TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1909-5p
miRNA Sequence: UGAGUGCCGGUGCCUGCCCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr82821 423 ------
NM_000038chr511407 --1192 11784
NM_000068chr1921423 47 --1564 --
NM_000080chr17179 ------
NM_000081chr1133 ------
NM_000084chrX44560 1757 1043 757 15890 1684 --
NM_000088chr17--2217 154 ----
NM_000109chrX12503 ------
NM_000115chr132641 252 22087 232 ----
NM_000117chrX2231 126 ------
NM_000125chr654224 3401 3327 884 385 13958 13760 --
NM_000129chr6132 ----11018
NM_000161chr1411625 21609 794 ----
NM_000163chr512280 ------
NM_000165chr61503 ----1105
NM_000168chr723235 2929 --1620 1674
NM_000176chr523624 2593 ----32921 2552 703
NM_000188chr102591 38 1295 ----
NM_000189chr222075 1484 12314 ----
NM_000192chr1221544 1202 1139 ----
NM_000194chrX1165 ------
NM_000210chr2--1493 ----
NM_000213chr17--1241 ----
NM_000217chr1275218 3687 2129 2092 1496 999 784 23271 985 14173 11253
NM_000222chr431820 754 667 11329 21832 1337 --
NM_000227chr181344 ------
NM_000232chr431226 711 699 ------
NM_000240chrX12268 ------
NM_000245chr712199 ------
NM_000248chr352938 2167 1042 485 23 ------
NM_000259chr1576136 4724 4466 4013 1284 1077 677 --11193 --
NM_000266chrX1247 ------
NM_000267chr1742664 1287 581 102 ------
NM_000278chr1011464 ------
NM_000280chr111272 ------
NM_000291chrX2240 74 ------
NM_000297chr432052 1680 137 --1414 --
NM_000314chr1032545 2383 419 11155 1277 --
NM_000321chr1321273 1207 ------
NM_000325chr4194 ------
NM_000332chr656755 5551 4635 404 317 26467 5109 22450 1390 --
NM_000333chr341122 1102 1094 71 1195 11023 --
NM_000335chr332193 1670 827 ------
NM_000337chr555059 4900 1936 1669 492 21424 459 --11068
NM_000346chr1711849 11770 ----
NM_000362chr221118 ------
NM_000365chr121442 ------
NM_000368chr983955 3945 1723 852 760 671 595 175 ------
NM_000389chr651291 1268 1153 229 169 --1473 --
NM_000393chr21643 ------
NM_000396chr13531 235 67 ------
NM_000399chr101463 ------
NM_000408chr231294 1139 1012 --13005 --
NM_000411chr2172565 2316 2187 1186 957 914 452 --12040 --
NM_000428chr1422341 2199 --21774 1042 --
NM_000430chr1752875 2798 294 242 47 ----13237
NM_000435chr193858 803 662 ------
NM_000449chr12517 71 ------
NM_000461chr344295 2885 511 171 ------
NM_000462chr15----11642 --
NM_000474chr72266 188 1634 ----
NM_000480chr1121178 234 1578 ----
NM_000484chr211715 ------
NM_000486chr121337 13251 --11113
NM_000489chrX--12538 ----
NM_000492chr731243 523 226 ------
NM_000493chr62379 44 ------
NM_000494chr10--1811 1824 155
NM_000503chr811776 ------
NM_000508chr4127 ------
NM_000522chr72907 129 ------
NM_000527chr1962168 1849 1634 1511 858 820 ------
NM_000533chrX1344 ------
NM_000555chrX87841 7109 5675 5437 1772 1571 244 62 37773 2622 374 17542 --
NM_000557chr20157 ------
NM_000572chr12857 645 ------
NM_000578chr241776 1645 1264 233 11478 21137 253 --
NM_000593chr62244 24 ------
NM_000599chr242971 1074 667 446 14642 ----
NM_000609chr1022499 107 33157 3129 1147 12532 --
NM_000610chr111436 13023 ----
NM_000612chr1122616 2377 22434 859 23512 496 --
NM_000615chr1133005 2880 428 12702 ----
NM_000618chr1264196 4081 1401 1012 598 426 22201 1729 12630 --
NM_000618chr1264196 4081 1401 1012 598 426 22201 1729 12630 --
NM_000627chr21334 ------
NM_000633chr1854566 1934 1761 1716 1580 --15183 --
NM_000635chr1911362 1369 ----
NM_000681chr1021306 96 ----182
NM_000682chr231260 537 302 --1518 1751
NM_000684chr1021227 1128 ------
NM_000702chr152252 2220 2014 1703 95 --12095 --
NM_000719chr1285317 5264 5021 2029 1507 1452 1065 700 14134 ----
NM_000720chr3191 ------
NM_000721chr12900 207 22697 1798 ----
NM_000723chr1741343 399 305 99 ------
NM_000725chr122227 96 ------
NM_000726chr21288 ------
NM_000739chr7197 ------
NM_000782chr20----2198 78 --
NM_000794chr51660 ------
NM_000807chr41192 ------
NM_000813chr564857 4528 3594 1904 638 402 33474 1592 1345 ----
NM_000814chr151737 --13393 --
NM_000817chr2----152 --
NM_000828chrX41830 791 580 515 11482 ----
NM_000829chr1132220 1916 1487 12066 --12190
NM_000833chr16----11202 --
NM_000844chr31404 ------
NM_000868chrX1347 12055 ----
NM_000872chr1021436 1167 ------
NM_000875chr1585436 5346 2217 1815 1575 1107 626 280 ------
NM_000880chr81136 ------
NM_000885chr221513 850 1254 ----
NM_000891chr1773247 3184 3029 1379 1047 609 85 --11138 --
NM_000899chr1244423 3822 2974 198 --11133 --
NM_000901chr431679 1643 433 12008 ----
NM_000905chr71171 ------
NM_000917chr10136 --1821 --
NM_000918chr172795 24 ------
NM_000919chr51403 ------
NM_000922chr111177 ------
NM_000940chr7179 ------
NM_000944chr432053 1809 1477 ------
NM_000945chr221334 198 ------
NM_000950chrX23072 64 --23334 643 --
NM_000958chr52869 146 ----11141
NM_000962chr962414 2105 948 922 551 370 ------
NM_001001323chr1212917 ------
NM_001001344chrX3742 727 150 12170 1935 --
NM_001001389chr111436 13023 ----
NM_001001390chr111436 13023 ----
NM_001001391chr111436 13023 ----
NM_001001392chr111482 13069 ----
NM_001001394chr21567 ------
NM_001001395chr121692 ------
NM_001001419chr554163 1541 1331 853 253 13408 ----
NM_001001420chr554163 1541 1331 853 253 13408 ----
NM_001001433chr2033115 2317 316 ------
NM_001001436chr16183 ------
NM_001001481chr853446 2638 2482 152 56 12436 ----
NM_001001484chr1021929 448 ------
NM_001001521chr2184 ------
NM_001001549chr73914 658 403 12582 ----
NM_001001550chr73914 658 403 12582 ----
NM_001001555chr73914 658 403 12582 ----
NM_001001556chr1511162 ----141
NM_001001557chr82676 100 11940 ----
NM_001001664chr233616 844 442 13892 ----
NM_001001669chr532486 2150 261 ------
NM_001001928chr2297059 5766 5336 5330 2186 1974 835 625 421 15873 12857 --
NM_001001971chr101106 ------
NM_001001995chrX11183 ------
NM_001002033chr171112 ------
NM_001002233chr832042 2024 851 --11718 --
NM_001002255chr6161 ------
NM_001002257chr211433 1140 --22731 432
NM_001002258chr211480 1205 --129
NM_001002259chr12--1251 ----
NM_001002265chr101582 --1744 --
NM_001002266chr101582 --1744 --
NM_001002296chr81262 ------
NM_001002843chr152467 43 ------
NM_001002860chr1474700 2868 1815 1675 1456 300 236 11649 2859 261 13684
NM_001002909chr1742128 1748 621 404 11933 ----
NM_001003406chr2243236 3176 1040 818 --12547 --
NM_001003407chr1035079 4268 1356 15071 ----
NM_001003408chr1035079 4268 1356 15071 ----
NM_001003652chr1868256 6599 2026 1897 1587 118 --11670 --
NM_001003681chr2221990 1415 ------
NM_001003688chr4----2813 352 --
NM_001003694chr32524 419 ------
NM_001003712chr1253211 2730 2700 749 300 1523 ----
NM_001003786chr172499 23 ------
NM_001003787chr172499 23 ------
NM_001003788chr172499 23 ------
NM_001003800chr922298 485 --33261 2466 1265 --
NM_001003940chr1533258 910 891 --13734 11270
NM_001003942chr1533258 910 891 --13734 11270
NM_001003943chr1533262 914 895 --13738 11274
NM_001004065chr923321 902 23761 2765 11362 13958
NM_001004304chr1232013 543 222 ------
NM_001004317chr634547 2881 542 ------
NM_001004342chr135677 5410 293 --24903 3972 --
NM_001004419chr1224484 26 2929 534 ----
NM_001004439chr153832 301 118 ------
NM_001005242chr1211638 ------
NM_001005335chr191292 ------
NM_001005360chr193811 231 217 ------
NM_001005361chr193811 231 217 ------
NM_001005362chr193811 231 217 ------
NM_001005366chr12--1656 ----
NM_001005386chr23471 452 263 ------
NM_001005404chr1744367 3580 3208 538 ------
NM_001005408chr171195 ------
NM_001005463chr1022510 794 1415 ----
NM_001005473chr524215 740 ------
NM_001005619chr17--1241 ----
NM_001005732chr211207 ------
NM_001005733chr211207 ------
NM_001005743chr143246 184 96 ------
NM_001005744chr143246 184 96 ------
NM_001005745chr143246 184 96 ------
NM_001005746chr21288 ------
NM_001005747chr21288 ------
NM_001005781chr21117 ------
NM_001005845chr811290 ------
NM_001005910chr32606 76 --1169 --
NM_001005911chr32606 76 --1169 --
NM_001006115chr332047 1980 1921 12438 1955 --
NM_001006600chr552291 1747 1716 1535 871 --12040 --
NM_001006618chr91204 ------
NM_001006626chr7197 ------
NM_001006627chr7197 ------
NM_001006628chr7197 ------
NM_001006629chr7197 ------
NM_001006630chr7197 ------
NM_001006631chr7197 ------
NM_001006632chr7197 ------
NM_001006636chr2--1310 ----
NM_001006665chr11671 ------
NM_001007024chr1744290 4024 3209 2943 13295 ----
NM_001007025chr1744290 4024 3209 2943 13295 ----
NM_001007097chr934882 3857 1597 13197 ----
NM_001007102chr641223 334 193 31 ------
NM_001007156chr15178 ------
NM_001007189chr5156 ------
NM_001007226chr172297 269 1579 ----
NM_001007227chr172297 269 1579 ----
NM_001007228chr172297 269 1579 ----
NM_001007229chr172297 269 1579 ----
NM_001007230chr172297 269 1579 ----
NM_001007237chr122653 346 ------
NM_001007246chr2131819 1635 1436 ------
NM_001007257chr12497 242 1424 ----
NM_001007466chr675079 4779 4737 1960 632 327 244 15094 ----
NM_001007527chr51126 ------
NM_001007553chr12428 359 1419 ----
NM_001008222chrX41191 872 250 148 ------
NM_001008225chr73598 590 216 ------
NM_001008239chr1883562 2953 2386 1495 1264 1178 715 109 --3887 439 423 --
NM_001008407chr72650 416 ------
NM_001008408chr765051 4990 4476 2478 2093 1363 1411 ----
NM_001008495chr822038 243 12277 ----
NM_001008529chr1721292 1042 ------
NM_001008540chr2------1399
NM_001008541chr10--11707 ----
NM_001008541chr10--11707 ----
NM_001008660chr1111263 ------
NM_001008707chr1441788 1253 547 407 11598 --11741
NM_001009552chr81127 1590 ----
NM_001009566chr141197 468 323 191 1996 ----
NM_001009899chr365897 5230 5077 2612 1501 1059 1915 --14425
NM_001009955chr1136 ------
NM_001009955chr1136 ------
NM_001009959chr222111 214 ------
NM_001009993chr254333 1721 1691 1022 575 --23008 1332 --
NM_001010861chr1--1215 ----
NM_001010888chrX84165 3638 3189 2857 2829 1749 1444 471 13333 --13922
NM_001010895chr932065 1381 387 --11668 --
NM_001010908chr101510 ------
NM_001010924chr1021207 132 ------
NM_001010984chr111700 12238 --1974
NM_001011513chr473834 2922 1382 1173 771 559 193 ------
NM_001011553chr71699 ------
NM_001011666chr734682 1280 69 26604 2601 25577 1252 --
NM_001011708chr232395 996 382 11865 ----
NM_001011713chr141156 ------
NM_001011724chr131235 ------
NM_001011725chr131235 ------
NM_001012264chr141719 ------
NM_001012329chr112090 11925 ----
NM_001012393chr1164221 3239 1871 1650 1316 715 --11622 --
NM_001012398chr1651080 1072 421 227 30 1298 ----
NM_001012410chr3--149 ----
NM_001012420chr1542903 2062 969 795 12014 21105 980 --
NM_001012423chr1542903 2062 969 795 12014 21105 980 --
NM_001012426chr6----13417 --
NM_001012427chr6----13417 --
NM_001012507chr6138 ------
NM_001012642chr1531936 1746 805 ------
NM_001012751chr1011246 11346 ----
NM_001012761chr51270 ------
NM_001012968chrX32273 823 557 ----1630
NM_001012977chrX1945 ------
NM_001012979chrX169 ------
NM_001013031chr1022339 542 ------
NM_001013399chr61720 ------
NM_001013438chr32260 80 ------
NM_001013439chr31106 ------
NM_001013699chr12123 ------
NM_001013843chr151746 ------
NM_001014431chr142774 314 ------
NM_001014432chr142774 314 ------
NM_001014435chr161420 ------
NM_001014797chr10138058 7939 7837 7722 7569 7331 6153 5145 2631 1846 1760 1302 931 15891 16888 16738
NM_001014809chr41161 --2993 661 --
NM_001014812chr15--1446 ----
NM_001015045chr442398 1825 884 205 1803 ----
NM_001015053chr1731108 321 254 ------
NM_001015508chr8----141 --
NM_001015877chrX22005 1116 ------
NM_001017369chr421091 915 ------
NM_001017371chr21208 11054 ----
NM_001017395chr353648 2948 2351 1377 714 ------
NM_001017396chr271874 1844 785 578 423 298 147 1487 ----
NM_001017406chr1156 ------
NM_001017415chr11267 ------
NM_001017416chr11267 ------
NM_001017424chr12708 174 ----11654
NM_001017425chr12708 174 ----11654
NM_001017440chr777709 7098 6480 4983 3171 2573 167 --22726 672 --
NM_001017923chr1411569 ------
NM_001017926chr811544 ------
NM_001017962chr10136 --1821 --
NM_001017963chr143746 177 36 1809 ----
NM_001017969chr9140 ------
NM_001017977chr1--124 ----
NM_001017999chr11455 ------
NM_001017999chr11455 ------
NM_001018000chr11455 ------
NM_001018000chr11455 ------
NM_001018001chr11455 ------
NM_001018003chr8----2198 56 --
NM_001018050chr2272883 2807 888 845 798 705 665 ------
NM_001018052chr2272883 2807 888 845 798 705 665 ------
NM_001018054chr121158 398 ------
NM_001018056chr91391 ------
NM_001018064chr931560 202 37 11487 ----
NM_001018074chr523624 2593 ----32921 2552 703
NM_001018075chr523624 2593 ----32921 2552 703
NM_001018076chr523624 2593 ----32921 2552 703
NM_001018077chr523624 2593 ----32921 2552 703
NM_001018108chr1522300 445 --21870 113 22266 1913
NM_001020658chr11526 11060 ----
NM_001020658chr11526 11060 ----
NM_001020825chr521099 68 ----2396 27
NM_001023567chr1542295 1768 977 798 --1988 11858
NM_001023587chr311140 ------
NM_001024094chr523624 2593 ----32921 2552 703
NM_001024218chr141590 1752 ----
NM_001024226chr1----1212 --
NM_001024227chr1----1212 --
NM_001024228chr1----1212 --
NM_001024455chrX42153 2024 693 242 ------
NM_001024457chr21561 ------
NM_001024463chr15--1120 ----
NM_001024660chr311338 ------
NM_001024666chrX----1208 --
NM_001024680chr231802 1590 164 ------
NM_001024688chr8--12162 ----
NM_001024808chr1222297 924 --2817 719 12600
NM_001024847chr36642 608 573 273 224 182 32430 2368 918 ----
NM_001024855chr321910 252 ------
NM_001024937chr171499 ------
NM_001024947chr52816 428 ------
NM_001024948chr122552 953 --21209 181 --
NM_001024956chr1145197 4052 827 140 35109 4265 4041 11076 --
NM_001025068chr32719 183 ----11484
NM_001025069chr32719 183 ----11484
NM_001025076chr1046077 6021 2382 1103 35532 4624 264 1389 --
NM_001025077chr1037435 7379 2461 56890 5982 5103 1622 530 11747 --
NM_001025079chr353911 1242 1128 675 477 ------
NM_001025100chr1811395 44000 3194 2805 2690 13695 --
NM_001025105chr51442 --11076 --
NM_001025107chr162630 2487 2116 867 643 68 ------
NM_001025107chr162630 2487 2116 867 643 68 ------
NM_001025233chr122928 554 1649 12670 --
NM_001025242chrX41307 1019 508 86 ------
NM_001025243chrX41307 1019 508 86 ------
NM_001025252chr822744 2098 13223 ----
NM_001025253chr822744 2098 13223 ----
NM_001025266chr331510 1115 452 --24511 416 --
NM_001025356chr1232787 697 25 ------
NM_001025366chr641231 688 217 182 ------
NM_001025366chr641231 688 217 182 ------
NM_001025367chr641231 688 217 182 ------
NM_001025367chr641231 688 217 182 ------
NM_001025368chr641231 688 217 182 ------
NM_001025368chr641231 688 217 182 ------
NM_001025369chr641247 704 233 198 ------
NM_001025369chr641247 704 233 198 ------
NM_001025370chr641231 688 217 182 ------
NM_001025370chr641231 688 217 182 ------
NM_001025389chr1121178 234 1578 ----
NM_001025390chr1121178 234 1578 ----
NM_001025579chr171327 ------
NM_001025580chrX34169 2868 181 1657 --11341
NM_001025595chr411241 11575 ----
NM_001025603chr12517 71 ------
NM_001025616chr41379 1358 ----
NM_001025780chr9151 1430 ----
NM_001029858chr631131 921 356 22556 245 ----
NM_001029875chr5--1535 12993 --
NM_001029882chr11480 ------
NM_001029882chr11480 ------
NM_001029989chr152742 82 ------
NM_001029998chr42910 521 ------
NM_001030006chr1721807 400 --11642 --
NM_001030007chr1673011 2697 2602 1151 565 253 228 --31097 488 472 --
NM_001030055chr1454667 4300 3672 2899 1064 ------
NM_001030287chr1--11120 ----
NM_001031677chr51537 ------
NM_001031680chr152081 1584 899 755 103 12417 ----
NM_001031684chr211459 --11207 --
NM_001031685chr1--1250 ----
NM_001031692chr71267 ------
NM_001031694chr11834 --2613 49 --
NM_001031694chr11834 --2613 49 --
NM_001031695chr2265037 4391 1807 1629 1575 809 13523 11183 --
NM_001031711chr521274 524 --1487 --
NM_001031716chr23919 216 64 ----1894
NM_001031740chr151658 1446 1284 313 72 ------
NM_001031804chr1623998 3250 --11223 11076
NM_001031812chr532122 594 528 ------
NM_001032221chr941811 138 123 46 ------
NM_001032296chr1331091 852 769 ----12560
NM_001032380chr1031577 221 120 ------
NM_001033044chr131732 1607 384 11491 ----
NM_001033045chr284259 4031 3303 3092 1529 1461 1226 595 11173 ----
NM_001033049chr2131972 1668 745 ------
NM_001033056chr131732 1607 384 11491 ----
NM_001033057chr341829 1819 1459 660 ------
NM_001033081chr11164 ------
NM_001033082chr11164 ------
NM_001033087chr2033188 2873 244 --12079 --
NM_001033117chr364548 3224 1889 841 256 154 11678 11266 13987
NM_001033507chr11717 1530 --11449
NM_001033518chr721754 1141 ------
NM_001033519chr721754 1141 ------
NM_001033520chr721754 1141 ------
NM_001033551chr1753545 3515 2999 2918 65 33862 1531 480 1408 --
NM_001033561chr171195 1215 ----
NM_001033578chr862221 1783 1510 841 630 170 12302 ----
NM_001033602chr1332521 2216 954 --21921 592 1175
NM_001033723chr831940 1103 539 11709 ----
NM_001033756chr641165 622 151 116 ------
NM_001033756chr641165 622 151 116 ------
NM_001034841chr1675489 3786 2152 1886 678 441 106 12061 14973 --
NM_001034852chr144750 390 384 132 --1439 --
NM_001034954chr101959 1601 ----
NM_001034955chr101959 1601 ----
NM_001034956chr101959 1601 ----
NM_001034957chr101959 1601 ----
NM_001035chr1--1425 ----
NM_001035254chr951929 1585 683 310 128 11865 11748 --
NM_001035260chr1011309 1359 21401 656 --
NM_001037132chr75872 855 747 657 55 ------
NM_001037133chr75872 855 747 657 55 ------
NM_001037164chr751760 1622 1402 785 225 ------
NM_001037172chr32306 228 --21353 1081 --
NM_001037174chr232176 574 498 --11414 --
NM_001037317chr1--1215 ----
NM_001037331chr18----1195 --
NM_001037339chr111853 ------
NM_001037340chr111853 ------
NM_001037341chr111853 ------
NM_001037341chr111853 ------
NM_001037582chr411602 ------
NM_001037954chr1152911 2695 2478 2432 179 1430 13093 --
NM_001038702chr532403 2388 1764 31775 848 667 --1678
NM_001038707chr1----11689 --
NM_001038707chr1----11689 --
NM_001039029chr1251927 760 161 85 52 1560 1314 --
NM_001039348chr22158 28 ------
NM_001039349chr22158 28 ------
NM_001039468chr111249 ------
NM_001039469chr111289 --1119 --
NM_001039479chr1492258 2024 1923 901 828 638 624 559 435 ------
NM_001039538chr253609 3311 2409 1478 663 ------
NM_001039547chr3107712 7621 7535 7410 6742 5725 5513 2091 1527 647 ------
NM_001039570chr2274639 3893 2951 1728 1598 1387 1006 33919 1133 212 23107 483 11122
NM_001039571chr2274639 3893 2951 1728 1598 1387 1006 33919 1133 212 23107 483 11122
NM_001039590chrX53962 3832 3587 1076 355 ------
NM_001039591chrX53962 3832 3587 1076 355 ------
NM_001039618chr1165647 4833 4378 1700 1276 1190 ------
NM_001039619chr14--1248 ----
NM_001039664chr11228 ------
NM_001039690chr1611612 --12231 --
NM_001039711chr11966 ------
NM_001039712chr11966 ------
NM_001039802chr121392 137 ------
NM_001039840chrX75755 4796 4415 1397 504 487 201 ------
NM_001039888chr12189 163 ------
NM_001039937chr1344054 3475 2578 494 23434 81 ----
NM_001039938chr1311488 ------
NM_001040002chr1731242 938 148 ------
NM_001040097chr7--1156 ----
NM_001040098chr7--1156 ----
NM_001040099chr7--1156 ----
NM_001040100chr33124 108 28 ------
NM_001040142chr241969 1869 1680 1664 ------
NM_001040143chr241969 1869 1680 1664 ------
NM_001040144chr1611612 --12231 --
NM_001040146chr1611612 --12231 --
NM_001040152chr723868 402 ------
NM_001040153chr13--2760 170 ----
NM_001040158chr51201 ------
NM_001040202chr4----1521 --
NM_001040214chr62946 424 11730 ----
NM_001040272chr9----12337 --
NM_001040273chr1042044 1746 767 38 --21999 797 --
NM_001040284chr1655019 4882 4490 2187 1824 ------
NM_001040402chr44915 800 352 172 12494 ----
NM_001040429chr13229 23 ------
NM_001040436chr122617 405 ------
NM_001040445chr254268 3741 1942 801 337 1762 14367 --
NM_001040446chr541733 903 725 495 --1109 --
NM_001040450chr1522342 251 ------
NM_001040453chr1522342 251 ------
NM_001040455chr11--11359 ----
NM_001040619chr1--11570 ----
NM_001040653chr322306 871 --11723 --
NM_001040712chr933005 2695 2199 --179 --
NM_001040715chr162362 130 ------
NM_001042355chr1664845 3898 3577 1158 957 197 --11328 --
NM_001042368chr9--143 ----
NM_001042388chr18----159 --
NM_001042404chr121776 499 1469 1777 --
NM_001042410chr21167 ------
NM_001042412chr1664845 3898 3577 1158 957 197 --11328 --
NM_001042413chr963769 3468 3303 1420 1281 68 13384 ----
NM_001042430chr14--1150 ----
NM_001042453chrX11107 ------
NM_001042459chr31233 ------
NM_001042473chr1022045 1534 ----1563
NM_001042475chr6--197 ----
NM_001042479chrX31941 675 511 ------
NM_001042480chrX31941 675 511 ------
NM_001042481chr1432159 2031 166 ------
NM_001042492chr1742664 1287 581 102 ------
NM_001042506chrX1945 ------
NM_001042510chr811339 ------
NM_001042511chr811339 ------
NM_001042517chr131654 ------
NM_001042533chr323123 2260 ------
NM_001042537chrX32250 532 202 --1752 --
NM_001042539chr16127 ------
NM_001042555chr1263407 3363 1259 1220 818 220 14715 21207 170 14667
NM_001042599chr267438 6646 6619 6528 5501 5074 37144 7017 1088 ----
NM_001042603chr1244134 3894 1363 478 ------
NM_001042604chr334169 681 188 24050 3681 1148 --
NM_001042616chr41167 ------
NM_001042632chr2032254 2166 1650 --1320 --
NM_001042633chr2032254 2166 1650 --1320 --
NM_001042646chr32797 87 11733 11417 --
NM_001042663chr121059 942 --1486 --
NM_001042664chr121059 942 --1486 --
NM_001042665chr121059 942 --1486 --
NM_001042669chr41379 1358 ----
NM_001042681chr1----22228 1972 --
NM_001042682chr1----22228 1972 --
NM_001042682chr1----22228 1972 --
NM_001042729chr11540 ------
NM_001042747chr11540 ------
NM_001042749chrX2481 326 11927 ----
NM_001042750chrX2481 326 11927 ----
NM_001042751chrX2481 326 11927 ----
NM_001043351chr122099 2089 ------
NM_001044305chr641450 1363 1066 400 ------
NM_001044385chr213303 --13746 --
NM_001044722chr532122 594 528 ------
NM_001044723chr532122 594 528 ------
NM_001045478chr13987 852 39 ------
NM_001046chr532832 2679 37 ------
NM_001048183chr162487 1415 949 760 136 83 ----1581
NM_001049chr1412059 11790 1897 --
NM_001065chr12----1414 --
NM_001066chr12858 646 11821 12172 --
NM_001071775chr131241 11395 ----
NM_001077628chr11180 ------
NM_001078chr11561 ------
NM_001079874chr141695 842 774 177 ------
NM_001092chr172357 105 ------
NM_001094chr172826 24 ------
NM_001099678chr366218 5302 4981 4585 3898 1466 25820 865 14769 11504
NM_001100108chr1128091 7867 7004 6292 6086 5657 5446 3339 2713 2626 1951 384 36768 5917 854 22072 1148 --
NM_001106chr398483 7519 7327 7120 3582 3213 2131 1691 650 --17455 --
NM_001111chr162630 2487 2116 867 643 68 ------
NM_001113490chrX33285 1075 553 1470 ----
NM_001116chr163911 653 611 23085 516 ----
NM_001117chr1811907 --21966 541 --
NM_001119chr431238 284 257 --1443 --
NM_001121chr101440 ------
NM_001124chr111537 ------
NM_001128chr1673011 2697 2602 1151 565 253 228 --31097 488 472 --
NM_001135chr15----1724 --
NM_001148chr451850 1441 721 304 134 --11758 --
NM_001149chr1021282 548 11345 ----
NM_001152chrX167 ------
NM_001160chr121469 2292 118 ----
NM_001167chrX76257 5422 5416 4465 4264 2644 2477 ----16725
NM_001172chr14155 1702 138 --
NM_001173chr1454667 4300 3672 2899 1064 ------
NM_001174chrX1152 ----2333 75
NM_001177chr1232376 1971 1685 ----12478
NM_001186chr2122145 768 ------
NM_001187chr211127 ------
NM_001189chr441062 827 56 38 11071 ----
NM_001200chr2011159 ------
NM_001201chr433420 2589 1509 --11079 12658
NM_001204chr277379 6301 5071 4858 4775 1528 211 ----15542
NM_001206chr932500 795 54 22944 2296 ----
NM_001222chr1021880 1795 1751 ----
NM_001237chr41936 ------
NM_001237chr41936 ------
NM_001241chr221803 821 1411 1713 --
NM_001241chr221803 821 1411 1713 --
NM_001254chr1741154 921 821 42 --1849 --
NM_001256chr1722004 616 ----12572
NM_001259chr775148 5086 2408 1583 721 542 392 22153 1826 25047 1134 12521
NM_001261chr92185 76 ------
NM_001271chr152202 142 --1256 --
NM_001282chr1721807 400 --11642 --
NM_001284chr52372 127 ------
NM_001289chrX11393 1638 ----
NM_001290chr41240 ------
NM_001298chr2--11307 ----
NM_001299chr191480 ------
NM_001304chr1722997 185 ------
NM_001310chr1222765 798 1915 ----
NM_001313chr41161 --2993 661 --
NM_001315chr631803 1659 904 ------
NM_001319chr1931058 717 690 ------
NM_001329chr10--1665 ----
NM_001332chr5----1312 --
NM_001343chr511695 ------
NM_001346chr332550 2377 2244 11008 1647 12085
NM_001356chrX----11897 --
NM_001358chr41422 ------
NM_001364chr1162999 1839 1262 851 688 373 ------
NM_001379chr191198 ------
NM_001383chr172302 151 ------
NM_001386chr811872 11927 ----
NM_001387chr512045 12987 ----
NM_001390chr1823323 3256 21241 839 12330 --
NM_001396chr211359 ------
NM_001397chr132674 700 76 --1238 --
NM_001400chr12418 32 --1927 --
NM_001401chr911100 ------
NM_001408chr121596 221 155 --1164
NM_001419chr1923758 3396 11280 ----
NM_001420chr1922598 160 ------
NM_001421chrX61754 1702 1625 691 543 354 ------
NM_001423chr1211420 ------
NM_001430chr251844 1835 1751 1505 765 ------
NM_001431chr61771 ------
NM_001432chr453653 3640 1278 737 654 23938 3071 ----
NM_001440chr831958 226 69 ------
NM_001447chr52376 233 1553 1890 --
NM_001451chr16----1928 --
NM_001452chr6--1671 ----
NM_001463chr21701 ------
NM_001478chr122695 92 ------
NM_001493chrX1602 ------
NM_001518chr71829 1297 ----
NM_001527chr624626 3707 --13652 --
NM_001530chr142963 903 ------
NM_001533chr191292 ------
NM_001539chr9132 ------
NM_001542chr122653 346 ------
NM_001554chr11485 --1426 --
NM_001569chrX41307 1019 508 86 ------
NM_001604chr111272 ------
NM_001617chr221242 229 ------
NM_001620chr111769 ------
NM_001655chr1141744 1703 819 796 11828 1836 --
NM_001658chr1----1212 --
NM_001662chr72368 309 ------
NM_001663chr14--1449 ----
NM_001664chr32250 229 --1379 1978
NM_001674chr1--11120 ----
NM_001676chr131168 ------
NM_001682chr1222631 1085 ------
NM_001689chr211480 1205 --129
NM_001693chr831153 69 27 1888 ----
NM_001695chr81891 23848 1028 ----
NM_001706chr31388 ------
NM_001707chr7149 1215 ----
NM_001709chr1112801 ------
NM_001718chr6--11092 ----
NM_001731chr121951 ------
NM_001735chr9--136 1140 --
NM_001743chr2----1441 --
NM_001744chr5138 ------
NM_001753chr711175 ------
NM_001755chr1672082 1471 850 683 492 303 151 11903 ----
NM_001759chr1245059 1329 973 881 ----11437
NM_001760chr61303 ------
NM_001769chr121291 ------
NM_001777chr353911 1242 1128 675 477 ------
NM_001788chr71699 ------
NM_001791chr121392 137 ------
NM_001792chr1821030 299 168 ----
NM_001794chr201214 --1235 --
NM_001796chr16137 ------
NM_001798chr12--1211 ----
NM_001830chrX61438 1205 1144 868 811 186 1847 11505 --
NM_001833chr9------1178
NM_001839chr11265 1556 ----
NM_001842chr91113 ------
NM_001843chr12----1165 --
NM_001858chr655071 3506 1633 1298 131 --1876 --
NM_001866chrX192 ------
NM_001873chr41680 ------
NM_001892chr51442 --11076 --
NM_001893chr171322 ------
NM_001901chr61419 ------
NM_001907chr16--165 ----
NM_001918chr1138678 7226 3662 3476 3319 2936 2601 1868 1648 1322 1023 541 329 ------
NM_001931chr112228 148 ------
NM_001944chr181456 ----1106
NM_001949chr621265 839 11188 ----
NM_001951chr81513 ------
NM_001964chr5----1442 --
NM_001968chr42655 348 ------
NM_001977chr421639 1383 --11171 --
NM_001981chr122133 952 ------
NM_001982chr1231064 828 194 --1278 122
NM_001991chr1732212 734 40 127 --1610
NM_001993chr15993 922 902 206 158 1287 ----
NM_001999chr51287 --1943 --
NM_002006chr443787 1951 1810 659 14166 ----
NM_002009chr1522623 1099 ------
NM_002010chr13--1177 ----
NM_002015chr1313045 1888 ----
NM_002017chr111563 ------
NM_002023chr13383 44 21 11291 ----
NM_002025chrX79268 7761 6375 1880 1815 1702 331 17940 ----
NM_002028chr1441241 1042 130 81 ------
NM_002039chr41285 ------
NM_002040chr212965 719 ------
NM_002044chr1511162 ----141
NM_002048chr9----1180 --
NM_002061chr141945 1735 1470 1261 --11374 --
NM_002063chrX1392 ------
NM_002065chr131732 1607 384 11491 ----
NM_002074chr121490 226 1480 --1396
NM_002076chr1223262 447 ------
NM_002077chr921987 225 21884 312 ----
NM_002083chr14199 ------
NM_002084chr5--1739 ----
NM_002085chr19------165
NM_002086chr172872 667 11548 12093 --
NM_002105chr1121039 730 --1290 --
NM_002126chr17196 ------
NM_002130chr52347 227 ------
NM_002136chr121235 ------
NM_002137chr722019 314 --1767 --
NM_002140chr911177 ------
NM_002146chr1711237 1953 ----
NM_002149chr23790 758 719 ------
NM_002154chr51215 ------
NM_002156chr21303 ------
NM_002158chr222974 1194 ------
NM_002160chr91106 ------
NM_002176chr9149 ------
NM_002182chr352289 2202 2191 1026 856 ------
NM_002192chr71553 --1447 --
NM_002193chr221253 1219 ------
NM_002203chr543013 2900 2804 1291 ------
NM_002210chr243143 2904 431 123 ------
NM_002214chr765675 3846 2215 2069 640 236 --14107 --
NM_002222chr341307 523 422 271 ------
NM_002226chr142929 852 --1248 --
NM_002227chr141294 1007 496 259 1252 ----
NM_002229chr19--1402 --1318
NM_002233chr111377 ------
NM_002239chr2121 1780 ----
NM_002247chr1032113 1796 312 ------
NM_002254chr22439 389 ------
NM_002264chr343165 2000 1835 1340 2268 122 ----
NM_002267chr1312312 11603 ----
NM_002268chr311806 ------
NM_002270chr524205 880 ------
NM_002290chr61973 ------
NM_002293chr122740 391 21999 758 ----
NM_002298chr1311046 135 ----
NM_002310chr522027 260 1520 178 --
NM_002313chr1035079 4268 1356 15071 ----
NM_002314chr721216 1081 ------
NM_002334chr1151877 1840 1788 375 247 ------
NM_002356chr632801 2177 72 ------
NM_002359chr1733946 3177 1547 24121 586 ----
NM_002374chr253609 3311 2409 1478 663 ------
NM_002375chr322206 1422 ------
NM_002382chr1421193 1011 ------
NM_002384chr181742 --150 --
NM_002387chr554627 3975 886 870 730 1286 1125 --
NM_002390chr1711604 --1202 --
NM_002397chr51206 --1126 1541
NM_002399chr15--1171 ----
NM_002422chr111250 --133 --
NM_002428chr1621194 968 --11264 --
NM_002429chr1221496 1148 --11021 --
NM_002444chrX31403 703 284 ------
NM_002455chr1146 ------
NM_002473chr2221150 172 ------
NM_002480chr12--11062 ----
NM_002485chr8--12162 ----
NM_002486chr941897 1686 443 150 ------
NM_002499chr1542041 1969 369 98 11937 ----
NM_002500chr22937 88 ------
NM_002501chr1923486 2878 13178 --11298
NM_002505chr6--1301 ----
NM_002518chr21990 ------
NM_002522chr17----22646 1177 --
NM_002526chr621463 537 ------
NM_002527chr12--1264 ----
NM_002544chr17134 ------
NM_002545chr1164221 3239 1871 1650 1316 715 --11622 --
NM_002546chr82590 131 --175 --
NM_002547chrX41654 1117 549 128 ------
NM_002556chr113727 470 392 ------
NM_002568chr81305 ------
NM_002569chr1511212 --147 --
NM_002570chr1521016 344 --133 --
NM_002572chr11161 --190 --
NM_002577chr331604 1235 688 ------
NM_002578chrX--1378 ----
NM_002581chr923806 1440 23966 1864 14778 --
NM_002588chr52626 598 --11091 --
NM_002590chr131144 ------
NM_002595chr1211867 ------
NM_002596chr111354 --1357 --
NM_002600chr111853 ------
NM_002605chr151848 1374 ----
NM_002608chr2211506 ------
NM_002612chr711346 1561 ----
NM_002613chr1654607 4361 3732 2077 789 --14498 --
NM_002627chr10178 ------
NM_002628chr341150 1042 477 355 ------
NM_002635chr121125 ------
NM_002649chr73242 165 107 ----11627
NM_002655chr894940 4881 4625 3632 2098 1940 1591 791 681 24247 1708 ----
NM_002656chr62749 347 ------
NM_002657chr2043747 3621 3089 143 12736 ----
NM_002662chr361691 724 431 246 227 100 --1623 --
NM_002670chr3--1398 11601 --
NM_002699chr111458 ------
NM_002709chr222246 723 ------
NM_002710chr121149 ------
NM_002715chr52901 802 1519 ----
NM_002716chr1123139 1329 1611 --13070
NM_002717chr83667 461 63 --1224 --
NM_002719chr1412132 --1658 --
NM_002721chr9194 ------
NM_002725chr153044 2832 1607 1391 37 13986 --11685
NM_002731chr142487 1142 155 45 ------
NM_002734chr17----11414 --
NM_002736chr71234 --1393 --
NM_002745chr2264294 1823 1792 1780 590 480 34571 3550 1154 1450 --
NM_002748chr151767 ------
NM_002752chr51366 ------
NM_002760chrY104439 4101 3890 2356 2210 2149 1823 1177 957 364 --14183 --
NM_002776chr1921850 1326 ------
NM_002779chr101220 ------
NM_002794chr1182 ------
NM_002813chr121281 --1179 --
NM_002823chr22480 154 ------
NM_002829chr91518 11106 1133 --
NM_002830chr22146 87 ------
NM_002833chr1511387 1532 ----
NM_002837chr1244567 4344 1290 1177 1832 ----
NM_002839chr933005 2695 2199 --179 --
NM_002840chr12273 215 --11324 --
NM_002841chr31448 ----123
NM_002843chr1132164 1017 214 ------
NM_002844chr621351 360 ------
NM_002848chr1251205 937 866 448 282 ------
NM_002858chr141212 1204 1004 885 ------
NM_002868chr1221611 969 --1150 --
NM_002874chr942320 1956 1603 838 21537 867 ----
NM_002892chr1441651 1636 483 393 184 --1281
NM_002893chrX2138 77 ------
NM_002894chr183190 176 72 ------
NM_002895chr202246 31 --1961 --
NM_002906chr11--1105 ----
NM_002912chr61651 ------
NM_002922chr11226 ------
NM_002930chr18168 ------
NM_002941chr321260 343 ------
NM_002945chr17--1791 ----
NM_002950chr3142 ------
NM_002953chr11671 ------
NM_002956chr12141 ------
NM_002959chr133280 2877 188 ------
NM_002968chr1621005 339 129 ----
NM_002970chrX1307 ------
NM_002971chr31390 ------
NM_002973chr121189 ------
NM_002998chr821697 1685 --1116 --
NM_003011chr91567 ------
NM_003012chr842991 1092 604 146 ------
NM_003014chr721128 58 21313 262 --11196
NM_003016chr1711768 ------
NM_003030chr311460 ----21317 43
NM_003036chr12976 763 ------
NM_003042chr33669 450 331 ------
NM_003045chr1333598 3446 1480 34447 566 524 11598 --
NM_003048chr232844 1097 408 --1456 --
NM_003060chr521031 903 --11228 --
NM_003068chr8179 ------
NM_003069chrX----1239 --
NM_003070chr9189 ------
NM_003074chr31511 --1845 --
NM_003076chr12----1423 --
NM_003081chr201280 ------
NM_003105chr11184 ------
NM_003107chr642400 2104 739 193 ------
NM_003108chr244435 2060 1653 445 --32915 2069 1032 --
NM_003111chr21208 11054 ----
NM_003112chr732743 2153 37 ------
NM_003115chr11389 ------
NM_003137chr622219 836 --21676 822 --
NM_003144chr621788 1502 1171 ----
NM_003149chr31510 11233 ----
NM_003150chr175842 628 453 447 54 22287 934 21488 163 --
NM_003155chr832548 1975 189 ------
NM_003156chr1121327 132 ------
NM_003164chr11191 --123 --
NM_003165chr941910 237 222 145 ------
NM_003173chrX1914 1218 ----
NM_003178chr311724 ------
NM_003189chr133212 921 223 11074 ----
NM_003192chr61383 ------
NM_003194chr62563 178 ------
NM_003199chr1821464 162 ------
NM_003205chr151512 --11607 --
NM_003216chr2221068 28 --13152 22746 322
NM_003217chr1221940 713 --11651 --
NM_003221chr643092 1500 1478 1131 ------
NM_003222chr201917 ------
NM_003234chr32868 127 ------
NM_003239chr141825 --1909 --
NM_003242chr36642 608 573 273 224 182 32430 2368 918 ----
NM_003246chr151529 1195 --1617
NM_003247chr611669 11976 ----
NM_003250chr17----1462 --
NM_003253chr2131389 1240 101 ------
NM_003255chr1731966 486 224 1330 ----
NM_003257chr151122 ------
NM_003262chr364977 3698 1048 172 95 85 13338 --11756
NM_003269chr631228 1200 150 11305 ----
NM_003270chrX2769 389 ------
NM_003274chr2131978 625 46 ------
NM_003275chr911508 ------
NM_003281chr121839 24 --1784 --
NM_003286chr2021064 808 ------
NM_003288chr2031581 1453 375 --11411 --
NM_003291chr132803 75 ------
NM_003292chr11661 --11752 --
NM_003295chr131152 ------
NM_003298chr386200 6046 4646 3974 1845 1301 951 420 35649 5153 432 ----
NM_003304chr321479 1022 ------
NM_003317chr142732 32 ------
NM_003330chr1231856 1446 730 ------
NM_003337chr521581 1366 1367 11485 --
NM_003338chr1011932 ------
NM_003339chr531229 1112 250 ------
NM_003342chr17277 62 ------
NM_003344chr7--1249 ----
NM_003347chr2232006 1944 496 156 1833 --
NM_003348chr1211197 ------
NM_003350chr831000 248 220 ------
NM_003358chr9----1145 --
NM_003360chr41224 ------
NM_003367chr191338 ------
NM_003368chr11267 ------
NM_003369chr1111923 31109 874 66 ----
NM_003374chr5----1300 --
NM_003376chr641231 688 217 182 ------
NM_003376chr641231 688 217 182 ------
NM_003383chr91391 ------
NM_003390chr1111092 1336 ----
NM_003400chr21232 ------
NM_003404chr2021794 475 11507 1209 --
NM_003405chr223250 172 132 ------
NM_003406chr821304 414 1433 ----
NM_003407chr191684 ------
NM_003409chr1811100 1114 ----
NM_003410chrX----1325 --
NM_003411chrY----1310 --
NM_003413chrX1206 ------
NM_003430chr19--1132 ----
NM_003431chr1--1172 ----
NM_003439chr773577 2902 2488 2276 1112 784 754 33455 3224 2589 1310 1940
NM_003442chr111602 ------
NM_003455chr1121150 562 ------
NM_003458chr363988 3599 3232 3118 1285 1254 23271 1184 ----
NM_003463chr642863 2661 1340 724 ------
NM_003466chr231978 1918 434 12440 ----
NM_003467chr2------1399
NM_003468chr223256 1751 11586 13909 --
NM_003471chr332323 310 297 11852 ----
NM_003478chr1121104 456 1236 1180 --
NM_003482chr1211803 ------
NM_003483chr1222366 754 ----1423
NM_003488chr17------159
NM_003489chr2132581 973 353 12613 ----
NM_003498chr1642350 2146 212 49 22555 2523 ----
NM_003502chr161646 182 ----
NM_003506chr821219 484 1102 ----
NM_003559chr1712544 13159 11017 --
NM_003563chr172297 269 1579 ----
NM_003565chr1241569 480 384 93 ------
NM_003566chr1222872 2337 ------
NM_003574chr1853839 2260 1547 1468 1370 11221 --25443 1069
NM_003576chr1331091 852 769 ----12560
NM_003583chr1253205 3183 2983 1234 604 23409 130 --13272
NM_003590chr243586 3086 392 39 2760 563 ----
NM_003592chr72343 325 ------
NM_003597chr222152 357 1271 ----
NM_003607chr133891 3056 1407 23381 245 33774 2650 1360 13715
NM_003613chr152655 94 ------
NM_003620chr171744 ------
NM_003629chr142710 847 165 35 --174 1706
NM_003670chr32568 420 ------
NM_003671chr92455 441 33331 2964 1191 ----
NM_003672chr111380 ------
NM_003677chr1232297 411 292 ------
NM_003702chr82804 520 ------
NM_003704chr4--1570 ----
NM_003705chr2192 1278 ----
NM_003718chr71414 ------
NM_003722chr342670 2236 380 59 1430 ----
NM_003725chr121417 ------
NM_003728chr41105 ------
NM_003735chr52626 598 --11091 --
NM_003736chr52626 598 --11091 --
NM_003743chr211922 ------
NM_003744chr143246 184 96 ------
NM_003749chr131859 ----1211
NM_003759chr444023 1619 688 267 ------
NM_003760chr12689 172 ------
NM_003763chr2033115 2317 316 ------
NM_003772chr111332 --1282 --
NM_003774chr1242991 781 767 574 12203 --11076
NM_003783chr121209 804 ------
NM_003787chr1821449 1308 ------
NM_003796chr191560 --1442 --
NM_003822chr142877 2534 858 89 ------
NM_003831chr1811199 --11803 --
NM_003861chr1432659 2607 992 1684 --22253 837
NM_003872chr212396 --12096 12104
NM_003884chr31125 ------
NM_003887chr242042 1880 1430 344 11672 ----
NM_003895chr214846 438 65 28 11496 ----
NM_003899chr1332329 2072 695 180 ----
NM_003901chr1022659 2042 ------
NM_003913chr654266 3739 3204 1293 665 23640 520 ----
NM_003916chrX31044 964 34 ------
NM_003927chr18--1302 1863 --
NM_003939chr1053951 3306 3208 3140 1165 --13734 --
NM_003941chr71927 ------
NM_003947chr311309 ------
NM_003958chr653944 2873 756 234 21 ----13713
NM_003972chr1021357 980 ------
NM_003980chr621100 278 ------
NM_003983chr1654011 3167 1279 1215 785 ------
NM_003987chr1011464 ------
NM_003988chr1011541 ------
NM_003989chr1011400 ------
NM_003990chr1011400 ------
NM_003994chr1244423 3822 2974 198 --11133 --
NM_003996chr6143 ------
NM_004006chrX12503 ------
NM_004007chrX12503 ------
NM_004009chrX12503 ------
NM_004010chrX12503 ------
NM_004011chrX12503 ------
NM_004012chrX12503 ------
NM_004013chrX12503 ------
NM_004014chrX12503 ------
NM_004015chrX12503 ------
NM_004016chrX12417 ------
NM_004017chrX12503 ------
NM_004018chrX12417 ------
NM_004020chrX12503 ------
NM_004021chrX12417 ------
NM_004022chrX12417 ------
NM_004023chrX12417 ------
NM_004040chr241237 921 895 449 --11141 --
NM_004050chr1422067 777 --11097 --
NM_004067chr72351 144 ------
NM_004075chr121432 ------
NM_004077chr1231027 1012 113 ------
NM_004085chrX1802 ------
NM_004093chr1331055 830 178 12390 1908 --
NM_004094chr1422925 1968 ----11909
NM_004098chr102505 358 ------
NM_004100chr612236 1444 ----
NM_004105chr22158 28 ------
NM_004109chr1142301 2046 1583 733 ------
NM_004114chrX1496 11127 ----
NM_004117chr612207 ------
NM_004124chr1422719 250 --11179 --
NM_004133chr832103 75 26 ------
NM_004156chr81127 1590 ----
NM_004161chr211331 ------
NM_004162chr31902 ------
NM_004200chr1142567 898 550 220 ------
NM_004203chr16124 ------
NM_004210chr1022136 230 ------
NM_004219chr5149 ------
NM_004226chr21108 ------
NM_004229chrX22036 149 11889 ----
NM_004232chr18128 ------
NM_004240chr19177 ------
NM_004277chr631222 688 140 ------
NM_004279chr71329 1323 ----
NM_004280chr6158 ------
NM_004293chr923702 1086 1577 12353 --
NM_004296chr1433102 2861 548 --161 12461
NM_004302chr1232796 1795 330 22103 648 22788 810 --
NM_004311chr1032996 1950 422 ------
NM_004329chr103888 314 155 11164 ----
NM_004330chr15--165 1970 --
NM_004331chr842634 2611 1032 174 ------
NM_004342chr72610 415 ------
NM_004346chr431148 112 66 ------
NM_004349chr81863 ------
NM_004350chr152081 1584 899 755 103 12417 ----
NM_004370chr612195 ------
NM_004378chr151206 ------
NM_004381chr6--1135 ----
NM_004384chr532122 594 528 ------
NM_004385chr51675 ----1173
NM_004389chr22686 579 ------
NM_004392chr1322397 1617 ------
NM_004393chr342369 2126 1811 1606 --11876 --
NM_004395chr5184 ------
NM_004397chr1123382 616 --1903 --
NM_004411chr71712 ------
NM_004414chr2131564 1451 25 ------
NM_004419chr102959 799 ------
NM_004420chr1142243 1959 632 348 ------
NM_004426chr1241973 1644 1350 783 ------
NM_004429chrX11153 --11219 --
NM_004430chr822369 1983 ------
NM_004432chr932223 2047 244 12278 ----
NM_004433chr141601 1452 1269 469 ------
NM_004434chr1441788 1253 547 407 11598 --11741
NM_004437chr123514 939 --1838 --
NM_004438chr242814 2405 75 56 ------
NM_004439chr4143 ------
NM_004447chr12139 1889 ----
NM_004449chr2121402 1082 137 ----
NM_004454chr342096 1794 1698 1624 ------
NM_004463chrX----1118 --
NM_004464chr443434 3416 1277 583 ------
NM_004474chr1135 --1133 --
NM_004480chr14--2682 232 ----
NM_004482chr21707 1649 ----
NM_004485chr112841 --14373 21248 162
NM_004491chr1983904 1521 1305 1130 1088 555 194 56 --23222 1235 --
NM_004497chr193699 215 172 ------
NM_004501chr123380 1303 ------
NM_004503chr121579 ------
NM_004506chr6177 ------
NM_004514chr1742450 1130 465 74 22773 796 ----
NM_004527chr1731242 938 148 ------
NM_004529chr9----1921 --
NM_004530chr163391 199 124 --11169 --
NM_004566chr1031633 946 813 ------
NM_004567chr322035 35 ----1622
NM_004571chr2142616 2561 2494 103 --13234 13304
NM_004583chr17--179 ----
NM_004586chrX55249 3764 3348 1729 874 33573 1792 395 14449 --
NM_004588chr1163901 3871 1163 559 550 420 ------
NM_004599chr221671 ------
NM_004600chr12624 506 ------
NM_004612chr943997 3931 1775 871 11406 1975 --
NM_004626chr11----1540 --
NM_004631chr121158 398 ------
NM_004634chr32524 419 ------
NM_004637chr331281 1040 330 --11111 --
NM_004655chr171194 11273 ----
NM_004656chr32830 237 ----1975
NM_004657chr21403 ------
NM_004660chrY32306 1931 1423 --21828 638 --
NM_004663chr1521428 1141 11265 1599 --
NM_004671chr181209 ------
NM_004684chr41352 ------
NM_004686chr81511 --11557 --
NM_004687chr1711835 --1511 11287
NM_004690chr61256 ------
NM_004703chr172719 31 ------
NM_004709chrX11721 ------
NM_004717chr731489 967 338 ------
NM_004719chr1252331 2273 1902 1016 805 ------
NM_004725chr102344 54 ------
NM_004726chrX74863 3988 3834 2207 1485 531 151 13931 ----
NM_004730chr532118 1620 1436 --2575 471 --
NM_004731chr1231422 1340 1248 ------
NM_004733chr31420 ------
NM_004734chr1322315 424 22627 210 ----
NM_004736chr182270 2243 1740 1489 489 479 356 329 ------
NM_004742chr311744 ------
NM_004745chr885996 5463 2070 1962 1572 1547 429 120 11214 ----
NM_004755chr1421138 753 ------
NM_004756chr1921271 1067 1507 ----
NM_004758chr17------1338
NM_004762chr171491 --11620 --
NM_004772chr541475 1347 1109 466 21548 305 1646 --
NM_004774chr17--12391 ----
NM_004775chr182918 61 --11958 --
NM_004781chr141358 1146 332 165 11736 11651 --
NM_004781chr141358 1146 332 165 11736 11651 --
NM_004796chr1422296 281 ------
NM_004798chr2022975 2282 12485 1971 1181
NM_004799chr12425 70 ------
NM_004808chr1053151 2939 1162 958 749 1687 ----
NM_004822chr1733726 984 191 --11108 --
NM_004824chr621160 1142 ------
NM_004830chr61882 --1299 --
NM_004831chr192164 27 ------
NM_004840chrX31722 1624 192 --12185 --
NM_004850chr241754 1543 583 490 ----11275
NM_004856chr151462 ------
NM_004857chr1464751 3804 3498 880 668 68 1311 ----
NM_004859chr1731073 1000 313 12288 ----
NM_004866chr554346 4131 1056 1033 303 ------
NM_004871chr1744290 4024 3209 2943 13295 ----
NM_004884chr153656 619 533 ------
NM_004887chr51164 ------
NM_004888chr9296 33 ------
NM_004893chr51201 ------
NM_004896chr1011224 1274 21316 571 --
NM_004898chr422072 328 12814 11074 --
NM_004904chr734682 1280 69 26604 2601 25577 1252 --
NM_004905chr12215 148 ------
NM_004921chr121902 146 --2969 364 --
NM_004924chr19199 ------
NM_004930chr1137 ------
NM_004936chr931049 555 403 22345 1204 ----
NM_004945chr193811 231 217 ------
NM_004947chr322346 637 2463 113 11946 --
NM_004948chr1821437 336 ------
NM_004954chr111249 ------
NM_004965chr211619 ------
NM_004968chr7------126
NM_004969chr10139 ------
NM_004974chr1--122 ----
NM_004984chr122174 32 ------
NM_004992chrX118202 7833 7712 7258 5820 5765 2670 2288 1533 774 247 --17684 --
NM_004992chrX118202 7833 7712 7258 5820 5765 2670 2288 1533 774 247 --17684 --
NM_004995chr142315 185 --1430 --
NM_004999chr694075 3864 3650 3542 3420 1775 628 441 45 --13578 --
NM_005009chr161286 ------
NM_005010chr75872 855 747 657 55 ------
NM_005014chr91591 ------
NM_005023chr511356 ------
NM_005028chr1022218 1485 193 ----
NM_005032chrX21101 997 ------
NM_005036chr2297059 5766 5336 5330 2186 1974 835 625 421 15873 12857 --
NM_005044chrX74172 2958 1702 1184 1039 826 181 ------
NM_005045chr72966 342 ------
NM_005056chr1244378 4138 1607 722 ------
NM_005065chr1445086 3863 1382 868 ------
NM_005079chr822744 2098 13223 ----
NM_005087chr31106 ------
NM_005095chr111518 ------
NM_005096chrX--1211 ----
NM_005119chr141130 1039 159 43 ------
NM_005120chrX1155 ------
NM_005121chr1723197 1136 12952 ----
NM_005124chr6--123 ----
NM_005126chr321737 617 1226 ----
NM_005134chr18----159 --
NM_005153chr16--1661 ----
NM_005156chr935408 5161 4865 ------
NM_005159chr1532207 1760 1490 ------
NM_005160chr2265575 5222 4512 1623 538 458 1819 14903 1675
NM_005163chr142774 314 ------
NM_005168chr251481 1352 1232 1170 450 ------
NM_005180chr1051131 673 615 467 298 ------
NM_005182chr161420 ------
NM_005184chr19162 1262 1534 --
NM_005190chr61720 ------
NM_005194chr201108 --1117 --
NM_005197chr1436092 2436 1690 ----24892 4032
NM_005204chr101291 ------
NM_005206chr1731219 1103 245 ------
NM_005216chr12504 210 ------
NM_005222chr71358 ----1869
NM_005230chr122206 118 ------
NM_005233chr322275 2030 ------
NM_005235chr267438 6646 6619 6528 5501 5074 37144 7017 1088 ----
NM_005238chr1122202 1096 12940 ----
NM_005241chr321310 1104 ------
NM_005244chr202685 472 ------
NM_005248chr11540 ------
NM_005254chr1531332 907 898 ------
NM_005256chr112609 380 ------
NM_005259chr21172 ------
NM_005277chr431847 1560 1528 1162 ----
NM_005284chr61355 --1176 --
NM_005297chr222589 344 ------
NM_005302chr7--1428 ----
NM_005308chr101452 ------
NM_005311chr73914 658 403 12582 ----
NM_005324chr172644 291 11997 ----
NM_005328chr81242 ------
NM_005329chr1611849 12359 --1296
NM_005333chrX--183 ----
NM_005334chrX299 93 ------
NM_005336chr242018 1409 292 237 ------
NM_005338chr753689 3477 2875 2767 1609 13019 ----
NM_005339chr422744 1028 --1102 --
NM_005342chrX4592 323 304 281 12818 32157 2106 255 11051
NM_005348chr143746 177 36 1809 ----
NM_005359chr1845174 4519 1852 1362 ------
NM_005370chr19--11293 1995 --
NM_005375chr61898 --1372 --
NM_005378chr21864 ------
NM_005380chr131078 383 99 ------
NM_005384chr9127 ------
NM_005386chr202294 123 ------
NM_005387chr111710 ------
NM_005400chr232827 880 141 21205 1030 1193 --
NM_005402chr711757 --11466 --
NM_005407chr141352 --1477 --
NM_005414chr3----1112 --
NM_005415chr2----1491 --
NM_005426chr1--1250 ----
NM_005433chr1822095 964 ----11113
NM_005435chr7----1567 --
NM_005436chr1043792 3531 2829 2722 13655 12520 --
NM_005443chr4174 ------
NM_005458chr972340 1893 1823 895 602 343 273 1756 1989 1142
NM_005465chr121996 1248 ------
NM_005474chr1731108 321 254 ------
NM_005476chr91432 ------
NM_005483chr19189 ------
NM_005487chr2221990 1415 ------
NM_005494chr73659 262 240 ------
NM_005497chr17115881 5754 5713 5372 5160 4467 4258 4186 3888 1582 315 24632 1240 ----
NM_005499chr192664 485 1137 ----
NM_005501chr1721131 222 ------
NM_005502chr923084 2287 ------
NM_005521chr10--1794 1585 --
NM_005523chr7--11594 ----
NM_005537chr131703 ------
NM_005539chr1031227 508 77 --1434 --
NM_005542chr721864 237 11935 ----
NM_005552chr141430 --1524 --
NM_005565chr51539 ----1423
NM_005570chr1811074 ------
NM_005573chr52677 556 ------
NM_005575chr51114 ------
NM_005578chr354601 4132 749 273 26 ------
NM_005587chr15----1272 1191
NM_005595chr1--1658 ----
NM_005596chr9106269 6043 5578 4928 1979 1625 1282 1024 1013 582 34427 1081 257 ----
NM_005598chr111288 ------
NM_005600chr11278 ------
NM_005603chr185695 689 540 452 241 194 ----
NM_005607chr8--1102 ----
NM_005614chr72755 263 ------
NM_005618chr61200 --1527 --
NM_005627chr62798 774 ------
NM_005632chr162963 58 ------
NM_005639chr1251206 481 453 125 104 11510 ----
NM_005647chrX83312 3249 3102 1371 814 808 802 113 23372 2351 1903 --
NM_005650chr221167 ------
NM_005665chr124114 1605 11213 ----
NM_005668chr521743 30 1280 --13521
NM_005686chr13607 136 94 ------
NM_005688chr31230 --1949 --
NM_005692chr7173 ------
NM_005693chr111131 ------
NM_005700chr111117 ------
NM_005707chr15136 --21137 115 --
NM_005715chr672464 2346 2322 1947 1053 877 587 --1717 --
NM_005722chr23471 452 263 ------
NM_005730chr1221280 870 --1477 --
NM_005734chr11--1615 ----
NM_005738chr751760 1622 1402 785 225 ------
NM_005746chr732355 2239 672 12733 ----
NM_005748chr1222708 493 ------
NM_005749chr171280 ------
NM_005751chr71344 ------
NM_005759chr254275 1806 568 557 378 ------
NM_005761chr121120 ------
NM_005768chr12166 ------
NM_005775chr8----2198 56 --
NM_005776chr142796 271 ------
NM_005779chr533336 1395 1174 --21010 928 --
NM_005786chr181467 11135 ----
NM_005789chr1721648 477 21709 1434 ----
NM_005796chr16------122
NM_005797chr1121749 395 ------
NM_005813chr242244 2189 1674 532 1857 ----
NM_005826chr11487 ------
NM_005832chr32988 490 ------
NM_005839chr11284 ------
NM_005840chrX37530 7402 5309 --11880 --
NM_005841chr4--11103 1781 --
NM_005842chr13194 ------
NM_005859chr511425 ------
NM_005862chr3--11027 ----
NM_005870chr1321051 222 1567 ----
NM_005871chr10--1260 ----
NM_005885chr5--1135 ----
NM_005888chr121125 ------
NM_005895chr1222681 1397 --23452 3224 --
NM_005898chr1153027 3003 2393 901 817 11257 1686 --
NM_005900chr4----2813 352 --
NM_005901chr1868256 6599 2026 1897 1587 118 --11670 --
NM_005902chr1531482 1134 851 1957 ----
NM_005903chr554163 1541 1331 853 253 13408 ----
NM_005904chr1821371 1171 ------
NM_005906chr641712 1508 647 125 ------
NM_005909chr544078 3912 1073 308 23151 982 1539 --
NM_005911chr221221 923 ------
NM_005917chr21185 ------
NM_005920chr113102 ----12652
NM_005924chr71124 ------
NM_005933chr1132396 2192 861 ------
NM_005934chr1921821 142 --12326 --
NM_005935chr424320 789 14558 ----
NM_005937chr1754154 3242 2618 984 366 ------
NM_005941chr811512 ------
NM_005955chr144645 3840 3585 2171 13718 ----
NM_005962chr10--11707 ----
NM_005962chr10--11707 ----
NM_005964chr171478 ------
NM_005966chr212397 2611 289 ----
NM_005977chr131280 ------
NM_006003chr19------1176
NM_006005chr41307 ------
NM_006010chr31197 ------
NM_006011chr1554205 4142 3383 1154 1147 ----14168
NM_006037chr264468 4382 3955 3597 3174 3148 ------
NM_006038chr201105 --1222 11808
NM_006040chr1631290 1063 466 ------
NM_006043chr161692 ------
NM_006047chr2022994 2452 ------
NM_006054chr1121364 109 ------
NM_006060chr754281 2795 1455 1411 576 ----13477
NM_006076chr742998 2984 590 85 12477 --12962
NM_006080chr722760 96 ------
NM_006084chr141310 ------
NM_006094chr8----1404 --
NM_006095chr443093 3051 677 451 ------
NM_006106chr1113398 ------
NM_006108chr112800 30 ------
NM_006109chr14--1248 ----
NM_006113chr141695 842 774 177 ------
NM_006135chr12409 401 ------
NM_006136chr711182 ------
NM_006141chr1652514 2498 1980 996 747 1535 ----
NM_006143chr12--1127 ----
NM_006148chr1732667 2061 2052 ------
NM_006154chr1522589 893 ------
NM_006159chr12--1580 ----
NM_006161chr51246 ------
NM_006164chr22451 395 ------
NM_006166chr1252278 2221 2068 1939 1772 ------
NM_006167chr832022 676 289 ------
NM_006180chr931560 202 37 11487 ----
NM_006186chr221069 217 ------
NM_006194chr1411277 ------
NM_006195chr921046 211 21206 49 ----
NM_006202chr1911372 11440 ----
NM_006203chr533538 1917 380 35497 4075 152 ----
NM_006206chr442762 2218 533 527 --11924 --
NM_006212chr165271 4955 4580 3821 534 22 ------
NM_006216chr21649 ------
NM_006224chr17123 12170 21721 581 --
NM_006226chr21944 2881 405 ----
NM_006237chr1331807 249 50 ------
NM_006245chr6----1141 --
NM_006246chr1411143 ------
NM_006252chr125808 4895 17173 ----
NM_006254chr31154 ------
NM_006255chr142751 192 1696 ----
NM_006256chr122206 783 12250 ----
NM_006258chr101148 ------
NM_006266chr9--143 ----
NM_006267chr221739 232 1448 ----
NM_006268chr1111050 1267 --1883
NM_006281chr8--1188 ----
NM_006281chr8--1188 ----
NM_006282chr2074446 4008 3388 1842 475 230 86 ------
NM_006283chr834633 4117 4056 13405 ----
NM_006292chr111173 ------
NM_006298chr651268 1244 1201 882 620 22957 2263 --12658
NM_006306chrX55246 2176 1139 792 127 --13684 1480
NM_006313chr1231670 1083 494 ------
NM_006315chr444277 3877 3238 1811 --1639 --
NM_006320chr41944 ------
NM_006321chr321924 399 ------
NM_006333chr21658 ------
NM_006334chr91290 ------
NM_006335chr151033 983 863 738 137 ------
NM_006345chr421049 912 ------
NM_006352chr131719 168 133 11509 ----
NM_006359chrX32250 532 202 --1752 --
NM_006363chr201212 ------
NM_006364chr141337 1466 ----
NM_006366chr62952 166 ------
NM_006367chr1----1767 --
NM_006371chr344558 3311 1980 1080 13652 11346 --
NM_006380chr1752857 2820 1619 643 357 ------
NM_006382chr171194 ------
NM_006386chr2211824 12173 ----
NM_006390chr1251557 1512 1141 140 129 ------
NM_006400chr121376 ------
NM_006405chr141102 ------
NM_006411chr61912 1780 ----
NM_006421chr821094 27 ------
NM_006434chr101959 1601 ----
NM_006449chr241932 365 308 242 11380 ----
NM_006454chr422951 145 ------
NM_006457chr473834 2922 1382 1173 771 559 193 ------
NM_006459chr1041860 1559 1276 753 ------
NM_006464chr243996 435 429 234 ------
NM_006467chr52415 233 1869 ----
NM_006469chr111116 --11425 --
NM_006472chr141198 1171 801 515 ------
NM_006482chr1253205 3183 2983 1234 604 23409 130 --13272
NM_006496chr12295 131 ------
NM_006516chr121501 1099 ----11627
NM_006517chrX1899 --11562 --
NM_006519chr6----1108 --
NM_006527chr43562 487 84 ------
NM_006534chr2072588 2426 1301 1262 925 919 719 --1251 --
NM_006537chr15195 ------
NM_006539chr16--2517 364 --1441
NM_006540chr811335 1243 ----
NM_006544chr1445370 2252 1312 1222 ------
NM_006546chr1744055 1463 1093 693 --36066 1079 247 --
NM_006547chr732018 272 74 22055 1752 ----
NM_006559chr12928 167 ------
NM_006561chr1046077 6021 2382 1103 35532 4624 264 1389 --
NM_006585chr21--151 ----
NM_006595chr1131282 537 72 ------
NM_006599chr1677454 7059 6577 5818 5763 1805 577 ------
NM_006601chr1211061 ------
NM_006603chrX2481 326 11927 ----
NM_006609chr242084 1158 270 70 ----1488
NM_006614chr333140 1441 184 ------
NM_006618chr121605 289 ----196
NM_006621chr1------11707
NM_006622chr51482 ------
NM_006624chr1042087 2080 1646 482 ------
NM_006626chr942335 2218 1960 446 ------
NM_006628chr1534504 3912 1145 ----14057
NM_006651chr411128 1363 ----
NM_006654chr1263407 3363 1259 1220 818 220 14715 21207 170 14667
NM_006660chr15187 ------
NM_006667chrX1109 ------
NM_006675chr1243335 294 275 82 ------
NM_006682chr742252 573 361 63 1923 ----
NM_006690chr2011764 ------
NM_006695chr17144 ------
NM_006698chr202167 52 1504 ----
NM_006699chr1--1418 ----
NM_006704chr13169 ------
NM_006713chr51285 ------
NM_006717chr923142 1046 ------
NM_006718chr62749 347 ------
NM_006720chr1035079 4268 1356 15071 ----
NM_006722chr352938 2167 1042 485 23 ------
NM_006729chrX35156 5041 657 178 ----
NM_006731chr985764 5257 5251 1806 1663 916 578 431 24260 3548 1753 --
NM_006734chr621167 218 1632 ----
NM_006738chr1553889 2949 1236 733 562 24195 4017 ----
NM_006745chr421091 915 ------
NM_006749chr821268 1059 ------
NM_006750chr1646945 5981 470 199 --16199 --
NM_006751chr2----182 --
NM_006756chr821287 1244 ------
NM_006759chr2184 ------
NM_006763chr111525 ----1480
NM_006765chr8------128
NM_006766chr822600 1698 1763 --1493
NM_006775chr6----1122 --
NM_006777chrX21860 371 11873 ----
NM_006783chr131280 ------
NM_006790chr51348 ------
NM_006791chr151490 ------
NM_006802chr111083 ------
NM_006805chr5--11461 ----
NM_006806chr211172 ------
NM_006807chr171241 ------
NM_006813chr62905 345 ------
NM_006815chr123916 526 378 ------
NM_006822chr171234 ------
NM_006823chr821216 1170 ------
NM_006826chr21514 ------
NM_006852chr171534 ------
NM_006857chr2--184 ----
NM_006874chr421069 861 ------
NM_006884chr311460 ----21317 43
NM_006885chr1643807 3724 725 267 1449 ----
NM_006888chr1413514 ------
NM_006898chr21786 ------
NM_006906chr112629 32 ------
NM_006908chr7--1114 ----
NM_006910chr16--1116 ----
NM_006912chr152534 2357 2299 1698 347 ----11627
NM_006914chr91330 1119 ----
NM_006915chrX21642 579 ------
NM_006918chr1145197 4052 827 140 35109 4265 4041 11076 --
NM_006920chr211291 1581 ----
NM_006924chr1752915 2779 1569 1175 124 ------
NM_006930chr52637 313 ------
NM_006931chr1231942 1741 132 ------
NM_006943chr2033220 710 587 22471 1082 11117 --
NM_006947chr431575 439 233 ------
NM_006948chr2122339 594 1309 ----
NM_006965chr1831165 1068 1056 132 ----
NM_006981chr92289 223 ------
NM_006988chr212354 254 ------
NM_006991chr32387 175 ------
NM_007005chr9145 ------
NM_007006chr1622543 2160 12611 ----
NM_007011chr1595627 5416 5328 4989 4322 2579 1477 1453 1430 25948 1208 34872 1951 615 22440 1863
NM_007023chr22893 786 1145 ----
NM_007030chr53183 65 25 15034 11176 --
NM_007033chr131637 763 171 12235 ----
NM_007034chr1138 ------
NM_007035chr121645 ------
NM_007038chr2155947 5209 4755 4620 1296 15192 ----
NM_007039chr144925 855 535 112 ------
NM_007040chr191183 11032 ----
NM_007045chr61588 ------
NM_007050chr2057801 7589 6032 2388 2135 22295 647 11343 16127
NM_007052chrX--1148 ----
NM_007064chr311338 ------
NM_007067chr172357 279 --1468 --
NM_007073chr641483 1416 975 68 --23558 1541 --
NM_007078chr1062771 2560 1897 430 395 375 ------
NM_007084chr132294 233 ------
NM_007096chr9------1178
NM_007106chr132689 378 1642 ----
NM_007114chr333013 1232 979 22097 237 ----
NM_007118chr51125 1814 ----
NM_007124chr61731 11277 ----
NM_007137chrX43967 3564 1858 1253 24205 4125 14307 --
NM_007146chr1732394 911 556 ------
NM_007158chr12428 359 1419 ----
NM_007166chr1111263 ------
NM_007174chr1241950 1839 881 243 1265 ----
NM_007189chr721206 159 ------
NM_007191chr121554 ------
NM_007200chr1553889 2949 1236 733 562 24195 4017 ----
NM_007202chr172754 554 ------
NM_007203chr923321 902 23761 2765 11362 13958
NM_007204chr12428 98 ------
NM_007212chr132105 868 73 ------
NM_007214chr6----1547 --
NM_007222chr811544 ------
NM_007236chr1552344 1967 1943 686 180 ------
NM_007246chr42103 83 ------
NM_007249chr13108058 6780 3694 3473 3000 2660 2553 2321 1590 246 18377 --1548
NM_007259chr11486 ------
NM_007270chr7--11520 --11413
NM_007271chr63742 602 589 ------
NM_007275chr32416 371 ------
NM_007278chr17----1119 --
NM_007286chr532121 1326 553 ------
NM_007324chr12425 70 ------
NM_007325chrX41830 791 580 515 11482 ----
NM_007331chr442400 2286 190 25 12613 1956 --
NM_007345chr1831769 231 65 ------
NM_007347chr1533159 1204 87 ------
NM_007358chr1132 ------
NM_007359chr1721245 621 ----11470
NM_007363chrX1224 ------
NM_007372chr171880 ------
NM_007373chr1021169 1149 ----11602
NM_007375chr142673 2460 1078 574 22787 981 12508 --
NM_012069chrX1555 --12137 --
NM_012081chr533518 3480 3295 ------
NM_012082chr81385 ------
NM_012095chr1043031 2189 2179 1042 11282 13302 --
NM_012096chr362798 2495 680 619 581 564 13260 ----
NM_012097chr232176 574 498 --11414 --
NM_012098chr931436 1333 994 ------
NM_012099chr191183 ------
NM_012102chr1----22228 1972 --
NM_012118chr41462 --1150 --
NM_012124chr111113 ------
NM_012137chr112217 ------
NM_012141chr1344054 3475 2578 494 23434 81 ----
NM_012153chr111359 ------
NM_012156chr2032816 1320 24 --12374 --
NM_012158chr1321293 750 --1742 --
NM_012161chr421088 60 ------
NM_012193chr1154562 3601 1528 1113 565 2999 641 ----
NM_012197chr931323 601 516 ------
NM_012199chr143233 1498 1003 711 24383 3712 13993 1721
NM_012214chr2106266 5841 5823 5610 5487 2149 1504 1293 1265 347 2959 820 15536 14287
NM_012215chr101493 --1764 --
NM_012229chr1031238 1024 182 ------
NM_012233chr24836 808 355 318 ------
NM_012234chr332651 2316 1169 1912 ----
NM_012236chr11834 --2613 49 --
NM_012238chr103606 517 226 1459 ----
NM_012242chr101118 ----1224
NM_012243chr12298 40 ------
NM_012247chr101325 ------
NM_012248chr161170 ------
NM_012257chr71859 1837 ----
NM_012259chr611286 ------
NM_012261chr20168 --1510 --
NM_012262chr155189 3550 1372 192 167 11233 ----
NM_012281chr722000 175 1580 ----
NM_012286chrX----1479 --
NM_012294chr762805 1422 1017 900 238 37 23007 1011 12735 --
NM_012297chr431714 585 56 1464 1487 --
NM_012300chr53475 401 375 1860 ----
NM_012301chr721862 1469 ------
NM_012302chr111001 --11009 --
NM_012304chr572089 1849 993 644 526 289 205 ------
NM_012306chr1243199 796 460 70 ------
NM_012308chr1131750 1707 615 1696 ----
NM_012309chr1164327 3531 3365 1154 504 366 ------
NM_012316chr1125545 4960 4857 4647 4529 4285 4126 3851 3729 3623 2018 443 ------
NM_012317chrX2802 183 1762 ----
NM_012320chr1611389 ------
NM_012325chr201140 ------
NM_012328chr721218 945 ------
NM_012329chr17----149 --
NM_012333chr131432 1030 292 ------
NM_012342chr10171 ------
NM_012343chr51781 ------
NM_012384chr2032456 830 677 12260 ----
NM_012399chr2211699 11667 ----
NM_012402chr1131384 1163 1050 1868 ----
NM_012405chr163875 3552 3195 2527 2389 1251 --13691 --
NM_012412chr71861 1606 ----
NM_012419chr62636 101 ------
NM_012434chr63518 358 86 ------
NM_012464chr412873 ------
NM_012479chr722168 408 ------
NM_012482chr11635 ------
NM_013227chr15----1724 --
NM_013229chr121469 2292 118 ----
NM_013230chrY--1508 ----
NM_013254chr122491 60 ------
NM_013255chr766487 5562 3029 1431 1080 625 17451 11921 --
NM_013256chr191504 1285 1265 --
NM_013257chr862221 1783 1510 841 630 170 12302 ----
NM_013261chr41632 12354 ----
NM_013262chr611134 ------
NM_013269chr1214411 2856 461 ----
NM_013275chr162627 130 ------
NM_013277chr124910 200 103 62 185 ----
NM_013281chr20--1372 ----
NM_013283chr51583 --157 --
NM_013316chr7----1850 --
NM_013323chr1721188 443 --21054 983 --
NM_013336chr321232 186 ------
NM_013341chr232395 996 382 11865 ----
NM_013354chr81431 1197 ----
NM_013372chr1532594 425 224 ------
NM_013374chr332160 443 102 ------
NM_013381chr1242264 1734 580 439 ------
NM_013382chr1422261 870 ----11507
NM_013390chr9166 --11739 --
NM_013401chr11----1722 --
NM_013423chrX--1158 ----
NM_013427chrX--1158 ----
NM_013433chr19------11511
NM_013436chr21657 ------
NM_013438chr91375 ------
NM_013448chr14--1148 ----
NM_013449chr121364 ----12150
NM_013450chr211220 ------
NM_013951chr231978 1918 434 12440 ----
NM_013995chrX52223 1036 810 751 498 1973 ----
NM_013999chr1731279 975 185 ------
NM_014011chr232257 585 293 --1618 --
NM_014023chr103968 731 308 ------
NM_014034chr631293 1256 965 1283 ----
NM_014038chr71318 ------
NM_014048chr1664652 3588 1687 454 448 230 --24680 1670 --
NM_014106chr1542344 2071 231 116 ------
NM_014112chr874897 4375 4316 4237 2013 1994 972 11817 ----
NM_014117chr162796 760 1724 ----
NM_014141chr763381 1851 1638 1474 683 280 12113 ----
NM_014155chr1156788 6782 1542 852 138 --1865 --
NM_014157chr1633795 758 409 --22899 216 23968 403
NM_014181chr222806 2796 ------
NM_014188chr11266 ------
NM_014189chr431238 284 257 --1443 --
NM_014190chr451590 1179 636 609 97 ------
NM_014191chr121424 ------
NM_014212chr121928 --1146 --
NM_014217chr12708 174 ----11654
NM_014223chr11292 ------
NM_014231chr123759 256 158 ------
NM_014233chr1731990 508 290 --11884 --
NM_014240chr363919 3708 2819 1589 1076 655 --12865 --
NM_014249chr152518 32 ------
NM_014250chr2221990 1415 ------
NM_014253chrX22450 1590 12180 ----
NM_014267chr11--1232 ----
NM_014268chr1821230 388 ------
NM_014278chr42434 158 ------
NM_014282chr921147 133 2872 466 ----
NM_014283chr111227 ----1113
NM_014289chrX--11363 ----
NM_014294chr821436 150 ------
NM_014305chr13193 ------
NM_014309chr2265027 4381 1797 1619 1565 799 13513 11173 --
NM_014319chr1211736 ------
NM_014325chr12199 1885 ----
NM_014333chr111574 ----12004
NM_014344chr111776 ------
NM_014351chr22--171 --1947
NM_014368chr942170 2067 1737 725 11699 --11527
NM_014372chr11417 11359 12043 --
NM_014382chr3--1295 1430 --
NM_014386chr5----1201 --
NM_014391chr10142 ------
NM_014393chr831517 783 442 11546 ----
NM_014410chr181135 1365 ----
NM_014415chr3--1596 ----
NM_014423chr535315 5154 3463 14832 1638 --
NM_014445chr321817 933 --1426 --
NM_014447chr411240 11574 ----
NM_014452chr62857 340 ------
NM_014454chr6167 1859 1669 --
NM_014456chr1041466 1171 117 98 ------
NM_014458chr121116 1027 ------
NM_014469chr11--1773 ----
NM_014470chr122730 218 ------
NM_014488chr11----2524 241 --
NM_014491chr71760 1423 ----
NM_014504chr73823 616 488 ----1286
NM_014507chr2221004 46 ------
NM_014517chr331868 1730 366 ------
NM_014547chr153727 595 580 ------
NM_014547chr153727 595 580 ------
NM_014554chr1222095 1425 1144 ----
NM_014572chr1311712 2369 269 ----
NM_014575chr31196 ------
NM_014586chr2174737 4609 4395 3881 3267 1844 81 1254 21713 1303 1325
NM_014588chr202708 55 --1216 --
NM_014593chr18134 ------
NM_014602chr3165 ------
NM_014612chr9--1251 ----
NM_014613chr532539 2516 2060 ------
NM_014614chr22585 153 ------
NM_014616chr342863 1307 544 282 12127 ----
NM_014621chr21100 ------
NM_014629chr831227 408 207 ------
NM_014630chr1521569 716 11310 1381 --
NM_014636chr944120 4056 2779 673 24015 1225 ----
NM_014646chr1853190 2843 2637 1284 974 ------
NM_014647chr1631976 1566 236 --11544 --
NM_014659chr15--1120 ----
NM_014660chr7--21093 283 ----
NM_014661chr1053876 2582 1459 1424 62 1968 ----
NM_014663chr13371 162 48 ------
NM_014665chr863406 3268 1214 1146 682 191 ----22961 447
NM_014666chr51189 ------
NM_014667chr342340 1593 961 738 12021 --11733
NM_014671chr71487 --11051 --
NM_014676chr11526 11060 ----
NM_014679chr112544 267 ------
NM_014682chr81259 1644 --11582
NM_014683chr1711652 ------
NM_014686chr1911685 22158 1936 --1873
NM_014701chr15--1826 ----
NM_014702chr643077 2454 493 61 ------
NM_014705chr7130 --185 --
NM_014706chr12--1805 --1793
NM_014707chr71367 ------
NM_014727chr191257 ------
NM_014729chr821873 276 1119 ----
NM_014730chr1223277 1947 --13675 --
NM_014730chr1223277 1947 --13675 --
NM_014731chr2021667 21 ------
NM_014732chr1695306 5180 4920 4863 3615 2201 1911 1557 418 22037 1104 21972 1154 --
NM_014733chr522028 1825 21879 308 ----
NM_014736chr152767 107 ------
NM_014739chr644180 3829 3814 1078 13943 ----
NM_014740chr17148 ------
NM_014746chr254280 3102 622 468 433 ------
NM_014747chr134535 3575 1602 --11580 --
NM_014751chr81133 1874 ----
NM_014752chr1131937 1339 584 ------
NM_014755chr263363 1700 1380 683 485 437 13235 ----
NM_014759chr81143 ------
NM_014761chr16--1845 ----
NM_014764chr12152 11248 1148 --
NM_014765chr1------12481
NM_014774chr132239 608 388 ------
NM_014779chr311094 ------
NM_014781chr81417 ------
NM_014786chr111150 1428 ----
NM_014787chr142280 2098 282 249 11039 ----
NM_014795chr21307 1947 ----
NM_014803chr1021084 901 1190 ----
NM_014807chr11----1580 --
NM_014810chr143436 3354 3083 757 ------
NM_014812chr121776 499 1469 1777 --
NM_014822chr41136 ------
NM_014824chr111353 ------
NM_014826chr133891 3056 1407 23381 245 33774 2650 1360 13715
NM_014827chr111624 ------
NM_014829chr51139 ------
NM_014835chr2031577 1421 871 --11513 --
NM_014836chr1031577 221 120 ------
NM_014838chr222575 385 1644 22066 113 12506
NM_014839chr142312 1905 1702 772 ------
NM_014840chr1253220 2942 710 228 119 ----1289
NM_014850chr364548 3224 1889 841 256 154 11678 11266 13987
NM_014872chr931613 600 568 22149 409 ----
NM_014873chr153583 1624 941 729 601 --14151 --
NM_014874chr111780 ------
NM_014876chr2231991 1892 1638 1215 11971 --
NM_014877chr1747140 6607 5816 552 --1631 --
NM_014883chr442398 1825 884 205 1803 ----
NM_014890chr31233 ------
NM_014891chr731596 1483 1271 ------
NM_014893chrY2914 170 ------
NM_014899chr52855 388 ------
NM_014900chr2127 ------
NM_014901chr52431 301 ------
NM_014904chr1023733 269 13377 ----
NM_014912chr104228 217 101 63 1397 ----
NM_014913chr1811439 ------
NM_014915chr1011447 ------
NM_014916chr71618 --1685 --
NM_014918chr15----1540 --
NM_014920chr623194 500 ------
NM_014923chr1341456 1436 104 91 --1168 --
NM_014925chr122393 164 ------
NM_014926chr321018 947 ------
NM_014927chrX----141 --
NM_014937chr1021278 232 ------
NM_014939chr1821101 370 11555 ----
NM_014944chr141197 468 323 191 1996 ----
NM_014947chr132741 2303 755 ----13137
NM_014949chr11861 ------
NM_014950chr1411664 ------
NM_014952chr1551957 1420 1311 78 60 ------
NM_014962chr202631 177 --12051 --
NM_014969chr14913 813 319 272 ------
NM_014974chr1021618 1568 ------
NM_014978chr1011170 --1163 --
NM_014982chr14152 25243 1566 ----
NM_014989chr621932 788 ------
NM_014990chr1411211 ------
NM_014991chr443273 2795 2586 75 ------
NM_014992chr14--1264 ----
NM_014994chr1572357 2320 1832 1616 900 486 463 --1388 --
NM_014999chr1231644 1386 195 ------
NM_015000chr1242172 824 672 237 1697 ----
NM_015002chr1222115 226 --12078 --
NM_015008chr353648 2948 2351 1377 714 ------
NM_015017chr11142 11240 11026 --
NM_015020chr1673698 3594 3327 1469 919 880 552 11367 168 --
NM_015025chr22761 649 11718 11929 --
NM_015026chr1244705 3780 1687 438 ------
NM_015032chr1312611 ------
NM_015037chr101244 ------
NM_015039chr122812 2679 1623 1161 --
NM_015040chr242876 1317 527 178 1742 ----
NM_015042chr1523519 219 11300 13901 --
NM_015045chr1032027 166 160 ------
NM_015049chr213122 22981 1291 ----
NM_015051chr932617 2208 692 12462 ----
NM_015052chr721132 389 11307 ----
NM_015054chr121178 ------
NM_015062chr101211 ------
NM_015064chr1253640 2855 2715 2595 982 ----13289
NM_015068chr732720 1087 984 ------
NM_015071chr546114 4389 4003 410 14576 66245 5877 4711 4434 2067 454 1294
NM_015073chr191606 --11527 --
NM_015074chr164087 1317 1108 944 177 137 13246 13700 11950
NM_015075chrX62232 1797 1719 1521 1406 648 1835 ----
NM_015078chr32266 47 ------
NM_015091chr14190 ------
NM_015092chr1644003 1760 1547 1223 3900 461 178 ----
NM_015093chr6----1502 --
NM_015094chr2274502 4362 1419 899 753 517 504 --31586 1014 728 --
NM_015097chr3------12053
NM_015102chr11131 ------
NM_015107chrX----170 --
NM_015115chr44915 800 352 172 12494 ----
NM_015116chr1331657 1500 622 1554 --1685
NM_015125chr191421 ------
NM_015129chrX31531 390 187 ----11766
NM_015130chr411125 ------
NM_015132chr71297 --1736 1712
NM_015137chr822218 594 11901 1551 --
NM_015138chr1522510 650 1319 ----
NM_015141chr332200 1743 542 12176 ----
NM_015143chr41257 ------
NM_015144chr1663728 3705 3448 2898 2616 672 --13196 --
NM_015149chr121748 1417 ------
NM_015151chr215866 655 330 276 158 ------
NM_015153chr6--1555 ----
NM_015155chr1063378 3185 2824 1062 859 559 ------
NM_015163chr141778 11244 ----
NM_015172chr121516 453 ------
NM_015176chr111209 ------
NM_015180chr141289 ------
NM_015184chr3--179 ----
NM_015192chr2012006 22124 763 ----
NM_015193chr811157 --11168 --
NM_015196chr4----1107 --
NM_015198chr7--21232 302 ----
NM_015199chr341111 414 295 141 12737 167 --
NM_015203chr1122 1196 ----
NM_015208chr1854051 3837 1124 827 314 ------
NM_015209chr11455 ------
NM_015215chr132691 799 204 12364 ----
NM_015216chr51180 11506 ----
NM_015230chr431577 392 136 ------
NM_015231chr111130 2792 78 ----
NM_015233chr1332521 2216 954 --21921 592 1175
NM_015236chr421201 91 ----1285
NM_015238chr5191 ------
NM_015239chr92206 178 ------
NM_015247chr1664845 3898 3577 1158 957 197 --11328 --
NM_015250chr93600 348 155 --21563 768 --
NM_015265chr212364 22701 328 ----
NM_015267chr12--22021 57 ----
NM_015268chr31188 ------
NM_015270chr1271968 1860 1749 1503 725 90 45 --1509 --
NM_015271chr454086 3831 3041 1534 1221 ------
NM_015275chr1221428 528 ------
NM_015277chr1841280 515 140 52 ------
NM_015278chr613212 1238 ----
NM_015282chr222841 321 12126 ----
NM_015284chr131986 589 489 --21819 271 --
NM_015285chr1832346 2204 346 ------
NM_015288chr533866 3195 363 --13292 --
NM_015291chr123492 3388 --12575 --
NM_015299chr1442524 1385 983 786 --11227 --
NM_015305chr1421682 286 11599 --1635
NM_015313chr1134500 3680 1099 --2920 769 --
NM_015317chr212401 ------
NM_015326chr1------11034
NM_015327chr1------1905
NM_015329chr1962644 2268 1828 527 496 227 11972 22438 1113 167
NM_015332chr743462 2490 1246 79 21193 532 ----
NM_015336chr122960 683 ------
NM_015338chr2041707 483 340 114 ------
NM_015339chr20187 ------
NM_015347chr1242676 2464 1902 1153 12290 ----
NM_015349chr642004 1041 637 283 12606 ----
NM_015355chr172610 106 ------
NM_015358chr211202 2292 136 ----
NM_015361chr22747 120 1872 ----
NM_015365chrX34169 2868 181 1657 --11341
NM_015374chr2241443 1277 1226 490 --185 --
NM_015375chr194362 3962 3783 3131 1980 1673 1188 937 726 ------
NM_015385chr101959 1601 ----
NM_015387chr211647 ----1196
NM_015397chr921922 484 ----1140
NM_015423chr1121587 498 ------
NM_015429chr31383 170 ----
NM_015435chr821427 148 1346 ----
NM_015443chr172211 43 ------
NM_015446chr11434 ------
NM_015455chr533088 3048 623 ------
NM_015475chr21691 ------
NM_015477chr15--164 ----
NM_015483chr721127 1020 1446 ----
NM_015488chr211620 ----21778 1646
NM_015497chr1531076 796 133 ------
NM_015508chr3--21358 219 1111 --
NM_015520chr332527 2517 2157 ------
NM_015530chr2--1842 1717 --
NM_015534chr11989 ------
NM_015548chr6--1958 ----
NM_015549chr141549 ------
NM_015550chr723482 2530 ------
NM_015554chr1541869 199 165 23 32195 1137 346 ----
NM_015557chr163632 2574 1117 863 451 330 134 ----
NM_015564chr543380 982 774 214 11203 ----
NM_015565chr21149 ------
NM_015567chr131851 ------
NM_015575chr213471 11235 ----
NM_015576chr31315 ------
NM_015577chr551750 1612 1331 473 381 ------
NM_015601chr10193 ------
NM_015608chr101587 ------
NM_015610chr721754 1141 ------
NM_015622chr7--191 ----
NM_015627chr1----1613 --
NM_015630chr21259 ------
NM_015635chr931983 464 122 ------
NM_015642chr3176 ------
NM_015675chr191564 ------
NM_015678chr1321107 679 1572 11369 --
NM_015686chrX21983 1848 ------
NM_015716chr171499 ------
NM_015718chr6125 ------
NM_015726chr141827 1246 619 98 --11492 --
NM_015833chr2131972 1668 745 ------
NM_015840chr162630 2487 2116 867 643 68 ------
NM_015841chr162630 2487 2116 867 643 68 ------
NM_015844chr181742 --150 --
NM_015846chr181742 --150 --
NM_015847chr181742 --150 --
NM_015850chr842387 1526 397 285 11682 ----
NM_015866chr12497 242 1424 ----
NM_015878chr8--11486 ----
NM_015879chr1866943 6626 6367 3413 1416 836 26438 2031 ----
NM_015886chr825047 4333 --1735 14574
NM_015888chr132724 2114 1096 --13000 --
NM_015891chr631417 1337 575 ------
NM_015898chr1931881 917 407 ----2774 559
NM_015902chr81737 --2798 631 --
NM_015905chr71495 ----1584
NM_015906chr153965 3902 3830 3029 2983 ------
NM_015913chr12744 135 1313 ----
NM_015916chr10134 --1231 --
NM_015938chr32302 275 ------
NM_015948chr6199 ------
NM_015980chr531319 565 90 --11211 --
NM_015986chr171251 ------
NM_015995chr1575076 3681 1996 1135 709 622 324 14848 23886 949 --
NM_016003chr721754 1141 ------
NM_016018chr82667 391 ------
NM_016019chr73877 730 363 ------
NM_016022chr11828 1227 ----
NM_016032chrX41191 872 250 148 ------
NM_016038chr72250 57 ------
NM_016041chr171127 ------
NM_016072chr1242442 1579 773 373 ------
NM_016075chr1322582 600 13106 22335 1959 --
NM_016083chr621180 556 --13055 1174
NM_016096chr811339 ------
NM_016098chr61345 1338 ----
NM_016099chr81262 ------
NM_016107chr51894 ------
NM_016123chr1241310 1098 928 474 ------
NM_016131chr242332 2157 2114 1995 ------
NM_016141chr3--1817 ----
NM_016151chr16144 ------
NM_016162chr12--1657 ----
NM_016185chr171112 ------
NM_016205chr421339 140 ------
NM_016206chr3108477 7875 7143 2736 2624 2308 1835 1819 1081 1054 ------
NM_016217chr613560 12265 11183 --
NM_016221chr552155 1464 454 302 155 --22322 608 --
NM_016224chr621688 751 ------
NM_016227chr111227 ----1113
NM_016247chr3------1492
NM_016248chr131291 --12432 11565
NM_016255chr643312 2680 1131 275 12783 ----
NM_016258chr11766 ------
NM_016260chr266846 5533 5034 2334 1920 721 36629 5369 65 22458 1554 --
NM_016264chr191143 126 ----
NM_016270chr192419 351 ------
NM_016272chr2242585 2136 2095 660 1499 ----
NM_016275chr31571 ------
NM_016277chr661559 1522 1223 553 492 372 ------
NM_016279chr5170 ------
NM_016281chr1211102 ------
NM_016287chr131627 662 155 --11812 --
NM_016289chr221719 317 --168 --
NM_016297chr262656 2444 2360 1243 1158 317 1187 1806 --
NM_016308chr131795 1654 630 11286 ----
NM_016320chr1121143 77 ------
NM_016322chr952970 2032 1045 734 517 ------
NM_016333chr161478 ------
NM_016339chr1721586 57 ----150
NM_016374chr131205 152 23 131 11129 1143
NM_016374chr131205 152 23 131 11129 1143
NM_016396chr1542155 2121 541 524 --12222 --
NM_016403chr113617 572 191 ----1638
NM_016422chr1141187 979 185 78 ------
NM_016424chr1721429 537 --21304 720 1708
NM_016436chr2042651 2394 2182 587 ------
NM_016441chr251676 831 630 175 81 --12325 --
NM_016451chr11176 ------
NM_016472chr1411089 11033 ----
NM_016475chr14--11115 ----
NM_016485chr6--1156 1779 --
NM_016507chr1721953 871 1315 1718 --
NM_016513chr623194 500 ------
NM_016529chr13--1258 ----
NM_016530chr1522603 1342 13364 ----
NM_016531chr443353 2879 1067 810 ------
NM_016538chr17----131 --
NM_016542chrX11107 ------
NM_016545chr12261 101 ------
NM_016577chr333761 2849 1386 --14244 --
NM_016586chr14--1411 ----
NM_016603chr532207 1478 78 12060 12223 1102
NM_016605chr5----1350 11029
NM_016607chrX--1468 11661 --
NM_016617chr13181 1799 ----
NM_016620chr11469 ------
NM_016621chr1153390 3339 3284 1200 665 12964 ----
NM_016626chr1831105 396 389 ------
NM_016628chr101649 --1664 --
NM_016644chr5169 1114 ----
NM_016654chr1531332 907 898 ------
NM_016823chr1731089 973 115 ------
NM_016824chr101440 ------
NM_016930chr41678 ----144
NM_016936chr161365 12095 1146 --
NM_016946chr1--22626 337 ----
NM_017415chr554147 4008 3401 3301 1433 --11171 --
NM_017420chr1452951 2930 911 715 421 ------
NM_017423chr421900 1775 1761 1782 --
NM_017447chr2122741 441 ------
NM_017456chr171491 --11620 --
NM_017483chr221242 229 ------
NM_017490chr111249 ------
NM_017519chr6--1266 ----
NM_017522chr121158 398 ------
NM_017548chr311997 1353 ----
NM_017553chr151159 ------
NM_017563chr315938 11266 34995 1703 418 --
NM_017567chr21119 ------
NM_017580chr1052337 2291 2035 1971 1722 11921 1435 1370
NM_017602chrX4767 258 163 43 ------
NM_017610chr15153 ------
NM_017628chr444280 2013 1886 1492 ------
NM_017629chr1--1751 ----
NM_017633chr642477 1556 1427 1364 12754 --12406
NM_017634chr8--1208 ----
NM_017635chr1121283 94 ------
NM_017637chr977934 7338 6099 3487 1443 1209 820 12063 13774 --
NM_017643chr1722049 550 ------
NM_017650chr745300 4844 3761 171 14998 25485 3734 15956
NM_017658chr1474441 3963 3321 1501 514 255 145 ------
NM_017661chr152467 43 ------
NM_017680chr9------11024
NM_017686chr121137 754 ------
NM_017694chr211580 ------
NM_017700chr41130 ------
NM_017709chr143410 3143 1352 86 --11260 --
NM_017714chr20136 ------
NM_017719chr311817 2317 295 ----
NM_017721chr191325 ------
NM_017737chr11642 ------
NM_017739chr1133 ------
NM_017752chrX41811 1757 823 179 ------
NM_017758chr1721506 449 ------
NM_017772chr621355 528 --11588 --
NM_017778chr841448 1248 527 128 ------
NM_017780chr81330 ------
NM_017784chr3--1287 --187
NM_017787chr1021868 1858 ------
NM_017811chr942192 763 529 222 ------
NM_017813chr875040 4476 4421 3898 3643 1154 877 ------
NM_017824chr1052392 2356 934 400 79 22292 139 ----
NM_017848chrX34173 3422 1390 11216 13313 --
NM_017856chrX31941 675 511 ------
NM_017887chr1151 ------
NM_017893chr101548 1984 11167 --
NM_017899chr12132 ------
NM_017902chr1024851 4841 55755 2050 2014 257 105 1171 --
NM_017910chr2190 ------
NM_017913chr9191 ------
NM_017933chr211366 21611 1034 ----
NM_017935chr41256 ------
NM_017943chr141138 ------
NM_017944chr1132722 2558 2236 11207 --12541
NM_017948chr91349 ------
NM_017958chr26993 782 481 286 214 69 ----12291
NM_017974chr221041 133 ------
NM_017988chr12--1701 1786 --
NM_017994chr712883 --12531 12960
NM_018011chr131618 ------
NM_018013chr642101 1221 1168 568 22594 1941 ----
NM_018017chr1031031 870 583 ------
NM_018027chr1062714 1249 998 540 241 219 --1313 --
NM_018030chr18--1841 ----
NM_018045chr142268 1048 922 69 1557 --12221
NM_018046chr521874 1384 ------
NM_018060chr1----1396 --
NM_018061chr12660 92 11658 ----
NM_018063chr101350 ------
NM_018070chr1136 ------
NM_018078chr41322 11074 ----
NM_018084chr221031 340 22994 711 1785 --
NM_018085chr196519 6134 2612 2127 1746 1417 1203 1068 81 22917 1627 ----
NM_018086chr231870 1605 109 ------
NM_018087chr1171 ------
NM_018089chr21167 ------
NM_018092chr1621088 512 ------
NM_018098chr3290 76 ------
NM_018105chr81912 ------
NM_018110chr161912 --1468 --
NM_018115chr41313 ------
NM_018116chr12516 119 ------
NM_018120chr821495 459 ------
NM_018121chr1022451 984 ------
NM_018126chr4155 ------
NM_018131chr10166 --1776 --
NM_018137chr13514 273 242 ------
NM_018150chr12893 198 ------
NM_018155chr31234 ----11348
NM_018157chr1222251 752 ----1185
NM_018159chrX41485 1100 187 89 ------
NM_018166chr11258 --129 --
NM_018171chr12--2665 271 ----
NM_018181chr1841760 1422 563 510 ------
NM_018182chr171588 12200 ----
NM_018184chr31833 21431 1397 ----
NM_018191chr1322074 42 ------
NM_018202chr12885 47 ------
NM_018206chr16--1301 ----
NM_018216chr11100 ------
NM_018240chr14570 319 247 79 1577 1309 --
NM_018243chr433314 2818 2606 132 ----
NM_018244chr2011251 ------
NM_018246chr832114 1764 939 --12736 --
NM_018247chr611919 --1239 --
NM_018254chr1--11829 ----
NM_018266chr3--1944 ----
NM_018287chr1041004 954 420 113 ------
NM_018293chr342753 2670 2556 773 ------
NM_018299chr853446 2638 2482 152 56 12436 ----
NM_018310chr8122 1436 1376 --
NM_018312chr1111536 1102 ----
NM_018313chr31719 11876 ----
NM_018314chr111711 ------
NM_018320chr1111166 2464 441 156 --
NM_018330chr1021277 692 ------
NM_018334chr71212 ------
NM_018362chr1122848 1393 --23083 2856 --
NM_018364chr143728 3026 1243 582 ------
NM_018367chr11--1452 ----
NM_018370chr1231800 1594 929 21967 469 12074 --
NM_018374chr735038 4706 3780 ------
NM_018383chr221739 673 ------
NM_018387chr9----1451 --
NM_018388chrX11008 11344 ----
NM_018403chr322994 669 ------
NM_018413chr121274 ------
NM_018416chr1211759 ----11836
NM_018424chr931359 195 49 11622 ----
NM_018429chr532191 2096 1108 ------
NM_018433chr21468 --1127 --
NM_018440chr8118043 7946 7505 7212 6386 6171 5880 5560 5268 1285 826 1335 26915 686 18682
NM_018442chr1--124 ----
NM_018445chr15--1226 ----
NM_018462chr31220 ------
NM_018482chr821829 599 1247 ----
NM_018486chrX1447 ------
NM_018488chr17170 ------
NM_018489chr14585 355 292 140 --11786 --
NM_018490chr112512 89 11873 ----
NM_018527chr132170 108 ------
NM_018534chr22140 70 ------
NM_018557chr21365 ------
NM_018584chr13959 484 84 --1419 --
NM_018602chr151123 ------
NM_018638chr1233632 1398 1132 14394 ----
NM_018640chr121692 ------
NM_018650chr111750 ----1633
NM_018657chr32845 651 ------
NM_018667chr162506 316 1617 11961 --
NM_018682chr72714 75 ------
NM_018683chr2021647 118 ------
NM_018689chr1532691 2442 919 ------
NM_018695chr552291 1747 1716 1535 871 --12040 --
NM_018703chr16--1116 ----
NM_018710chr81987 11285 ----
NM_018712chr1141436 1139 522 214 ------
NM_018713chr1----140 --
NM_018715chr142133 2087 862 822 ------
NM_018718chr7--22074 601 ----
NM_018719chr731036 341 42 --11190 --
NM_018728chr1521297 23 ------
NM_018834chr51107 ------
NM_018837chr202793 131 ------
NM_018840chr201380 ------
NM_018847chr921437 165 1452 1661 --
NM_018890chr7--1114 ----
NM_018898chr522264 1972 ------
NM_018899chr522264 1972 ------
NM_018900chr522264 1972 ------
NM_018901chr522264 1972 ------
NM_018902chr522264 1972 ------
NM_018903chr522264 1972 ------
NM_018904chr522264 1972 ------
NM_018905chr522264 1972 ------
NM_018906chr522264 1972 ------
NM_018907chr522264 1972 ------
NM_018908chr522264 1972 ------
NM_018909chr522264 1972 ------
NM_018910chr522264 1972 ------
NM_018911chr522264 1972 ------
NM_018912chr52626 598 --11091 --
NM_018913chr52626 598 --11091 --
NM_018914chr52626 598 --11091 --
NM_018915chr52626 598 --11091 --
NM_018916chr52626 598 --11091 --
NM_018917chr52626 598 --11091 --
NM_018918chr52626 598 --11091 --
NM_018919chr52626 598 --11091 --
NM_018920chr52626 598 --11091 --
NM_018921chr52626 598 --11091 --
NM_018922chr52626 598 --11091 --
NM_018923chr52626 598 --11091 --
NM_018924chr52626 598 --11091 --
NM_018925chr52626 598 --11091 --
NM_018926chr52626 598 --11091 --
NM_018927chr52626 598 --11091 --
NM_018928chr52626 598 --11091 --
NM_018929chr52626 598 --11091 --
NM_018931chr52690 270 ------
NM_018945chr653019 2809 1128 872 198 ------
NM_018951chr721160 403 ------
NM_018955chr17140 ------
NM_018970chr742499 2098 2000 561 12647 --12924
NM_018976chr1231849 1019 473 --11878 --
NM_018977chrX11100 ------
NM_018979chr121532 ------
NM_018983chr4----1226 --
NM_018999chr1054341 4291 3989 3786 666 ------
NM_019001chr334169 681 188 24050 3681 1148 --
NM_019004chr732305 935 642 ------
NM_019009chr1162492 1016 876 758 366 239 --157 1992
NM_019027chr452059 669 603 563 349 11975 ----
NM_019035chr441941 1278 341 86 11452 ----
NM_019042chr711115 1462 ----
NM_019046chr101774 ------
NM_019050chr43532 497 196 1437 ----
NM_019055chr111517 ------
NM_019057chr51263 ------
NM_019059chr71328 ------
NM_019060chr11121 ------
NM_019063chr222276 459 ------
NM_019071chr72273 199 --1304 --
NM_019084chr10--12599 ----
NM_019087chr521647 183 ------
NM_019088chr19156 ------
NM_019091chr241166 1100 966 103 ------
NM_019096chr62400 360 ------
NM_019102chr7--1364 ----
NM_019102chr7--1364 ----
NM_019106chr2222554 2166 ------
NM_019114chr931853 830 553 ------
NM_019116chr1623212 3009 11086 ----
NM_019555chr3288 59 11411 --1250
NM_019558chr21361 1318 ----
NM_019593chr2033060 2708 298 1375 ----
NM_019596chr2142566 715 668 459 11850 --12575
NM_019606chr71464 ------
NM_019610chr121690 858 ------
NM_019842chr61356 ------
NM_019843chr221102 ------
NM_019859chr1021467 1198 ------
NM_019860chr1021515 1246 ------
NM_019885chr252811 2533 2518 947 406 ------
NM_019903chr101440 ------
NM_020066chr11919 ------
NM_020116chr4--152 ----
NM_020123chr102234 113 ----1404
NM_020134chr241162 1048 809 394 --1190 --
NM_020139chr431805 763 524 21754 481 ----
NM_020141chr111889 ------
NM_020144chr752080 1640 1413 1310 419 --1604 --
NM_020145chr92445 27 ------
NM_020148chr1843061 1986 582 411 ----23043 2632
NM_020154chr15123 ------
NM_020159chr41627 153 1560 --
NM_020163chr322061 834 22151 2016 ----
NM_020168chr1511357 ------
NM_020177chr51650 188 ----
NM_020178chr1731109 881 212 ------
NM_020193chr113523 89 23 ------
NM_020194chr23611 590 533 ------
NM_020199chr5190 ------
NM_020205chr123131 2874 13250 12315 --
NM_020210chr151977 ------
NM_020239chr1----11689 --
NM_020240chr532403 2388 1764 31775 848 667 --1678
NM_020245chr674985 4685 4643 1866 538 233 150 15000 ----
NM_020248chr112090 11925 ----
NM_020309chr193835 709 119 ------
NM_020310chr1732781 954 905 ------
NM_020317chr1299 42 ------
NM_020319chr72820 694 ------
NM_020336chr2013694 --12515 --
NM_020337chr421173 243 ------
NM_020338chr1011330 13062 ----
NM_020340chr642282 1908 879 637 12067 ----
NM_020341chr2031513 399 97 ------
NM_020342chr231922 1740 964 12355 ----
NM_020346chr1111261 1372 ----
NM_020354chr102747 340 ------
NM_020357chr31508 ------
NM_020381chr611873 21617 1317 ----
NM_020384chrX1462 11775 1702 --
NM_020390chr374513 4397 4184 3592 3551 637 451 --14653 --
NM_020405chr1774219 3557 1726 1283 1205 995 926 14007 14274 --
NM_020416chr412619 21759 820 12431 --
NM_020428chr1921140 190 ------
NM_020429chr732289 2283 209 ------
NM_020432chr721639 719 ------
NM_020440chr152593 2461 2387 2295 1023 --2205 133 --
NM_020456chr1321491 1460 ----11565
NM_020466chr674805 4287 4245 3849 816 784 544 11358 24487 1537 13384
NM_020474chr1821976 1872 ------
NM_020478chr82821 423 ------
NM_020482chr61235 ------
NM_020529chr141464 ------
NM_020630chr103458 276 139 ------
NM_020631chr121059 942 --1486 --
NM_020640chr322103 461 --11486 --
NM_020644chr111299 ------
NM_020647chr821857 321 22158 929 ----
NM_020648chr1822782 325 ------
NM_020651chr21333 ------
NM_020654chr331451 1352 1076 ------
NM_020673chr2077016 6700 4920 2440 1876 549 346 11068 ----
NM_020689chr2011073 ------
NM_020699chr125002 683 21916 581 11713 --
NM_020711chr222111 214 ------
NM_020713chr2072755 2686 2305 2178 2098 2076 840 --11952 --
NM_020717chrX44928 4717 4198 1140 1340 --1464
NM_020718chr1666498 6130 5307 2481 1113 515 21876 1864 15765 --
NM_020727chr2133477 3390 915 12966 23553 3538 --
NM_020728chr742856 2639 2353 2296 22117 1998 ----
NM_020732chr6--1266 ----
NM_020734chr1233072 2154 962 22466 733 --13031
NM_020752chr1052254 2200 1943 857 552 ------
NM_020755chr631225 1112 558 ------
NM_020760chr211646 ------
NM_020762chr1221017 172 --1413 --
NM_020766chrX24090 3416 --13887 --
NM_020769chrX1817 ------
NM_020772chr1788288 5721 5333 3309 2755 1481 685 256 12889 ----
NM_020773chr442533 2493 667 23 ----12519
NM_020774chr1824935 4309 26022 2459 ----
NM_020786chr1622046 1429 ------
NM_020791chr17192 ------
NM_020796chr5------1159
NM_020801chr532351 2259 2088 ------
NM_020805chr1841648 544 469 85 ------
NM_020806chr141590 1752 ----
NM_020807chr162306 181 ------
NM_020809chr1112260 1305 ----
NM_020818chr14199 ----1302
NM_020825chr16103482 3366 3154 3092 2737 969 860 630 330 225 --1925 --
NM_020830chr271151 1132 961 893 705 465 159 1591 ----
NM_020841chr1253211 2730 2700 749 300 1523 ----
NM_020850chr1633217 3107 2371 ----12814
NM_020854chr182541 358 --11508 --
NM_020856chr192406 362 --11202 --
NM_020858chr15--2403 303 ----
NM_020871chrX21998 1006 ------
NM_020872chr311726 ------
NM_020888chr13448 399 23 1191 1784 --
NM_020899chr1721717 718 --11865 --
NM_020918chr1063559 3402 2832 2735 2524 1106 ------
NM_020920chr141393 ------
NM_020921chr1452710 2525 2491 644 34 23293 2738 11370 --
NM_020925chr111194 1351 11275 --
NM_020935chr233743 1110 599 --24555 235 --
NM_020940chr1032413 1808 364 12464 ----
NM_020946chr911678 11755 1538 11529
NM_020948chr112646 1899 13170 --
NM_020962chr1542476 2017 904 501 11821 ----
NM_020967chr202345 97 ------
NM_020977chr451850 1441 721 304 134 --11758 --
NM_020983chr1271968 1860 1749 1503 725 90 45 --1509 --
NM_020987chr1021282 548 11345 ----
NM_020993chr1222297 924 --2817 719 12600
NM_021005chr15------1996
NM_021007chr241969 1869 1680 1664 ------
NM_021019chr12--1182 ----
NM_021020chr842944 2658 1026 38 ----13118
NM_021033chr1353381 1073 951 848 285 ------
NM_021038chr332762 2599 2452 43194 3108 1348 297 13136 --
NM_021061chr834180 4075 3756 2417 148 ----
NM_021064chr651782 1213 630 461 336 ------
NM_021072chr511704 1219 ----
NM_021076chr221525 --1183 --
NM_021088chr271874 1844 785 578 423 298 147 1487 ----
NM_021090chr2231868 793 88 --23469 1145 --
NM_021096chr2243236 3176 1040 818 --12547 --
NM_021097chr21246 22688 803 ----
NM_021101chr362196 1676 1610 821 806 613 ------
NM_021102chr191384 ------
NM_021111chr9------11282
NM_021120chrX2626 418 --1737 --
NM_021132chr101505 1939 ----
NM_021136chr141164 2720 513 ----
NM_021137chr1741967 1585 591 191 ------
NM_021144chr91181 ------
NM_021145chr72719 361 ------
NM_021149chr161334 11207 ----
NM_021151chr72394 335 2986 25 ----
NM_021159chr421229 297 ------
NM_021183chrX11880 1719 ----
NM_021189chr13959 858 166 ------
NM_021191chr1212011 21956 1776 ----
NM_021202chr2032511 2073 424 --21921 604 --
NM_021218chr92992 779 ------
NM_021222chr121436 1165 ------
NM_021229chr121896 --130 --
NM_021238chr1232012 1492 627 ------
NM_021239chr141164 1343 ----
NM_021240chr91171 1493 ----
NM_021242chrX3730 363 241 1282 ----
NM_021244chr61175 ------
NM_021255chr1421001 838 ------
NM_021614chr51257 ------
NM_021627chr32151 113 ------
NM_021633chr11274 ------
NM_021639chr1------1358
NM_021649chr54605 453 446 174 ------
NM_021705chr6--1301 ----
NM_021722chr71208 ------
NM_021728chr142266 74 ------
NM_021785chrX169 ------
NM_021813chr634439 1242 69 1984 ----
NM_021814chr611586 ------
NM_021818chr14176 ------
NM_021911chr564857 4528 3594 1904 638 402 33474 1592 1345 ----
NM_021912chr151737 --13393 --
NM_021914chr1422262 511 2976 435 1405 --
NM_021935chr31213 ------
NM_021940chr641450 1363 1066 400 ------
NM_021943chr61146 ------
NM_021945chr652364 1431 1308 854 264 12284 ----
NM_021947chr173956 380 347 ------
NM_021949chrX31037 1022 445 12465 ----
NM_021958chr1------1310
NM_021959chr62312 22 ------
NM_021961chr1177140 7080 6592 6362 5622 4989 2251 26006 5430 --12917
NM_021962chr172357 105 ------
NM_021964chr372566 2312 2101 2069 1154 395 176 24022 927 134 --
NM_021973chr43578 231 92 ------
NM_021994chr71954 1178 ----
NM_021998chrX11532 ----11136
NM_022037chr21356 1679 ----
NM_022048chr1575879 5713 2316 2057 1667 1334 752 1551 16330 14451
NM_022051chr11567 ------
NM_022079chr10193 ------
NM_022080chr2021897 1793 1344 ----
NM_022098chr2261408 1196 1007 565 307 106 ------
NM_022114chr134629 3850 1481 14467 14333 --
NM_022118chr131427 ------
NM_022123chr14285 57 ------
NM_022130chr51370 --1225 --
NM_022137chr144750 390 384 132 --1439 --
NM_022138chr631087 316 100 ------
NM_022143chr721321 988 ------
NM_022154chr42297 36 ------
NM_022165chr19130 --164 --
NM_022171chr33622 208 181 ------
NM_022173chr21356 1679 ----
NM_022307chr7------126
NM_022361chr61407 ------
NM_022459chr1345731 4266 1988 1188 11441 --25063 3998
NM_022462chr1923602 634 13319 ----
NM_022463chr1711404 ------
NM_022465chr1242411 663 517 54 --1552 --
NM_022469chr13383 330 127 1485 11118 --
NM_022470chr321247 1036 ------
NM_022474chr1422769 260 11857 ----
NM_022475chr42713 39 ------
NM_022476chr1651080 1072 421 227 30 1298 ----
NM_022479chr741449 577 477 279 ----1182
NM_022483chr52692 586 ------
NM_022484chr721094 250 135 ----
NM_022494chr101351 ------
NM_022572chr211620 ----21778 1646
NM_022716chr143035 2774 2058 277 ------
NM_022719chr2273843 3691 2860 2385 1284 948 716 --42490 1489 432 172 12704
NM_022728chr71679 1564 ----
NM_022730chr21142 --2959 420 125
NM_022733chr1------1274
NM_022735chr111672 1174 11602 --
NM_022737chr1921240 519 ------
NM_022749chr841397 1390 1037 68 ------
NM_022753chr142450 1960 1737 621 --11051 --
NM_022763chr342872 2561 2488 731 ------
NM_022771chr122386 308 ------
NM_022781chr922419 2228 ------
NM_022802chr10--1665 ----
NM_022818chr161269 ------
NM_022824chr541640 724 561 389 ----1438
NM_022831chr121633 1323 11653 ----
NM_022832chr471021 950 922 827 618 612 383 12130 11794 --
NM_022841chr153858 762 382 ------
NM_022843chr132582 525 ------
NM_022845chr1672036 1425 804 637 446 257 105 11857 ----
NM_022893chr212280 ----12997
NM_022894chr21181 ------
NM_022898chr1484283 3850 1531 1381 1331 857 663 269 1696 24631 133 11518
NM_022900chr711110 ------
NM_022901chr9------1103
NM_022918chr1152192 2162 1652 1517 1474 ------
NM_023000chr1441651 1636 483 393 184 --1281
NM_023001chr1441651 1636 483 393 184 --1281
NM_023008chr192326 133 ------
NM_023010chrX--1848 ----
NM_023011chr133850 797 335 ------
NM_023012chr122774 82 ------
NM_023016chr252796 2474 1921 501 104 12062 ----
NM_023067chr331293 404 239 ------
NM_023071chr1231103 940 730 ------
NM_023072chr19184 ----1865
NM_023074chr191992 ------
NM_023076chr1672166 1197 992 720 385 312 49 ------
NM_023079chr172192 80 ------
NM_023105chr842387 1526 397 285 11682 ----
NM_023106chr842387 1526 397 285 11682 ----
NM_023110chr842387 1526 397 285 11682 ----
NM_023111chr842387 1526 397 285 11682 ----
NM_023112chr1422759 49 12538 ----
NM_023923chr162487 1415 949 760 136 83 ----1581
NM_023925chr12--1251 ----
NM_023929chr821082 867 ------
NM_023940chr42956 238 1294 ----
NM_023948chr7--1156 ----
NM_024007chr5------12523
NM_024037chr11840 ------
NM_024052chr171262 ------
NM_024095chr12162 ------
NM_024107chr171583 ------
NM_024165chr6----145 --
NM_024297chr171103 ------
NM_024345chr983890 3753 1786 1576 1314 1241 560 219 ------
NM_024348chr91252 ------
NM_024415chr51229 ------
NM_024422chr1831709 529 462 ------
NM_024490chr152538 521 ------
NM_024491chr31621 ------
NM_024501chr21495 ------
NM_024511chr433330 2715 209 32785 2381 830 ----
NM_024513chr373624 3464 3365 2564 2329 639 164 --1478 --
NM_024524chr332955 2662 90 ------
NM_024532chr2----131 --
NM_024539chrX31191 1086 1075 ------
NM_024546chr132897 803 ------
NM_024548chr321385 241 21619 293 ----
NM_024551chr1222265 2015 --151 --
NM_024551chr1222265 2015 --151 --
NM_024554chr131612 1203 186 1241 21245 598 --
NM_024556chr111387 ------
NM_024567chr81276 ------
NM_024581chr61178 ------
NM_024582chr41746 ------
NM_024595chr121221 1007 1767 --1291
NM_024612chr173979 353 106 ------
NM_024613chr811541 ------
NM_024615chr5--1230 ----
NM_024617chr9121 ------
NM_024639chr61552 ------
NM_024643chr14--1122 ----
NM_024659chr2--1310 ----
NM_024665chr353678 3363 1780 1340 588 ------
NM_024680chr111379 ------
NM_024689chrX--11161 ----
NM_024702chr17----187 --
NM_024704chr202914 742 ------
NM_024713chr1511335 ------
NM_024721chr822383 870 1898 ----
NM_024725chr11----1161 --
NM_024743chr41532 ------
NM_024745chr164937 719 386 311 ------
NM_024749chr13843 597 52 1702 ----
NM_024755chr151746 ------
NM_024759chr8--1185 --1660
NM_024761chr934049 1229 286 13450 11577 --
NM_024770chr2116685 6438 5708 5670 5614 5591 4619 4465 1948 889 677 1275 ----
NM_024779chr121404 ------
NM_024792chr173403 182 56 ------
NM_024798chr1562434 1936 823 680 392 286 12385 ----
NM_024804chr12340 129 ------
NM_024824chr1441555 1409 478 329 ------
NM_024834chr101662 1448 ----
NM_024837chr1511949 ------
NM_024850chr51218 ------
NM_024881chr1983812 3578 3445 1289 1085 762 353 341 ------
NM_024884chr1452932 562 365 287 67 14434 ----
NM_024887chr11301 --11583 --
NM_024900chr452272 1842 1726 1474 854 ------
NM_024900chr452272 1842 1726 1474 854 ------
NM_024947chr389315 9165 8819 8492 3301 2853 2508 866 11332 12016 --
NM_024953chr12122 ----1606
NM_024969chr23876 168 46 ------
NM_024979chr1321346 467 --21572 633 --
NM_024991chr101959 1601 ----
NM_025057chr141198 11261 ----
NM_025065chr13612 600 94 ------
NM_025073chr1--23803 722 21618 539 --
NM_025076chr22459 198 ------
NM_025083chr1531843 662 492 11998 ----
NM_025130chr10----1145 --
NM_025133chr21423 ------
NM_025134chr1621828 240 ------
NM_025137chr151108 ------
NM_025138chr132913 472 ------
NM_025146chr34720 505 430 29 ------
NM_025151chr832042 2024 851 --11718 --
NM_025154chr71516 ----11086
NM_025160chr134254 1343 591 ------
NM_025164chr1121976 1347 11953 --1580
NM_025181chr21181 ------
NM_025182chr911043 --1191 --
NM_025191chr132956 2422 286 --1455 --
NM_025195chr82332 44 1687 ----
NM_025201chr1511313 --32053 2022 323 --
NM_025212chr4130 ------
NM_025216chr22557 502 --1516 --
NM_025235chr101209 ------
NM_025257chr61352 ------
NM_030594chr1521324 135 1867 ----
NM_030621chr1453385 3074 2905 1510 1311 --11346 --
NM_030625chr102626 259 ------
NM_030627chr5146 1797 ----
NM_030629chr1611747 ------
NM_030637chr142679 141 ------
NM_030640chr121662 ------
NM_030647chr733866 2340 719 26254 1705 ----
NM_030648chr434420 2153 1963 11127 13593 --
NM_030650chr284253 3948 3283 1688 981 736 588 525 13753 --176
NM_030661chr741365 452 418 136 --11606 --
NM_030664chr1021929 448 ------
NM_030665chr171559 11421 --1313
NM_030667chr1251205 937 866 448 282 ------
NM_030668chr1251205 937 866 448 282 ------
NM_030669chr1251205 937 866 448 282 ------
NM_030670chr1262237 1969 1898 1581 1480 567 ------
NM_030671chr1262237 1969 1898 1581 1480 567 ------
NM_030751chr101356 ------
NM_030751chr101356 ------
NM_030755chr1423052 996 ------
NM_030756chr10197 ------
NM_030758chr22--2438 65 ----
NM_030762chr1231725 1572 683 ------
NM_030786chr1181 11234 ----
NM_030791chr142723 604 ------
NM_030802chr171116 --1648 --
NM_030803chr221041 133 ------
NM_030805chr22158 61 ------
NM_030808chr171241 ------
NM_030815chr201560 --1310 --
NM_030881chr2211824 12173 ----
NM_030884chr322206 1422 ------
NM_030906chr113410 194 53 ------
NM_030911chr1321638 50 ------
NM_030934chr121762 1237 11526 ----
NM_030949chr611378 --1556 --
NM_030953chr531034 340 110 ------
NM_030958chr81378 ------
NM_030962chr1121579 205 11233 ----
NM_030964chr531464 690 197 12724 ----
NM_030979chr131334 ------
NM_030981chr1121157 96 ------
NM_031157chr121235 ------
NM_031216chr1821708 873 ------
NM_031243chr722019 314 --1767 --
NM_031262chr911120 ------
NM_031263chr911177 ------
NM_031267chr71414 ------
NM_031268chr1654607 4361 3732 2077 789 --14498 --
NM_031283chr22318 138 --1294 --
NM_031305chr41379 1358 ----
NM_031371chr131205 152 23 131 11129 1143
NM_031371chr131205 152 23 131 11129 1143
NM_031411chr522264 1972 ------
NM_031412chr121791 11128 ----
NM_031417chr1922540 2105 11940 1764 --
NM_031418chr1111066 1658 ----
NM_031422chr182524 502 ------
NM_031427chr1495384 5313 4379 4166 4138 3765 2036 1769 1557 11923 --14115
NM_031435chr1293412 3094 2989 2982 2748 2489 1155 447 359 ----169
NM_031438chr52448 84 ------
NM_031442chrX12905 --12168 --
NM_031445chr222511 1358 --1693 --
NM_031457chr112395 126 1370 ----
NM_031468chr777709 7098 6480 4983 3171 2573 167 --22726 672 --
NM_031469chr653440 2883 1490 1269 813 ----153
NM_031483chr2073053 2954 2773 1387 1139 773 417 ------
NM_031844chr123380 1303 ------
NM_031845chr253609 3311 2409 1478 663 ------
NM_031847chr253609 3311 2409 1478 663 ------
NM_031849chr522264 1972 ------
NM_031857chr522264 1972 ------
NM_031860chr522264 1972 ------
NM_031866chr102333 191 ------
NM_031886chr1952566 2114 1902 1701 458 ------
NM_031890chr2212748 32627 2187 205 1652 --
NM_031935chr11147 ------
NM_031942chr22929 359 1456 ----
NM_031953chr4--1478 ----
NM_032021chr1121101 937 ----1217
NM_032042chr532706 878 322 1247 ----
NM_032047chr31430 --12058 --
NM_032052chr221324 ------
NM_032088chr52626 598 --11091 --
NM_032092chr52626 598 --11091 --
NM_032102chr1132261 2050 749 ------
NM_032109chr521375 577 --11228 --
NM_032120chr71109 ------
NM_032121chrX22609 1729 ------
NM_032124chr1821123 957 ------
NM_032144chr211672 ------
NM_032153chr332756 927 718 11809 1332 --
NM_032156chr12--1251 ----
NM_032182chr10--11053 ----
NM_032186chr11469 ------
NM_032193chr1131411 789 583 ------
NM_032199chr1042602 2405 1176 363 13465 ----
NM_032221chr2041324 819 777 669 ------
NM_032229chr131179 --1999 --
NM_032231chr15--1322 ----
NM_032239chr431377 1214 346 ------
NM_032242chr362455 1271 1190 1048 915 421 ------
NM_032256chr121789 ------
NM_032268chr1683044 2771 2152 1105 1016 818 279 254 ------
NM_032281chr1922598 160 ------
NM_032291chr131627 249 104 ------
NM_032299chr111173 ------
NM_032312chr21850 ----1783
NM_032316chr352369 2222 932 721 91 --22436 413 --
NM_032320chr112321 54 ------
NM_032321chr253175 1031 979 857 269 12835 --1440
NM_032352chr1431133 581 134 ------
NM_032373chr1055700 4940 4136 3925 412 24207 156 ----
NM_032382chr161464 ------
NM_032403chr52626 598 --11091 --
NM_032408chr711073 --1217 --
NM_032410chr811211 ------
NM_032413chr15133 ------
NM_032424chr1121021 571 11088 ----
NM_032433chr1921257 617 11343 ----
NM_032438chr641223 334 193 31 ------
NM_032439chr1021490 461 1362 ----
NM_032440chr101155 ------
NM_032442chr171195 ------
NM_032452chr141467 --1979 --
NM_032457chr443678 3315 3283 2877 ------
NM_032458chrX12335 ------
NM_032466chr82473 160 --11331 --
NM_032468chr82473 160 --11331 --
NM_032491chr1221048 817 1442 ----
NM_032505chr332467 2386 308 ------
NM_032539chrX1553 ------
NM_032557chr41354 ------
NM_032580chr171234 ------
NM_032595chr1721405 501 ------
NM_032603chr2--1105 ----
NM_032622chr411430 ------
NM_032632chr1431982 371 150 ------
NM_032638chr311093 --131 --
NM_032682chr361455 1345 1308 865 252 224 12778 ----
NM_032701chr191634 ------
NM_032711chr1733946 3177 1547 24121 586 ----
NM_032741chr61912 1780 ----
NM_032765chr52996 801 ------
NM_032778chr323123 2260 ------
NM_032780chr112799 362 ------
NM_032781chr112629 32 ------
NM_032801chr1142534 1927 700 89 ------
NM_032844chr101251 ------
NM_032870chr61106 ------
NM_032873chr1154268 3740 712 694 607 --34456 3524 3505 --
NM_032875chr17----1305 --
NM_032918chr1251241 1149 331 227 85 ------
NM_032932chr1795814 5715 4519 1229 1094 688 330 254 223 1751 ----
NM_032949chr131144 ------
NM_032971chrY31022 849 258 1944 ----
NM_032972chrY31022 849 258 1944 ----
NM_032975chr1823323 3256 21241 839 12330 --
NM_032980chr1823323 3256 21241 839 12330 --
NM_032991chr431148 112 66 ------
NM_032993chr4----1226 --
NM_032998chr11966 ------
NM_032999chr71829 1297 ----
NM_033000chr71829 1297 ----
NM_033001chr71829 1297 ----
NM_033016chr2211506 ------
NM_033020chr153965 3902 3830 3029 2983 ------
NM_033023chr71197 ------
NM_033025chr19--1694 ----
NM_033119chr16163 ------
NM_033127chr1------2285 137
NM_033133chr1723093 2640 23704 2356 ----
NM_033136chr531749 709 659 11387 ----
NM_033137chr531749 709 659 11387 ----
NM_033138chr72610 415 ------
NM_033139chr72610 415 ------
NM_033140chr72610 415 ------
NM_033143chr443765 3747 1608 914 ------
NM_033157chr72610 415 ------
NM_033181chr621180 556 --13055 1174
NM_033211chr531986 176 71 21909 381 ----
NM_033222chr9--1492 11144 --
NM_033224chr758021 7706 5320 5122 3105 ------
NM_033254chr31126 ------
NM_033285chr834372 3722 3230 --21316 698 1869
NM_033300chr121158 398 ------
NM_033326chr1132153 1006 30 11759 --1699
NM_033331chr92455 441 33331 2964 1191 ----
NM_033340chr101474 --21356 22 --
NM_033375chr17----11070 --
NM_033387chr92677 434 12637 ----
NM_033389chr1754717 4341 3835 3595 78 --13389 --
NM_033394chr221125 646 ------
NM_033396chr111158 ------
NM_033425chr1152911 2695 2478 2432 179 1430 13093 --
NM_033426chr1432664 2379 2004 22093 553 ----
NM_033430chr443974 3917 3117 1495 --1540 --
NM_033437chr443974 3917 3117 1495 --1540 --
NM_033496chr102591 38 1295 ----
NM_033497chr102591 38 1295 ----
NM_033498chr102591 38 1295 ----
NM_033500chr102591 38 1295 ----
NM_033503chr1533258 910 891 --13734 11270
NM_033505chr275258 5044 4892 1532 1325 714 114 15450 ----
NM_033512chr822810 134 --1602 --
NM_033535chr421088 60 ------
NM_033546chr181161 ------
NM_033547chr11175 ------
NM_033550chr2051809 1731 1681 266 144 --12271 --
NM_033624chr1222115 226 --12078 --
NM_033631chr143249 1260 1035 1017 ------
NM_033637chr1053951 3306 3208 3140 1165 --13734 --
NM_033642chrX1496 11127 ----
NM_033644chr53475 401 375 1860 ----
NM_033645chr53475 401 375 1860 ----
NM_033656chr2145554 1087 166 45 1189 ----
NM_052827chr12--1211 ----
NM_052832chr832885 2260 65 --11872 --
NM_052834chr1832346 2204 346 ------
NM_052845chr1232836 833 254 --12595 --
NM_052875chr1152184 2037 1902 1529 421 ------
NM_052880chr2241393 978 899 437 ------
NM_052886chr822057 1890 --11924 --
NM_052896chr122552 2121 ------
NM_052898chr821324 290 ------
NM_052900chr82500 210 --11566 --
NM_052904chr61273 ------
NM_052910chr1351984 1673 1655 1623 543 11769 ----
NM_052918chr1022538 741 ------
NM_052925chr193731 330 113 ------
NM_052927chr511579 --1146 --
NM_052934chr1----144 --
NM_052937chr81951 12119 ----
NM_052954chr2112038 11674 1531 --
NM_052978chr14175 11579 ----
NM_053001chr8--1347 ----
NM_053016chr966616 5903 1348 1254 343 40 21205 578 23019 2821 --
NM_053023chr1132941 965 808 13075 1509 --
NM_053024chr341472 1364 996 221 ------
NM_053025chr32460 183 31582 1127 339 --11177
NM_053026chr32460 183 31582 1127 339 --11177
NM_053027chr32460 183 31582 1127 339 --11177
NM_053028chr32460 183 31582 1127 339 --11177
NM_053031chr32460 183 31582 1127 339 --11177
NM_053032chr32460 183 31582 1127 339 --11177
NM_053043chr765051 4990 4476 2478 2093 1363 1411 ----
NM_053056chr1143104 1217 1019 361 --12409 --
NM_053064chr1431873 448 91 ------
NM_053279chr821916 664 12583 1555 --
NM_057089chr7----1167 --
NM_057159chr911100 ------
NM_057161chr61512 ------
NM_057175chr411750 12107 ----
NM_058172chr421704 705 --21140 417 --
NM_058191chr213900 780 562 ------
NM_058229chr8166 ------
NM_058240chr14----160 --
NM_058241chr221703 721 1311 1613 --
NM_058241chr221703 721 1311 1613 --
NM_078467chr651291 1268 1153 229 169 --1473 --
NM_078469chr1031173 1135 413 ------
NM_080388chr1130 --1487 --
NM_080391chr11117 --1593 --
NM_080392chr12166 35 --1642 --
NM_080546chr91213 ------
NM_080591chr962414 2105 948 922 551 370 ------
NM_080597chr18--1841 ----
NM_080632chrX--1848 ----
NM_080645chr612195 ------
NM_080669chr1731659 1599 1526 14930 ----
NM_080676chr2033188 2873 244 --12079 --
NM_080682chr11561 ------
NM_080717chr1221544 1202 1139 ----
NM_080723chr611326 1547 ----
NM_080737chrX------11217
NM_080742chr6--184 ----
NM_080743chr662139 1819 1664 963 365 257 ------
NM_080759chr1322397 1617 ------
NM_080760chr1322397 1617 ------
NM_080829chr205979 431 215 96 74 1246 1414 --
NM_080867chr1444925 1866 1585 332 23942 693 ----
NM_080872chr873225 3049 2989 1030 639 522 397 12858 ----
NM_080881chr5184 ------
NM_080927chr363140 2723 1175 435 379 277 ------
NM_100264chr101649 --1664 --
NM_100486chr101649 --1664 --
NM_130386chr181582 ------
NM_130391chr933005 2695 2199 --179 --
NM_130392chr933005 2695 2199 --179 --
NM_130393chr933005 2695 2199 --179 --
NM_130434chr15--1447 ----
NM_130436chr211359 ------
NM_130438chr211936 ------
NM_130439chr10--11707 ----
NM_130439chr10--11707 ----
NM_130440chr12273 215 --11324 --
NM_130443chr111117 ------
NM_130459chr921027 560 ------
NM_130469chr141600 1943 ----
NM_130781chr51537 ------
NM_130811chr201280 ------
NM_130838chr15----11642 --
NM_130839chr15----11642 --
NM_133170chr2057801 7589 6032 2388 2135 22295 647 11343 16127
NM_133264chr1733632 3183 2559 --1355 --
NM_133265chrX33285 1075 553 1470 ----
NM_133266chr112971 318 ------
NM_133328chr192651 512 ------
NM_133329chr22317 97 ------
NM_133334chr475874 5707 5659 5304 2237 1751 1167 ----12169
NM_133369chr51202 2916 908 ----
NM_133444chr1941752 1311 1099 451 ------
NM_133445chr943461 3335 1055 707 --12443 --
NM_133452chr1911029 ------
NM_133478chr242168 973 761 48 ------
NM_133493chr633802 1317 978 --11720 --
NM_133496chr154240 3375 1652 1363 50 --13880 --
NM_133510chr14--1281 ----
NM_133631chr321260 343 ------
NM_133646chr285318 5248 5101 3820 3705 1875 1276 644 ------
NM_134421chr23790 758 719 ------
NM_134447chr191560 --1442 --
NM_138270chrX--12538 ----
NM_138285chr22503 167 ------
NM_138319chr1521016 344 --133 --
NM_138333chr922539 544 1901 ----
NM_138335chr42635 42 ------
NM_138338chr2272883 2807 888 845 798 705 665 ------
NM_138357chr101179 ------
NM_138375chr182855 485 158 1803 1307
NM_138409chr621337 516 --1986 --
NM_138423chr1521903 1508 ------
NM_138426chr721816 511 2793 679 ----
NM_138444chr1323802 313 ------
NM_138457chr6----13417 --
NM_138468chr2105980 5703 5330 4540 3964 2219 1603 1392 578 205 ------
NM_138473chr1241571 1148 914 700 1458 33886 3163 786 --
NM_138476chr14125 ------
NM_138479chr112029 --1112 --
NM_138555chr151462 ------
NM_138568chr191417 ------
NM_138576chr1484283 3850 1531 1381 1331 857 663 269 1696 24631 133 11518
NM_138609chr51201 ------
NM_138610chr51201 ------
NM_138635chr71348 12993 ----
NM_138638chr1422262 511 2976 435 1405 --
NM_138694chr643650 3536 621 339 --1242 --
NM_138713chr1677454 7059 6577 5818 5763 1805 577 ------
NM_138714chr1677454 7059 6577 5818 5763 1805 577 ------
NM_138731chr1413757 14262 13391 --
NM_138761chr19149 ------
NM_138765chr19149 ------
NM_138766chr51403 ------
NM_138773chr51120 1247 ----
NM_138775chr11------1306
NM_138782chr522046 145 ------
NM_138793chr1741107 239 156 67 ------
NM_138799chr252075 1863 1645 309 250 --1235 --
NM_138811chr711031 ------
NM_138821chr51403 ------
NM_138822chr51403 ------
NM_138927chr212786 695 ------
NM_138931chr31388 ------
NM_138959chr145576 2324 2110 152 --25565 4485 --
NM_138961chr111114 ------
NM_138967chr1522251 495 ----1203
NM_138970chr1422296 281 ------
NM_139012chr631803 1659 904 ------
NM_139035chrX----1239 --
NM_139045chr9189 ------
NM_139062chr171404 ------
NM_139068chr51497 ------
NM_139069chr51497 ------
NM_139070chr51366 ------
NM_139071chr12----1423 --
NM_139126chr61753 1340 ----
NM_139131chr111710 ------
NM_139132chr1121143 77 ------
NM_139136chr121161 ----1194
NM_139159chr193994 530 296 --1104 --
NM_139169chr1022128 754 178 ----
NM_139182chr431577 392 136 ------
NM_139207chr1211397 ------
NM_139241chr121152 ------
NM_139242chr152413 145 ------
NM_139244chr62958 183 ------
NM_139276chr175842 628 453 447 54 22287 934 21488 163 --
NM_139283chr1231659 969 458 22423 2108 ----
NM_139321chr2073327 3308 1611 1555 1506 1155 858 ------
NM_139323chr2021794 475 11507 1209 --
NM_144498chr2031577 1421 871 --11513 --
NM_144570chr1623016 2286 12334 ----
NM_144571chr436194 2494 1439 24231 270 25809 2446 --
NM_144578chr1413389 15059 35352 4504 3725 1103
NM_144583chr21603 11498 --11669
NM_144595chr13--2760 170 ----
NM_144599chr1545203 3704 417 39 21316 883 14641 --
NM_144609chr1721365 105 ------
NM_144634chr3--127 ----
NM_144635chr331217 1089 125 ------
NM_144643chr41477 ------
NM_144644chr41181 ------
NM_144658chrX1291 ------
NM_144664chr1122480 1802 ------
NM_144691chr191166 ------
NM_144703chr2011029 180 ----
NM_144720chr4--1196 ----
NM_144726chr53917 823 141 ------
NM_144732chr191183 11032 ----
NM_144767chr1553889 2949 1236 733 562 24195 4017 ----
NM_144775chr1734950 4217 3148 --11141 --
NM_144778chr1312589 ------
NM_144949chr232257 585 293 --1618 --
NM_144963chr82503 441 ------
NM_144967chrX11062 ------
NM_144973chr1265271 3819 1666 1353 789 765 ------
NM_144982chr121549 ------
NM_145018chr112212 76 ------
NM_145021chr101582 --1744 --
NM_145025chr6--1105 1170 1929
NM_145055chr1883562 2953 2386 1495 1264 1178 715 109 --3887 439 423 --
NM_145112chr1421193 1011 ------
NM_145113chr1421465 1283 ------
NM_145117chr1121254 45 12606 ----
NM_145159chr142929 852 --1248 --
NM_145175chr231295 559 533 ------
NM_145239chr166976 801 366 329 292 272 ------
NM_145251chr1421527 305 ------
NM_145259chr267099 7090 6285 5078 1454 723 --15926 14887
NM_145260chr2----3708 154 95 1240
NM_145263chr42246 188 ------
NM_145287chr181179 ------
NM_145313chr1041515 1371 1168 426 ----1166
NM_145315chr61105 ------
NM_145320chr723482 2530 ------
NM_145321chr723482 2530 ------
NM_145322chr723482 2530 ------
NM_145332chr61382 --1143 --
NM_145333chr61382 --1143 --
NM_145341chr1041466 1171 117 98 ------
NM_145690chr821304 414 1433 ----
NM_145695chr71595 ------
NM_145698chr1022045 1534 ----1563
NM_145716chr1136 ------
NM_145733chr221343 ------
NM_145799chrX12862 1622 --13097
NM_145808chr732609 2383 477 ------
NM_145810chr22929 359 1456 ----
NM_145858chr21----1478 --
NM_145888chr1921850 1326 ------
NM_145891chr1631571 1129 615 ------
NM_145892chr1631571 1129 615 ------
NM_145893chr1631693 1251 737 ------
NM_147147chr641483 1416 975 68 --23558 1541 --
NM_147150chr923321 902 23761 2765 11362 13958
NM_147156chr1011514 ------
NM_147164chr91113 ------
NM_147171chr71344 ------
NM_147175chrX41550 806 772 761 ------
NM_147185chr71344 ------
NM_147223chr212105 ------
NM_147233chr211922 ------
NM_148174chr8--11486 ----
NM_148177chr8166 ------
NM_148894chr4--1888 ----
NM_148898chr71760 1423 ----
NM_148899chr71760 1423 ----
NM_152240chr321247 1036 ------
NM_152244chr1721188 443 --21054 983 --
NM_152261chr1242485 1015 49 23 ----1474
NM_152265chr121086 177 11278 11072 --
NM_152277chr511854 ----11455
NM_152278chrX169 ------
NM_152280chr122574 208 --13132 --
NM_152282chr32306 228 --21353 1081 --
NM_152287chr1622358 1943 12643 --1428
NM_152313chr111621 ------
NM_152330chr1432159 2031 166 ------
NM_152332chr1452620 2392 2235 426 391 12786 ----
NM_152360chr19--1140 ----
NM_152363chr194847 409 390 220 ------
NM_152388chr213303 --13746 --
NM_152407chr54404 259 198 92 ----11186
NM_152409chr571142 930 816 776 591 509 193 21293 174 ----
NM_152414chr8----1494 --
NM_152417chr8164 ------
NM_152424chrX44239 3720 1278 230 23848 3419 ----
NM_152437chr121571 ------
NM_152441chr121167 --174 --
NM_152446chr141395 ------
NM_152450chr151495 187 ----
NM_152493chr121534 234 ------
NM_152519chr221672 811 ------
NM_152520chr21898 ------
NM_152523chr21499 ------
NM_152529chr284259 4031 3303 3092 1529 1461 1226 595 11173 ----
NM_152536chr31464 --11094 --
NM_152542chr42849 613 ------
NM_152553chr61203 ------
NM_152556chr732086 858 388 1453 12331 --
NM_152586chr103854 304 94 ------
NM_152588chr1231723 1671 739 1249 1270 --
NM_152589chr121100 ------
NM_152594chr151300 ------
NM_152622chr52790 606 ----1807
NM_152624chr577250 7243 6866 2123 1752 482 249 --15016 --
NM_152629chr963769 3468 3303 1420 1281 68 13384 ----
NM_152641chr1232063 1965 808 ----12763
NM_152643chr1011167 ------
NM_152653chr3--1723 ----
NM_152665chr11276 1492 ----
NM_152678chr352713 2065 809 318 230 --11948 --
NM_152682chr4132 1382 ----
NM_152695chrX22203 1521 11986 ----
NM_152699chr343266 2645 2634 441 13740 ----
NM_152739chr72748 260 ------
NM_152745chr71463 ------
NM_152756chr534315 3626 1612 ------
NM_152758chr842778 2581 2146 220 12017 ----
NM_152780chrX2925 268 ------
NM_152787chrX43893 3484 2682 1289 ----13649
NM_152835chr142288 1073 857 455 12826 11924 12417
NM_152838chr2022994 2452 ------
NM_152857chr621018 76 ------
NM_152858chr621018 76 ------
NM_152896chr9--1653 ----
NM_152897chr203868 780 264 ------
NM_152903chr1341889 1809 770 561 12582 ----
NM_152924chr1595627 5416 5328 4989 4322 2579 1477 1453 1430 25948 1208 34872 1951 615 22440 1863
NM_152991chr112513 477 1642 ----
NM_152994chr2----1440 --
NM_152996chr131801 236 174 ------
NM_153000chr182243 96 ------
NM_153015chr821029 38 ------
NM_153020chr621302 1137 ------
NM_153029chr1654145 4011 3990 3436 3304 130 1578 --
NM_153040chr151101 ------
NM_153042chr631710 1464 1325 1194 11596 --
NM_153050chr2231868 793 88 --23469 1145 --
NM_153051chr2231868 793 88 --23469 1145 --
NM_153182chr323123 2260 ------
NM_153183chrX11260 ------
NM_153184chr311934 ------
NM_153188chr524205 880 ------
NM_153207chr121239 ----11385
NM_153211chr18148 ------
NM_153218chr131321 ------
NM_153226chr101333 ------
NM_153235chr632453 652 78 11644 ----
NM_153246chr611276 --21968 347 --
NM_153252chrX--1324 ----
NM_153260chr1531163 622 581 ------
NM_153261chr161185 ------
NM_153262chr132963 2025 775 2994 551 ----
NM_153267chr9--2342 326 ----
NM_153273chr332047 1980 1921 12438 1955 --
NM_153332chr82521 197 12006 ----
NM_153335chr1711183 ------
NM_153354chr52368 218 ------
NM_153367chr1032772 1407 591 --13926 --
NM_153426chr4194 ------
NM_153427chr4194 ------
NM_153456chr1345739 4708 1724 958 22490 1616 15398 14526
NM_153487chr644467 3093 367 174 24856 4342 ----
NM_153499chr1222493 1866 ------
NM_153500chr1222493 1866 ------
NM_153605chr311197 ------
NM_153607chr553142 2866 2655 856 465 11189 ----
NM_153616chr15--2403 303 ----
NM_153617chr15--2403 303 ----
NM_153618chr15--2403 303 ----
NM_153619chr15----21125 934 148
NM_153631chr741365 452 418 136 --11606 --
NM_153632chr741365 452 418 136 --11606 --
NM_153649chr122099 2089 ------
NM_153689chr22728 49 ------
NM_153693chr121579 ------
NM_153707chr91137 ------
NM_153715chr721160 403 ------
NM_153748chr121161 ----1194
NM_153756chr11168 1238 11272 11662
NM_153812chr141848 1577 580 546 ------
NM_153813chr16------1162
NM_153827chr171499 ------
NM_153831chr8--1102 ----
NM_170587chr82804 520 ------
NM_170606chr721517 241 ------
NM_170663chr171499 ------
NM_170665chr1251604 1191 1024 950 663 ------
NM_170674chr15--1171 ----
NM_170677chr15--1171 ----
NM_170706chr122812 2679 1623 1161 --
NM_170709chr862221 1783 1510 841 630 170 12302 ----
NM_170719chr132913 472 ------
NM_170731chr1112801 ------
NM_170732chr1112801 ------
NM_170733chr1112801 ------
NM_170734chr1112801 ------
NM_170735chr1112801 ------
NM_170751chr621160 1142 ------
NM_170752chr621160 1142 ------
NM_170775chr51257 ------
NM_171998chrX32156 897 219 ------
NM_172058chr811776 ------
NM_172059chr811776 ------
NM_172060chr811776 ------
NM_172069chr212165 ------
NM_172070chr211970 ------
NM_172071chr136027 5174 751 ------
NM_172097chr151759 1198 ----
NM_172103chr612236 1444 ----
NM_172105chr612236 1444 ----
NM_172110chr202685 472 ------
NM_172111chr202685 472 ------
NM_172112chr202685 472 ------
NM_172113chr202685 472 ------
NM_172127chr4170 ------
NM_172128chr4126 ------
NM_172159chr332323 310 297 11852 ----
NM_172160chr332323 310 297 11852 ----
NM_172169chr1021880 1795 1751 ----
NM_172170chr1021880 1795 1751 ----
NM_172171chr1021880 1795 1751 ----
NM_172173chr1021880 1795 1751 ----
NM_172226chr1222493 1866 ------
NM_172240chr1221328 121 1254 ----
NM_172315chr15--1171 ----
NM_172316chr15--1171 ----
NM_172337chr142266 74 ------
NM_172344chr22317 97 ------
NM_172373chr131216 ------
NM_172375chr14168 ------
NM_173054chr72966 342 ------
NM_173075chr431558 444 414 ------
NM_173078chrX1434 ------
NM_173083chr11131 ------
NM_173156chr1--11900 ----
NM_173171chr221069 217 ------
NM_173172chr231377 525 327 --11025 --
NM_173173chr221069 217 ------
NM_173177chr21658 ------
NM_173198chr92289 223 ------
NM_173200chr92289 223 ------
NM_173214chr1677454 7059 6577 5818 5763 1805 577 ------
NM_173354chr2121911 1436 ------
NM_173355chr2184 --1385 --
NM_173454chr151848 1374 ----
NM_173468chr455856 5727 5507 2260 1243 ----1472
NM_173469chr1511109 --11007 --
NM_173473chr1052618 2003 724 602 412 --12089 --
NM_173475chr16----1168 --
NM_173478chr171298 148 --1712
NM_173495chrX42565 2533 365 114 ------
NM_173496chr1032923 2588 2474 --12135 --
NM_173508chr131140 425 151 ----11184
NM_173511chr223687 2431 ------
NM_173515chr61334 ------
NM_173552chr331770 341 334 ------
NM_173563chr6188 ------
NM_173582chr1176260 5340 5129 4908 1271 449 86 --15501 --
NM_173587chr11----1235 --
NM_173595chr1274894 4021 1207 758 656 487 475 --182 --
NM_173607chr1421957 503 ------
NM_173642chr1129021 8909 5803 3303 2997 2930 2740 2314 2139 752 573 277 48022 5940 1298 350 29042 8841 1123
NM_173683chr8159 ------
NM_173694chrX--12143 ----
NM_173807chr11437 ------
NM_173808chr112974 31063 393 303 ----
NM_173812chr1211519 ------
NM_173822chr23706 640 557 ------
NM_173829chr535125 3827 2193 ------
NM_173833chr821655 116 11604 ----
NM_173848chr81276 ------
NM_173851chr843176 1552 1534 168 12533 ----
NM_173854chr12722 37 ------
NM_174890chr101308 ------
NM_174911chr812473 ----2849 292
NM_174921chr431167 954 71 ------
NM_174937chr102516 126 ------
NM_174938chr9--1162 ----
NM_175038chr12----1165 --
NM_175056chr322160 383 ------
NM_175060chr14----123 --
NM_175061chr72686 354 185 ----
NM_175607chr32550 147 ------
NM_175610chr151122 ------
NM_175611chr21138 ------
NM_175612chr32550 147 ------
NM_175634chr81863 ------
NM_175635chr81863 ------
NM_175636chr81863 ------
NM_175733chr1112196 ------
NM_175736chr12117366 6997 6617 5901 5475 4858 1263 979 200 163 25 36715 5447 4897 16723 12883
NM_175748chr1452083 1905 721 234 124 ----11518
NM_175767chr521570 226 ------
NM_175852chr122620 173 --22684 129 1542
NM_175854chr131131 ------
NM_175856chr51616 1299 ----
NM_175863chr6--1266 ----
NM_175866chr13441 173 100 ------
NM_175884chr721132 124 ------
NM_175887chr72471 420 ------
NM_175907chr1831095 1046 797 --146 --
NM_175920chr51114 ------
NM_176801chr451590 1179 636 609 97 ------
NM_176814chr74578 205 189 94 ------
NM_176863chr1721648 477 21709 1434 ----
NM_176871chr8133189 3151 2931 2897 2442 2404 2250 2184 909 835 713 245 171 --13300 --
NM_177398chr11717 1530 --11449
NM_177399chr11717 1530 --11449
NM_177401chr191460 ------
NM_177424chr11515 11410 ----
NM_177438chr1453385 3074 2905 1510 1311 --11346 --
NM_177441chr171583 ------
NM_177553chr112609 380 ------
NM_177947chrX--1468 11661 --
NM_177948chrX--1468 11661 --
NM_177967chr132255 229 --2730 317 --
NM_177974chr1521903 1508 ------
NM_177985chr232176 574 498 --11414 --
NM_177990chr2031513 399 97 ------
NM_177996chr2032816 1320 24 --12374 --
NM_177999chr953660 3480 3200 869 118 --1786 --
NM_178033chr11457 ------
NM_178037chr1253640 2855 2715 2595 982 ----13289
NM_178038chr1253640 2855 2715 2595 982 ----13289
NM_178151chrX87841 7109 5675 5437 1772 1571 244 62 37773 2622 374 17542 --
NM_178152chrX87841 7109 5675 5437 1772 1571 244 62 37773 2622 374 17542 --
NM_178153chrX87841 7109 5675 5437 1772 1571 244 62 37773 2622 374 17542 --
NM_178154chr14--2682 232 ----
NM_178155chr14--2682 232 ----
NM_178156chr14--2682 232 ----
NM_178157chr14--2682 232 ----
NM_178313chr222047 1945 21995 504 ----
NM_178423chr721183 182 ------
NM_178425chr721183 182 ------
NM_178439chr2164 ------
NM_178450chr52720 486 ------
NM_178539chr121771 ----1115
NM_178566chr921700 558 11378 ----
NM_178585chr443273 2795 2586 75 ------
NM_178586chr1412132 --1658 --
NM_178812chr821377 1146 ------
NM_178835chr4------1643
NM_180976chr6----1141 --
NM_180977chr6----1141 --
NM_180989chr1332292 784 769 1715 ----
NM_181050chr161646 182 ----
NM_181054chr1431109 1049 843 ------
NM_181077chr1532288 1766 798 ----11856
NM_181291chr14--1519 ----
NM_181349chr732289 2283 209 ------
NM_181351chr1133005 2880 428 12702 ----
NM_181354chr821337 394 11406 ----
NM_181358chr153332 3121 1516 939 250 ------
NM_181361chr32988 490 ------
NM_181442chr20187 ------
NM_181443chr202631 177 --12051 --
NM_181486chr1221544 1202 1139 ----
NM_181492chr221105 ------
NM_181504chr522557 1336 11540 12810 --
NM_181521chr16107172 6836 6604 6164 5851 4575 2806 2590 1053 820 11364 16852 --
NM_181523chr522557 1336 11540 12810 --
NM_181524chr522557 1336 11540 12810 --
NM_181534chr17154 ------
NM_181659chr2072588 2426 1301 1262 925 919 719 --1251 --
NM_181659chr2072588 2426 1301 1262 925 919 719 --1251 --
NM_181671chr173589 277 65 ------
NM_181672chrX32007 824 379 11390 ----
NM_181673chrX32007 824 379 11390 ----
NM_181689chr202294 123 ------
NM_181701chr91213 1225 ----
NM_181704chr21124 ------
NM_181714chr611865 11983 --11254
NM_181782chr621554 233 22336 452 ----
NM_181787chr852913 2703 1432 1288 503 --13264 --
NM_181825chr221141 --130 --
NM_181836chr532353 616 68 21878 774 ----
NM_181838chr531229 1112 250 ------
NM_181839chr821216 1170 ------
NM_181846chr1911968 13001 ----
NM_181861chr121469 2292 118 ----
NM_181868chr121469 2292 118 ----
NM_181869chr121554 2377 203 ----
NM_181876chr412619 21759 820 12431 --
NM_182472chr4143 ------
NM_182484chr21124 ------
NM_182485chr4196 1346 ----
NM_182507chr121806 --132 --
NM_182509chr1431682 1544 343 --11249 --
NM_182515chr1984790 4579 2037 1427 1215 1031 829 305 34475 2570 2322 ----
NM_182527chr2221756 1514 1259 ----
NM_182540chrX1624 --1328 --
NM_182546chr71131 ------
NM_182551chr211433 1140 --22731 432
NM_182557chr1121888 140 ------
NM_182580chr162171 917 809 770 714 105 --12363 --
NM_182643chr8----1404 --
NM_182646chr4196 1346 ----
NM_182648chr14--1148 ----
NM_182691chr72135 23 ------
NM_182692chr72135 23 ------
NM_182697chr7--1249 ----
NM_182717chr101984 ------
NM_182720chr101984 ------
NM_182721chr101984 ------
NM_182722chr101984 ------
NM_182723chr101984 ------
NM_182729chr1231856 1446 730 ------
NM_182742chr1231856 1446 730 ------
NM_182743chr1231856 1446 730 ------
NM_182744chr131078 383 99 ------
NM_182765chr102777 259 141 1294 --
NM_182767chr1241789 700 584 161 ------
NM_182796chr51583 --157 --
NM_182830chr1442289 1995 461 40 1575 ----
NM_182853chr101984 ------
NM_182898chr734682 1280 69 26604 2601 25577 1252 --
NM_182899chr734682 1280 69 26604 2601 25577 1252 --
NM_182910chr141289 ------
NM_182913chr141289 ------
NM_182914chr141289 ------
NM_182918chr2121402 1082 137 ----
NM_182925chr53542 292 28 11048 11174 --
NM_182931chr72714 75 ------
NM_182936chr14----160 --
NM_182944chr142340 25 ------
NM_182948chr142487 1142 155 45 ------
NM_182964chr1121254 45 12606 ----
NM_182972chr12816 304 1345 22304 1964 --
NM_182975chr1167 ------
NM_182976chr11109 ------
NM_182977chr51781 ------
NM_183002chr14----160 --
NM_183011chr101984 ------
NM_183012chr101984 ------
NM_183013chr101984 ------
NM_183043chr131280 ------
NM_183044chr131280 ------
NM_183078chr643850 2779 662 140 ----13619
NM_183227chr661559 1522 1223 553 492 372 ------
NM_183377chr172826 24 ------
NM_183380chr6--1958 ----
NM_183416chr121411 709 11358 ----
NM_183419chr821427 148 1346 ----
NM_194247chr233901 3172 604 ------
NM_194250chr22383 294 ------
NM_194282chr452843 2645 2158 2010 762 ------
NM_194285chr1193442 2951 2737 2217 2126 1042 603 395 276 --22551 2447 1108
NM_194301chr1411039 ------
NM_194314chr1105403 5323 4082 3537 1841 1810 1587 1442 1255 718 11572 ----
NM_194317chr221846 1833 12697 ----
NM_194328chr922419 2228 ------
NM_194329chr922419 2228 ------
NM_194330chr922419 2228 ------
NM_194332chr922419 2228 ------
NM_194429chr61588 ------
NM_194434chr1853839 2260 1547 1468 1370 11221 --25443 1069
NM_194452chr1111166 2464 441 156 --
NM_194453chr1111166 2464 441 156 --
NM_194463chrX31191 1086 1075 ------
NM_197941chr542280 2131 1145 1103 ------
NM_197955chr15133 ------
NM_198042chr81323 --122 --
NM_198056chr332193 1670 827 ------
NM_198077chr11238 ------
NM_198123chr82500 210 --11566 --
NM_198124chr82500 210 --11566 --
NM_198129chr181344 ------
NM_198158chr352938 2167 1042 485 23 ------
NM_198159chr352938 2167 1042 485 23 ------
NM_198177chr352938 2167 1042 485 23 ------
NM_198178chr352938 2167 1042 485 23 ------
NM_198181chr1532668 986 808 --11124 --
NM_198212chr721482 931 ------
NM_198215chr101106 ------
NM_198217chr131703 ------
NM_198218chr131703 ------
NM_198219chr131703 ------
NM_198225chr1031577 221 120 ------
NM_198240chr12141 ------
NM_198261chr122774 82 ------
NM_198262chr122774 82 ------
NM_198268chr153332 3121 1516 939 250 ------
NM_198269chr153332 3121 1516 939 250 ------
NM_198270chrX13216 ------
NM_198324chr1231027 1012 113 ------
NM_198334chr11------1742
NM_198335chr11------1742
NM_198336chr721776 149 11847 ----
NM_198390chr1611747 ------
NM_198391chr20--1372 ----
NM_198399chr32719 183 ----11484
NM_198400chr1522589 893 ------
NM_198402chr32276 258 ------
NM_198463chr31419 --131 --
NM_198465chrX42871 2546 1991 369 12851 1202 --
NM_198467chr7--1171 ----
NM_198485chr321818 1738 ------
NM_198503chr121523 672 --1177 --
NM_198507chr51191 ------
NM_198511chrX--21827 1749 ----
NM_198513chr82653 199 ------
NM_198578chr1211261 1285 --191
NM_198681chr121059 942 --1486 --
NM_198686chr14173 ----11804
NM_198715chr124941 1117 11197 35024 2245 801 15272
NM_198793chr353907 1238 1124 671 473 ------
NM_198829chr7--1114 ----
NM_198834chr1742282 1620 514 120 ------
NM_198836chr1742282 1620 514 120 ------
NM_198837chr1742282 1620 514 120 ------
NM_198838chr1742282 1620 514 120 ------
NM_198839chr1742282 1620 514 120 ------
NM_198859chr374665 3508 3444 3119 1753 1544 959 --11816 --
NM_198883chr1146 ------
NM_198892chr4125 198 ----
NM_198900chr12117366 6997 6617 5901 5475 4858 1263 979 200 163 25 36715 5447 4897 16723 12883
NM_198904chr522151 1422 11592 ----
NM_198925chr151977 ------
NM_198935chr2022401 321 12840 ----
NM_198965chr121296 ------
NM_198966chr121296 ------
NM_198990chr742148 1262 743 666 ------
NM_199054chr1932025 846 121 --11591 --
NM_199160chr942111 2008 1678 666 11640 --11468
NM_199167chr181135 1365 ----
NM_199168chr1021203 1012 ----1537
NM_199189chr51107 ------
NM_199245chr122662 564 ----1284
NM_199324chr433091 1205 190 ------
NM_199327chr4--11103 1781 --
NM_199334chr171532 ------
NM_199355chr1621192 204 --1194 --
NM_199359chr2031581 1453 375 --11411 --
NM_199360chr2031581 1453 375 --11411 --
NM_199361chr2031581 1453 375 --11411 --
NM_199362chr2031581 1453 375 --11411 --
NM_199363chr2031581 1453 375 --11411 --
NM_199421chr1444925 1866 1585 332 23942 693