13456 --
NM_001698chr91140 ------
NM_001699chr1971792 1754 1431 1355 179 78 70 194 ----
NM_001701chr911267 ------
NM_001703chr12224 64 ------
NM_001704chr63512 486 386 ------
NM_001706chr3--171 ----
NM_001707chr72182 166 --1359 --
NM_001716chr1141508 582 359 293 11062 ----
NM_001718chr621236 1091 ------
NM_001731chr121815 1234 1185 --
NM_001735chr92140 35 1121 ----
NM_001742chr731862 1266 345 ------
NM_001745chr541199 1027 821 94 --1261 --
NM_001746chr572886 2228 2018 1919 1043 737 282 183 12867 --
NM_001748chr151117 887 294 277 77 ------
NM_001753chr731175 233 137 11528 ----
NM_001754chr2193740 3694 2850 1722 1464 1173 475 250 43 ----1505
NM_001755chr1642206 1902 294 79 1354 ----
NM_001759chr1255336 4917 4013 3475 1741 --2974 544 14167
NM_001777chr352791 2617 1332 1103 862 13554 31307 773 555 --
NM_001788chr7--1777 2722 220 --
NM_001791chr121316 123 1402 ----
NM_001792chr18----1255 --
NM_001797chr161183 1577 ----
NM_001798chr123858 210 122 --11014 --
NM_001800chr19171 ------
NM_001806chr1962757 2460 1962 1806 1127 723 1612 ----
NM_001812chr41321 ------
NM_001826chr13290 101 61 ------
NM_001830chrX41574 1144 868 640 24006 3077 23128 1214 --
NM_001845chr13192 11400 1229 --
NM_001851chr63585 122 97 ------
NM_001854chr1143 ------
NM_001855chr92883 701 ------
NM_001858chr624119 3157 --33579 3507 308 --
NM_001859chr993595 3496 2881 2444 1307 1271 1092 988 665 1279 1545 --
NM_001880chr21292 ------
NM_001882chr52430 377 ------
NM_001884chr51499 ------
NM_001890chr4--2370 53 ----
NM_001892chr51608 ------
NM_001895chr203994 768 72 1399 ----
NM_001896chr16140 ------
NM_001901chr61901 --11052 1318
NM_001903chr52732 656 2866 797 ----
NM_001921chr451174 1132 1048 120 71 ------
NM_001924chr1156 ------
NM_001933chr1441324 1079 956 198 --1532 --
NM_001935chr21130 2197 159 ----
NM_001938chr121848 1801 --197 --
NM_001942chr1811874 1540 ----
NM_001944chr183802 575 105 11886 1457 --
NM_001945chr511097 ------
NM_001946chr122814 364 1886 ----
NM_001949chr62945 90 ------
NM_001951chr82553 97 ----1515
NM_001967chr31625 ------
NM_001968chr42850 154 1118 ----
NM_001969chr1453034 2912 1372 853 536 2589 117 12990 --
NM_001970chr171544 ------
NM_001975chr122874 311 --1215 --
NM_001977chr431639 1171 280 1434 ----
NM_001980chr1232222 1997 1909 ----1843
NM_001981chr132405 1575 221 ------
NM_001982chr1221270 1184 --2829 195 --
NM_001987chr1273633 3132 3065 2995 2666 1138 728 ----1168
NM_001991chr1722099 26 1547 --12214
NM_001993chr11186 --2876 248 1904
NM_001995chr421417 220 11213 ----
NM_001999chr521519 347 ------
NM_002006chr465491 4238 4186 1513 873 213 1652 23788 1952 --
NM_002009chr1542713 2623 2353 1099 1741 ----
NM_002010chr131176 ------
NM_002015chr1362432 2187 1244 1073 957 528 ------
NM_002017chr111985 --1243 --
NM_002024chrX2465 236 1199 11585 --
NM_002025chrX118879 7334 5991 5697 2887 2542 2517 1770 1320 331 253 --26083 1881 17763
NM_002026chr231030 899 726 ------
NM_002028chr141324 1950 ----
NM_002029chr19253 22 ------
NM_002035chr1883999 3756 3671 3280 2791 1603 1435 899 --13162 --
NM_002039chr4----2686 286 1327
NM_002040chr212955 67 ----12500
NM_002044chr15140 1187 11163 --
NM_002045chr31344 ------
NM_002046chr12----1164 --
NM_002048chr931063 180 79 ------
NM_002051chr103961 326 145 ------
NM_002052chr851371 573 420 405 242 ------
NM_002063chrX2143 81 1806 ----
NM_002069chr731456 384 113 ------
NM_002074chr121667 345 ------
NM_002076chr1282839 2743 2605 2560 2105 1092 447 387 12966 23263 2571 --
NM_002077chr972134 1486 571 333 311 284 41 21889 628 21988 607 --
NM_002078chr32547 55 ------
NM_002086chr1742031 1552 781 139 --1668 --
NM_002087chr172303 76 ------
NM_002092chr464785 4109 4063 1289 1116 58 --23552 3354 --
NM_002107chr11119 ------
NM_002126chr17104052 3762 3216 2948 2717 2610 1086 1017 720 141 --12965 23998 98
NM_002130chr51419 21686 1134 ----
NM_002137chr71704 1212 ----
NM_002140chr92420 344 --190 --
NM_002143chr12740 542 ------
NM_002146chr173952 942 397 1391 ----
NM_002148chr21622 ------
NM_002152chr19132 ------
NM_002156chr2123 ------
NM_002158chr263403 2861 2699 2318 1130 1082 ------
NM_002182chr312253 --12203 --
NM_002184chr5137 ------
NM_002192chr72634 408 --1448 --
NM_002193chr231797 1253 1219 --1401 --
NM_002196chr202712 206 ------
NM_002196chr202712 206 ------
NM_002202chr51924 ------
NM_002203chr554105 3779 3569 1491 630 --33014 2856 1320 11526
NM_002205chr122949 676 ------
NM_002210chr243374 2894 307 28 ------
NM_002211chr1021121 1065 ------
NM_002214chr774488 4180 4107 4056 3655 2069 315 44690 1923 767 306 12216 24551 238
NM_002222chr34422 271 260 31 ------
NM_002224chr6--1241 ----
NM_002226chr141585 ------
NM_002227chr12827 251 --11295 --
NM_002228chr12916 907 ------
NM_002229chr192401 192 ------
NM_002233chr112183 38 ------
NM_002234chr121789 ----1684
NM_002241chr142028 925 448 400 22305 1935 23103 2263 12228
NM_002245chr1--1108 ----
NM_002246chr251025 414 378 342 25 ------
NM_002247chr103924 840 312 2948 694 11797 --
NM_002252chr2----1109 --
NM_002253chr42519 337 ------
NM_002254chr272294 1797 708 671 538 505 404 --1440 --
NM_002264chr3134843 4567 3556 2000 1844 1459 1328 1157 677 621 267 142 25 --15048 --
NM_002265chr173471 244 54 --2853 482 --
NM_002267chr1342405 2093 380 150 11641 22313 22 --
NM_002268chr351694 1358 627 517 377 11446 ----
NM_002270chr585410 5220 5006 4591 2172 1931 1849 697 23573 763 --14096
NM_002271chr1341818 1590 833 524 21669 841 11796 --
NM_002283chr12136 --2626 167 --
NM_002285chr293878 3037 1382 1318 1253 1104 842 354 226 ------
NM_002290chr641313 967 412 355 ------
NM_002293chr171998 1702 1108 780 483 477 245 32674 2486 235 ----
NM_002294chrX178 ------
NM_002313chr1084262 3776 3505 3343 1663 1430 796 490 21586 260 ----
NM_002314chr721043 1026 --11082 --
NM_002334chr1131877 517 241 --21789 795 --
NM_002336chr12115010 4242 3831 3363 1970 1687 1645 1632 1593 735 682 ------
NM_002351chrX1134 ------
NM_002355chr1241415 1274 1107 1024 --31345 906 143 --
NM_002356chr632576 897 249 11757 31875 1068 324 --
NM_002360chr7171 --12641 --
NM_002372chr54698 564 550 46 ------
NM_002373chr1521261 249 ------
NM_002374chr21297 --1664 --
NM_002376chr141592 --199 --
NM_002381chr21992 1701 ----
NM_002385chr1851231 1214 1188 1176 1073 ------
NM_002387chr5105007 4494 4127 4028 3966 3475 1987 870 397 125 --14628 --
NM_002395chr62977 190 --1575 --
NM_002397chr52652 206 161 12202 --
NM_002398chr221192 409 11073 ----
NM_002399chr1511357 ------
NM_002401chr1752263 1849 1802 922 439 ------
NM_002408chr143584 324 316 ------
NM_002422chr11----1209 135
NM_002429chr1221021 196 --11497 --
NM_002430chr2232135 1826 149 ------
NM_002465chr12160 ------
NM_002469chr122411 201 ------
NM_002478chr111440 ------
NM_002480chr1211396 ------
NM_002482chr1162 ------
NM_002484chr161176 1153 ----
NM_002485chr862068 1951 1588 893 460 48 1801 1206 --
NM_002487chr152246 141 1310 ----
NM_002489chr71413 ------
NM_002499chr1592494 2090 2007 1936 408 346 306 135 98 --32211 1632 899 --
NM_002500chr21420 1190 ----
NM_002501chr1934105 2878 1244 ------
NM_002505chr61300 ------
NM_002515chr1431370 1269 600 ------
NM_002518chr21305 --2991 934 --
NM_002519chr1131299 1184 431 2615 127 1104 --
NM_002522chr1763761 3180 2522 2392 750 376 --12647 --
NM_002524chr13914 224 39 ------
NM_002544chr171291 ------
NM_002545chr1194221 3239 1801 1650 1622 1316 1255 595 266 --23908 1056 --
NM_002546chr8175 ----1751
NM_002547chrX73773 3495 2646 1117 628 457 418 --1129 --
NM_002569chr15----148 --
NM_002572chr11128 --191 --
NM_002576chr1121183 822 ------
NM_002577chr363864 2778 2734 890 631 538 22872 2835 ----
NM_002581chr985450 5325 5087 4720 1863 1543 966 603 14522 15154 --
NM_002586chr631160 392 228 1566 ----
NM_002588chr531279 320 165 ------
NM_002591chr204582 476 144 23 ------
NM_002594chr2031629 917 79 11554 ----
NM_002595chr122517 403 2725 527 ----
NM_002599chr1141121 273 260 138 --1449 --
NM_002600chr1--1569 ----
NM_002605chr1541114 920 848 373 ------
NM_002608chr2251522 1364 456 347 257 --11507 --
NM_002609chr531355 680 58 --1447 11706
NM_002612chr7--2704 23 ----
NM_002613chr1675064 4660 4498 4390 3949 3744 1781 23470 2165 14608 --
NM_002627chr10------180
NM_002628chr341226 494 260 219 --21151 356 --
NM_002634chr172734 21 ------
NM_002636chr61193 --1220 --
NM_002643chr2----1165 --
NM_002644chr131742 1420 42 ------
NM_002645chr1153091 2903 2573 1236 646 --22001 375 --
NM_002655chr8104625 4246 1940 1591 1351 1342 1230 842 594 358 11603 23633 3207 --
NM_002657chr20133614 3605 3001 2792 2601 1365 1051 849 724 543 398 360 143 11306 13748 --
NM_002662chr32623 413 11990 ----
NM_002670chr321248 466 11300 --11603
NM_002687chr1431137 262 68 ------
NM_002698chr1932775 2742 2530 ------
NM_002699chr1--1477 ----
NM_002707chr22376 363 ------
NM_002709chr2113588 3532 3340 3024 2883 2729 1256 889 859 252 114 --1827 --
NM_002710chr1211057 ------
NM_002711chr72842 611 ------
NM_002714chr63991 413 262 --1936 --
NM_002715chr5--1186 1902 --
NM_002716chr1143538 2765 1400 1128 12258 43140 2875 1460 645 --
NM_002717chr81253 --1225 --
NM_002718chr341891 1856 1848 236 1587 22577 1960 --
NM_002719chr1461990 1510 748 629 585 306 --22269 951 --
NM_002721chr9----195 --
NM_002725chr1154304 4248 4034 3859 3335 3112 2790 1516 1100 1027 986 620 421 59 37 34376 4180 1713 11392 --
NM_002729chr102653 622 ------
NM_002730chr1931171 231 110 ------
NM_002731chr11227 12175 33178 3018 2724 --
NM_002734chr1731745 1668 309 --11415 --
NM_002736chr751911 1751 429 393 181 ------
NM_002738chr1621081 168 ------
NM_002740chr342320 2178 2166 905 12136 12801 --
NM_002742chr142721 584 ------
NM_002747chr181230 ----11612
NM_002748chr151795 ------
NM_002752chr5----1367 --
NM_002753chr43872 536 77 ------
NM_002758chr17191 --1547 --
NM_002764chrX4988 885 661 636 ------
NM_002779chr102185 37 --1221 --
NM_002811chr161524 ------
NM_002819chr1941501 1458 968 163 167 ----
NM_002825chr71588 ------
NM_002829chr91117 ----1135
NM_002830chr2------1148
NM_002835chr72270 80 2119 24 ----
NM_002839chr943015 2752 234 79 1311 23006 2200 --
NM_002840chr141539 1372 1120 468 ------
NM_002841chr32181 22 ------
NM_002843chr1152882 2116 828 488 242 ------
NM_002844chr62294 71 ------
NM_002846chr2161 ------
NM_002851chr71715 1751 ----
NM_002857chr142388 2014 557 342 21940 1648 1292 --
NM_002860chr101123 ------
NM_002867chr11510 1237 1684 --
NM_002868chr122270 247 --2834 151 21623 971
NM_002869chr1121816 1796 --1661 --
NM_002874chr911918 --32177 1604 839 --
NM_002880chr33843 633 61 ------
NM_002890chr53902 263 101 ------
NM_002892chr1441081 611 483 280 --21652 394 --
NM_002893chrX1332 --1139 --
NM_002894chr18----1159 --
NM_002895chr202879 744 --2962 32 --
NM_002906chr113677 104 92 21986 637 ----
NM_002912chr63830 271 215 ------
NM_002923chr11627 ------
NM_002924chr12556 50 ------
NM_002938chr421351 360 11448 --1539
NM_002940chr421450 187 ------
NM_002950chr3----143 --
NM_002953chr11605 --1672 --
NM_002955chr621536 1361 ------
NM_002956chr1211127 1318 ----
NM_002957chr953469 3328 2611 437 260 --12696 --
NM_002958chr34862 698 401 197 ------
NM_002959chr153487 768 377 363 48 --23855 189 --
NM_002968chr162882 440 --31006 821 151 --
NM_002971chr32346 66 1968 ----
NM_002977chr241267 688 655 313 ------
NM_002994chr441497 462 231 157 2582 558 ----
NM_002998chr821495 548 11982 --1118
NM_002999chr2041911 1896 770 129 --1465 --
NM_003010chr1711984 1303 ----
NM_003011chr931516 644 176 ------
NM_003016chr1761841 1768 1470 789 779 135 ------
NM_003017chr61567 ------
NM_003027chr15--1154 ----
NM_003028chr923679 2370 ------
NM_003030chr351982 1743 1666 1290 28 11433 1150 --
NM_003031chr163786 743 399 --1243 --
NM_003036chr11288 --21166 977 --
NM_003042chr32209 82 11897 ----
NM_003043chr384274 3489 3426 1563 1263 1042 757 509 24306 495 ----
NM_003045chr1394914 4182 3376 3127 1716 1598 523 420 333 --24363 3328 --
NM_003047chr131010 573 24 ------
NM_003048chr242818 861 203 106 1554 11098 --
NM_003051chr121958 614 11751 1660 --
NM_003060chr551031 903 468 261 186 11150 ----
NM_003068chr8----1309 --
NM_003074chr351997 1518 1455 252 170 ------
NM_003076chr12----11156 --
NM_003088chr731063 864 286 ------
NM_003099chr1586520 6194 6067 5917 5782 3987 2144 66 --15721 16041
NM_003105chr11----185 --
NM_003107chr672605 2326 2094 1682 891 466 207 --12105 --
NM_003108chr296624 5993 5701 5037 4414 2069 2045 1140 1032 --22847 2150 --
NM_003111chr211053 11346 ----
NM_003112chr752375 989 580 50 37 1712 --1784
NM_003113chr21311 1875 ----
NM_003128chr252641 2611 2592 1048 36 2946 177 22715 2629 --
NM_003133chr12351 225 ------
NM_003137chr651802 1732 1530 836 482 --22103 271 1824
NM_003144chr622188 1466 --1575 --
NM_003150chr1751765 1658 1488 743 44 --3629 454 164 --
NM_003154chr42104 76 ------
NM_003161chr1763558 3485 3249 1390 1140 247 ----13047
NM_003162chr2122 1852 1252 --
NM_003173chrX5927 348 236 217 54 ------
NM_003178chr342232 2146 1724 590 ------
NM_003183chr21833 1642 ----
NM_003185chr2041199 999 225 48 ------
NM_003186chr111147 --195 --
NM_003189chr153071 2976 2885 1308 485 --23296 3213 --
NM_003194chr6----176 --
NM_003198chr1--1195 1273 --
NM_003199chr1875633 5039 4660 4371 3735 3480 2126 --11465 --
NM_003201chr102867 260 ------
NM_003203chr241918 687 385 159 22174 1782 ----
NM_003206chr6--1140 ----
NM_003211chr121286 ------
NM_003214chr62304 41 ------
NM_003216chr22103175 2937 2745 2452 1190 939 503 460 120 38 ------
NM_003217chr1261902 1749 1651 1580 582 197 ------
NM_003221chr6103870 3768 3536 3415 3391 3193 1500 1131 837 603 11663 12743 --
NM_003222chr203917 458 404 1117 ----
NM_003234chr331674 1500 121 ------
NM_003238chr11189 ------
NM_003242chr3122429 2047 917 905 816 809 788 779 608 573 368 224 ----1275
NM_003244chr18----1339 --
NM_003246chr1561970 1608 1457 616 264 218 --155 --
NM_003247chr621975 100 --11670 --
NM_003253chr2111542 --11241 --
NM_003255chr1752272 888 543 438 329 --22073 1967 --
NM_003257chr1561069 1050 1010 970 453 83 ------
NM_003262chr324322 3337 44361 1524 1182 976 11295 --
NM_003269chr611228 11103 ----
NM_003270chrX2254 35 ------
NM_003275chr9--1409 ----
NM_003281chr163506 1670 874 363 302 240 11824 1785 --
NM_003286chr2031104 834 125 ------
NM_003290chr193762 339 93 ------
NM_003291chr132596 253 ----1813
NM_003298chr3106029 5860 4680 4446 3974 1259 1043 767 458 431 15136 21302 421 11847
NM_003304chr321479 1361 1635 ----
NM_003305chr44363 347 279 109 ------
NM_003314chr5------1101
NM_003319chr241018 823 806 618 ------
NM_003334chrX1159 ------
NM_003336chrX51065 939 823 207 126 --11006 --
NM_003337chr531485 603 366 --11367 11068
NM_003338chr101779 21895 411 1260 --
NM_003339chr521490 108 --11580 --
NM_003340chr421199 107 ------
NM_003341chr3--1585 ----
NM_003342chr1733242 3105 321 22376 1084 13132 --
NM_003345chr163477 367 130 ------
NM_003348chr121120 ------
NM_003350chr81839 1372 1787 --
NM_003352chr22969 253 ------
NM_003358chr92151 145 ------
NM_003363chr33696 535 60 ------
NM_003369chr1162788 2521 579 555 273 65 12594 ----
NM_003373chr1031289 493 182 11789 ----
NM_003374chr5153 --1301 --
NM_003376chr6----1183 --
NM_003376chr6----1183 --
NM_003379chr64913 804 754 436 ------
NM_003383chr91122 --1392 --
NM_003387chr222351 171 --22937 896 --
NM_003390chr1121092 416 1430 ----
NM_003392chr344121 2930 1622 1017 14080 --24268 1334
NM_003400chr21197 --1757 --
NM_003403chr141703 --2804 41 --
NM_003404chr2031630 1254 655 12023 11300 --
NM_003405chr221591 ------
NM_003406chr851480 1389 514 432 210 11797 ----
NM_003407chr19--1657 ----
NM_003409chr1831318 242 23 --11101 --
NM_003410chrX92917 2073 2066 1967 887 740 648 315 306 --12283 --
NM_003411chrY61640 1580 1521 1347 611 136 ------
NM_003412chr352915 2837 2717 2477 2371 1956 --1991
NM_003413chrX21896 119 22018 386 ----
NM_003435chr191771 2190 81 1125 --
NM_003439chr7103223 3207 2765 2691 2588 2397 1241 1191 784 300 --23578 2277 --
NM_003442chr112158 45 ------
NM_003458chr363777 3118 992 380 295 217 ------
NM_003463chr631363 1340 617 32683 2350 500 ----
NM_003466chr232395 434 383 ----11920
NM_003467chr22469 398 ------
NM_003468chr243346 1442 301 89 ------
NM_003471chr342163 1661 654 302 ------
NM_003478chr1112541 1131 ----
NM_003482chr1251115 832 319 275 226 ------
NM_003483chr1242486 754 194 104 ------
NM_003489chr2183162 3005 2477 1260 1004 973 903 522 ----22641 1063
NM_003505chr731489 1362 464 11631 ----
NM_003506chr821272 101 --2947 485 --
NM_003507chr231640 1456 21 12028 11866 --
NM_003558chr91283 1512 ----
NM_003563chr1741280 974 578 319 ------
NM_003565chr1251651 1503 1483 1186 215 ----1482
NM_003566chr1242753 2294 486 195 --22873 930 21359 1039
NM_003567chr12441 54 ------
NM_003574chr1875442 4709 4214 3839 3689 1220 483 15064 23733 2320 14284
NM_003575chr751411 1216 1175 421 66 ------
NM_003576chr1352716 1120 1060 961 687 --22798 937 12339
NM_003581chr21319 1807 ----
NM_003583chr1273281 3271 2975 1119 1019 741 129 33951 3345 1295 12521 1533
NM_003589chr1331255 964 144 ------
NM_003590chr243406 571 562 217 12842 1393 13654
NM_003592chr71325 --1344 --
NM_003597chr221447 848 ----12154
NM_003601chr41157 ------
NM_003603chr461803 1608 1463 1421 60 46 ----11439
NM_003607chr163891 3626 3547 945 244 60 ------
NM_003615chr363788 1328 1185 1000 969 400 --12485 --
NM_003617chr1114814 4531 4187 3806 3156 3132 3104 1891 1064 668 565 14415 14044 --
NM_003618chr211181 ------
NM_003626chr1111019 ------
NM_003629chr153468 3005 2856 2231 613 13360 --12587
NM_003630chr62515 480 ----1163
NM_003631chr102945 21 ------
NM_003632chr171584 ----1578
NM_003633chr512237 11764 1147 --
NM_003637chr11415 ------
NM_003645chr151202 ------
NM_003651chr12----122 --
NM_003653chr172253 43 ------
NM_003663chr322738 756 23105 556 --12833
NM_003672chr121349 146 1117 11316 --
NM_003679chr182873 2802 2769 2496 2420 2397 2255 536 --1409 --
NM_003688chrX138 ------
NM_003701chr13----1943 --
NM_003705chr24327 320 304 277 --135 --
NM_003711chr5----178 --
NM_003713chr12697 313 ------
NM_003718chr73482 451 213 ------
NM_003722chr332476 429 170 1887 ----
NM_003728chr41105 1173 1222 --
NM_003735chr531279 320 165 ------
NM_003736chr531279 320 165 ------
NM_003740chr63537 222 27 ------
NM_003743chr272165 2043 1908 1661 1621 1498 1460 ----12025
NM_003749chr134877 812 606 398 12162 ----
NM_003754chr111138 ------
NM_003758chr1531187 434 27 ------
NM_003758chr1531187 434 27 ------
NM_003759chr453664 3069 1205 476 333 --24088 4024 --
NM_003763chr2053115 2589 2540 1975 480 --11127 --
NM_003766chr171495 1141 ----
NM_003772chr113879 265 243 2863 398 1333 --
NM_003774chr1241317 1075 781 383 ----12569
NM_003779chr1--122 ----
NM_003780chr11168 ------
NM_003783chr111048 --11210 --
NM_003787chr1821630 389 --21450 596 --
NM_003794chr3----1959 --
NM_003796chr19------1444
NM_003800chr631979 1973 243 1216 ----
NM_003816chr8--21092 376 ----
NM_003822chr12513 473 1741 ----
NM_003825chr1521500 65 11007 ----
NM_003831chr1811335 1204 ----
NM_003838chr151602 365 318 301 25 --11562 --
NM_003840chr882081 1935 1922 1885 1543 834 162 41 1733 1305 --
NM_003842chr872209 1926 1780 1730 701 177 43 --1293 --
NM_003846chr13630 610 301 --1706 --
NM_003858chr141682 --194 --
NM_003861chr1421114 683 --22507 1048 --
NM_003872chr242615 2396 752 483 ------
NM_003884chr331603 1225 641 --1126 --
NM_003887chr241700 1671 1511 470 ------
NM_003888chr1521672 1331 1205 ----
NM_003895chr2111495 --1759 --
NM_003897chr64627 613 541 63 ------
NM_003899chr1342501 2278 1743 115 --12330 --
NM_003901chr1052624 2437 2159 1822 1002 12400 ----
NM_003902chr11317 ------
NM_003908chr2021222 1030 ------
NM_003913chr663947 1674 1634 1575 1103 282 13617 1747 13485
NM_003924chr41243 ------
NM_003927chr182991 301 ------
NM_003934chr9----11318 --
NM_003936chr251228 937 899 780 470 1478 ----
NM_003939chr1073664 3325 3300 3208 1664 506 302 11099 1986 --
NM_003941chr71371 --1928 --
NM_003945chr52497 92 --1197 --
NM_003947chr321354 1244 ------
NM_003949chr1751993 1972 1924 240 184 --21596 613 --
NM_003953chr142888 1961 1103 951 ------
NM_003958chr643890 1473 715 508 --22874 2778 --
NM_003966chr5137688 7630 7170 6716 6213 5461 4954 4800 2810 2801 2019 623 550 26322 735 46678 5711 1295 386 --
NM_003971chr171527 ------
NM_003972chr102945 319 ------
NM_003980chr651067 1047 1031 412 386 --11101 --
NM_003983chr1684248 3731 2712 1188 1114 890 785 737 1748 14391 --
NM_003993chr11281 --129 --
NM_003994chr122808 120 13616 ----
NM_004024chr12456 126 --1565 --
NM_004028chr1873908 3676 1552 887 699 508 261 22955 1383 14119 --
NM_004034chr102505 467 --1543 --
NM_004035chr17124975 4872 4447 4014 3653 3271 1867 1675 1542 1185 796 41 33963 3811 1150 11742 --
NM_004037chr11864 --138 --
NM_004040chr221172 121 ------
NM_004047chr13248 217 33 ------
NM_004050chr141777 ------
NM_004056chr811008 --197 --
NM_004061chr52571 557 ------
NM_004067chr72272 211 --1506 --
NM_004073chr11232 ------
NM_004077chr1261229 1093 953 874 841 357 ------
NM_004079chr122704 875 --22416 45 --
NM_004081chrY21305 489 ------
NM_004089chrX31197 1190 379 11208 ----
NM_004090chr1752817 2193 410 154 116 ------
NM_004093chr1352816 2141 2069 2038 532 --1831 --
NM_004094chr1432214 1908 200 --32926 2542 2088 --
NM_004096chr1061501 1441 804 692 557 53 ------
NM_004098chr101505 ------
NM_004100chr632028 1986 1660 22551 217 ----
NM_004102chr11423 1395 ----
NM_004103chr83126 113 53 ------
NM_004105chr22911 94 157 ----
NM_004107chr19180 ------
NM_004112chr1741634 1166 458 451 11429 ----
NM_004113chr321650 469 11728 ----
NM_004116chr23406 394 312 ------
NM_004117chr642123 2112 1482 353 --12208 --
NM_004124chr1442515 2376 748 167 32791 1101 734 12720 1643
NM_004134chr52629 609 --1700 --
NM_004136chr1553119 2904 2377 2335 23 22289 795 ----
NM_004157chr33890 872 197 ------
NM_004161chr21403 --1987 --
NM_004170chr931408 454 433 ------
NM_004171chr1199522 9379 8716 7308 6608 6539 6024 1724 430 26562 3303 28341 8064 --
NM_004176chr17143 ------
NM_004187chrX21412 1004 ------
NM_004193chr10----1356 --
NM_004199chr54320 270 250 61 ------
NM_004200chr1172948 2840 2273 2154 880 870 361 163 12165 --
NM_004203chr16----125 --
NM_004205chr111516 ------
NM_004209chr162835 197 --11168 --
NM_004210chr1052136 1711 1391 569 34 --2388 362 --
NM_004226chr2----1109 --
NM_004229chrX51452 666 597 175 149 22056 580 1736 --
NM_004232chr1853719 3035 1459 673 593 11559 229 22 --
NM_004236chr151506 ------
NM_004240chr191225 ----179
NM_004242chr61352 ------
NM_004261chr1161 2887 38 ----
NM_004268chr1121032 355 1160 1144 --
NM_004274chr1432117 2097 1056 12186 11298 --
NM_004277chr64472 279 273 60 ----1142
NM_004279chr742384 1830 742 329 ------
NM_004293chr963143 3085 2494 2380 576 51 23721 1449 22354 95 --
NM_004301chr3283 25 2355 40 ----
NM_004302chr1262717 2163 742 647 298 187 12856 ----
NM_004311chr1022378 2133 ------
NM_004321chr263551 3188 3004 2176 1249 520 --1563 --
NM_004330chr151394 1262 21174 304 1972
NM_004331chr831732 1032 596 11986 12635 --
NM_004338chr1876345 5594 5461 4918 4904 2644 2634 25307 1048 15289 --
NM_004342chr71464 ----1417
NM_004349chr81920 ------
NM_004354chr42283 121 ----1229
NM_004356chr114470 448 388 169 ------
NM_004365chr51293 145 --1126
NM_004370chr63818 642 560 ------
NM_004371chr121327 425 --2306 80 --
NM_004380chr1642216 1679 1614 67 11842 ----
NM_004381chr61134 ------
NM_004392chr1362431 1843 1703 1632 1031 1000 ------
NM_004393chr321500 928 --11825 --
NM_004397chr1193844 3775 3609 3429 1417 903 491 185 93 12969 23220 1265 --
NM_004399chr125801 661 621 362 346 ------
NM_004414chr212620 581 ------
NM_004415chr6129 2190 57 ----
NM_004419chr103760 292 279 1412 ----
NM_004423chr352228 1851 663 166 93 --11736 --
NM_004426chr121771 --1589 1251
NM_004429chrX3949 335 99 --21209 1154 --
NM_004430chr841847 480 285 26 11832 1204 12535
NM_004432chr932277 1723 658 12256 22048 611 --
NM_004434chr142769 189 21913 137 ----
NM_004438chr242695 2544 1056 271 --176 158
NM_004439chr4----144 --
NM_004440chr62263 139 --2782 521 --
NM_004441chr321233 1215 11283 ----
NM_004443chr31480 ------
NM_004444chr71304 --2226 103 --
NM_004446chr1139 ------
NM_004448chr171585 ------
NM_004450chr141102 ------
NM_004454chr322115 722 1490 11473 11700
NM_004459chr1711878 ------
NM_004463chrX1159 --1119 --
NM_004464chr41440 13763 23844 584 --
NM_004472chr51665 --1172 --
NM_004481chr152123 1952 953 895 666 ------
NM_004482chr21648 --1708 --
NM_004485chr184359 3376 3194 3150 2822 2785 1733 1541 --14374 --
NM_004491chr19104239 3022 2991 1737 1569 1397 1130 543 451 122 --11236 11523
NM_004492chr152171 32 ------
NM_004498chr152332 252 ------
NM_004499chr52361 350 --1434 1119
NM_004501chr153572 3151 1337 898 320 11542 13381 --
NM_004504chr252821 1044 705 386 182 22914 1146 ----
NM_004505chr1721962 1817 21595 1313 --1747
NM_004506chr6----1133 --
NM_004516chr1931048 378 314 ------
NM_004520chr51554 1684 ----
NM_004521chr10------1328
NM_004525chr231313 475 39 ------
NM_004527chr1741480 478 113 71 ------
NM_004529chr951452 1411 1120 1058 549 ------
NM_004537chr1231351 224 46 ------
NM_004560chr93685 409 68 ------
NM_004566chr1051594 946 850 788 625 --2814 489 --
NM_004571chr2173303 3017 2500 2475 1219 578 282 --23235 104 12827
NM_004575chr43616 399 77 ----11385
NM_004578chr14915 691 248 85 --1737 --
NM_004583chr172222 78 --1180 --
NM_004586chrX74724 4369 4145 1637 1315 874 394 14104 35213 4450 3462 --
NM_004594chr163928 837 210 --1947 --
NM_004596chr191170 ------
NM_004598chr543032 2720 2456 935 32888 2532 2086 ----
NM_004606chrX160 1124 ----
NM_004612chr953448 3238 1324 327 242 ------
NM_004615chrX1177 --1668 --
NM_004622chr232106 298 156 12307 ----
NM_004626chr111540 ------
NM_004631chr11229 ----1326
NM_004635chr32764 352 --1253 --
NM_004637chr321281 1094 ------
NM_004642chr122595 32 --1686 --
NM_004643chr141658 ------
NM_004651chrX----1356 --
NM_004654chrY21085 437 ------
NM_004655chr1731155 1149 1003 --1988 --
NM_004660chrY31828 1423 638 1556 ----
NM_004663chr1521264 87 --21113 600 --
NM_004673chr121541 1112 11462 ----
NM_004681chrY--1180 ----
NM_004684chr41352 ------
NM_004686chr841638 673 421 326 1558 ----
NM_004687chr1791835 1577 1454 1286 847 467 397 202 118 ------
NM_004694chr171103 ------
NM_004703chr1722370 50 22198 1922 32257 720 32 11816
NM_004717chr711500 ------
NM_004721chr32304 119 ------
NM_004726chrX85275 5252 4612 4089 3556 2076 1308 151 14047 --12209
NM_004730chr52235 180 11448 1576 11806
NM_004731chr1221731 1248 --11423 --
NM_004734chr1333013 2336 424 --11253 --
NM_004736chr141862 1740 489 27 --2520 80 --
NM_004742chr31618 11770 11317 --
NM_004745chr876446 6103 6065 5463 4641 1561 694 --11548 25976 1574
NM_004748chr1574081 4026 3262 613 555 327 170 1283 13162 --
NM_004755chr141357 --21139 36 1755
NM_004756chr1921187 346 --11068 --
NM_004760chr782428 1584 1541 850 777 735 432 308 --1245 --
NM_004762chr1761800 1582 1507 757 535 61 --11621 --
NM_004768chr121097 282 --1962 --
NM_004772chr551467 1347 1042 1016 386 11244 ----
NM_004774chr1732250 1231 766 ------
NM_004775chr1831852 825 418 --1919 --
NM_004776chr2073257 2709 2701 2280 775 523 168 ------
NM_004779chr541163 537 288 108 ------
NM_004781chr121735 1605 ------
NM_004781chr121735 1605 ------
NM_004786chr181193 ------
NM_004788chr111534 1901 ----
NM_004798chr2093685 3545 3408 971 816 575 427 214 201 2795 412 12976 --
NM_004799chr1------172
NM_004805chr241017 1001 317 56 ------
NM_004808chr1033310 3060 2387 1470 22940 750 --
NM_004815chr174811 4365 4322 4094 3448 1968 662 14088 1485 --
NM_004818chr122625 32 ------
NM_004822chr1743726 1599 1321 1108 --22616 65 --
NM_004824chr621379 1365 11039 ----
NM_004831chr1981070 1003 808 418 392 335 326 34 ------
NM_004840chrX32051 793 476 --143 --
NM_004841chr151129 856 850 420 288 ------
NM_004844chr3--1404 ----
NM_004850chr241274 631 583 332 1527 21544 419 --
NM_004856chr152568 88 ----1464
NM_004857chr1443418 1861 1184 310 13915 1669 13500
NM_004859chr1732336 2287 2220 12885 ----
NM_004865chr6--1289 140 --
NM_004866chr594974 4254 3049 1854 1470 1099 1087 538 28 23659 3489 24132 41 --
NM_004871chr1753724 1256 919 840 800 24139 3127 24291 4025 --
NM_004872chr1--1332 ----
NM_004879chr112329 295 ------
NM_004884chr153656 619 453 ------
NM_004887chr51451 --1165 --
NM_004888chr93385 198 136 11018 1977 --
NM_004896chr1041384 1224 571 493 --11317 --
NM_004898chr442914 2621 2214 728 11067 21075 646 --
NM_004902chr202130 56 ------
NM_004904chr796356 5993 5586 5231 5050 2600 623 561 498 26276 430 11253 14684
NM_004915chr212669 564 ------
NM_004921chr14969 718 632 364 ------
NM_004922chr101141 --11031 --
NM_004925chr9--1794 --1185
NM_004926chr1431375 569 139 --1513 --
NM_004930chr1--1687 ----
NM_004932chr531541 1522 166 ------
NM_004936chr942886 2003 1203 403 --1712 --
NM_004945chr19----1232 --
NM_004952chr11812 --1300 --
NM_004956chr754273 3889 1559 885 736 ----1177
NM_004961chrX31250 1144 472 --11096 --
NM_004969chr102511 71 181 ----
NM_004972chr91399 11190 1407 --
NM_004973chr621485 652 ------
NM_004975chr203972 615 216 1290 ----
NM_004976chr1175106 5013 4132 3186 2034 908 633 ----14250
NM_004980chr12221 175 ------
NM_004984chr12----133 --
NM_004985chr1253273 3150 1818 1722 1374 23836 135 ----
NM_004991chr3192 ------
NM_004992chrX158475 8272 8202 8033 7403 7236 6265 5869 5196 3123 2288 1985 1781 633 319 12947 1248 12105
NM_004992chrX158475 8272 8202 8033 7403 7236 6265 5869 5196 3123 2288 1985 1781 633 319 12947 1248 12105
NM_004995chr141315 1393 1192 --
NM_004996chr1631308 1093 625 --21628 1497 --
NM_005010chr731704 1666 55 ------
NM_005012chr1----1121 --
NM_005016chr12--1130 ----
NM_005017chr3146 ----1211
NM_005025chr31233 ------
NM_005026chr192018 1684 1657 1551 546 510 366 239 97 ------
NM_005027chr192749 366 ------
NM_005028chr1031861 127 97 --12219 --
NM_005036chr22127756 7099 7031 6995 6980 6208 5523 5479 1738 1707 1607 24 21188 103 46874 1975 626 422 --
NM_005044chrX53521 617 130 119 66 11143 1827 --
NM_005045chr72884 151 ------
NM_005054chr231598 1490 1119 11100 11340 --
NM_005056chr1264947 4745 3974 3429 1329 700 1885 15085 --
NM_005058chrY--1244 ----
NM_005063chr1053009 2947 2744 2584 973 1246 ----
NM_005065chr1454837 1970 1598 968 366 14327 14078 --
NM_005066chr1----1261 --
NM_005069chr2151717 1326 1264 366 269 --1719 --
NM_005077chr93363 336 315 --1420 --
NM_005079chr853159 3082 2041 1211 62 23103 2488 ----
NM_005080chr223334 228 98 ------
NM_005087chr31593 --1107 --
NM_005095chr132201 1709 227 ------
NM_005096chrX51179 1025 1009 854 26 ------
NM_005109chr342255 1966 489 406 11819 11783 --
NM_005112chr44988 975 855 223 ------
NM_005116chr2064351 4177 3584 2896 1568 140 24267 4206 1681 --
NM_005117chr113886 779 49 1764 ----
NM_005121chr1773510 3014 2733 2614 2586 818 433 23628 2802 ----
NM_005126chr331481 225 194 11839 ----
NM_005135chr1553637 3393 2762 1023 152 1432 21393 924 13215
NM_005140chrX1781 ------
NM_005151chr18--12432 1598 --
NM_005156chr954237 1780 1772 1697 1374 ------
NM_005157chr921479 1327 --31801 197 107 --
NM_005159chr1552140 1509 84 74 25 ------
NM_005163chr141774 ------
NM_005168chr241232 372 287 140 --11482 --
NM_005171chr1221117 379 --11006 --
NM_005182chr162453 39 ------
NM_005184chr1921086 1007 1364 ----
NM_005188chr1187268 7068 5796 2249 1768 1619 600 66 27849 6843 11287 --
NM_005189chr1762386 2166 1782 437 280 219 12372 ----
NM_005191chr32558 105 ------
NM_005194chr202570 117 ------
NM_005197chr14126153 5383 5159 4918 4697 4481 2450 2159 2058 1690 551 381 1651 25198 4266 --
NM_005201chr321037 296 ------
NM_005203chr10172 ----1102
NM_005204chr10----1292 --
NM_005206chr17----11220 --
NM_005207chr22113365 3079 2466 2453 2353 1210 1171 864 819 642 412 --11037 --
NM_005210chr2121 ------
NM_005214chr21222 1358 ----
NM_005220chr1751479 559 409 313 57 ------
NM_005222chr75845 303 267 251 227 ------
NM_005225chr202946 41 --2986 393 --
NM_005229chrX1350 ------
NM_005230chr12----1119 --
NM_005233chr31967 1493 ----
NM_005235chr2157736 7523 7293 7103 6285 5624 5603 5412 5240 2655 1522 1303 1087 638 312 56977 6920 6895 5927 2904 ----
NM_005238chr1142967 2857 2431 119 12327 ----
NM_005241chr3--1312 1294 --
NM_005248chr11540 ------
NM_005249chr141698 ------
NM_005252chr142703 82 ------
NM_005254chr1511182 11410 --1900
NM_005257chr1821314 389 1974 11305 --
NM_005271chr101837 ------
NM_005276chr1271530 1449 1312 680 158 116 68 --11703 --
NM_005276chr1271530 1449 1312 680 158 116 68 --11703 --
NM_005277chr471788 1274 1206 758 478 342 161 ------
NM_005281chr1--1331 ----
NM_005284chr6------2357 178
NM_005311chr752581 1049 394 278 97 --12614 --
NM_005312chr932138 896 531 21737 607 22656 2577 --
NM_005313chr153932 451 22 ------
NM_005328chr81710 141 1243 --
NM_005329chr1652358 932 504 352 253 ------
NM_005334chrX51665 1611 1085 661 99 ------
NM_005339chr474249 3726 3358 3254 1162 1028 627 1403 ----
NM_005342chrX22674 2106 1605 1282 --
NM_005348chr142938 385 1171 ----
NM_005349chr43497 461 431 ------
NM_005358chr13----1245 --
NM_005359chr1865324 4480 2553 2325 1948 89 15502 21392 1363 --
NM_005370chr1911292 11323 ----
NM_005375chr62898 386 ------
NM_005376chr1------2866 196
NM_005378chr23690 284 34 --1865 1856
NM_005380chr11855 --1414 11080
NM_005386chr205876 694 680 123 53 ------
NM_005387chr111150 ------
NM_005392chr91713 1273 11407 --
NM_005398chr1021145 1040 11463 11103 --
NM_005399chr1123089 2776 2763 1750 1553 1399 1196 872 733 665 397 41 --13885 --
NM_005400chr242169 1918 1029 723 ------
NM_005402chr731586 1292 438 ------
NM_005406chr181360 ------
NM_005417chr20----11483 --
NM_005430chr121100 --1945 --
NM_005433chr1832678 2579 151 11920 1965 --
NM_005435chr71567 ------
NM_005436chr1022520 1158 11205 1653 --
NM_005445chr101294 ------
NM_005455chr111610 1126 ----
NM_005458chr91178 ----1897
NM_005460chr52579 87 ------
NM_005465chr151629 1427 336 145 33 --2791 101 --
NM_005475chr1233179 2493 1032 ------
NM_005476chr92163 138 --1433 --
NM_005477chr1522559 702 1684 --1988
NM_005477chr1522559 702 1684 --1988
NM_005479chr104509 440 414 234 ------
NM_005483chr19----190 --
NM_005487chr2231415 686 334 --11975 --
NM_005493chr62778 197 ------
NM_005494chr71114 --1241 --
NM_005497chr1775503 4467 4377 4200 2460 2083 2005 12025 25161 4259 --
NM_005499chr191658 ------
NM_005502chr972869 2508 2395 2375 938 550 308 --12565 13086
NM_005504chr1254450 4366 2437 2180 2027 45532 5025 848 218 1776 --
NM_005507chr11130 ------
NM_005509chr531593 481 307 1625 11214 --
NM_005520chr5153 ------
NM_005521chr102793 227 ------
NM_005522chr73352 196 35 ------
NM_005523chr711593 ------
NM_005537chr131703 ------
NM_005561chr132132 84 --1795 --
NM_005563chr1----1245 --
NM_005570chr1811074 1480 ----
NM_005573chr51189 ------
NM_005574chr111625 --384 62 21 --
NM_005575chr53809 712 163 ------
NM_005578chr333344 1213 307 44339 3933 894 796 ----
NM_005587chr152272 190 ------
NM_005591chr1151124 1008 776 476 159 ------
NM_005593chr121135 1144 ----
NM_005595chr12657 301 ------
NM_005596chr994550 3964 2521 2433 2092 1798 1676 1080 256 140 14929 --
NM_005598chr141356 619 182 95 --11289 --
NM_005604chr621710 734 ------
NM_005607chr83746 169 101 2367 350 ----
NM_005613chr12816 573 1845 21694 879 12207
NM_005614chr71970 ------
NM_005618chr61527 ------
NM_005625chr83813 338 165 11041 1399 --
NM_005626chr11428 ------
NM_005632chr16------160
NM_005638chrX41397 1296 1176 126 1408 ----
NM_005639chr1231763 1206 684 1504 ----
NM_005647chrX43410 3346 2224 525 --53103 1295 1277 904 864 --
NM_005650chr221167 --11272 --
NM_005655chr821073 469 --2918 812 --
NM_005665chr174406 3958 3858 1129 797 623 476 13593 ----
NM_005667chr21371 ------
NM_005668chr564097 3023 1293 903 801 30 14144 14370 --
NM_005688chr321314 150 11294 1950 --
NM_005711chr5--11063 ----
NM_005715chr632573 1947 1001 --3800 718 247 --
NM_005717chr1195 ------
NM_005722chr221830 1751 1298 --1504
NM_005734chr112614 152 ------
NM_005736chr10--146 ----
NM_005737chr252624 2250 785 489 439 --12290 --
NM_005738chr731666 606 347 --21403 786 --
NM_005746chr732239 1854 785 ------
NM_005748chr1222318 278 12643 12709 --
NM_005749chr171639 1471 ----
NM_005751chr7----1345 --
NM_005754chr52911 487 ------
NM_005756chrX2304 60 ------
NM_005759chr294743 4289 4166 3673 3624 3471 3307 568 122 13130 11807 --
NM_005761chr121113 ------
NM_005768chr122675 666 ------
NM_005776chr141271 ------
NM_005779chr52928 390 ----11397
NM_005780chr13176 ------
NM_005781chr32776 203 ------
NM_005783chr21599 ------
NM_005786chr1821116 1110 --1971 --
NM_005795chr242446 2150 747 470 1726 ----
NM_005797chr1141224 724 557 395 --11750 --
NM_005802chr9--1607 1205 --
NM_005808chr322778 463 1729 --12349
NM_005813chr23830 686 583 21751 274 ----
NM_005819chr173334 3238 3145 2814 2645 1369 1358 --22602 357 --
NM_005826chr12535 93 ------
NM_005828chr17104944 4459 4397 3887 3109 863 719 686 412 200 --24148 572 --
NM_005832chr321224 562 --11291 --
NM_005836chr8--167 ----
NM_005840chrX137498 5697 5069 4644 2819 2586 2139 2077 1880 1586 1515 1500 69 16716 ----
NM_005841chr46781 729 211 199 110 22 ------
NM_005842chr13------1677
NM_005843chr21616 1522 --11810
NM_005848chr15163 ------
NM_005851chr113345 299 289 ------
NM_005852chr1741063 928 193 90 --1271 --
NM_005859chr5--1222 --11427
NM_005862chr321026 89 ------
NM_005871chr103294 259 48 ------
NM_005880chr164599 395 223 189 11602 ----
NM_005885chr52394 272 1316 ----
NM_005895chr1273452 3231 3224 1413 1391 996 371 --1458 --
NM_005897chr131106 919 785 --2979 178 --
NM_005898chr1163162 3154 2620 1256 764 223 --22697 687 --
NM_005899chr17--1195 ----
NM_005900chr41172 ----1354
NM_005901chr18118636 8629 7301 6840 3470 3215 3033 2610 2376 433 118 27614 3308 1143 11514
NM_005902chr15124538 4434 4348 3833 3020 1471 1271 1232 1134 717 394 225 --22863 1796 --
NM_005903chr553704 3592 3480 3351 1967 --31332 942 854 --
NM_005904chr181512 --11372 --
NM_005906chr641693 1499 1382 390 ------
NM_005907chr621646 1308 150 ----
NM_005909chr594078 3912 3517 2922 2708 1289 1143 981 69 1679 12826 --
NM_005910chr17123989 3785 3704 3438 2991 2648 2590 1283 1074 977 806 206 24050 3301 ----
NM_005911chr211506 ------
NM_005920chr143290 2752 1264 292 --13315 --
NM_005923chr6------1105
NM_005924chr71884 ------
NM_005930chr142585 85 ------
NM_005933chr1152609 1998 1861 672 561 11187 ----
NM_005934chr1922444 396 --22327 143 --
NM_005935chr465265 4562 3349 2087 1533 560 --23918 3555 13600
NM_005937chr1764154 3856 3796 1318 366 81 23294 448 ----
NM_005941chr824179 4115 1833 ----
NM_005944chr31495 1344 ----
NM_005955chr164835 3980 3717 1683 260 122 --14054 13587
NM_005962chr1021734 943 11697 ----
NM_005962chr1021734 943 11697 ----
NM_005964chr1751519 1226 996 478 240 ------
NM_005966chr212397 12335 12023 --
NM_005967chr122662 261 ------
NM_005968chr19----1214 --
NM_005977chr13----1281 --
NM_005985chr201560 ------
NM_005994chr172897 740 ------
NM_006005chr4------1309
NM_006007chr953936 3118 3079 2902 824 --21697 871 11371
NM_006011chr1574205 4167 3068 1589 1207 1103 275 --14154 14144
NM_006016chr621749 1474 22207 2197 --1627
NM_006035chr1431210 1127 107 ------
NM_006037chr284837 4370 3955 3371 1681 1490 1020 471 14259 --13176
NM_006038chr2052014 1812 358 222 105 ----12087
NM_006040chr1631290 424 219 1904 1467 --
NM_006042chr172477 399 1153 ----
NM_006047chr201850 33350 2228 2198 1518 --
NM_006054chr1131615 1063 448 21305 255 ----
NM_006055chr233040 2722 550 --11159 --
NM_006076chr742053 1037 1014 479 ----1592
NM_006079chr64588 297 177 91 ------
NM_006080chr7--1237 ----
NM_006084chr14------1312
NM_006094chr862423 2376 1925 1741 927 344 21776 977 ----
NM_006095chr41471 --1706 --
NM_006099chr11357 --1780 --
NM_006106chr1143438 3351 3147 1332 1892 ----
NM_006113chr152123 1968 774 548 365 ------
NM_006116chr2251608 1484 585 508 187 --11144 --
NM_006134chr2131545 1112 290 --21371 362 --
NM_006135chr12526 401 ------
NM_006136chr721256 460 ------
NM_006139chr232200 2192 972 1796 1861 --
NM_006141chr1632408 2061 306 --32499 1981 620 --
NM_006148chr1712824 --12668 --
NM_006154chr154893 787 637 174 12906 --1545
NM_006159chr122652 579 ------
NM_006161chr5----1247 --
NM_006162chr1811450 11221 ----
NM_006166chr1282428 2096 1939 1772 1750 1638 893 468 --12069 --
NM_006177chr142825 760 --197 --
NM_006180chr931943 1833 66 21964 1878 1777 --
NM_006182chr11177 ------
NM_006186chr2--1432 11070 --
NM_006191chr121917 1727 ----
NM_006194chr142941 52 1882 ----
NM_006195chr911046 11151 1969 1213
NM_006202chr1931936 1551 373 1698 ----
NM_006203chr565496 5146 4540 4137 1967 208 ----1755
NM_006206chr41219 168 12763 --
NM_006216chr2----171 --
NM_006224chr1782480 2458 2211 1671 1660 1637 1613 264 11946 124 --
NM_006226chr221144 404 133 ----
NM_006241chr332277 2250 859 ------
NM_006243chr11969 ------
NM_006245chr62141 106 --1881 --
NM_006246chr143516 499 108 ------
NM_006251chr543192 2485 2059 524 --13131 --
NM_006252chr1107296 7192 6425 6400 6293 3007 2989 1766 1466 788 32096 1946 170 14896 --
NM_006256chr151922 1710 1034 887 316 1351 22586 2207 --
NM_006258chr1021359 591 --1349 --
NM_006264chr41571 1591 ----
NM_006265chr821213 170 ------
NM_006266chr92324 42 --177 --
NM_006267chr21147 --1576 --
NM_006275chr2052481 2368 1002 836 39 ------
NM_006277chr21176 --1701 --
NM_006278chr111371 ------
NM_006282chr2094339 3619 3320 1825 1569 1516 421 174 86 --23389 114 --
NM_006283chr834412 1126 313 --14118 --
NM_006292chr11----1174 --
NM_006298chr692956 2086 1280 1087 1056 966 710 675 646 22188 1163 ----
NM_006312chr123692 344 124 ------
NM_006313chr1241670 1133 606 33 ------
NM_006317chr53704 334 263 ------
NM_006321chr341764 899 713 174 ------
NM_006335chr11863 --1138 --
NM_006345chr42523 324 ------
NM_006350chr51130 ------
NM_006352chr111508 11598 --1135
NM_006357chr23496 441 434 --143 --
NM_006359chrX42012 1829 1544 752 11861 12219 --
NM_006364chr1451029 1023 478 465 356 ------
NM_006366chr63484 398 330 ------
NM_006367chr12863 88 --1696 --
NM_006369chr12407 111 ------
NM_006375chrX31651 534 164 ------
NM_006377chr91916 1347 11227 --
NM_006379chr762189 1997 1824 738 722 258 ------
NM_006380chr1743268 643 529 28 --11620 --
NM_006386chr2282454 1924 1655 1635 764 756 442 83 11696 ----
NM_006389chr111184 ------
NM_006393chr1053311 2793 1803 625 362 33819 1714 962 13120 --
NM_006416chr61695 ------
NM_006420chr2011123 --22669 104 12624
NM_006449chr211379 ------
NM_006451chr541038 837 825 729 1683 ----
NM_006454chr442037 1938 674 525 22724 1020 ----
NM_006457chr433267 679 339 1277 33326 1174 560 12924
NM_006459chr1041998 1860 814 437 11495 1566 --
NM_006464chr253745 3417 1675 1388 228 --1235 --
NM_006467chr53715 456 147 2611 170 --1417
NM_006469chr1--11435 --11254
NM_006471chr18142 ------
NM_006472chr131171 515 69 2843 114 11199 1803
NM_006475chr131245 1229 ----
NM_006476chr113642 567 505 --1696 --
NM_006482chr1273281 3271 2975 1119 1019 741 129 33951 3345 1295 12521 1533
NM_006489chr1431370 1269 600 ------
NM_006496chr141886 1606 476 57 ------
NM_006504chr1082648 2471 2315 2187 2020 1860 1102 294 --22040 402 --
NM_006513chr11222 ------
NM_006517chrX31548 776 711 11601 ----
NM_006519chr6----1109 --
NM_006520chrX1305 ------
NM_006526chr202692 395 --21655 711 --
NM_006527chr4290 84 ------
NM_006529chr411531 ------
NM_006534chr2062873 2859 2706 1016 317 94 --11302 1721
NM_006536chr13960 953 192 ------
NM_006537chr15----196 --
NM_006538chr273024 2718 1217 738 694 320 163 14130 1675 --
NM_006540chr811587 1248 ----
NM_006541chr101202 ------
NM_006544chr1465794 4876 4249 4028 3891 158 2753 98 15371 --
NM_006546chr1796066 5672 5559 5168 5110 2170 1101 722 693 --34781 4056 248 24794 1465
NM_006547chr722119 272 ------
NM_006548chr3----11333 --
NM_006557chr92375 306 11727 ----
NM_006559chr111093 1145 1286 --
NM_006561chr10206021 5672 5641 5531 4966 4402 4178 4124 2382 2116 1965 1946 1841 1772 1537 1334 675 608 578 51 --12153 --
NM_006565chr1611097 ----161
NM_006571chr8--1111 ----
NM_006575chr1421192 423 ------
NM_006584chr17--151 ----
NM_006591chr1121796 205 ------
NM_006595chr1152019 1802 809 333 187 ------
NM_006597chr11------1177
NM_006599chr1698173 7841 7159 5710 5447 5319 3221 2510 196 67422 7265 6348 5882 947 886 1936 26896 5820
NM_006601chr12--1433 11062 --
NM_006603chrX11981 ------
NM_006609chr242544 1090 963 54 --22309 71 1272
NM_006614chr363541 2252 1275 843 680 184 12782 --13477
NM_006618chr151605 1452 518 478 196 --1303 --
NM_006621chr131706 1490 436 1367 1331 1306
NM_006624chr1051567 798 738 413 121 ------
NM_006625chr11473 ------
NM_006625chr11473 ------
NM_006625chr11473 ------
NM_006626chr91753 2432 212 12336 --
NM_006628chr1584504 3981 3912 2872 1815 706 650 399 34257 1646 330 11856 --
NM_006629chr1882203 2078 2027 1792 1779 1739 400 104 ------
NM_006631chr193634 622 257 ------
NM_006633chr51544 ------
NM_006644chr131649 1677 ----
NM_006646chr1353074 2945 1173 1060 255 --2992 100 22142 981
NM_006654chr1264770 3372 3328 3074 530 310 1730 2137 30 11222
NM_006667chrX1109 ------
NM_006670chr63506 417 81 ------
NM_006675chr1283156 2949 1135 727 473 425 334 228 1495 13336 --
NM_006682chr7--12226 22253 362 165
NM_006690chr20------11766
NM_006695chr17173 --145 --
NM_006696chr51110 ------
NM_006698chr202503 475 --1123 --
NM_006699chr132305 550 449 42636 2089 1684 912 1350 --
NM_006703chr61461 ------
NM_006706chr53740 154 28 ------
NM_006710chr24746 675 102 29 ------
NM_006711chr163758 328 62 ------
NM_006717chr923238 782 --1670 --
NM_006720chr1084262 3776 3505 3343 1663 1430 796 490 21586 260 ----
NM_006722chr3----12330 1991
NM_006726chr441198 912 334 49 ------
NM_006729chrX105584 5357 5333 5143 4867 4194 3798 2013 1064 657 11190 23830 465 --
NM_006731chr9105779 5257 4942 4604 3877 3780 2336 2328 2079 753 12266 25524 5369 --
NM_006732chr1922077 344 ------
NM_006734chr621167 631 11287 ----
NM_006735chr71295 ------
NM_006738chr1564233 4208 3224 3054 1311 878 --14005 12951
NM_006745chr41143 --11092 --
NM_006746chrX21138 1012 --11360 --
NM_006749chr831059 872 182 ------
NM_006750chr16118088 7474 7103 6968 5889 3157 2947 2925 984 179 165 26806 611 ----
NM_006751chr2--1251 183 --
NM_006754chr721200 62 1296 ----
NM_006755chr111164 ------
NM_006756chr831491 580 206 1300 ----
NM_006759chr21295 1218 ----
NM_006763chr132131 1781 1318 21956 1503 11865 --
NM_006764chr31342 198 ----
NM_006765chr8127 ------
NM_006766chr862644 2342 2201 1912 1793 492 11745 ----
NM_006769chr12262 89 --1129 --
NM_006772chr61370 ------
NM_006775chr672980 2077 2053 2007 288 122 85 ------
NM_006777chrX1676 2670 344 --1373
NM_006783chr131238 ------
NM_006788chr1861797 1751 766 532 471 399 11490 --154
NM_006793chr101216 --124 --
NM_006802chr11326 --1127 --
NM_006806chr21----1317 1174
NM_006807chr1721259 338 11139 1242 --
NM_006815chr1231233 155 53 11281 ----
NM_006823chr81322 --11171 --
NM_006825chr12----1611 --
NM_006826chr21514 ------
NM_006827chr1432787 34 28 ------
NM_006838chr1251375 1312 608 367 28 ----11869
NM_006846chr5161 ------
NM_006851chr1262747 2266 2105 1951 643 176 1873 22947 1888 --
NM_006852chr1712761 --12205 --
NM_006854chr721493 25 21995 1913 21598 183 --
NM_006856chr1241008 723 392 336 169 ----
NM_006861chr1242057 1563 235 147 1399 ----
NM_006870chr204607 554 318 116 --1654 --
NM_006875chrX1353 ------
NM_006877chr6--1336 1266 --
NM_006884chr351982 1743 1666 1290 28 11433 1150 --
NM_006885chr1673724 3506 1090 1063 732 522 413 ------
NM_006887chr22522 143 ------
NM_006888chr1452835 2321 1383 1338 1192 1245 2711 144 --
NM_006892chr2051264 1188 1029 970 120 11426 ----
NM_006892chr2051264 1188 1029 970 120 11426 ----
NM_006908chr72921 322 ------
NM_006910chr162382 115 ------
NM_006914chr94616 597 168 118 ------
NM_006915chrX32001 402 73 ------
NM_006918chr1185632 4647 4577 4040 2333 1485 979 862 24410 1399 ----
NM_006920chr241737 1516 580 413 21445 332 --11293
NM_006922chr252333 2322 863 837 307 ------
NM_006924chr1733884 1302 986 ------
NM_006930chr541982 1403 1243 238 12005 ----
NM_006937chr171406 ------
NM_006940chr123707 560 513 ------
NM_006943chr2043342 1264 439 393 12206 21118 974 1938
NM_006947chr431346 243 148 2396 307 ----
NM_006948chr2132063 308 67 ------
NM_006950chrX5861 735 685 581 69 --1151 --
NM_006981chr932150 737 43 12679 1290 --
NM_006983chr1----121 --
NM_006990chr162029 1958 1004 720 399 24 --12464 11978
NM_006991chr31859 --1176 --
NM_006997chr10198 ------
NM_006999chr521294 165 --11375 --
NM_007005chr92554 85 --146 --
NM_007006chr1622543 129 22302 321 ----
NM_007007chr1284282 3954 1691 1556 1550 1254 389 24 11245 ----
NM_007008chr22586 33 1193 1317 --
NM_007010chr1751532 1520 1294 566 509 1764 ----
NM_007011chr15176760 6551 6465 6244 6232 5784 5535 4913 4701 4270 2644 2059 1649 921 780 615 270 --25417 1478 11953
NM_007013chr82890 364 ------
NM_007017chr51799 ------
NM_007023chr23823 420 261 --1894 --
NM_007024chr3275 27 ------
NM_007026chr17144 ------
NM_007027chr31101 ------
NM_007030chr584658 4146 3396 1493 1158 567 376 65 14956 34633 3467 959 --
NM_007033chr151674 1392 922 867 370 ------
NM_007034chr11333 ------
NM_007038chr2175486 5109 4920 4867 2335 1891 1296 24061 417 ----
NM_007040chr1951101 1031 689 272 55 ------
NM_007042chr382363 2289 1760 1666 1652 780 284 147 1735 2919 210 11751
NM_007050chr2077801 7714 5308 1847 1524 1183 977 28026 2647 57590 2389 1448 1344 161 --
NM_007052chrX1546 189 ----
NM_007067chr174518 506 468 285 ------
NM_007073chr653607 3313 1541 813 710 21179 961 169 --
NM_007084chr132294 233 ------
NM_007099chr22661 253 1136 ----
NM_007111chr131136 --1872 --
NM_007118chr51904 ------
NM_007124chr651706 1617 1598 1263 1250 1392 ----
NM_007125chrY1362 ------
NM_007126chr92351 345 ------
NM_007144chr1741010 490 104 53 --11237 --
NM_007146chr1731808 1155 527 2352 200 ----
NM_007150chrX32115 574 288 ------
NM_007158chr13379 300 142 --1360 1235
NM_007159chr321588 1141 ------
NM_007166chr1151593 1545 1535 1185 1080 ------
NM_007174chr1282383 2332 2194 1590 1537 280 219 31 --1244 --
NM_007175chr883048 2836 2767 2316 1230 876 610 88 --1700 --
NM_007187chr131892 ------
NM_007192chr141289 1321 ----
NM_007197chr121926 ------
NM_007200chr1564233 4208 3224 3054 1311 878 --14005 12951
NM_007207chr11803 2357 142 ----
NM_007212chr1------1870
NM_007214chr611325 --11350 --
NM_007232chr202341 59 --1163 --
NM_007242chr161240 ------
NM_007245chr162347 50 --1653 --
NM_007246chr42839 83 21031 676 --1105
NM_007249chr13189425 8752 8578 8415 7877 7277 6976 6948 6876 6667 5878 5733 2358 2334 2167 1882 1453 990 36505 5781 334 78601 7726 6378 3695 3474 2554 2118 --
NM_007271chr631384 1292 166 ----1591
NM_007275chr31852 ----1373
NM_007278chr172351 119 ------
NM_007280chr152415 127 ------
NM_007282chr3--11023 --1782
NM_007284chr32131 49 ------
NM_007292chr17124975 4872 4447 4014 3653 3271 1867 1675 1542 1185 796 41 33963 3811 1150 11742 --
NM_007308chr42468 154 1601 ----
NM_007313chr921479 1327 --31801 197 107 --
NM_007324chr1------172
NM_007331chr462612 2539 1849 956 769 723 12316 1191 --
NM_007332chr841346 1258 583 152 11401 ----
NM_007345chr1841477 563 65 21 --21770 1448 --
NM_007347chr1532060 1984 1125 --12651 --
NM_007349chr7----1164 --
NM_007358chr131498 432 153 ------
NM_007359chr1741469 1204 610 216 11123 ----
NM_007363chrX2814 334 ------
NM_007372chr172573 359 1350 ----
NM_007373chr1011215 --11150 --
NM_007375chr132460 2406 574 --11878 --
NM_012069chrX52575 2137 472 127 67 ------
NM_012074chr1421075 819 --11052 --
NM_012081chr552988 2971 2381 2271 739 13180 13481 --
NM_012082chr83896 385 23 ------
NM_012083chr102311 110 ------
NM_012090chr131164 826 35 11231 1365 --
NM_012092chr22398 114 ------
NM_012095chr1042179 1318 876 399 --13032 --
NM_012096chr342573 1503 1284 619 23600 1039 ----
NM_012097chr252046 1891 1500 854 169 ------
NM_012098chr921170 577 --1305 --
NM_012102chr122081 914 ------
NM_012104chr1193351 3015 2685 1421 381 185 103 88 58 ------
NM_012104chr1193351 3015 2685 1421 381 185 103 88 58 ------
NM_012134chr141464 1389 1226 179 --11330 --
NM_012137chr152131 1129 552 511 188 12734 ----
NM_012141chr1363332 3101 2714 2578 1070 854 11381 1495 --
NM_012156chr2072651 2579 2432 2170 1268 653 470 12270 --13299
NM_012157chr33618 285 171 --1979 --
NM_012158chr1321862 742 11795 --125
NM_012161chr4--11065 11089 162
NM_012164chr987487 6617 6103 5728 2576 2350 1218 280 --47471 6433 5800 5521 --
NM_012166chr931523 1373 135 --11039 --
NM_012175chr111272 ------
NM_012193chr11104896 4562 4415 3317 1747 1562 1528 941 820 521 1263 34686 3666 2025 --
NM_012197chr94549 105 44 26 --21203 517 --
NM_012199chr174382 3951 3580 1457 1363 720 232 34428 663 624 54560 3994 1517 1004 822 --
NM_012207chr10140 ------
NM_012214chr286089 5548 4583 4327 3958 2483 2241 1974 15180 25611 1294 14662
NM_012215chr1041473 1463 372 155 --2765 47 --
NM_012218chr1962951 2325 2202 1903 36 28 ------
NM_012229chr101287 --11025 --
NM_012231chr141267 696 488 28 ------
NM_012233chr22859 836 ------
NM_012234chr352994 2543 1323 195 150 13700 12317 --
NM_012238chr101427 ------
NM_012242chr102223 130 ------
NM_012243chr12267 176 ------
NM_012247chr101197 ------
NM_012249chr242326 1005 865 191 33173 2533 1332 ----
NM_012250chr1171231 1144 1073 988 945 73 47 11326 184 --
NM_012252chr743952 2117 1172 394 25345 4057 ----
NM_012257chr71836 ----1861
NM_012259chr621385 1286 ------
NM_012261chr20177 --169 --
NM_012262chr164156 1421 1321 1291 1232 55 11926 11373 --
NM_012266chr921083 905 ------
NM_012281chr752290 1887 977 722 579 ------
NM_012282chrX4714 213 69 61 1174 ----
NM_012286chrX148 ------
NM_012287chr344013 3316 2959 1192 --1353 13722
NM_012288chr6135588 5065 4870 4301 4128 3633 2224 2172 1742 1509 1008 811 589 35137 2123 368 31393 1226 303 --
NM_012290chr22682 608 ------
NM_012294chr793011 2735 1539 1422 1364 1010 929 615 471 14039 22709 38 --
NM_012296chr1193558 3233 2959 1517 882 639 188 132 36 1252 ----
NM_012297chr442511 2473 1714 544 --1129 --
NM_012300chr542501 1944 859 724 --1376 --
NM_012301chr711469 1407 ----
NM_012302chr111009 ----1431
NM_012308chr1132490 695 261 ----11794
NM_012309chr1164514 4249 1881 1107 980 504 14277 13366 --
NM_012316chr1125223 5088 4920 4765 4460 3933 3867 3721 2148 1661 857 201 --34961 4648 330 --
NM_012322chr7175 ------
NM_012325chr2031057 192 123 --1141 --
NM_012326chr21819 ------
NM_012327chr183629 295 26 ------
NM_012328chr721494 1385 1106 1946 --
NM_012329chr173530 451 49 --11054 --
NM_012330chr1021531 64 --1213 --
NM_012342chr101101 ----173
NM_012343chr52781 414 ------
NM_012347chr652853 1029 652 64 28 ----1843
NM_012384chr201830 --12242 --
NM_012399chr2231831 1272 322 ------
NM_012402chr1131283 1075 498 --11164 --
NM_012408chr20194 ------
NM_012412chr71605 --1180 --
NM_012416chr931268 396 243 ------
NM_012417chr171601 ------
NM_012421chr11390 ----1431
NM_012428chr151380 ------
NM_012433chr21250 146 ----
NM_012443chr103777 625 117 ------
NM_012444chr201326 ------
NM_012448chr1741991 1923 1860 35 1668 ----
NM_012454chr61230 ------
NM_012464chr412161 22629 625 ----
NM_012471chrX71951 1645 1257 465 338 254 136 1228 ----
NM_012475chr12250 21 ------
NM_012478chr172988 227 --193 --
NM_012479chr742693 2168 1857 995 ------
NM_013227chr153810 724 189 ------
NM_013229chr1252305 816 572 255 183 ------
NM_013230chrY61619 584 507 322 124 41 ------
NM_013231chr1494351 3458 3391 1608 1406 1379 1188 752 340 --14389 --
NM_013246chr11149 ------
NM_013247chr21162 ------
NM_013259chr32311 80 ------
NM_013261chr443529 2943 2517 389 --11392 --
NM_013262chr6--11242 1330 --
NM_013269chr121855 21397 603 ----
NM_013272chr151266 ------
NM_013275chr164812 722 143 130 ------
NM_013277chr121240 --2911 201 --
NM_013281chr2021241 414 ------
NM_013283chr51583 --158 --
NM_013286chr321159 84 23823 3077 23220 1474 --
NM_013293chr73221 137 130 ------
NM_013314chr10141 ------
NM_013316chr721034 115 ------
NM_013336chr32641 44 --1299 --
NM_013341chr252165 996 784 484 46 12097 ----
NM_013351chr171730 ------
NM_013354chr8----196 1433
NM_013358chr14670 382 376 207 --1110 --
NM_013361chr193702 502 180 ------
NM_013372chr1532582 1142 1034 --13267 --
NM_013377chr121467 --1179 --
NM_013381chr1221734 580 ------
NM_013386chr111705 1476 1603 --
NM_013390chr941739 1421 1385 255 --2379 173 --
NM_013396chr211268 1954 ----
NM_013399chr1641514 666 517 77 ------
NM_013401chr111649 --1723 --
NM_013433chr1941749 1623 1494 548 ------
NM_013436chr22780 742 179 ----
NM_013437chr81401 2922 363 ----
NM_013438chr931602 287 253 --1626 --
NM_013444chrX1207 --1766 --
NM_013446chr72522 160 11373 31440 1273 1012 --
NM_013449chr1282714 2267 1152 1110 707 45 34 25 ------
NM_013951chr232395 434 383 ----11920
NM_013952chr232472 511 460 ----11997
NM_013953chr232472 511 460 ----11997
NM_013958chr83391 332 40 ------
NM_013959chr83391 332 40 ------
NM_013961chr83391 332 40 ------
NM_013962chr83391 332 40 ------
NM_013992chr232472 511 460 ----11997
NM_013995chrX32450 996 972 --22415 1037 --
NM_013999chr1741517 515 150 108 ------
NM_014000chr1031289 493 182 11789 ----
NM_014002chr11152 --1709 --
NM_014011chr242528 2257 2143 564 21901 1642 ----
NM_014016chr331309 445 123 11261 11292 --
NM_014021chr143001 2473 1315 215 12647 2835 306 --
NM_014023chr1032149 1842 850 --22250 969 1733
NM_014030chr1751033 924 296 242 222 ------
NM_014034chr61282 --11257 --
NM_014038chr72359 43 ------
NM_014042chr113232 218 185 ------
NM_014043chr31632 11354 ----
NM_014048chr1684958 4323 4022 3332 3231 1670 448 230 24965 372 44681 3589 2025 285 --
NM_014069chr62267 35 ------
NM_014089chr1351741 1505 880 660 168 --2545 437 --
NM_014106chr1572626 2351 2308 1891 1073 996 910 ------
NM_014109chr84862 429 417 298 11081 31215 342 96 --
NM_014112chr854791 4375 1816 256 228 --14898 --
NM_014117chr1652209 1818 647 476 91 12756 ----
NM_014154chr331030 308 261 11037 ----
NM_014155chr1165912 5902 5338 1970 1873 1272 --37362 875 139 16168
NM_014157chr1643701 2942 869 541 11488 --13814
NM_014166chr1331083 858 817 ------
NM_014176chr1165 123 ----
NM_014181chr232855 2686 278 --11963 --
NM_014188chr11266 ------
NM_014189chr421409 333 ------
NM_014190chr431761 685 48 11222 11180 --
NM_014191chr121843 1388 1159 --
NM_014216chr1431604 1465 1151 ------
NM_014217chr12597 208 --1175 --
NM_014232chr173510 485 323 ------
NM_014232chr173510 485 323 ------
NM_014233chr1751523 1339 290 114 65 11423 21885 1389 --
NM_014240chr383552 2998 2865 1603 1239 1148 1013 888 12592 13709 --
NM_014243chr431698 1497 150 1378 ----
NM_014245chr32995 301 11124 ----
NM_014246chr221370 ------
NM_014249chr15------1520
NM_014250chr2231415 686 334 --11975 --
NM_014252chr13--1143 1369 --
NM_014253chrX22356 276 --22451 1591 --
NM_014264chr41594 ------
NM_014267chr112805 161 1275 ----
NM_014271chrX1619 ------
NM_014278chr43158 105 58 --1383 --
NM_014281chr8129 ------
NM_014282chr931231 871 465 --1134 --
NM_014283chr131305 1266 133 --21228 352 --
NM_014284chr12946 759 --162 --
NM_014289chrX21282 166 11190 ----
NM_014293chr2274107 3534 3476 3363 2602 1531 41 --11455 --
NM_014296chr321197 469 21014 595 ----
NM_014299chr1952237 1522 759 298 188 ------
NM_014309chr2243512 1317 1208 368 1632 35010 4066 1174 --
NM_014317chr10170 ------
NM_014319chr1221751 1693 --21768 1517 --
NM_014323chr221996 ------
NM_014325chr1211785 1893 ----
NM_014333chr1152537 2258 2236 2003 1000 ------
NM_014342chr1131473 1240 1094 --1288 --
NM_014344chr111836 ----1778
NM_014345chr63825 776 280 ----1124
NM_014350chr51994 ------
NM_014351chr222937 186 --21471 1351 --
NM_014368chr942104 1526 1341 22 --12068 --
NM_014376chr582563 2535 2136 1945 1810 1698 516 121 ------
NM_014382chr32294 286 11632 11146 --
NM_014388chr1134977 4971 4844 4708 4493 4420 2225 1442 867 765 689 205 142 2522 445 11131 --
NM_014392chr421480 222 --1629 --
NM_014393chr841988 623 417 293 1504 ----
NM_014399chr73673 222 48 ----1115
NM_014405chr1752333 2318 2255 2209 1588 ------
NM_014410chr181364 ------
NM_014415chr32595 274 ------
NM_014423chr595240 4915 4131 3653 3639 1888 1434 1239 427 24214 3522 11334 --
NM_014426chr202538 61 ------
NM_014429chr31643 ------
NM_014431chr1021409 1205 --1280 --
NM_014445chr32638 543 --21997 934 1428
NM_014447chr431083 558 422 ------
NM_014452chr61819 --31089 858 432 1342
NM_014454chr6--1897 ----
NM_014456chr103512 253 98 11859 11467 --
NM_014458chr11947 --21336 1117 --
NM_014469chr111112 ------
NM_014488chr11----1525 --
NM_014494chr1631907 736 125 22174 519 21867 698 --
NM_014498chr31323 ------
NM_014506chr941697 1636 501 443 11065 --1110
NM_014515chr121792 ------
NM_014517chr321230 372 --2638 527 --
NM_014521chr231686 449 255 ----11721
NM_014554chr1242013 1641 786 277 12199 12096 --
NM_014564chr93311 280 26 ------
NM_014572chr1351786 1172 368 268 168 ------
NM_014574chr1421525 979 1152 ----
NM_014577chr223829 788 252 ------
NM_014586chr2164426 3604 3231 3156 1303 1201 13768 11845 --
NM_014587chr1631286 505 305 --1293 --
NM_014592chr53524 123 114 155 ----
NM_014600chr221619 1527 ------
NM_014601chr1941091 1072 409 304 ------
NM_014607chr261861 1764 1739 1471 836 745 1668 1565 --
NM_014612chr91250 ------
NM_014613chr573013 2516 2075 1199 864 416 301 --1276 12062
NM_014614chr251296 1200 585 238 221 ------
NM_014615chr16103033 2787 2734 2702 2653 2574 1163 1060 167 60 ------
NM_014620chr123598 250 134 ------
NM_014623chr6192 2194 146 ----
NM_014629chr81207 ----11229
NM_014634chr2242778 2598 2254 1449 ------
NM_014635chr251570 1462 1405 159 109 --11308 --
NM_014636chr954362 3793 1698 1268 280 --13037 --
NM_014647chr1632305 2234 2161 1124 ----
NM_014660chr721092 282 ------
NM_014663chr121116 140 ------
NM_014665chr883627 2633 1082 926 840 710 191 126 --11239 --
NM_014666chr52397 189 ------
NM_014667chr332435 2014 1775 1988 ----
NM_014670chr221213 82 1316 ----
NM_014671chr731288 288 59 ----11053
NM_014677chr821327 1006 11024 1323 --
NM_014679chr11142 --2964 268 --
NM_014680chr171136 ------
NM_014682chr82545 438 ------
NM_014686chr1972366 2294 2248 2192 1593 801 431 ------
NM_014690chr753065 2772 2066 978 879 12451 22690 1114 --
NM_014701chr1573354 3235 2213 983 959 825 56 1619 1998 --
NM_014702chr632272 2174 468 ------
NM_014703chr331224 1005 873 1457 ----
NM_014705chr721362 280 --1266 187
NM_014707chr7----11921 --
NM_014709chr21612 1246 1182 --
NM_014711chr162477 105 12130 11808 --
NM_014713chr21517 ------
NM_014717chr19----1592 --
NM_014720chr1041142 694 111 61 1251 21480 219 --
NM_014721chr6126444 6406 5625 4558 2628 2180 2057 2047 1751 1411 1185 40 --1660 --
NM_014723chr2083233 2764 2453 1039 722 587 437 26 190 12999 --
NM_014725chrX31340 1115 988 ------
NM_014726chr1741148 408 151 63 --1553 --
NM_014727chr19297 56 --1258 --
NM_014729chr851435 927 737 421 118 ------
NM_014730chr1284847 4536 4293 3558 1421 920 910 595 1382 ----
NM_014730chr1284847 4536 4293 3558 1421 920 910 595 1382 ----
NM_014732chr1675663 5557 4665 4395 2228 1103 450 15088 15857 25182 2203
NM_014733chr51307 ----12030
NM_014735chrX21733 1552 1486 ----
NM_014739chr663942 3771 2599 1428 1401 916 32940 2565 1393 --13279
NM_014743chr4----22038 1143 1299
NM_014746chr2190 14077 12942 --
NM_014747chr184991 4868 4275 4113 3974 3730 2227 1639 --15671 11750
NM_014751chr831967 878 141 --11868 --
NM_014752chr1131453 748 292 ------
NM_014755chr273846 3826 3609 3447 683 196 185 11558 33364 1329 427 --
NM_014758chr1171821 1801 1694 1675 1635 889 653 ------
NM_014764chr1241247 188 52 44 --1149 --
NM_014765chr142027 1057 716 381 22115 818 1805 --
NM_014766chr72154 142 145 ----
NM_014770chr123902 154 121 ------
NM_014772chr1821413 945 12429 ----
NM_014774chr163110 2528 2286 2149 350 123 12056 --1390
NM_014779chr331074 1067 384 176 ----
NM_014781chr82288 90 ------
NM_014783chr1551308 1108 1099 537 260 ------
NM_014786chr112918 427 --1416 --
NM_014795chr221282 1273 ------
NM_014800chr731137 878 82 --1175 --
NM_014803chr103901 381 102 3989 304 42 1230 --
NM_014806chr91133 ------
NM_014807chr112780 588 ------
NM_014810chr193269 3153 1305 1092 1070 884 757 378 248 13168 ----
NM_014812chr131249 755 237 --1778 --
NM_014820chr342038 1917 1410 576 11386 11786 --
NM_014824chr112703 402 1815 178 --
NM_014826chr163891 3626 3547 945 244 60 ------
NM_014827chr131624 1441 223 122 ----
NM_014828chr14--12403 11680 --
NM_014830chr1253697 3324 1536 1123 819 ------
NM_014832chr1332064 638 127 --1403 --
NM_014835chr2032246 1577 1513 --11422 --
NM_014836chr1031640 136 58 11696 ----
NM_014839chr132312 1599 435 ----12236
NM_014840chr1262686 2475 2410 1004 629 243 --12943 --
NM_014841chr611394 1183 ----
NM_014847chr12556 31 ------
NM_014850chr333048 1677 435 14810 34549 3586 1267 --
NM_014864chr152924 911 746 399 212 11085 ----
NM_014868chr122586 22 ------
NM_014869chr341323 1120 176 33 --1284 --
NM_014871chr122564 88 ------
NM_014872chr952239 2148 1621 408 363 --1569 --
NM_014873chr134808 1896 456 --1730 --
NM_014874chr151374 399 379 222 174 ----11782
NM_014876chr2261991 1971 816 714 377 214 --11639 --
NM_014877chr17126882 6800 6398 6193 5798 5379 5039 3004 2947 2577 1704 1479 22300 1207 26597 498 1979
NM_014880chr252623 2442 2278 2041 703 1342 --12535
NM_014883chr43802 632 603 --1546 11827
NM_014884chr19135 ------
NM_014885chr4----173 --
NM_014888chr741227 1094 499 103 --135 11404
NM_014890chr32248 233 1278 ----
NM_014892chr63131 89 28 ------
NM_014893chrY--32385 2305 742 ----
NM_014897chr1732885 2346 170 ------
NM_014899chr543058 958 918 829 1585 12562 --
NM_014900chr22756 27 ------
NM_014902chr2051366 1336 1090 1003 396 ------
NM_014904chr1023332 2817 12487 --13611
NM_014906chr1774031 3568 3152 3062 2940 2564 495 23512 1610 ----
NM_014909chr1463939 3909 3722 3443 1092 1012 ----1395
NM_014912chr103776 396 241 11384 23098 229 1259
NM_014914chr231308 1162 32 ------
NM_014918chr1551200 1150 399 238 186 1654 ----
NM_014920chr633119 2763 622 1114 ----
NM_014921chr1921893 1242 ------
NM_014923chr1321456 690 12077 --1170
NM_014924chr1422006 922 1387 --22599 1140
NM_014925chr121769 1665 ----
NM_014926chr31793 --21019 948 --
NM_014927chrX131 ------
NM_014932chr311690 ------
NM_014933chr41325 1152 ----
NM_014934chr1373790 3700 3134 2549 2425 1516 537 11363 ----
NM_014936chr64901 479 336 226 ------
NM_014944chr11262 --11198 --
NM_014945chr561887 1735 1499 1483 1304 790 1395 1460 --
NM_014946chr23998 640 622 ------
NM_014947chr153136 2146 1203 842 39 1104 --12305
NM_014950chr143190 179 99 ------
NM_014951chr1041683 1007 299 137 ----11881
NM_014952chr1521311 78 --21958 233 --
NM_014961chr461884 1748 1576 746 504 285 ------
NM_014962chr2062824 2051 1080 1035 331 246 11158 ----
NM_014964chr1762312 2226 1915 442 172 31 --1599 --
NM_014970chr11215 ------
NM_014974chr1041612 1568 1546 1239 --1534 --
NM_014977chr142494 403 1484 ----
NM_014978chr1051542 1383 726 98 29 --1231 --
NM_014982chr1474774 4748 1582 1437 413 146 97 21862 1765 13748 --
NM_014988chr421927 584 21029 381 1644 --
NM_014989chr641932 1594 1380 616 ------
NM_014990chr1421181 433 1213 ----
NM_014991chr482603 2282 2127 2009 859 771 317 238 12571 12796 --
NM_014992chr141608 ------
NM_014994chr1552267 1734 833 463 260 --11617 --
NM_014997chr772902 1905 1880 1072 1019 569 176 --12715 1288
NM_014999chr12--11213 11387 --
NM_015000chr122659 458 ------
NM_015001chr13915 877 187 ------
NM_015002chr1241963 1768 1743 1491 --124 22080 527
NM_015008chr342612 2363 1021 576 --33649 2635 715 --
NM_015015chr1951411 815 764 510 338 ------
NM_015017chr13812 512 366 --11027 --
NM_015020chr1663698 3594 3496 3348 2876 249 21494 736 2952 881 --
NM_015025chr221717 166 32705 2604 1018 1762 11931
NM_015026chr1254527 4462 3109 3062 1216 11261 14706 --
NM_015027chr1631796 1463 1295 ------
NM_015035chr20136275 6024 5692 5420 5173 4541 4167 2386 2061 1764 480 254 117 11798 35301 5030 568 --
NM_015039chr173372 1519 1068 973 960 180 41 24008 3943 ----
NM_015040chr231105 976 741 --1179 --
NM_015042chr1564273 4258 3858 3715 670 486 1999 ----
NM_015044chr1663116 2998 2892 2102 2003 1230 ------
NM_015049chr232668 2263 572 12378 ----
NM_015050chr641091 838 366 118 ------
NM_015051chr933110 3101 1261 22755 241 ----
NM_015056chr2162030 956 901 878 364 62 ------
NM_015061chr91731 ------
NM_015068chr773188 1502 1192 1094 1080 909 249 1796 ----
NM_015071chr575285 5183 4646 4434 2174 1987 807 25593 4941 15878 16247
NM_015073chr1961828 1721 797 767 522 23 --1607 --
NM_015074chr174641 3329 3039 3014 1108 1020 30 1475 2419 138 --
NM_015075chrX41521 654 648 492 ----11799
NM_015076chr654276 3985 3123 2822 270 2790 726 2454 314 --
NM_015077chr1764480 3331 1250 689 504 168 11563 ----
NM_015082chr542112 2084 1671 1028 1588 2562 479 --
NM_015090chr1155790 5451 4913 4402 4320 4023 4010 2401 1590 1150 1026 871 331 98 30 --1382 13949
NM_015091chr142545 90 --1825 --
NM_015092chr16104256 4003 3646 2851 1872 1668 1270 1053 720 707 --34606 3722 1548 --
NM_015093chr641342 1161 557 315 ------
NM_015094chr2264165 1783 1645 1586 1241 34 14129 ----
NM_015097chr332034 2027 667 ------
NM_015099chr173152 109 37 --2705 244 --
NM_015100chr14783 745 702 560 ------
NM_015102chr12175 131 ------
NM_015107chrX62220 1563 890 635 398 182 ------
NM_015110chr9--31621 805 516 ----
NM_015115chr452552 2493 1137 915 714 12010 12712 --
NM_015122chr19--1226 ----
NM_015125chr19----1422 --
NM_015130chr431119 968 111 21059 487 11126 --
NM_015135chr71129 ------
NM_015137chr832008 1900 559 22510 265 1514 --
NM_015138chr1552312 714 487 461 55 ------
NM_015143chr411272 --2258 31 --
NM_015144chr1683736 3720 3196 2898 2454 672 255 223 12799 13514 --
NM_015149chr172179 2161 2023 655 647 600 386 12086 21749 1418 --
NM_015150chr31623 ----154
NM_015151chr2141030 774 158 141 --2656 331 --
NM_015155chr1052394 1062 911 882 747 11211 12230 --
NM_015156chr1463628 2808 1312 825 768 213 13196 11575 --
NM_015161chr161348 11433 11300 --
NM_015170chr841649 1579 764 750 1804 1896 --
NM_015171chr164400 349 154 59 ------
NM_015172chr131281 1111 203 --1241 --
NM_015173chr421459 1309 1685 --11758
NM_015176chr121552 445 ----11523
NM_015180chr14----1290 --
NM_015187chr41222 195 ----
NM_015192chr2042580 2362 2325 90 --12007 --
NM_015196chr4----1108 --
NM_015199chr322719 2093 1961 21898 68 --
NM_015200chr411740 1780 ----
NM_015205chr1334180 1085 31 ------
NM_015206chr1562996 2975 2843 1513 1353 624 11412 ----
NM_015208chr1843959 3822 3529 2537 --23838 1125 --
NM_015210chr182459 28 ------
NM_015215chr152691 774 744 450 241 --1205 1801
NM_015216chr52624 349 11298 --1372
NM_015225chr972335 2005 765 455 324 99 89 ------
NM_015233chr1352476 2050 1798 846 174 --1568 --
NM_015236chr441254 1241 410 43 ------
NM_015245chr662637 2225 2126 1907 1097 637 ------
NM_015250chr921699 768 11813 1349 --
NM_015251chr1642030 889 395 35 --1765 1675
NM_015252chr23984 731 262 ------
NM_015263chr15------1178
NM_015264chr2274237 3656 3556 3345 3227 884 518 13370 ----
NM_015265chr252502 2020 1750 327 230 1258 ----
NM_015267chr1272020 1915 1860 849 203 56 43 ------
NM_015269chr1179 ------
NM_015270chr1251860 1777 1731 926 509 --11937 --
NM_015271chr464036 3831 758 675 458 185 ----11653
NM_015272chr16123 --1242 --
NM_015277chr1831445 1144 470 --153 --
NM_015278chr643455 661 390 237 --13213 --
NM_015282chr242968 2623 2391 828 22725 1007 1997 --
NM_015284chr192133 1956 1891 1718 1350 859 693 571 489 --11987 --
NM_015285chr1842319 1795 582 386 11918 ----
NM_015288chr563476 3411 3387 3376 1547 404 ------
NM_015291chr193237 2372 2285 1309 1240 1174 1084 491 360 --33389 2410 2394 --
NM_015294chr173415 327 36 --11149 --
NM_015296chr13152 1944 ----
NM_015299chr14114003 3981 3898 3726 3363 2884 1432 1227 983 727 137 ------
NM_015305chr1441973 564 513 78 --1369 --
NM_015308chr111153 1799 ----
NM_015310chr8137777 7371 6716 6594 5387 5100 2647 2462 2062 1829 1499 559 434 --46810 3082 2206 221 --
NM_015313chr11104636 4353 4073 3522 3401 1568 1132 920 769 704 --33813 3112 551 --
NM_015314chr742443 1681 881 795 1585 22496 1648 --
NM_015315chr593121 2789 2518 2512 2331 1300 993 580 487 13269 ----
NM_015317chr272892 2607 2550 2226 2177 1050 316 ------
NM_015321chr1964414 4303 3688 1595 735 45 --24905 1778 --
NM_015326chr142807 2133 1033 868 12018 1395 --
NM_015328chr722681 396 23014 2338 12605 11920
NM_015335chr1232660 2628 1830 ----1931
NM_015336chr1262222 2213 2090 683 420 151 ------
NM_015338chr203777 507 412 --11245 --
NM_015339chr2021031 841 ------
NM_015344chr83397 326 136 ------
NM_015345chr662445 2107 1916 948 842 740 1172 12775 --
NM_015347chr1242663 2211 2175 229 31922 531 71 11903 11155
NM_015349chr632873 559 449 --11042 --
NM_015352chr2042415 1291 433 212 --23489 997 --
NM_015355chr172610 193 1620 ----
NM_015358chr2131097 861 415 ------
NM_015361chr24871 698 52 25 ------
NM_015365chrX64300 3600 2708 799 562 65 1747 ----
NM_015367chr221553 11522 11260 --
NM_015387chr231922 1423 399 11383 ----
NM_015388chr61135 ------
NM_015393chr473595 3506 2762 2395 2329 298 77 22846 1142 ----
NM_015396chr361480 1071 305 159 99 21 ------
NM_015397chr931922 1654 139 ------
NM_015419chrX3815 457 213 ------
NM_015429chr311072 ------
NM_015435chr821337 570 ------
NM_015436chr463243 2857 2354 2118 1205 367 ------
NM_015441chr1----147 --
NM_015443chr172567 211 ------
NM_015446chr131549 608 533 --1435 --
NM_015449chr12619 511 ------
NM_015455chr543385 3170 3088 227 14064 13049 --
NM_015458chr8105165 4689 4312 4058 3887 1757 1585 1501 212 79 11713 34348 3940 3376 --
NM_015460chr321848 1381 --1469 --
NM_015472chr3----1397 --
NM_015472chr3----1397 --
NM_015475chr2173 ------
NM_015477chr153933 900 367 2717 194 ----
NM_015483chr73808 745 445 1846 ----
NM_015488chr241747 1731 1645 397 11399 21621 1249 --
NM_015492chr1511038 ------
NM_015497chr1531152 456 56 1172 ----
NM_015508chr311357 11513 1112 11029
NM_015516chr1131287 1204 1128 ------
NM_015520chr352517 2038 1776 794 319 ------
NM_015523chr111106 --190 --
NM_015525chr62999 855 ------
NM_015526chr1921339 45 --1226 --
NM_015527chr164840 688 681 630 --187 --
NM_015541chr31476 21098 959 11074 --
NM_015542chr1011103 ------
NM_015545chr74282 242 215 202 ------
NM_015548chr62690 283 ------
NM_015550chr732530 1425 212 --32981 2271 611 --
NM_015554chr1562452 1136 821 345 246 23 ------
NM_015555chr621323 471 21726 626 11509 --
NM_015557chr193620 2674 1252 863 538 322 277 122 101 12514 2756 331 --
NM_015559chr1831074 195 23 ------
NM_015564chr533319 3067 1154 12426 ----
NM_015565chr2111644 ------
NM_015567chr1321162 216 ------
NM_015568chr2033647 3084 1333 --33011 2820 1631 --
NM_015569chr174818 3810 3790 3550 1112 870 147 --14724 --
NM_015571chr632515 761 264 --1486 --
NM_015575chr253159 3025 1095 361 59 --11386 --
NM_015576chr332198 851 332 32969 743 177 ----
NM_015577chr511612 11280 ----
NM_015578chr1911284 1198 ----
NM_015602chr131418 1346 54 ------
NM_015605chr10181 ------
NM_015627chr1--11554 11441 1615
NM_015630chr241026 732 259 181 ------
NM_015640chr155181 3920 3505 2073 1491 1781 14622 --
NM_015641chr731299 1057 939 ------
NM_015646chr121175 198 ----
NM_015675chr192564 474 ------
NM_015676chr141274 ------
NM_015678chr1341608 1425 1196 1114 --21370 680 1447
NM_015686chrX22165 509 --11849 --
NM_015687chr6----1377 --
NM_015716chr171662 ----1501
NM_015719chr192821 607 ------
NM_015726chr151492 1318 619 571 176 1584 199 --
NM_015833chr2182194 1582 569 468 434 231 153 94 11529 11973 --
NM_015840chr172386 2281 2109 1912 1777 702 286 ----1645
NM_015841chr172386 2281 2109 1912 1777 702 286 ----1645
NM_015866chr131184 289 173 11022 ----
NM_015874chr43497 461 431 ------
NM_015878chr841775 1506 1485 1427 ----1889
NM_015879chr18105720 5262 3242 3119 2842 2807 2585 2498 2030 455 32373 2318 2153 21417 777 --
NM_015886chr8135347 5166 5038 4792 4696 4573 4532 4464 2171 1287 1237 1176 1122 11553 25422 5048 --
NM_015888chr193138 3000 2883 2724 2562 2365 664 538 531 --21097 71 --
NM_015891chr61284 ----11419
NM_015897chr192152 146 ------
NM_015902chr81737 --2799 632 1117
NM_015905chr71583 ------
NM_015906chr154345 1876 1352 966 118 14025 ----
NM_015907chr42349 259 ------
NM_015912chr852242 2185 2093 1747 776 ------
NM_015920chr151596 1610 ----
NM_015933chr3180 ------
NM_015952chr6144 ------
NM_015955chr21500 ------
NM_015975chrX31226 574 267 31413 723 93 ----
NM_015981chr51136 ------
NM_015986chr1711462 1357 1910 --
NM_015995chr1585376 4868 4157 1657 1489 1183 686 628 24363 302 1950 --
NM_015999chr13471 241 147 ------
NM_016018chr822162 391 12790 1142 --
NM_016019chr71730 ------
NM_016021chr672993 2127 2068 1971 635 590 271 ----12569
NM_016022chr11226 ------
NM_016023chr8--1105 ----
NM_016032chrX21323 1191 --2873 557 --
NM_016033chr841956 1451 776 560 11374 11264 --
NM_016040chr132619 505 154 22764 1770 11951 --
NM_016041chr17192 ----1129
NM_016057chr1211279 --11241 --
NM_016061chr22248 23 178 ----
NM_016073chr151997 ------
NM_016075chr1322640 506 13170 ----
NM_016076chr143173 3164 3037 928 ------
NM_016079chr242302 2041 358 262 11727 ----
NM_016083chr622617 2609 --23056 557 13509
NM_016097chr184974 838 174 104 --11089 --
NM_016098chr61337 ------
NM_016099chr85500 268 262 194 146 ------
NM_016104chr6144 ------
NM_016107chr5--21231 1166 ----
NM_016120chrX2489 76 ------
NM_016122chr124486 389 352 133 ------
NM_016123chr12192 --21099 475 --
NM_016124chr141322 1276 389 243 ------
NM_016127chr84593 564 500 56 ------
NM_016129chr4133 ------
NM_016131chr232140 1592 478 1113 12158 --
NM_016132chr1532837 2680 1262 12266 ----
NM_016151chr161103 ----146
NM_016152chr321270 848 --138 --
NM_016156chr1192265 2154 2131 1809 1775 1574 511 502 315 1116 ----
NM_016166chr15--185 ----
NM_016169chr1073292 3111 2218 2062 1085 877 413 ------
NM_016173chr384255 3992 3707 3312 3200 1668 1221 1008 --23434 67 --
NM_016185chr17--1319 --1114
NM_016205chr42382 121 --11163 --
NM_016206chr3148477 8234 8133 7700 7322 7216 5890 5527 3082 2157 1912 1645 394 320 48845 6513 6110 5689 11836 28161 6485
NM_016211chr41325 1152 ----
NM_016217chr612844 11122 13561 13197
NM_016224chr641702 1463 751 522 --11689 --
NM_016226chr123374 128 94 ------
NM_016227chr131305 1266 133 --21228 352 --
NM_016230chr61399 ------
NM_016231chr1731689 1678 511 ------
NM_016248chr1373717 3682 2949 1564 1537 1439 200 23537 3265 12433 --
NM_016252chr22911 880 1289 ----
NM_016257chr182753 2593 1366 1035 966 676 566 526 13163 --13112
NM_016258chr1138 ------
NM_016260chr2137139 6628 5884 5868 5368 4901 2738 2478 1920 757 99 77 64 1949 22459 1319 --
NM_016270chr19----1493 --
NM_016271chr1851968 1635 168 45 31 11620 124 --
NM_016275chr351857 1751 891 785 140 1860 ----
NM_016281chr1221032 958 1450 --11104
NM_016287chr131908 1850 1812 --11628 --
NM_016297chr252764 1378 492 317 186 23075 516 12445 --
NM_016302chr31304 ------
NM_016303chrX1141 ------
NM_016308chr111285 1206 ----
NM_016312chr121383 ------
NM_016315chr221175 151 1370 1308 11487
NM_016320chr111109 ------
NM_016322chr963169 2925 2485 2086 1113 938 192 ----
NM_016339chr1751149 529 211 89 42 --158 --
NM_016353chr842436 2186 459 267 ------
NM_016356chr672868 2486 1970 1866 1833 1074 545 22477 2260 ----
NM_016357chr122825 803 ----1423
NM_016374chr151148 1129 142 52 30 1464 2153 24 --
NM_016374chr151148 1129 142 52 30 1464 2153 24 --
NM_016376chr1763582 3371 3154 2735 1332 1018 11179 3946 798 782 --
NM_016395chr152456 63 ------
NM_016396chr1582258 2222 2198 2004 1943 1077 1023 399 12497 11952 --
NM_016422chr1142689 2428 896 778 12368 1980 --
NM_016424chr1731474 396 56 ------
NM_016436chr2032516 553 44 1877 22183 1070 --
NM_016441chr242325 671 182 81 1503 11677 --
NM_016442chr5----2919 568 1559
NM_016448chr161904 1198 603 292 276 163 ------
NM_016451chr11168 ------
NM_016454chr151326 ------
NM_016467chr211364 ------
NM_016470chr202143 83 ------
NM_016475chr1421119 301 ----1802
NM_016476chr171150 ------
NM_016505chr11507 ------
NM_016507chr1742601 662 591 314 1238 1609 --
NM_016513chr633119 2763 622 1114 ----
NM_016516chr21713 ------
NM_016519chr4----167 --
NM_016520chr9131 --2314 108 --
NM_016522chr1111478 --21282 451 --
NM_016529chr13168 ------
NM_016530chr1542977 877 555 352 23762 654 --12605
NM_016531chr453411 3300 1266 1183 223 --23625 3354 --
NM_016536chr19173 ------
NM_016538chr17----132 --
NM_016542chrX3632 472 297 ------
NM_016575chr1264099 3793 2097 1625 1541 1497 --1872 1130
NM_016577chr354377 4346 3769 1770 1065 --12881 --
NM_016603chr552223 2059 567 540 227 ------
NM_016604chr531259 856 324 1846 ----
NM_016605chr552452 2202 2164 996 350 12356 ----
NM_016607chrX21333 60 ------
NM_016618chr2184 ------
NM_016621chr1133520 3189 743 ------
NM_016626chr18--1370 ----
NM_016628chr10----1665 --
NM_016631chr212840 670 ------
NM_016644chr5----170 --
NM_016649chr20135 ------
NM_016654chr1511182 11410 --1900
NM_016818chr212669 564 ------
NM_016824chr10----11796 --
NM_016834chr17123989 3785 3704 3438 2991 2648 2590 1283 1074 977 806 206 24050 3301 ----
NM_016835chr17123989 3785 3704 3438 2991 2648 2590 1283 1074 977 806 206 24050 3301 ----
NM_016841chr17123989 3785 3704 3438 2991 2648 2590 1283 1074 977 806 206 24050 3301 ----
NM_016929chr684010 3791 1502 649 422 334 227 122 21777 1199 1102 13442
NM_016936chr1632094 379 146 ------
NM_016946chr133447 2797 2615 22707 2631 ----
NM_016950chr411272 --1458 --
NM_016952chr1153233 1411 1379 751 581 ------
NM_016953chr286011 5574 4823 4196 1388 851 226 143 14621 ----
NM_017413chrX42504 2348 226 110 ------
NM_017415chr564008 3815 3301 2774 1747 1565 --43582 1419 1172 249 --
NM_017420chr1413033 ------
NM_017423chr42451 232 1209 ----
NM_017426chr4----140 --
NM_017437chr1442334 2110 1788 824 1750 ----
NM_017443chr93976 179 161 --125 --
NM_017447chr2184073 4048 3830 3684 2741 963 577 139 23059 2686 24029 2975 --
NM_017455chr151380 ------
NM_017456chr1761800 1582 1507 757 535 61 --11621 --
NM_017483chr22927 489 --11026 11013
NM_017488chr241262 1092 1083 249 --11361 11348
NM_017491chr44988 975 855 223 ------
NM_017519chr61277 ------
NM_017522chr11229 ----1326
NM_017526chr11113 1133 ----
NM_017545chr201533 ------
NM_017551chr1022320 454 --12388 --
NM_017553chr1541283 1026 240 188 --2160 92 --
NM_017563chr3116210 5308 5223 5154 4713 2560 2176 1863 1220 580 387 22525 32 24996 419 16377
NM_017567chr2------1121
NM_017569chr131309 ------
NM_017580chr1031920 1738 369 3730 448 151 1332 --
NM_017582chr161290 1270 667 477 229 53 ------
NM_017589chr11130 --148 --
NM_017590chr2232216 1926 145 12580 12716 --
NM_017593chr4198 1504 ----
NM_017594chr941011 493 415 43 1600 11218 11019
NM_017599chr1241873 1702 667 661 31369 768 323 ----
NM_017602chrX2821 68 --1596 --
NM_017628chr4114212 3797 3280 3272 2026 2013 1954 1561 1382 1189 517 --21920 1089 --
NM_017633chr673520 3201 2960 2729 2722 2645 2477 --13782 --
NM_017634chr851870 1711 1269 338 56 ------
NM_017635chr1131464 618 94 --11284 --
NM_017637chr9148893 8723 8323 7577 7211 7119 6854 6490 6099 5957 3412 3091 2808 2137 27438 5950 49228 7339 6706 821 --
NM_017641chr122285 243 ------
NM_017643chr1722808 408 --12061 --
NM_017644chr374875 4860 4467 3472 1257 1117 301 34540 4308 1362 21165 246 14103
NM_017650chr7104997 3903 2221 2159 1599 1508 1406 701 278 207 35643 5465 4812 ----
NM_017651chr621624 635 1455 1513 --
NM_017658chr1424207 1154 --44524 3164 2879 256 13965
NM_017661chr15--1128 ----
NM_017666chrX52100 2028 1445 1429 314 1178 ----
NM_017672chr15262 37 ------
NM_017676chr52374 220 11843 ----
NM_017679chr173187 177 110 ------
NM_017686chr12959 877 --1767 --
NM_017694chr222007 1580 22068 1392 ----
NM_017709chr142948 1691 990 251 13865 22872 1261 11354
NM_017719chr34316 294 183 122 11971 11902 --
NM_017721chr19------1327
NM_017724chr32181 122 --1714 --
NM_017730chr3----1171 1464
NM_017737chr141682 757 749 553 1587 ----
NM_017738chr92933 208 ------
NM_017739chr12231 110 ------
NM_017741chr431937 969 678 --1206 --
NM_017742chr1831862 506 419 ------
NM_017745chrX1455 ------
NM_017752chrX21771 343 12109 2591 180 --
NM_017753chr94979 911 875 40 1353 ----
NM_017754chr664346 4316 4180 1643 1309 1247 --11848 --
NM_017758chr1761506 1297 1023 1013 449 299 ------
NM_017778chr821248 492 ------
NM_017779chr132573 1853 502 ------
NM_017780chr8----1737 --
NM_017789chr2194 --1213 --
NM_017798chr2021048 280 --1113 --
NM_017799chr1421732 1272 11861 ----
NM_017811chr952160 1967 1133 1024 763 --12291 --
NM_017812chr73726 622 278 ------
NM_017813chr895661 5239 4902 4127 2243 1814 1437 962 718 --24094 3644 15505
NM_017822chr122265 102 ------
NM_017824chr1052291 2002 623 138 79 ------
NM_017842chr122499 88 1698 ----
NM_017847chr11223 1705 ----
NM_017848chrX84186 4173 3944 3854 3587 3350 1181 141 13747 --13780
NM_017849chr273226 2864 2524 1999 822 729 114 --12965 1522
NM_017851chr15164 ------
NM_017856chrX----1676 --
NM_017860chr11144 1619 ----
NM_017873chr932256 2165 739 13159 ----
NM_017880chr23406 291 81 ------
NM_017893chr101534 --11168 --
NM_017899chr12----2133 33 --
NM_017902chr10105754 5140 4943 4793 3970 1655 1570 1015 478 104 14626 34842 1824 223 --
NM_017913chr92345 75 ----193
NM_017925chr941916 1806 1474 161 --1454 --
NM_017933chr231375 1033 394 11087 ----
NM_017935chr42608 256 ------
NM_017938chrX51442 617 389 375 314 21947 324 1650 --
NM_017943chr142791 200 ----11078
NM_017944chr1123148 2519 ----12238
NM_017945chr3179 11034 ----
NM_017948chr94424 349 298 149 ------
NM_017953chr11220 ------
NM_017955chr143904 322 75 21243 409 ----
NM_017964chr22740 295 1699 ----
NM_017966chr1141311 314 265 177 ------
NM_017974chr241243 1028 917 426 1455 --11043
NM_017988chr123813 725 65 1628 ----
NM_017994chr762808 2655 2531 826 516 239 22346 549 1424 --
NM_017999chr14------179
NM_018000chr262150 1708 1413 520 491 196 --1625 --
NM_018013chr682991 2593 1940 1168 673 636 349 147 --32960 569 202 --
NM_018014chr221317 494 ------
NM_018017chr102359 86 12154 11032 --
NM_018018chr1231491 759 146 --11617 1559
NM_018027chr1032714 1249 540 --33275 354 220 --
NM_018036chr1484082 2928 2768 1581 1103 505 331 264 --14423 1598
NM_018045chr183066 2845 2769 2515 2220 1179 922 201 1523 170 --
NM_018046chr5----11875 --
NM_018047chr52823 43 ------
NM_018054chr161265 ------
NM_018060chr11351 ------
NM_018061chr141669 1444 1255 581 ------
NM_018067chr12553 479 ----1148
NM_018070chr12156 109 ------
NM_018078chr431073 934 854 ------
NM_018079chr21136 ------
NM_018084chr252993 2295 2224 1061 258 --12611 --
NM_018085chr1117490 7394 6808 5244 4997 3150 2916 2038 1746 1626 941 --46135 1204 106 82 --
NM_018086chr221511 654 --1137 --
NM_018092chr1621426 1072 --11089 --
NM_018098chr3190 ------
NM_018103chr11106 ------
NM_018105chr82959 912 ------
NM_018117chr102508 162 ------
NM_018121chr1073161 3036 2641 2386 2314 1942 984 ------
NM_018126chr41128 ------
NM_018128chr1721171 1042 11088 11420 --
NM_018133chr31686 12197 ----
NM_018137chr11273 1377 ----
NM_018144chr102261 45 ------
NM_018151chr21785 ------
NM_018155chr31858 --11221 --
NM_018157chr121692 22393 2142 144 --
NM_018172chr1121352 1142 --11379 --
NM_018179chr12293 43 --1231 --
NM_018181chr1831644 1528 510 --31761 1303 133 --
NM_018182chr1762021 1660 1633 588 295 265 1823 2678 620 --
NM_018184chr311396 2554 295 ----
NM_018195chr1141905 1824 1688 1456 ------
NM_018203chr11712 --122 --
NM_018206chr164714 300 160 145 ------
NM_018211chr131832 1575 627 ----1218
NM_018227chr433138 445 55 ------
NM_018240chr12620 25 --1310 --
NM_018243chr494009 3422 3414 3164 2972 2658 1513 1189 632 --12607 --
NM_018244chr2051355 1228 941 928 116 ------
NM_018247chr641017 815 596 513 --11920 --
NM_018254chr142302 1949 1860 1828 22466 1697 ----
NM_018263chr272379 2245 1923 1835 929 842 236 32626 2127 549 22051 181 --
NM_018287chr10----2955 114 --
NM_018293chr322765 703 ------
NM_018299chr833146 2435 1084 12312 157 --
NM_018302chr472429 641 412 315 306 153 134 --21979 966 --
NM_018310chr82566 22 ------
NM_018312chr112876 424 ------
NM_018313chr372495 2247 2195 690 671 531 152 1476 1720 11709
NM_018314chr11------1713
NM_018315chr42457 239 ------
NM_018318chr122930 50 ------
NM_018319chr1421498 206 1414 --11421
NM_018328chr21396 1409 ----
NM_018330chr102512 349 11584 11278 --
NM_018339chr931706 694 72 1100 1437 --
NM_018348chr161328 --21183 337 1982
NM_018351chr1274390 4093 3958 3650 1153 1129 597 23211 342 24279 4230 --
NM_018362chr1163083 2814 947 807 597 181 ------
NM_018364chr11474 --43729 2984 1416 583 --
NM_018367chr1131947 369 34 1693 1740 --
NM_018370chr1252002 1532 652 468 106 --21595 681 --
NM_018371chr821002 31 --1635 --
NM_018372chr13470 216 201 ------
NM_018374chr734756 1121 659 24871 3381 ----
NM_018375chr1441324 464 106 98 ------
NM_018383chr272013 1513 1422 765 732 292 121 ------
NM_018387chr92213 126 ----1453
NM_018388chrX41457 1343 1122 989 1396 ----
NM_018398chr31123 ------
NM_018403chr394148 4029 3733 2902 2772 2649 861 709 332 14087 ----
NM_018416chr1261835 1023 583 418 385 307 --11938 11761
NM_018424chr931520 1317 31 21450 688 ----
NM_018427chr1671704 1312 1204 1156 492 157 132 11231 ----
NM_018429chr522138 2096 22556 874 ----
NM_018433chr22516 92 ------
NM_018440chr8118681 8498 7531 5838 2852 2514 1674 1272 999 601 192 12247 68044 7947 6673 6172 5881 2115 12296
NM_018441chr22645 46 ------
NM_018442chr1123 ------
NM_018445chr15121 --1514 --
NM_018448chr122825 113 ----11185
NM_018462chr32807 227 ------
NM_018466chrX1568 122 ----
NM_018469chr1731461 1132 175 --11195 --
NM_018471chr21157 --1144 --
NM_018482chr852203 2101 1865 246 239 ----1210
NM_018488chr172753 175 ------
NM_018489chr142348 1468 585 29 1233 11787 --
NM_018534chr2----2244 71 --
NM_018557chr22677 253 --1366 --
NM_018561chr63668 624 354 ------
NM_018566chr133358 1544 990 14528 31729 1607 1144 13502
NM_018571chr22600 40 ------
NM_018584chr11484 --21199 85 --
NM_018602chr1521466 1301 11706 ----
NM_018622chr3129 ------
NM_018638chr1264393 3817 3497 1712 1398 585 44530 3956 2153 2001 ----
NM_018639chr1221212 411 11122 11393 --
NM_018640chr1262806 2769 2763 2708 2673 152 1684 1693 --
NM_018644chr1172185 2009 1844 1697 1654 678 288 --1895 --
NM_018650chr151750 1699 914 632 317 12106 ----
NM_018657chr31133 --2846 652 --
NM_018667chr1652409 850 576 506 162 12556 ----
NM_018682chr7164 ------
NM_018683chr2031647 1370 456 ----183
NM_018684chrX31202 144 47 1930 ----
NM_018685chr731016 962 952 145 ----
NM_018686chr121232 ------
NM_018689chr1572691 2286 2072 671 569 342 239 11819 ----
NM_018695chr552152 1747 1681 1535 539 --11717 --
NM_018698chrX----1136 --
NM_018703chr162382 115 ------
NM_018704chr151560 1317 765 218 194 ------
NM_018710chr821123 69 --11372 --
NM_018712chr1121461 231 --1523 --
NM_018713chr1----141 --
NM_018715chr162149 1775 1596 1564 914 172 ------
NM_018719chr721317 341 11070 ----
NM_018728chr1521251 1052 --21361 24 --
NM_018834chr51876 ------
NM_018840chr202443 196 ------
NM_018841chr1113774 3316 3082 2432 1191 1079 1056 884 557 346 74 12880 --13787
NM_018847chr92661 316 ------
NM_018890chr72921 322 ------
NM_018898chr51877 21900 784 12265 --
NM_018899chr51877 21900 784 12265 --
NM_018900chr51877 21900 784 12265 --
NM_018901chr51877 21900 784 12265 --
NM_018902chr51877 21900 784 12265 --
NM_018903chr51877 21900 784 12265 --
NM_018904chr51877 21900 784 12265 --
NM_018905chr51877 21900 784 12265 --
NM_018906chr51877 21900 784 12265 --
NM_018907chr51877 21900 784 12265 --
NM_018908chr51877 21900 784 12265 --
NM_018909chr51877 21900 784 12265 --
NM_018910chr51877 21900 784 12265 --
NM_018911chr51877 21900 784 12265 --
NM_018912chr531279 320 165 ------
NM_018913chr531279 320 165 ------
NM_018914chr531279 320 165 ------
NM_018915chr531279 320 165 ------
NM_018916chr531279 320 165 ------
NM_018917chr531279 320 165 ------
NM_018918chr531279 320 165 ------
NM_018919chr531279 320 165 ------
NM_018920chr531279 320 165 ------
NM_018921chr531279 320 165 ------
NM_018922chr531279 320 165 ------
NM_018923chr531279 320 165 ------
NM_018924chr531279 320 165 ------
NM_018925chr531279 320 165 ------
NM_018926chr531279 320 165 ------
NM_018927chr531279 320 165 ------
NM_018928chr531279 320 165 ------
NM_018929chr531279 320 165 ------
NM_018940chr52424 334 ------
NM_018945chr683647 1217 986 979 640 314 132 95 --32810 661 479 --
NM_018948chr11583 --11095 --
NM_018963chr21128 --21149 105 --
NM_018970chr73911 635 541 3849 530 358 ----
NM_018975chr162775 103 ------
NM_018976chr1252527 2192 1063 933 769 ------
NM_018979chr1242608 2410 2271 1605 1790 ----
NM_018981chr22948 465 ------
NM_018993chr2021060 225 --21377 1370 --
NM_018999chr1084735 4136 3263 1515 1502 1400 517 149 24425 3482 --13991
NM_019001chr364169 3341 3148 1868 1860 47 --1149 1190
NM_019003chrX1117 ------
NM_019004chr7--22337 886 32306 2093 2014 --
NM_019006chr15133 ------
NM_019008chr2283532 3515 2734 2661 2507 1389 1214 883 --12834 --
NM_019010chr172398 257 ------
NM_019016chr17----2152 88 --
NM_019027chr441804 1012 669 246 --1375 --
NM_019028chr111417 ------
NM_019035chr41438 ----1211
NM_019036chr62827 807 ------
NM_019041chr612296 42572 2246 2107 477 ----
NM_019049chr12659 560 ------
NM_019050chr412230 --1533 --
NM_019058chr10------1280
NM_019059chr71132 --1329 --
NM_019060chr1----1122 --
NM_019063chr242023 1966 1784 264 ------
NM_019071chr71586 ------
NM_019072chr553583 2595 1007 854 606 --13574 14197
NM_019084chr1052598 2143 1819 791 337 ------
NM_019087chr531751 1552 278 1551 11226 --
NM_019088chr19----157 --
NM_019091chr2--1423 1228 21102 105
NM_019098chr831862 1518 53 --11196 --
NM_019106chr2242751 1324 1000 73 --1124 --
NM_019114chr941947 1853 830 280 --12533 --
NM_019116chr1653425 3212 1214 617 403 --23010 2832 --
NM_019555chr331697 1223 367 --2143 89 139
NM_019556chrX41133 435 311 294 ------
NM_019557chr12750 46 ------
NM_019558chr23361 317 112 ------
NM_019593chr2063158 2142 808 481 426 374 --22248 299 --
NM_019594chr931383 1356 1100 31447 1430 337 ----
NM_019595chr21176 --1701 --
NM_019596chr2173003 2574 1931 1130 982 814 111 --1460 --
NM_019597chrX1609 ------
NM_019600chr151629 ------
NM_019606chr73374 220 181 ------
NM_019610chr142172 2165 755 112 ------
NM_019842chr62341 139 ------
NM_019843chr221135 ------
NM_019845chr2146 ------
NM_019859chr1031444 1263 1257 ------
NM_019862chr1631308 1093 625 --21628 1497 --
NM_019891chr131267 1087 482 ------
NM_019895chr32421 204 ------
NM_019898chr1631308 1093 625 --21628 1497 --
NM_019899chr1631308 1093 625 --21628 1497 --
NM_019900chr1631308 1093 625 --21628 1497 --
NM_019903chr10----11796 --
NM_020039chr1211545 ----1431
NM_020066chr12362 217 ------
NM_020116chr421168 51 --11190 --
NM_020117chr53900 354 160 --1782 --
NM_020120chr23511 203 120 ------
NM_020122chr275997 5898 5100 3644 2112 648 537 1362 34736 1053 237 --
NM_020123chr1021061 403 1619 ----
NM_020134chr21809 --1191 1396
NM_020139chr431677 284 270 --1764 --
NM_020140chr12--175 ----
NM_020141chr131889 1815 128 ------
NM_020144chr752041 1793 1505 1413 1334 11422 21641 122 1606
NM_020150chr1021940 282 --22130 827 --
NM_020156chr71585 1617 ----
NM_020163chr362015 1587 711 690 536 62 ------
NM_020168chr1521357 971 --11326 --
NM_020177chr551182 1089 1025 885 726 22929 838 ----
NM_020178chr171212 --11110 --
NM_020184chr24921 888 588 280 ------
NM_020193chr1111342 --190 125
NM_020194chr22611 459 ------
NM_020204chr11150 ------
NM_020205chr153281 3249 2642 2416 192 --1881 --
NM_020210chr153891 816 717 ----1979
NM_020225chr4293 76 ------
NM_020228chr1122427 169 ------
NM_020235chr31327 ------
NM_020239chr122239 29 --21690 817 --
NM_020240chr522545 2187 22063 817 2810 34 --
NM_020243chr224830 730 611 298 1738 1665 --
NM_020309chr19----1710 1837
NM_020310chr1742781 2347 1031 353 12325 ----
NM_020336chr2093765 3547 2928 2864 2635 2446 2369 383 309 ------
NM_020337chr44876 772 761 524 1135 32113 1174 244 --
NM_020338chr1092830 2715 2379 2351 1464 1248 734 383 64 ------
NM_020340chr632190 2066 879 11521 1649 --
NM_020341chr201181 --2400 159 --
NM_020342chr221888 55 ------
NM_020346chr1121359 371 11616 ----
NM_020348chr1011784 ------
NM_020357chr321398 1227 1633 21107 270 --
NM_020360chr172418 257 --2612 456 --
NM_020381chr651924 1904 1389 821 675 ------
NM_020390chr321847 1537 34856 3517 1666 34654 4398 452 14186
NM_020405chr1764296 1811 1458 869 664 338 --23159 996 --
NM_020416chr412132 --1831 --
NM_020420chrY21305 489 ------
NM_020424chr162618 239 1642 1174 --
NM_020425chr642041 1897 1662 1541 ------
NM_020429chr742202 1983 1971 69 12872 ----
NM_020432chr721501 168 --1720 --
NM_020440chr132742 2593 2087 1737 22246 206 1724
NM_020443chr176649 6461 5630 5129 2068 1464 1191 12464 1167 --
NM_020444chr531327 257 61 --21411 139 11000
NM_020449chrX1112 ------
NM_020455chr632415 716 111 12224 1532 --
NM_020456chr1321661 1564 ------
NM_020466chr684304 3344 3300 1984 1680 1357 784 544 13860 11538 11407
NM_020474chr18----1329 --
NM_020475chr842348 2211 745 724 1454 22124 1820 --
NM_020476chr842348 2211 745 724 1454 22124 1820 --
NM_020477chr842348 2211 745 724 1454 22124 1820 --
NM_020478chr842411 2274 808 787 1517 22187 1883 --
NM_020480chr842348 2211 745 724 1454 22124 1820 --
NM_020525chr121175 ------
NM_020526chr131852 1729 175 --1235 --
NM_020532chr22586 33 1193 1317 --
NM_020546chr562886 2645 2224 910 374 57 11995 ----
NM_020638chr1261396 792 575 333 220 197 --1700 --
NM_020640chr32461 148 2701 249 --12205
NM_020644chr112749 90 --1759 --
NM_020647chr841570 928 789 725 ------
NM_020651chr221446 1336 1438 ----
NM_020654chr321512 1207 ------
NM_020663chr141612 ------
NM_020666chr52775 238 1624 ----
NM_020673chr20107719 7330 6875 6357 5821 5574 5563 2202 1164 1067 26416 2187 3676 550 347 --
NM_020686chr1672827 2778 2138 1252 979 629 257 ------
NM_020689chr2031254 1176 603 --21074 558 --
NM_020693chr112506 382 ------
NM_020697chr82426 259 --1205 175
NM_020699chr184861 4694 2136 1915 1746 1674 924 580 --11714 --
NM_020708chr2031622 1601 1572 ------
NM_020713chr2053061 2291 1045 739 427 --12099 22688 2307
NM_020718chr1685834 5376 3993 1439 1113 1024 881 710 24791 187 26499 516 --
NM_020727chr2133076 2965 2805 ----13479
NM_020728chr752716 2457 2116 807 469 21159 120 12640 --
NM_020732chr61277 ------
NM_020734chr1233219 2303 880 11264 1847 12604
NM_020739chr1574081 4026 3262 613 555 327 170 1283 13162 --
NM_020747chr51686 ------
NM_020748chr1741470 1426 739 191 ------
NM_020750chr6197 ------
NM_020752chr1062475 2254 2200 1943 980 857 ----1642
NM_020755chr6130 ------
NM_020760chr221539 1446 --1574 --
NM_020765chr11287 ------
NM_020766chrX114229 3860 3375 3145 3027 1564 1302 1062 935 798 395 ------
NM_020768chr532598 2105 716 1162 ----
NM_020772chr17118211 7853 7591 7348 7273 5916 5770 2888 2636 2491 1897 26861 2271 36936 6736 5722 --
NM_020774chr1886021 5728 5664 5037 4935 2165 1921 243 --12049 --
NM_020775chr12208 34 --146 --
NM_020778chr1594749 4465 4458 4366 1816 1658 1528 1076 294 ------
NM_020779chr273201 2646 2585 1238 1222 1037 638 --22335 2069 --
NM_020783chr1821704 100 --21688 789 --
NM_020796chr531165 232 213 ------
NM_020801chr521691 750 ------
NM_020803chr451778 703 413 87 77 --12215 11481
NM_020804chr672592 2085 2009 1037 942 492 370 --22040 784 --
NM_020806chr143612 327 123 ------
NM_020807chr1621779 267 ------
NM_020808chr11745 ------
NM_020809chr112930 304 11708 21758 287 --
NM_020812chr19125 ------
NM_020819chr61109 ------
NM_020825chr1652873 2671 1014 925 93 --43155 3093 2942 2491 --
NM_020834chr1441686 1541 1285 92 1429 ----
NM_020839chr351333 1043 1000 651 594 11379 11479 --
NM_020841chr1253762 3053 3039 1008 749 1742 ----
NM_020845chr1231782 781 544 11734 1425 --
NM_020850chr1662763 2659 2489 2371 2248 514 13275 32924 1135 255 --
NM_020854chr1811533 ------
NM_020856chr193544 379 334 --2407 60 --
NM_020858chr1532348 1785 407 22051 274 2647 538 175
NM_020860chr43894 74 38 --1388 --
NM_020868chr21348 1423 2582 432 --
NM_020870chr422021 1594 11391 ----
NM_020871chrX1852 21734 116 ----
NM_020872chr331574 604 591 --11727 --
NM_020873chr31730 ------
NM_020888chr151568 801 784 256 114 --1400 --
NM_020896chr1131060 795 280 1759 --163
NM_020897chr131182 1078 365 ------
NM_020899chr172581 399 --21718 719 11867
NM_020909chr264028 3698 3005 2710 804 25 --1440 --
NM_020918chr1022813 830 --22238 518 12834
NM_020920chr142377 149 ------
NM_020921chr1422737 793 23581 2330 11371 23140 36
NM_020922chrX71895 1673 1537 583 521 355 319 ----11483
NM_020925chr12514 462 ------
NM_020935chr264429 3791 1714 978 235 62 13949 14556 --
NM_020946chr951768 1528 1517 538 329 11148 ----
NM_020948chr133170 2950 248 175 1326 --
NM_020952chr91356 ------
NM_020956chr1943656 1392 1258 768 11286 14020 --
NM_020958chr141269 ------
NM_020971chr193868 759 69 ------
NM_020974chr112647 507 ------
NM_020977chr452037 1758 1441 721 66 --22121 1851 --
NM_020981chr22528 289 ------
NM_020983chr1251860 1777 1731 926 509 --11937 --
NM_020987chr1021205 220 1416 ----
NM_020988chr1611114 ------
NM_020993chr1242599 1983 1914 817 ------
NM_021003chr142706 30 ------
NM_021005chr152995 408 ------
NM_021007chr232346 1680 420 --11665 --
NM_021032chr321650 469 11728 ----
NM_021033chr1362970 2847 2677 1164 988 222 --12736 --
NM_021038chr363213 3193 3136 2452 340 208 --1463 --
NM_021064chr631508 604 156 --1337 --
NM_021069chr461803 1608 1463 1421 60 46 ----11439
NM_021072chr532279 994 447 ------
NM_021076chr222543 87 --1526 --
NM_021079chr1733248 3066 2215 1964 ----
NM_021083chrX63371 3273 2937 2536 1405 843 33509 2347 791 ----
NM_021088chr261868 785 692 594 497 486 ----1300
NM_021090chr2273492 3479 1631 1145 793 628 193 --31869 1238 89 --
NM_021096chr2293243 2871 2817 2547 2233 1223 1157 818 47 --22810 2004 --
NM_021097chr222499 218 22542 484 ----
NM_021111chr931281 508 325 ------
NM_021116chr7158684 8643 8484 7883 7624 7514 6726 6601 6217 5882 3076 2124 2066 1916 768 15584 58924 6839 6273 2059 1955 --
NM_021117chr1151686 742 365 220 174 --11907 12244
NM_021120chrX----1677 --
NM_021127chr182481 222 11359 ----
NM_021131chr931478 1012 918 ------
NM_021136chr142719 512 ------
NM_021137chr171191 --21645 592 --
NM_021140chrX1471 1265 ----
NM_021145chr7----1720 --
NM_021148chr722122 725 11549 1321 --
NM_021151chr73985 384 24 ----1396
NM_021155chr1942585 2567 862 503 --12189 --
NM_021156chr2021103 1071 --1313 --
NM_021159chr431140 513 144 ------
NM_021161chr141564 ------
NM_021163chr753506 2773 2618 1131 771 12835 ----
NM_021165chr11720 178 ----
NM_021174chr82608 229 ------
NM_021177chr61238 ------
NM_021183chrX32339 973 894 ----11882
NM_021190chr131326 1070 476 1548 ----
NM_021191chr1231955 1775 168 ------
NM_021202chr2062333 1949 1921 1126 380 222 1394 32512 2184 897 --
NM_021222chr151348 1317 937 236 184 ------
NM_021224chr91152 1418 ----
NM_021229chr1251083 896 324 308 30 ------
NM_021237chr32304 227 ------
NM_021238chr1221657 818 --12013 --
NM_021239chr1421158 342 ------
NM_021240chr94492 171 80 62 ------
NM_021244chr6----1176 --
NM_021252chr1061953 1387 1332 811 796 49 --1231 --
NM_021253chr661391 1083 443 377 127 114 ------
NM_021255chr1454073 3658 1023 744 75 12572 23694 3017 --
NM_021259chr1641039 874 173 70 ------
NM_021572chr6----1976 3372 330 316
NM_021614chr52257 199 ------
NM_021619chr941327 1276 1062 162 11184 ----
NM_021622chr1042206 1953 1870 910 22257 2017 ----
NM_021633chr111199 --1275 --
NM_021637chrX2226 197 ------
NM_021638chr464931 4529 3732 595 454 288 24612 998 23916 190 --
NM_021643chr221450 293 --11815 --
NM_021644chr10140 ------
NM_021647chr484655 4536 3801 3169 1033 548 518 74 33928 278 130 --1751
NM_021705chr61300 ------
NM_021728chr141747 ------
NM_021809chr2051678 1580 1007 853 296 ------
NM_021813chr6105703 5474 5324 5252 5163 2207 1497 1092 734 187 ------
NM_021814chr621518 1316 11534 1586 --
NM_021818chr142996 210 --1336 --
NM_021905chr612063 11466 21936 1857 --
NM_021907chr21108 --1259 --
NM_021911chr575444 5364 2126 2052 2038 826 367 21148 116 ----
NM_021912chr1533522 3393 723 ------
NM_021913chr1971792 1754 1431 1355 179 78 70 194 ----
NM_021914chr1442192 2179 588 405 --1512 --
NM_021931chr2011065 ------
NM_021935chr31975 141 ----
NM_021940chr6160 11499 ----
NM_021942chr4--1844 ----
NM_021945chr693532 3093 2980 2716 2610 2364 1379 976 628 --13542 1266
NM_021947chr1731331 503 366 1853 ----
NM_021949chrX62599 1862 1167 631 203 144 12260 1773 --
NM_021951chr93924 790 54 ------
NM_021954chr1383141 2857 1452 1141 819 441 216 70 23449 3070 33401 2957 929 --
NM_021958chr11309 1320 ----
NM_021960chr122674 2142 ----12233
NM_021961chr1167519 6592 5825 5429 2829 1091 14672 37148 2117 1807 --
NM_021962chr174808 634 541 164 --22003 358 --
NM_021963chrX--1733 ----
NM_021964chr3106349 4569 4026 2531 2480 1421 926 514 395 204 ----136
NM_021970chr4------128
NM_021973chr42578 179 ------
NM_021977chr673316 3170 2942 2668 572 556 516 23261 2884 1940 11300
NM_021984chrX31250 1144 472 --11096 --
NM_021987chrX31250 1144 472 --11096 --
NM_021990chrX31250 1144 472 --11096 --
NM_021994chr731073 851 177 1263 1955 --
NM_021998chrX51532 1313 1135 471 388 ------
NM_021999chr131537 2246 161 ----
NM_022037chr23683 278 218 ------
NM_022048chr1586189 5051 4921 4450 4158 3962 1005 53 --21041 753 12018
NM_022049chr121481 376 11539 1401 --
NM_022051chr1------1569
NM_022060chr1431301 873 418 ------
NM_022068chr182633 163 ------
NM_022073chr1421599 1474 ----1335
NM_022075chr11795 179 ----
NM_022085chr631404 1270 532 ------
NM_022091chr632088 1733 848 1958 ----
NM_022093chr12911 310 1610 ----
NM_022114chr174466 4185 3934 3136 1832 1153 967 11403 ----
NM_022116chr74913 794 335 26 --11125 --
NM_022117chrX2419 98 ------
NM_022118chr131151 ------
NM_022123chr14----186 --
NM_022124chr104251 200 188 165 ------
NM_022130chr51294 11239 ----
NM_022132chr51415 1135 ----
NM_022133chr821742 1461 ------
NM_022137chr1441954 1915 1646 1615 --31996 1404 133 --
NM_022138chr62285 125 --1101 --
NM_022165chr19------166
NM_022166chr1665609 4796 4512 2386 1701 489 44599 2178 1655 1576 36137 4999 1828 --
NM_022170chr741644 1607 1152 98 --1555 --
NM_022173chr23683 278 218 ------
NM_022340chr383630 3494 2311 1408 809 624 552 359 --32698 156 22 --
NM_022361chr61422 ------
NM_022367chr13557 104 37 ------
NM_022373chr7----2787 361 1900
NM_022455chr51112 ------
NM_022456chr12117452 7393 6186 6077 5105 4952 3047 2978 1649 1635 418 36435 4893 3004 36107 5170 2123 16721
NM_022459chr13106085 5609 5041 4358 4345 4156 2415 2098 1728 1604 11257 15337 --
NM_022465chr1222636 2274 3578 504 349 --12413
NM_022469chr142934 987 426 127 23083 2347 ----
NM_022473chr1573596 3307 3224 1425 1026 747 174 --21312 818 --
NM_022474chr1421856 543 ------
NM_022475chr41568 1602 ----
NM_022476chr16----2422 31 --
NM_022479chr721449 1424 ------
NM_022483chr531806 1687 586 ----1694
NM_022484chr72126 100 --1251 --
NM_022491chr1232550 1381 1190 13125 1155 --
NM_022494chr101339 ------
NM_022496chr122456 83 ------
NM_022497chr373752 3186 2854 2492 1497 628 524 2942 881 2998 838 --
NM_022552chr21408 11199 ----
NM_022566chr153594 416 177 ------
NM_022572chr241747 1731 1645 397 11399 21621 1249 --
NM_022644chr171201 171 ----
NM_022650chr53902 263 101 ------
NM_022652chr122814 364 1886 ----
NM_022658chr121167 ------
NM_022659chr8------1145
NM_022716chr122774 555 22196 771 12059 --
NM_022719chr2292490 2454 2385 1402 1394 948 662 650 283 1726 13844 --
NM_022728chr71679 ------
NM_022731chr11223 ------
NM_022733chr12300 273 ----1250
NM_022735chr111602 1104 ----
NM_022737chr1941294 1269 519 141 ------
NM_022739chr171965 ------
NM_022748chr752757 1976 1801 1135 82 ------
NM_022749chr8----11391 --
NM_022753chr152032 1717 742 366 141 32439 1758 716 ----
NM_022758chr651044 651 411 332 244 --23083 2326 --
NM_022763chr332201 667 288 21242 1021 1155 12490
NM_022771chr123798 325 34 1837 1309 --
NM_022776chr321253 133 21295 230 ----
NM_022781chr962753 2609 2140 1079 979 736 32695 2132 371 12229 --
NM_022821chr1------151
NM_022824chr541492 1271 437 389 ------
NM_022826chr22960 423 21086 1076 ----
NM_022828chr531246 141 113 ----1717
NM_022831chr181851 1806 1446 1323 1222 524 389 336 --11660 --
NM_022832chr442596 2391 957 477 --31795 1680 727 --
NM_022840chr1831040 527 50 ------
NM_022841chr1512691 ------
NM_022843chr1341400 1330 1211 525 ------
NM_022844chr161971 ------
NM_022845chr1642160 1856 248 33 1308 ----
NM_022893chr212996 --12348 12680
NM_022894chr241679 1418 1283 488 ------
NM_022898chr1444514 3872 3161 27 --34632 963 664 11383
NM_022900chr751110 415 322 70 42 ------
NM_022901chr921617 1586 ------
NM_022902chr51323 ------
NM_022912chr283075 2820 2741 2649 2225 1230 209 35 --11034 --
NM_022918chr1142117 1886 1699 41 11494 ----
NM_022965chr431382 568 547 --2458 191 --
NM_022970chr1031360 1222 482 ------
NM_023000chr1441081 611 483 280 --21652 394 --
NM_023001chr1441081 611 483 280 --21652 394 --
NM_023008chr19----1134 --
NM_023010chrX1518 --1660 --
NM_023011chr13----1336 --
NM_023012chr12----1775 --
NM_023016chr262747 2615 2061 1057 208 197 ------
NM_023037chr13----1324 --
NM_023039chr51319 1346 ----
NM_023071chr122344 113 --1731 --
NM_023076chr1652396 2166 1105 813 807 --2993 386 --
NM_023079chr1751721 1395 641 261 201 --2650 248 --
NM_023923chr1103523 3492 3430 3178 2395 1201 876 544 198 83 --2761 137 --
NM_023925chr121250 ------
NM_023927chr511163 ------
NM_023940chr41302 ----1958
NM_023943chr31147 ------
NM_024007chr533028 268 214 12255 --1540
NM_024015chr171365 1132 ----
NM_024017chr1731409 1050 142 ------
NM_024019chr421082 424 ------
NM_024034chr202980 715 ------
NM_024037chr1----2135 31 1842
NM_024043chr1631391 1207 555 ------
NM_024045chr101182 ------
NM_024052chr1752414 2247 1990 454 73 1253 1263 --
NM_024054chr7----1336 --
NM_024063chr15175 ------
NM_024071chr142481 445 1585 ----
NM_024085chr23850 705 296 ------
NM_024090chr431905 630 207 ------
NM_024091chr5190 ------
NM_024095chr123561 198 153 ------
NM_024106chr191250 158 ----
NM_024107chr174530 238 228 56 --1584 --
NM_024122chrX1262 124 ----
NM_024165chr6188 --146 --
NM_024294chr651044 651 411 332 244 --23083 2326 --
NM_024297chr172154 103 ------
NM_024315chr71173 ----1313
NM_024320chr172168 25 ------
NM_024332chrX21501 680 1347 ----
NM_024345chr965171 5042 4744 2122 208 179 33925 1947 1401 25915 1577 --
NM_024408chr173436 3158 2610 2562 930 486 433 ----1791
NM_024491chr3----1622 --
NM_024496chr14--1547 ----
NM_024503chr1264 25 --1140 --
NM_024522chr141318 528 136 28 ------
NM_024524chr362668 2662 2006 1958 1240 824 --13094 --
NM_024529chr131131 825 340 ------
NM_024539chrX--1343 --11077
NM_024546chr132803 66 ------
NM_024548chr321341 1259 1348 --1243
NM_024551chr1262527 2308 2265 968 688 51 --12016 --
NM_024551chr1262527 2308 2265 968 688 51 --12016 --
NM_024567chr8------150
NM_024569chr142965 2038 1180 1028 11811 ----
NM_024574chr4--158 ----
NM_024582chr43746 716 309 ------
NM_024595chr12940 59 --11008 --
NM_024607chr874355 3716 1735 1278 1104 799 424 11382 33328 1616 985 14449
NM_024612chr1761100 1082 979 814 758 106 ------
NM_024615chr51229 ------
NM_024617chr91882 ------
NM_024624chr221502 372 ------
NM_024640chr12847 184 ------
NM_024643chr141147 ------
NM_024645chr821223 605 ------
NM_024646chr163231 2886 1228 1171 500 242 24012 3824 22769 1582 --
NM_024652chr1521080 416 1844 ----
NM_024663chr202336 46 ------
NM_024665chr343992 3203 2982 551 11207 ----
NM_024667chr1231285 1233 1201 ------
NM_024670chr1021364 532 --11550 --
NM_024674chr153032 2331 646 476 457 --22466 634 --
NM_024686chr1--1437 ----
NM_024692chr211282 11628 ----
NM_024699chr82694 321 ------
NM_024700chr11965 --1206 --
NM_024702chr172605 49 --188 --
NM_024705chr1341128 824 447 229 --142 --
NM_024713chr1551335 1283 1151 1076 253 ------
NM_024721chr861946 936 897 749 741 304 ------
NM_024740chr11103385 2736 2561 1659 1101 989 942 566 397 34 --11091 --
NM_024744chr242642 1959 1644 168 ------
NM_024745chr162311 303 --1720 --
NM_024749chr121884 1435 --165 154
NM_024755chr15----1747 --
NM_024757chr95983 935 283 238 184 ------
NM_024761chr964562 4157 4088 583 286 159 ------
NM_024763chr131208 1022 477 ------
NM_024769chr1121060 726 ----1214
NM_024770chr286245 4363 4286 4220 2068 1746 1004 662 1434 36009 1949 678 --
NM_024779chr1261557 1493 1352 1159 1042 605 --1405 --
NM_024784chr112923 286 ----171
NM_024792chr171372 --1183 --
NM_024804chr11340 --1130 --
NM_024811chr1161394 1383 780 526 57 48 1569 ----
NM_024812chr832162 2097 1983 21950 369 ----
NM_024817chr1565391 4428 2149 1421 250 64 15418 34805 4545 324 --
NM_024828chr921610 1545 --1445 --
NM_024834chr1031333 683 460 1179 11688 --
NM_024881chr1943578 3182 2636 341 23667 3502 31086 852 298 --
NM_024884chr1434239 4123 3958 --1366 --
NM_024887chr151849 427 161 82 24 --1302 --
NM_024896chr91225 1724 ----
NM_024899chr181488 ------
NM_024900chr451931 1726 893 489 210 ------
NM_024900chr451931 1726 893 489 210 ------
NM_024915chr862687 2018 503 488 261 188 --11812 --
NM_024917chrX2899 855 ------
NM_024920chr421452 23 11618 ----
NM_024944</