TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-191-3p
miRNA Sequence: GCUGCGCUUGGAUUUCGUCCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51955 ------
NM_000037chr81818 12054 22114 319 --
NM_000074chrX1349 --1831 --
NM_000081chr111709 11505 ----
NM_000084chrX24247 696 --12300 --
NM_000090chr2181 ------
NM_000097chr3122 ------
NM_000108chr71201 ------
NM_000109chrX22269 510 ------
NM_000127chr8------172
NM_000151chr1731871 1402 1314 ------
NM_000152chr171517 ------
NM_000192chr121373 ------
NM_000208chr1934238 3078 1847 ------
NM_000216chrX1389 13852 1132 --
NM_000217chr1275105 4975 1300 1050 996 463 445 ------
NM_000232chr422766 454 --12332 --
NM_000245chr721443 642 --1568 11812
NM_000248chr31230 12596 ----
NM_000258chr3136 ------
NM_000259chr1554831 4592 3954 1050 984 ------
NM_000282chr131102 ------
NM_000284chrX21429 169 --1756 --
NM_000291chrX1249 ------
NM_000297chr4----11756 --
NM_000304chr17135 ------
NM_000314chr1023126 2599 ------
NM_000332chr656838 6442 6041 871 373 --1749 --
NM_000368chr91100 ------
NM_000396chr1152 ------
NM_000411chr2122948 930 --12726 1344
NM_000424chr12----134 --
NM_000430chr1712809 ------
NM_000444chrX1110 ------
NM_000448chr1122482 2396 ------
NM_000461chr344048 3242 3060 650 14624 23247 1020 --
NM_000475chrX----233 25 --
NM_000484chr211278 ------
NM_000503chr82120 25 ------
NM_000516chr201321 ------
NM_000522chr711074 ------
NM_000533chrX------1673
NM_000555chrX16451 11549 14958 --
NM_000612chr1111466 ------
NM_000618chr1215033 --15344 --
NM_000618chr1215033 --15344 --
NM_000626chr17130 ------
NM_000639chr11591 ------
NM_000723chr1711245 --11445 --
NM_000726chr22960 216 ------
NM_000767chr19----2272 171 --
NM_000816chr51579 ------
NM_000826chr421853 107 ------
NM_000836chr191360 --140 --
NM_000840chr7161 ------
NM_000868chrX22309 1821 ------
NM_000875chr1546084 5256 1620 48 ------
NM_000891chr17----12564 --
NM_000899chr12--14164 ----
NM_000902chr311172 ------
NM_000921chr12----1460 --
NM_000933chr2041282 1227 397 374 ------
NM_000942chr15139 ------
NM_000944chr422050 1911 ------
NM_001001132chr211526 11352 --1561
NM_001001323chr1222506 524 ------
NM_001001331chr322083 1772 ------
NM_001001349chr1721212 168 ------
NM_001001395chr12------1105
NM_001001396chr114259 --1235 --
NM_001001438chr211359 ------
NM_001001521chr21225 ------
NM_001001549chr712660 --1766 --
NM_001001550chr712660 --1766 --
NM_001001555chr712660 --1766 --
NM_001001557chr811883 --1164 --
NM_001001706chr62244 176 ------
NM_001001787chr11423 ------
NM_001001890chr2133380 171 60 13125 ----
NM_001002233chr811991 11637 ----
NM_001002838chrX1183 --1635 --
NM_001002840chr71140 ------
NM_001003674chr1855510 5263 986 804 541 ------
NM_001003675chr1855510 5263 986 804 541 ------
NM_001003694chr31206 --1161 --
NM_001003792chr311072 ------
NM_001003793chr311072 ------
NM_001003800chr923072 1056 ----2809 564
NM_001004065chr92400 99 --11212 --
NM_001004304chr1232590 2570 141 --13213 --
NM_001004317chr623445 3063 --23780 1166 --
NM_001004346chr411189 ------
NM_001004356chr411538 3945 429 369 ----
NM_001004358chr411538 3945 429 369 ----
NM_001004360chr22445 272 1192 ----
NM_001004419chr122910 512 1952 --11519
NM_001004722chr2134 --1498 --
NM_001005242chr1211581 ------
NM_001005291chr17297 55 ------
NM_001005375chrY149 ------
NM_001005404chr1754472 3643 3039 1728 410 ------
NM_001005746chr22960 216 ------
NM_001005747chr22960 216 ------
NM_001005753chr242309 2178 1761 385 ------
NM_001006605chr11778 ------
NM_001006605chr11778 ------
NM_001006636chr21826 ------
NM_001007026chr121363 1190 ----
NM_001007027chr111172 ------
NM_001007237chr122650 1978 ------
NM_001007246chr2111305 ------
NM_001007257chr11574 ------
NM_001007271chr102815 282 ------
NM_001007466chr665059 4817 4011 1646 498 49 --13891 --
NM_001008393chr412426 ------
NM_001008407chr731634 525 353 ------
NM_001008408chr714288 177 1423 --
NM_001008541chr1012225 --21649 25 --
NM_001008541chr1012225 --21649 25 --
NM_001008701chr1943010 2636 671 298 ------
NM_001008707chr1421281 215 --11331 --
NM_001008738chr522711 1854 ------
NM_001009185chr5----1668 --
NM_001009555chr411757 ------
NM_001009566chr121406 438 1112 ----
NM_001009993chr243607 1510 641 34 14147 11612 --
NM_001010867chr174371 2569 2558 2535 2368 1106 21 --36195 1494 681 --
NM_001010927chr61115 1443 ----
NM_001010986chrX--12350 ----
NM_001011538chr42768 127 ------
NM_001012329chr132020 1789 762 ------
NM_001012393chr1125183 414 14454 14793 --
NM_001012751chr1011451 --1338 --
NM_001012754chr1331882 1789 191 ------
NM_001012761chr522682 439 ------
NM_001012977chrX----2961 124 --
NM_001013415chr421600 116 ------
NM_001013438chr3177 ------
NM_001013690chr1211764 ------
NM_001013843chr152743 734 ------
NM_001014797chr1046487 5576 5095 1702 --11775 --
NM_001015045chr4----2622 67 12566
NM_001015877chrX22517 854 ------
NM_001015880chr1021674 615 ------
NM_001015887chr3----11531 --
NM_001017371chr211129 ------
NM_001017395chr343168 2534 2225 43 ----12524
NM_001017440chr742420 2195 567 152 ------
NM_001017923chr141461 ------
NM_001017930chrX21026 137 ------
NM_001017977chr12251 85 ------
NM_001018064chr912013 ------
NM_001024024chr141114 ------
NM_001024070chr141110 ------
NM_001024071chr14182 ------
NM_001024649chr512502 --2941 492 --
NM_001024688chr8--1590 ----
NM_001024808chr1262371 2153 2100 666 613 130 11882 ----
NM_001024858chr142598 22 141 ----
NM_001024947chr5189 ------
NM_001024948chr143309 1410 1054 1039 ------
NM_001025077chr1015068 ------
NM_001025108chr223891 2987 13421 23852 3825 13098
NM_001025266chr311507 --23765 1632 --
NM_001025366chr6--1176 11811 --
NM_001025366chr6--1176 11811 --
NM_001025367chr6--1176 11811 --
NM_001025367chr6--1176 11811 --
NM_001025368chr6--1176 11811 --
NM_001025368chr6--1176 11811 --
NM_001025369chr6--1192 11827 --
NM_001025369chr6--1192 11827 --
NM_001025370chr6--1176 11811 --
NM_001025370chr6--1176 11811 --
NM_001025580chrX43372 3244 2605 424 ------
NM_001025780chr91195 ------
NM_001029858chr6197 ------
NM_001030001chr14------1410
NM_001030006chr171447 186 --12024
NM_001030007chr161840 ------
NM_001030272chr11143 ------
NM_001030273chr11143 ------
NM_001031679chr1243140 3071 1001 681 --1390 --
NM_001031690chr732589 2530 522 --1327 --
NM_001031804chr1622677 1129 ------
NM_001032296chr1322713 270 ------
NM_001032380chr101535 ------
NM_001032394chr612778 ------
NM_001032395chr612645 ------
NM_001033045chr243065 1427 1364 158 ------
NM_001033057chr321376 605 ------
NM_001033059chr61251 ------
NM_001033087chr2022906 852 ----1630
NM_001033117chr344545 4096 3992 3607 24251 137 ----
NM_001033578chr822337 603 ------
NM_001033723chr822426 1100 12589 1534 --
NM_001033756chr6--1110 11745 --
NM_001033756chr6--1110 11745 --
NM_001033925chr1011558 11400 ----
NM_001034837chr51314 ------
NM_001034838chr51314 ------
NM_001034845chr41377 ------
NM_001034954chr1022574 614 --1820 --
NM_001034955chr1022574 614 --1820 --
NM_001034956chr1022574 614 --1820 --
NM_001034957chr1022574 614 --1820 --
NM_001035260chr1021316 375 --1229 --
NM_001037132chr732094 737 193 ------
NM_001037133chr732094 737 193 ------
NM_001037163chr7189 ------
NM_001037164chr71643 ------
NM_001037290chr112775 418 ------
NM_001037331chr181292 ----1762
NM_001037582chr431519 649 262 --2560 255 --
NM_001037872chr2170 ------
NM_001038493chr21144 --11274 --
NM_001038640chr151741 ------
NM_001039199chr2024977 4222 ------
NM_001039350chr721266 1196 ------
NM_001039538chr21642 ------
NM_001039574chr12395 259 ------
NM_001039577chr153280 3263 3146 857 39 --23696 71 --
NM_001039585chr123875 154 ------
NM_001039590chrX13085 ------
NM_001039591chrX13085 ------
NM_001039618chr1134203 2007 1662 ------
NM_001039619chr14170 ------
NM_001039693chr233771 3009 954 ------
NM_001039888chr11123 ------
NM_001039933chr17130 ------
NM_001039937chr13--14085 ----
NM_001040057chr7139 ------
NM_001040101chr421382 187 ----11519
NM_001040214chr6----11494 1600
NM_001040272chr931800 869 415 ----1566
NM_001040284chr1634487 1407 63 ------
NM_001040402chr4185 ------
NM_001040429chr1311046 ------
NM_001040450chr1522150 1039 ------
NM_001040453chr1522150 1039 ------
NM_001040633chr73401 333 252 ------
NM_001040712chr931294 1240 866 ------
NM_001041chr31142 ------
NM_001042355chr161273 11216 ----
NM_001042412chr161273 11216 ----
NM_001042437chr2----1101 --
NM_001042506chrX----2961 124 --
NM_001042510chr81412 ------
NM_001042511chr81412 ------
NM_001042537chrX183 ------
NM_001042555chr1211923 ------
NM_001042601chr3------22830 982
NM_001042604chr334065 1907 201 13430 ----
NM_001042631chr19------1437
NM_001042749chrX1143 ------
NM_001042750chrX1143 ------
NM_001042751chrX1143 ------
NM_001043318chr1443123 1637 982 194 148 22657 464 --
NM_001043351chr111446 ------
NM_001044305chr611447 --11505 --
NM_001077628chr1----187 --
NM_001083620chr421851 107 ------
NM_001083621chr121483 1116 1873 --11426
NM_001100108chr136764 6194 1773 15970 21815 625 --
NM_001106chr357755 7055 2984 1758 819 --22533 2069 --
NM_001116chr1611077 12245 --22377 2307
NM_001122631chr111275 ------
NM_001122679chr51955 ------
NM_001127chr221438 --1191 --
NM_001128chr161840 ------
NM_001135chr151789 --1296 --
NM_001147chr8160 ------
NM_001148chr421430 110 ----12001
NM_001160chr1221792 107 --2923 625 --
NM_001178chr11143 ------
NM_001187chr211562 ------
NM_001190chr19188 ------
NM_001196chr2241399 1067 910 299 ------
NM_001198chr621733 671 ------
NM_001204chr237276 4831 4783 ------
NM_001241chr232011 932 788 ------
NM_001241chr232011 932 788 ------
NM_001259chr711750 ------
NM_001273chr121141 ------
NM_001282chr171447 186 --12024
NM_001284chr5----1367 --
NM_001290chr41274 ------
NM_001292chr1531028 825 776 ------
NM_001316chr201455 ------
NM_001332chr52536 33 ------
NM_001346chr322466 529 ----22435 2146
NM_001364chr1134418 4221 1721 11352 ----
NM_001389chr211155 ------
NM_001391chr181896 ------
NM_001396chr21173 ------
NM_001397chr122403 2115 ------
NM_001400chr111260 ------
NM_001414chr12129 ------
NM_001418chr111539 ------
NM_001418chr111539 ------
NM_001420chr1911263 ------
NM_001429chr221132 1389 ----
NM_001431chr6--1405 ----
NM_001438chr132691 1320 696 12331 1721 --
NM_001482chr15185 ------
NM_001494chr101646 ------
NM_001500chr6--161 ----
NM_001539chr9142 ------
NM_001542chr122650 1978 ------
NM_001608chr21936 ------
NM_001614chr17121 ------
NM_001614chr17121 ------
NM_001616chr2------12418
NM_001634chr61251 ------
NM_001635chr71742 ------
NM_001650chr1842577 1422 828 102 ------
NM_001655chr1112203 ------
NM_001663chr1412790 11915 ----
NM_001677chr111061 ------
NM_001681chr12--1549 ----
NM_001682chr1222220 238 ------
NM_001683chr322083 1772 ------
NM_001684chr113976 ------
NM_001690chr32671 104 ------
NM_001706chr31116 ------
NM_001707chr71142 ------
NM_001730chr1321004 304 --11088 --
NM_001730chr1321004 304 --11088 --
NM_001742chr711456 ------
NM_001746chr512502 --2941 492 --
NM_001754chr2133380 171 60 13125 ----
NM_001759chr1211398 --14403 --
NM_001792chr18------1746
NM_001799chr51200 ------
NM_001810chr20------198
NM_001829chr41246 --1304 --
NM_001873chr42716 82 ------
NM_001936chr721266 1196 ------
NM_001940chr121363 1190 ----
NM_001945chr5----11167 --
NM_001962chr51479 ------
NM_001969chr1443531 2461 1414 69 --11243 --
NM_001980chr1211468 --1413 --
NM_001981chr11490 ------
NM_001995chr41420 ------
NM_002010chr131477 ------
NM_002015chr131209 ----13168
NM_002024chrX11742 ------
NM_002025chrX49125 6478 2628 55 18893 ----
NM_002076chr1232303 2164 1261 --12651 --
NM_002080chr163890 857 789 ------
NM_002084chr51735 ------
NM_002086chr172640 298 ----1103
NM_002129chr4----182 --
NM_002140chr9--1439 ----
NM_002141chr71617 ------
NM_002154chr52191 79 ------
NM_002198chr5--169 ----
NM_002210chr223180 2869 ------
NM_002211chr101105 ------
NM_002222chr31419 ------
NM_002226chr142894 754 ------
NM_002233chr111357 --167 --
NM_002247chr1012252 --11865 --
NM_002254chr22264 121 --11692 --
NM_002267chr1332171 1683 421 ----12211
NM_002268chr3----21888 365 --
NM_002270chr544509 1743 1490 402 --1858 --
NM_002271chr13------1355
NM_002285chr223891 2987 13421 23852 3825 13098
NM_002309chr2222103 310 1822 ----
NM_002315chr11----188 --
NM_002317chr51317 ------
NM_002336chr1214031 ------
NM_002359chr1764197 2869 2675 1187 562 542 ------
NM_002372chr51507 ------
NM_002374chr21642 ------
NM_002376chr141511 ------
NM_002397chr511365 ------
NM_002398chr2----11507 --
NM_002401chr1722479 2404 ------
NM_002480chr1211311 ------
NM_002485chr8--1590 ----
NM_002499chr1531933 774 290 ------
NM_002500chr21104 ------
NM_002505chr6--11328 ----
NM_002518chr21302 --21066 157 --
NM_002519chr1111020 ------
NM_002522chr1713588 ----1997
NM_002523chr741230 1130 447 405 ------
NM_002545chr1125183 414 14454 14793 --
NM_002547chrX33841 3021 1678 ------
NM_002581chr944786 1810 560 247 ------
NM_002590chr131200 ------
NM_002594chr2011824 ------
NM_002595chr122295 276 ------
NM_002596chr1------11380
NM_002607chr721019 180 ----1370
NM_002628chr32418 397 ------
NM_002635chr12158 ------
NM_002636chr61188 ------
NM_002643chr2--132 ----
NM_002645chr1112990 ------
NM_002653chr56892 357 298 129 56 50 163 ----
NM_002655chr814153 --1870 11801
NM_002693chr152165 54 ------
NM_002698chr19138 ------
NM_002705chr16196 ------
NM_002707chr21107 ------
NM_002709chr21756 ------
NM_002714chr611041 ------
NM_002715chr5----11074 --
NM_002719chr1421499 149 --21616 247 --
NM_002734chr173387 344 247 ------
NM_002737chr1732411 2036 1365 ------
NM_002745chr2232912 782 255 23388 1402 ----
NM_002809chr171119 ------
NM_002822chr1211829 ------
NM_002828chr181105 ------
NM_002834chr1224022 1302 --13288 --
NM_002837chr1224376 670 --23098 1775 --
NM_002839chr931294 1240 866 ------
NM_002844chr6124 187 ----
NM_002847chr71389 11043 1134 11308
NM_002868chr1232098 2026 702 ------
NM_002874chr931718 170 38 ------
NM_002890chr51194 ------
NM_002892chr141344 ------
NM_002912chr61901 ------
NM_002928chr11102 ----11127
NM_002941chr321527 96 ------
NM_002942chr321118 80 ------
NM_002948chr32877 138 ------
NM_002956chr12--179 ----
NM_002977chr212664 --1121 --
NM_003003chr171249 129 ----
NM_003010chr1722277 512 ------
NM_003011chr91358 11450 ----
NM_003016chr1721603 1361 11723 --11661
NM_003017chr6------11345
NM_003026chr9--1995 194 --
NM_003028chr943676 3656 3484 628 --23650 3149 --
NM_003034chr1247529 6407 5190 802 --15883 11934
NM_003045chr1341641 1311 520 87 ------
NM_003068chr82758 686 ------
NM_003100chr51290 ------
NM_003108chr256912 6004 2891 2336 2329 42640 1906 1679 40 --15891
NM_003111chr211129 ------
NM_003112chr733138 2803 2721 1944 ----
NM_003113chr21267 ------
NM_003128chr2--22092 207 1513 --
NM_003131chr612089 ------
NM_003139chr111911 ------
NM_003144chr6------176
NM_003156chr111258 ------
NM_003178chr31618 ------
NM_003189chr133185 1198 905 ------
NM_003199chr1833742 1195 210 --31653 1485 863 --
NM_003204chr1711396 ------
NM_003213chr12142 ------
NM_003216chr2273098 2994 2797 2537 1065 117 107 1232 ----
NM_003236chr23318 288 132 ------
NM_003247chr621758 668 ------
NM_003250chr171439 ------
NM_003253chr2111750 ------
NM_003255chr172931 255 ------
NM_003269chr61881 ------
NM_003286chr20--11086 ----
NM_003298chr336153 1739 940 ------
NM_003300chr141465 ------
NM_003304chr311287 ------
NM_003317chr141241 ------
NM_003319chr2----1765 --
NM_003337chr51425 ------
NM_003340chr421168 983 ------
NM_003347chr2221612 48 11564 ----
NM_003376chr6--1176 11811 --
NM_003376chr6--1176 11811 --
NM_003380chr101109 --122 --
NM_003390chr111709 ------
NM_003404chr2021779 1503 ------
NM_003410chrX----1660 --
NM_003412chr31664 12044 1700 --
NM_003432chr52470 456 ------
NM_003458chr343915 3744 3267 82 ------
NM_003473chr101696 ------
NM_003488chr171975 --1782 --
NM_003507chr211889 ------
NM_003559chr17--23664 2962 ----
NM_003574chr1811413 ------
NM_003576chr1322713 270 ------
NM_003583chr1213202 ------
NM_003603chr41690 ------
NM_003626chr1121192 936 --2980 975 --
NM_003629chr122210 1368 --1385 --
NM_003631chr101152 ------
NM_003632chr171741 ------
NM_003651chr121559 ------
NM_003668chr121134 ------
NM_003671chr923409 2960 ------
NM_003721chr19--1146 ----
NM_003722chr311690 ------
NM_003743chr2--11890 ----
NM_003749chr1332385 1714 389 --2600 543 --
NM_003750chr10----1898 --
NM_003758chr151642 --1108 --
NM_003758chr151642 --1108 --
NM_003760chr1----184 --
NM_003783chr11937 --1931 --
NM_003795chr6--1475 ----
NM_003799chr1844396 3992 3277 113 ------
NM_003873chr102370 196 12366 ----
NM_003875chr3134 ------
NM_003884chr311300 ------
NM_003885chr1742492 1859 1812 1642 --1800 --
NM_003887chr221865 1668 1849 ----
NM_003895chr2121816 102 ------
NM_003896chr2----1101 --
NM_003913chr644315 853 514 412 ------
NM_003921chr11343 ------
NM_003924chr411215 --1305 11368
NM_003927chr181900 ------
NM_003939chr1023948 3411 --23777 3391 --
NM_003947chr31125 ------
NM_003949chr1712036 --1623 --
NM_003958chr622754 958 ------
NM_003966chr567679 6796 5684 3005 420 113 ------
NM_003980chr611232 ------
NM_003992chr151111 ------
NM_003994chr12--14164 ----
NM_004006chrX22269 510 ------
NM_004007chrX22269 510 ------
NM_004009chrX22269 510 ------
NM_004010chrX22269 510 ------
NM_004011chrX22269 510 ------
NM_004012chrX22269 510 ------
NM_004013chrX22269 510 ------
NM_004014chrX22269 510 ------
NM_004015chrX22269 510 ------
NM_004016chrX22183 424 ------
NM_004017chrX22269 510 ------
NM_004018chrX22183 424 ------
NM_004020chrX22269 510 ------
NM_004021chrX22183 424 ------
NM_004022chrX22183 424 ------
NM_004023chrX22183 424 ------
NM_004028chr1842577 1422 828 102 ------
NM_004036chr22539 90 ------
NM_004037chr11874 ------
NM_004067chr71483 ------
NM_004081chrY149 ------
NM_004093chr133933 895 425 22618 226 ----
NM_004100chr622475 2365 12308 ----
NM_004171chr1135857 2627 43 ------
NM_004176chr17297 55 ------
NM_004200chr1123069 2365 11076 11260 --
NM_004227chr742421 715 220 200 11246 12539 --
NM_004230chr1912227 --2716 397 --
NM_004232chr18--1246 ----
NM_004236chr15----1592 144
NM_004241chr101746 ------
NM_004249chr42103 90 ------
NM_004263chr21457 ------
NM_004267chr31166 ------
NM_004296chr1413959 --13084 --
NM_004302chr122676 66 --1441 --
NM_004329chr10----1375 --
NM_004330chr151446 ------
NM_004331chr822472 2015 ------
NM_004338chr1855510 5263 986 804 541 ------
NM_004342chr71350 ------
NM_004354chr4----1755 --
NM_004365chr51301 ------
NM_004370chr611920 ------
NM_004380chr1612329 ------
NM_004385chr51590 --1268 --
NM_004396chr17----1115 --
NM_004414chr21------1433
NM_004420chr1122313 730 ------
NM_004430chr82438 90 ----1450
NM_004434chr1421281 215 --11331 --
NM_004454chr312247 ----12201
NM_004458chrX21851 30 --1195 --
NM_004482chr21120 ------
NM_004491chr1964208 3660 3651 3635 3615 3413 11482 23458 975 12733
NM_004496chr141160 ------
NM_004516chr191898 2923 259 ----
NM_004535chr2011736 1675 --11557
NM_004571chr2152461 2380 146 131 100 ------
NM_004575chr411311 ------
NM_004598chr5----1321 --
NM_004600chr111189 ------
NM_004603chr711007 ------
NM_004612chr954475 4323 4066 3300 1411 ------
NM_004615chrX1664 ------
NM_004634chr31206 --1161 --
NM_004664chr12--1252 ----
NM_004670chr1021674 615 ------
NM_004687chr1712057 1304 ----
NM_004717chr721406 37 ------
NM_004719chr123342 319 47 ------
NM_004725chr101182 1595 ----
NM_004730chr51683 --1203 --
NM_004736chr12503 471 ------
NM_004745chr832600 1642 56 1744 44742 689 467 61 --
NM_004762chr1731419 1413 747 ------
NM_004768chr121104 903 ------
NM_004774chr171383 --12715 --
NM_004788chr11------143
NM_004798chr2011459 --11059 --
NM_004805chr21209 --1519 --
NM_004831chr19124 ------
NM_004834chr212586 2731 120 13084 --
NM_004845chrX13014 1199 ----
NM_004859chr1721967 580 --11879 --
NM_004863chr1425284 4665 --14350 13797
NM_004869chr181595 ------
NM_004887chr5----1964 --
NM_004896chr1021231 290 --1144 --
NM_004898chr4----12692 --
NM_004932chr531567 1547 205 ------
NM_004949chr1822006 506 ------
NM_004958chr11687 ------
NM_004962chr102147 80 ------
NM_004969chr10126 ------
NM_004992chrX48028 6751 5812 806 28150 7556 32700 1724 1719 --
NM_004992chrX48028 6751 5812 806 28150 7556 32700 1724 1719 --
NM_005010chr732094 737 193 ------
NM_005028chr102917 416 ------
NM_005052chr171260 ------
NM_005056chr1253717 3659 3601 3426 3417 ------
NM_005065chr1434502 3697 1708 --22108 1816 --
NM_005078chr1521664 427 ------
NM_005109chr322252 2152 ------
NM_005112chr4------1876
NM_005121chr1722627 2478 ------
NM_005156chr945254 4277 1358 1289 11244 --14763
NM_005157chr921900 611 ------
NM_005159chr1522293 1921 1886 ----
NM_005168chr2184 ------
NM_005187chr1631955 317 204 1236 ----
NM_005192chr14--1115 ----
NM_005202chr11216 ----1839
NM_005219chr5--11213 1202 --
NM_005238chr1121387 166 ------
NM_005241chr311357 ------
NM_005244chr201603 ------
NM_005249chr141317 ------
NM_005259chr21504 ------
NM_005261chr82781 126 ------
NM_005262chr1631523 1337 75 --11206 --
NM_005281chr11971 ------
NM_005308chr101422 ------
NM_005311chr712660 --1766 --
NM_005312chr921659 86 142 ----
NM_005316chr1121026 798 ------
NM_005329chr162653 31 11603 --11945
NM_005338chr744048 3292 2764 2531 ------
NM_005358chr13----1219 --
NM_005359chr18--1987 12131 --
NM_005375chr61142 ------
NM_005386chr203925 915 82 ------
NM_005387chr111121 ------
NM_005388chr921499 394 ------
NM_005392chr911258 ------
NM_005401chr1195 ------
NM_005402chr7------11236
NM_005433chr1821750 203 ------
NM_005436chr10----11086 --
NM_005455chr11146 ------
NM_005458chr912359 ----1560
NM_005475chr1222355 636 ------
NM_005497chr1736003 4746 1558 --35432 1663 1193 --
NM_005504chr1224298 597 ----15909
NM_005509chr511544 ------
NM_005537chr13----1727 --
NM_005573chr5------163
NM_005584chr13197 ------
NM_005587chr151397 ------
NM_005595chr11802 --127 --
NM_005596chr934838 2116 880 ------
NM_005644chr1----1131 --
NM_005647chrX53261 3099 2641 913 705 ------
NM_005650chr2221268 110 ------
NM_005652chr16----1137 --
NM_005667chr2----1106 --
NM_005688chr31394 11117 ----
NM_005717chr1--11229 ----
NM_005721chr21360 ------
NM_005725chr111857 ------
NM_005734chr112654 292 ------
NM_005738chr71643 ------
NM_005763chr7----1354 --
NM_005765chrX1332 ------
NM_005768chr12--137 ----
NM_005776chr142857 35 ------
NM_005779chr51190 ------
NM_005819chr142598 2287 824 407 ------
NM_005832chr3190 ------
NM_005840chrX42507 1443 863 162 ------
NM_005859chr511040 ------
NM_005862chr31781 ------
NM_005885chr521402 371 ------
NM_005888chr12158 ------
NM_005896chr21705 ------
NM_005898chr11------12158
NM_005904chr181380 ------
NM_005911chr2137 ------
NM_005920chr12918 862 --13250 --
NM_005922chr61387 ------
NM_005923chr6--1497 ----
NM_005935chr41255 --11434 --
NM_005937chr1722567 862 --23205 528 11605
NM_005955chr121905 1083 21458 950 11898 --
NM_005962chr1012225 --21649 25 --
NM_005962chr1012225 --21649 25 --
NM_005969chr113966 810 196 ------
NM_005977chr131818 ------
NM_005984chr22----178 --
NM_006029chr141264 ----128
NM_006036chr212482 ------
NM_006047chr20----11165 --
NM_006051chr51293 ------
NM_006067chr16--2785 193 ----
NM_006089chrX11308 ------
NM_006096chr82679 312 ------
NM_006109chr14170 ------
NM_006141chr1612735 ------
NM_006160chr1721617 105 --2147 71 --
NM_006178chr171144 ------
NM_006180chr912013 ------
NM_006191chr12--1824 176 --
NM_006195chr9145 ------
NM_006203chr521167 60 ------
NM_006204chr101186 ------
NM_006206chr41495 ------
NM_006216chr21622 ------
NM_006251chr531118 544 207 --12252 --
NM_006256chr121085 195 ------
NM_006257chr101809 ------
NM_006268chr111263 ------
NM_006275chr201641 ------
NM_006283chr821250 1196 ----13133
NM_006293chr151383 ------
NM_006300chr1912380 ------
NM_006310chr171491 ------
NM_006311chr17130 ------
NM_006312chr122928 791 1209 ----
NM_006313chr1221442 150 ------
NM_006317chr5----1318 --
NM_006325chr12170 --1592 --
NM_006336chr921372 433 --11173 --
NM_006359chrX183 ------
NM_006367chr11210 ------
NM_006375chrX11856 ------
NM_006378chr92105 95 1125 ----
NM_006380chr1713820 ----13160
NM_006383chr151522 ------
NM_006407chr31523 ------
NM_006411chr61213 ------
NM_006420chr2023308 2115 ------
NM_006434chr1022574 614 --1820 --
NM_006482chr1213202 ------
NM_006496chr1--1735 ----
NM_006504chr1012773 ------
NM_006526chr201864 ------
NM_006534chr2043026 2524 716 707 ------
NM_006538chr214052 --11382 --
NM_006540chr82423 253 ------
NM_006546chr1756356 5447 1605 690 239 16112 ----
NM_006558chr81428 ------
NM_006593chr2----1148 --
NM_006595chr1121931 532 ------
NM_006603chrX1143 ------
NM_006609chr212425 ------
NM_006622chr51479 ------
NM_006625chr11928 ------
NM_006625chr11928 ------
NM_006625chr11928 ------
NM_006628chr1521363 183 --23486 1356 --
NM_006633chr51596 ------
NM_006644chr131242 ------
NM_006654chr1211923 ------
NM_006691chr112297 161 ------
NM_006703chr6151 ------
NM_006717chr912950 --13168 --
NM_006722chr31230 12596 ----
NM_006724chr61387 ------
NM_006729chrX31600 1351 102 --15389 --
NM_006734chr611478 ------
NM_006742chr1611945 ------
NM_006754chr71965 --1796 --
NM_006759chr21225 ------
NM_006766chr811887 ------
NM_006775chr61901 1957 1107 --
NM_006788chr18--1482 1673 --
NM_006806chr211341 ------
NM_006818chr11313 ------
NM_006851chr121879 ------
NM_006854chr741782 1742 1695 315 ------
NM_006874chr4--1869 ----
NM_006885chr1623721 2802 ------
NM_006888chr1422957 2304 1492 ----
NM_006897chr121529 1417 ----
NM_006922chr232151 712 381 ------
NM_006924chr1712727 ------
NM_006950chrX1835 ------
NM_006951chr101588 ------
NM_006981chr91609 ------
NM_006988chr2131234 89 57 ------
NM_006990chr1------1953
NM_006996chr1------181
NM_007008chr2----1102 --
NM_007011chr1515116 ----16396
NM_007013chr81392 ------
NM_007036chr51811 ------
NM_007054chr521316 244 --12692 --
NM_007067chr17----1240 --
NM_007106chr13--1809 ----
NM_007124chr611273 ------
NM_007126chr9121 ------
NM_007144chr17----11188 --
NM_007146chr17--11122 ----
NM_007167chr11869 ------
NM_007185chr11369 ------
NM_007203chr92400 99 --11212 --
NM_007207chr12740 327 ------
NM_007214chr6------11334
NM_007236chr151845 --11526 --
NM_007245chr16----1235 --
NM_007249chr1322933 27 11486 ----
NM_007285chr161106 ------
NM_007287chr311172 ------
NM_007288chr311172 ------
NM_007289chr311172 ------
NM_007313chr921900 611 ------
NM_007347chr1513070 ------
NM_007353chr752255 2076 2004 1909 486 --12235 --
NM_007358chr111606 --1452 --
NM_007361chr142511 141 ------
NM_007363chrX1692 ------
NM_007368chr1311130 21068 617 --187
NM_007375chr11850 2939 856 ----
NM_012081chr513292 1771 ----
NM_012083chr10--141 ----
NM_012095chr1033520 3146 383 ------
NM_012099chr192454 203 --2447 105 --
NM_012120chr612663 ------
NM_012141chr13--14085 ----
NM_012156chr2022386 903 ------
NM_012164chr977229 6403 4684 2257 2246 1281 122 ------
NM_012166chr91642 ------
NM_012199chr111513 11448 ----
NM_012218chr1932982 576 141 ------
NM_012223chr2149 ------
NM_012249chr233560 751 491 ------
NM_012257chr71847 ------
NM_012281chr722287 948 ------
NM_012297chr41384 ------
NM_012300chr512498 ------
NM_012301chr721966 37 1184 1282 --
NM_012304chr53853 837 70 ------
NM_012325chr2031442 1135 137 ------
NM_012328chr7193 ------
NM_012330chr1021525 481 ------
NM_012333chr11342 ------
NM_012334chr514572 ----13026
NM_012343chr51778 ------
NM_012347chr6153 ------
NM_012382chr5--13575 --13797
NM_012392chr1128 ------
NM_012399chr2231880 1857 227 --175 --
NM_012405chr133331 1286 44 --12696 --
NM_012414chr12156 53 ------
NM_012417chr171576 ------
NM_012428chr151991 ------
NM_012454chr61115 1443 ----
NM_012461chr141281 ------
NM_012479chr721067 24 11023 ----
NM_013227chr151789 --1296 --
NM_013229chr1221792 107 --2923 625 --
NM_013257chr822337 603 ------
NM_013261chr453750 3248 1329 957 56 ----1654
NM_013269chr122837 439 1879 --11446
NM_013281chr2011286 ------
NM_013316chr71956 ------
NM_013333chr19175 ------
NM_013372chr1522313 144 ----12253
NM_013374chr31591 ------
NM_013399chr1611632 1727 11689 --
NM_013423chrX21114 194 ------
NM_013427chrX21114 194 ------
NM_013444chrX1933 ------
NM_013449chr1232892 1032 995 1211 12634 --
NM_013450chr21278 ------
NM_013995chrX22216 969 ------
NM_014011chr222612 770 --21008 525 --
NM_014016chr31633 149 ----
NM_014043chr3------164
NM_014071chr201154 ------
NM_014079chr33668 398 220 ------
NM_014109chr81499 ------
NM_014112chr815409 --1595 --
NM_014184chr1143 ------
NM_014216chr1421418 542 2238 40 132 --
NM_014231chr12----1536 --
NM_014240chr323822 758 --13310 --
NM_014243chr411633 ------
NM_014253chrX12176 ------
NM_014271chrX1653 ------
NM_014275chr53653 626 604 ------
NM_014278chr41155 ------
NM_014283chr1--11029 ----
NM_014299chr1911952 ----12029
NM_014305chr13190 ------
NM_014317chr10--188 ----
NM_014325chr1211510 ------
NM_014333chr1112488 --12287 --
NM_014368chr911589 ------
NM_014392chr421382 187 ----11519
NM_014421chr4----1193 --
NM_014445chr3----11855 --
NM_014454chr62909 844 ------
NM_014458chr1--1186 ----
NM_014470chr12--153 ----
NM_014491chr71686 ------
NM_014502chr111389 ------
NM_014517chr31248 ------
NM_014574chr1421572 252 ------
NM_014586chr2144443 4055 1428 1315 --12959 --
NM_014592chr51314 ------
NM_014600chr211644 ------
NM_014612chr91551 ------
NM_014618chr91334 ------
NM_014634chr2233466 2857 2775 13172 23471 539 --
NM_014636chr92955 415 ------
NM_014665chr8123160 3145 3109 3073 3031 2643 2520 1424 1306 916 906 869 53444 3176 3120 2391 1352 ----
NM_014666chr5--148 ----
NM_014667chr3----11984 --
NM_014677chr811309 ------
NM_014682chr8--11463 ----
NM_014686chr1912425 1787 ----
NM_014690chr732589 2530 522 --1327 --
NM_014705chr71399 ----1465
NM_014707chr721917 738 ------
NM_014712chr161592 ------
NM_014718chr121723 --1704 --
NM_014729chr822185 689 ------
NM_014739chr612596 ----13954
NM_014743chr432563 2246 1139 ------
NM_014755chr213700 13131 11717 --
NM_014790chr51352 ------
NM_014810chr123562 3284 13478 ----
NM_014819chr51207 ------
NM_014820chr311712 ------
NM_014824chr1111935 11968 ----
NM_014836chr101535 ------
NM_014839chr111958 ------
NM_014841chr611363 --1442 --
NM_014850chr344545 4096 3992 3607 24251 137 ----
NM_014870chr121483 1116 1873 --11426
NM_014872chr941920 1575 305 180 ------
NM_014876chr2231621 622 134 ------
NM_014877chr1715795 --26978 5824 --
NM_014883chr4----2622 67 12566
NM_014893chrY--1535 ----
NM_014897chr171949 --12514 --
NM_014901chr512245 1445 ----
NM_014903chr1221901 1692 ------
NM_014917chr1--1860 ----
NM_014920chr623182 2468 2456 88 11466 --
NM_014921chr1943010 2636 671 298 ------
NM_014923chr13------11969
NM_014925chr12----1311 --
NM_014934chr1313758 ------
NM_014942chr612586 ------
NM_014944chr121406 438 1112 ----
NM_014947chr1148 22943 2587 21050 964 --
NM_014962chr2022127 38 ----12869
NM_014982chr1411090 ------
NM_014988chr41411 ------
NM_014991chr423175 2983 --1902 --
NM_014997chr712636 ------
NM_015000chr12--169 ----
NM_015001chr1----1975 --
NM_015008chr343168 2534 2225 43 ----12524
NM_015020chr1633062 157 38 ------
NM_015024chr81424 ----1519
NM_015026chr121536 --11172 --
NM_015032chr1312663 ------
NM_015040chr223120 3079 ------
NM_015051chr912290 ------
NM_015053chr112260 --11515 --
NM_015057chr132626 133 ------
NM_015069chr161588 ------
NM_015076chr61149 --24418 2788 --
NM_015094chr2264655 3712 3372 3225 1257 438 1475 ----
NM_015113chr171168 ----1221
NM_015115chr4185 ------
NM_015130chr411116 ------
NM_015132chr7----11863 --
NM_015137chr8------1828
NM_015138chr1532634 1122 293 ------
NM_015144chr1632895 569 156 --1893 2270 150
NM_015155chr1032440 578 406 --23209 2355 --
NM_015156chr1413283 --12449 1994
NM_015163chr14--190 ----
NM_015176chr1--1265 ----
NM_015192chr2022459 1038 ------
NM_015200chr411966 ----12342
NM_015205chr1343842 3778 3516 3345 ------
NM_015206chr1521121 227 ------
NM_015208chr1843809 2900 1595 1461 1539 --13243
NM_015213chr11189 ------
NM_015215chr1----12771 --
NM_015225chr91789 ------
NM_015247chr161273 11216 ----
NM_015250chr911374 1393 ----
NM_015256chr5----1668 --
NM_015263chr151486 ------
NM_015265chr21947 ----1925
NM_015271chr41601 ------
NM_015282chr252712 2646 2531 637 300 ----1625
NM_015285chr1812313 ------
NM_015299chr1423506 2537 --11400 --
NM_015310chr875832 5071 3269 3078 2527 2469 549 --15624 --
NM_015326chr1--22774 2752 ----
NM_015344chr831910 1826 535 --11953 --
NM_015355chr171725 ------
NM_015365chrX43372 3244 2605 424 ------
NM_015382chr141675 171 ----
NM_015385chr1022574 614 --1820 --
NM_015423chr1111489 ------
NM_015435chr81203 11053 ----
NM_015436chr41336 ------
NM_015455chr522921 317 --13908 --
NM_015458chr814906 ------
NM_015460chr321886 126 ------
NM_015463chr2----166 --
NM_015475chr2----1921 --
NM_015477chr151151 ------
NM_015483chr7121 1990 ----
NM_015509chr122600 215 ------
NM_015520chr332074 243 233 --3538 493 469 --
NM_015542chr1011054 ------
NM_015550chr723398 2513 ------
NM_015570chr71147 ------
NM_015571chr6----1732 --
NM_015589chr14----1152 --
NM_015601chr102312 31 ------
NM_015609chr12527 419 ------
NM_015626chr171361 ------
NM_015630chr2140 ------
NM_015633chr121115 ------
NM_015678chr1311507 ------
NM_015687chr6--131 ----
NM_015713chr813597 ------
NM_015850chr8----11648 --
NM_015852chr713547 ------
NM_015859chr14----1118 --
NM_015866chr11574 ------
NM_015878chr81782 ------
NM_015886chr811666 ------
NM_015906chr11330 ----1509
NM_015912chr841981 1864 437 400 ------
NM_015984chr12187 101 ------
NM_016022chr11810 ------
NM_016025chr1611422 ------
NM_016048chr5------1314
NM_016073chr15--1273 ----
NM_016079chr242309 2178 1761 385 ------
NM_016094chr31167 ------
NM_016096chr81412 ------
NM_016107chr51308 ------
NM_016120chrX------1933
NM_016131chr21570 ------
NM_016147chr111839 ------
NM_016169chr1033281 786 122 ------
NM_016173chr333704 3284 396 1839 11821 --
NM_016178chr11107 ------
NM_016199chr19126 ------
NM_016201chr31636 ------
NM_016203chr73401 333 252 ------
NM_016205chr431209 137 39 --144 --
NM_016218chr51110 ------
NM_016226chr121308 ------
NM_016227chr1--11029 ----
NM_016231chr17----1248 --
NM_016248chr1333697 3141 843 ------
NM_016255chr61892 ------
NM_016260chr237518 6246 2523 11528 17603 --
NM_016263chr1953356 3219 2872 2688 2628 ------
NM_016271chr1812134 --11536 --
NM_016316chr2170 ------
NM_016322chr912539 ------
NM_016337chr142170 86 ------
NM_016339chr1731807 1197 526 ------
NM_016374chr11149 ------
NM_016374chr11149 ------
NM_016396chr1522152 229 ------
NM_016424chr17----190 1814
NM_016441chr212333 1165 ----
NM_016453chr3144 ------
NM_016472chr141994 ------
NM_016488chr1211979 ------
NM_016513chr623182 2468 2456 88 11466 --
NM_016530chr1512850 --21155 872 --
NM_016598chr311258 ------
NM_016603chr52463 186 ------
NM_016620chr111171 ------
NM_016621chr1121570 679 ----198
NM_016623chr8--1598 ----
NM_016631chr211295 ------
NM_016651chr141891 ------
NM_016931chr11144 ------
NM_016936chr1642145 2074 1843 54 1199 ----
NM_016937chrX----1667 --
NM_016953chr243976 2220 2083 1599 ------
NM_017426chr41241 ------
NM_017455chr151991 ------
NM_017456chr1731419 1413 747 ------
NM_017491chr4------1876
NM_017519chr61262 --186 --
NM_017544chrX2774 194 ------
NM_017548chr322169 1656 ------
NM_017553chr15186 ------
NM_017595chr1721212 168 ------
NM_017610chr15--21738 90 --1660
NM_017633chr61597 ------
NM_017637chr947195 7116 7047 6619 ------
NM_017658chr141846 ------
NM_017660chr1911018 1554 13248 --
NM_017664chr131190 11000 ----
NM_017672chr1511026 ------
NM_017679chr172669 184 ------
NM_017737chr132018 544 119 ------
NM_017738chr92273 244 ------
NM_017741chr42320 312 --11011 --
NM_017742chr1821252 493 ------
NM_017758chr1711501 ------
NM_017769chr1412316 ------
NM_017780chr81186 ------
NM_017784chr32911 154 ------
NM_017818chr1--124 ----
NM_017831chr181145 --24108 1546 1410
NM_017848chrX43851 3834 1212 721 ------
NM_017851chr151811 ------
NM_017866chr81774 ------
NM_017902chr1045287 4972 1694 542 --13867 --
NM_017915chr121812 ------
NM_017919chr9------14057
NM_017938chrX41937 1483 1418 635 ----1167
NM_017966chr111293 ----1354
NM_017988chr121634 ------
NM_017998chr9--1905 ----
NM_018017chr1021941 1004 ------
NM_018027chr1011132 12085 ----
NM_018028chr192427 21 ------
NM_018061chr1180 ------
NM_018084chr212073 ------
NM_018085chr146249 2631 2607 1176 17557 1361 --
NM_018086chr221352 169 ------
NM_018098chr32490 397 ------
NM_018110chr1611226 --1369 --
NM_018171chr121728 ------
NM_018180chr10124 ------
NM_018200chr1511984 ----1107
NM_018214chr621097 182 --1866 --
NM_018225chr935110 1578 217 --21487 438 --
NM_018254chr11474 ----1703
NM_018314chr111113 ------
NM_018315chr421600 116 ------
NM_018322chr61938 ------
NM_018328chr22393 25 ------
NM_018340chr1634503 4110 987 --13810 --
NM_018364chr111288 ------
NM_018393chr111206 ------
NM_018403chr323983 3703 11623 1646 --
NM_018433chr2------1230
NM_018442chr12251 85 ------
NM_018509chr1711471 ------
NM_018553chr17164 --11381 --
NM_018557chr211572 ------
NM_018566chr1------13795
NM_018569chr41181 ------
NM_018638chr1222280 1947 ------
NM_018640chr12------1105
NM_018644chr112332 285 ------
NM_018650chr11439 ------
NM_018683chr2011644 1437 ----
NM_018717chr412836 ------
NM_018847chr911817 ------
NM_018896chr171224 1277 ----
NM_018945chr61445 ------
NM_018948chr1------176
NM_018951chr71148 ------
NM_018970chr72978 920 ------
NM_018976chr121900 ----2138 111
NM_018991chr71140 ------
NM_018993chr20--1307 ----
NM_019001chr334065 1907 201 13430 ----
NM_019004chr742099 932 897 653 ------
NM_019006chr15--1273 --1249
NM_019027chr41523 ------
NM_019046chr10288 31 ------
NM_019063chr231824 1452 536 ------
NM_019071chr7----1670 --
NM_019102chr7148 ------
NM_019102chr7148 ------
NM_019114chr911959 ------
NM_019555chr31608 --11188 11201
NM_019556chrX11457 ------
NM_019558chr21358 ------
NM_019593chr2022858 753 ------
NM_019594chr911364 --1250 --
NM_019600chr151605 ------
NM_019845chr21707 1252 ----
NM_019859chr101334 --1451 --
NM_020066chr11816 ------
NM_020122chr225125 4649 --24051 212 --
NM_020141chr122100 242 ------
NM_020148chr1832054 814 589 ------
NM_020150chr1032182 1696 213 ------
NM_020153chr111122 ------
NM_020156chr71598 ------
NM_020177chr513084 ------
NM_020178chr1711157 ------
NM_020180chr18----11198 --
NM_020182chr2032699 94 33 11391 ----
NM_020184chr222041 1467 ------
NM_020205chr123246 877 ------
NM_020211chr152170 26 181 11167 --
NM_020226chr41584 ------
NM_020245chr654965 4723 3917 1552 404 --13797 --
NM_020248chr132020 1789 762 ------
NM_020319chr71676 ------
NM_020337chr413008 1863 ----
NM_020338chr1032592 853 184 22549 1139 23445 257 --
NM_020346chr1121327 163 ------
NM_020348chr1022387 828 ------
NM_020381chr631827 591 582 ------
NM_020390chr3----1970 --
NM_020420chrY149 ------
NM_020432chr721636 1433 ------
NM_020440chr1--13182 --1166
NM_020443chr126448 5786 12325 ----
NM_020455chr612778 ------
NM_020456chr13----11682 --
NM_020474chr18----11262 --
NM_020475chr81755 11991 22051 256 --
NM_020476chr81755 11991 22051 256 --
NM_020477chr81755 11991 22051 256 --
NM_020478chr81818 12054 22114 319 --
NM_020480chr81755 11991 22051 256 --
NM_020532chr2----1102 --
NM_020644chr111903 ------
NM_020689chr2011070 ------
NM_020690chr5------136
NM_020699chr121588 597 ----14885
NM_020704chr7------12110
NM_020708chr2052243 2181 577 498 32 31939 302 189 ----
NM_020713chr2032946 2605 233 ----1305
NM_020718chr1646435 4766 4031 1253 1378 ----
NM_020728chr733176 2759 227 --22509 34 --
NM_020732chr61262 --186 --
NM_020742chrX1547 ------
NM_020750chr62322 159 ------
NM_020752chr1012522 ------
NM_020755chr61168 ------
NM_020764chr1661205 935 362 303 264 85 ------
NM_020766chrX1696 ------
NM_020769chrX1338 ------
NM_020772chr1715314 28282 1345 ----
NM_020791chr1721283 113 ------
NM_020792chr31191 ------
NM_020794chr11233 ------
NM_020795chr171323 ------
NM_020796chr5----12575 --
NM_020801chr512483 ------
NM_020805chr1821585 1494 ------
NM_020807chr162603 67 ------
NM_020810chr141718 ------
NM_020813chr1952410 878 775 310 256 ----1897
NM_020814chr241188 244 161 66 ------
NM_020824chr102299 151 ------
NM_020834chr143715 707 409 ------
NM_020839chr31216 ----1286
NM_020850chr1632866 210 83 ------
NM_020868chr22445 272 1192 ----
NM_020873chr31160 ------
NM_020899chr171111 ------
NM_020922chrX1183 --1635 --
NM_020962chr151251 ------
NM_020977chr421430 110 ----12001
NM_020993chr1262371 2153 2100 666 613 130 11882 ----
NM_021005chr1521075 320 ------
NM_021012chr1722954 2473 ------
NM_021045chr1011952 ------
NM_021069chr41690 ------
NM_021072chr512256 ------
NM_021106chr91510 ------
NM_021132chr1021373 1327 ------
NM_021136chr141257 ------
NM_021148chr722441 884 --1265 --
NM_021161chr141508 ------
NM_021183chrX1157 --1606 --
NM_021184chr61122 --1570 1598
NM_021190chr1--1915 ----
NM_021202chr2022911 520 11059 ----
NM_021238chr12----1129 --
NM_021602chr17130 ------
NM_021639chr1----1300 --
NM_021643chr211610 11584 ----
NM_021648chr642431 1812 263 233 ------
NM_021705chr6--11328 ----
NM_021809chr2032291 767 569 ------
NM_021813chr645321 4702 4359 1343 ------
NM_021914chr14--12202 ----
NM_021923chr411538 3945 429 369 ----
NM_021940chr611447 --11505 --
NM_021956chr611501 ------
NM_021961chr1157336 4541 1903 898 264 17237 12262 15493
NM_021964chr31781 --16415 --
NM_021991chr17148 ------
NM_021999chr13170 ------
NM_022037chr22341 95 ------
NM_022048chr1555124 3926 2410 1939 545 ------
NM_022062chr1121744 1411 ------
NM_022066chr172842 153 ------
NM_022072chr3--1215 ----
NM_022079chr102312 31 ------
NM_022129chr102141 93 ------
NM_022170chr721182 140 ------
NM_022171chr321614 1118 ------
NM_022173chr22341 95 ------
NM_022361chr61469 ------
NM_022373chr72223 65 ------
NM_022465chr1212806 ------
NM_022475chr4--1145 ----
NM_022488chr31183 ------
NM_022574chr712079 --11395 --
NM_022650chr51194 ------
NM_022658chr121996 ------
NM_022735chr12556 429 ------
NM_022739chr171962 ------
NM_022751chr18--1269 ----
NM_022755chr941898 1624 625 476 1543 ----
NM_022776chr3--1105 ----
NM_022781chr923270 412 12479 ----
NM_022824chr5----1162 --
NM_022841chr1532650 2554 722 ------
NM_022893chr212420 ------
NM_022898chr141264 ------
NM_022977chrX21851 30 --1195 --
NM_023000chr141344 ------
NM_023001chr141344 ------
NM_023010chrX2743 620 ------
NM_023016chr212499 ----12178
NM_023037chr131360 ------
NM_023039chr51407 ------
NM_023067chr31437 124 --1371
NM_023075chr18--1775 ----
NM_023105chr8----11648 --
NM_023106chr8----11648 --
NM_023110chr8----11648 --
NM_023111chr8----11648 --
NM_024007chr532696 616 575 --1192 --
NM_024015chr17----155 --
NM_024019chr41370 ------
NM_024090chr42204 90 --1721 --
NM_024092chr1111234 ------
NM_024293chr22826 176 ------
NM_024312chr1221405 1178 --11171 --
NM_024345chr944419 4100 1760 1548 ----11383
NM_024429chr73401 333 252 ------
NM_024490chr151510 ------
NM_024551chr1262237 2080 2038 2029 1871 203 12354 ----
NM_024551chr1262237 2080 2038 2029 1871 203 12354 ----
NM_024607chr833440 957 64 --24299 528 --
NM_024630chr61573 ------
NM_024659chr21826 ------
NM_024664chr11451 ------
NM_024674chr132438 892 837 --12141 --
NM_024721chr822358 894 --1964 --
NM_024755chr152743 734 ------
NM_024757chr92429 232 --11006 --
NM_024779chr121531 ------
NM_024787chr81155 ------
NM_024834chr10----11854 --
NM_024835chr171389 ------
NM_024893chr201956 ------
NM_024930chr521719 77 ------
NM_024941chr521446 1298 ------
NM_024947chr347352 6832 2566 1186 --18102 --
NM_024953chr12------1737
NM_024969chr21686 ------
NM_024989chr237818 6543 1242 --12229 17844
NM_024991chr1022574 614 --1820 --
NM_025045chr22131 ------
NM_025069chr81189 ------
NM_025076chr2------1232
NM_025134chr162131 84 ------
NM_025151chr811991 11637 ----
NM_025160chr12543 416 ------
NM_025164chr1142110 1773 1419 864 ------
NM_025191chr11139 ------
NM_025219chr2022069 174 11698 ----
NM_025244chr2178 ------
NM_025248chr1722653 2350 32672 2552 2393 ----
NM_025251chr821232 175 1819 ----
NM_030594chr151428 ------
NM_030621chr141428 --13418 --
NM_030625chr10----138 --
NM_030627chr533053 793 43 ------
NM_030647chr7153 ------
NM_030648chr444436 2056 974 387 --1953 --
NM_030674chr1213830 14824 14052 --
NM_030780chr8----1545 --
NM_030782chr5131 ------
NM_030791chr1421458 145 ------
NM_030796chr741813 809 612 330 ------
NM_030939chr6--1881 ----
NM_030958chr81483 ------
NM_030963chr6190 ------
NM_030965chr11546 1784 1160 --
NM_031263chr9--1439 ----
NM_031309chr811446 11461 21637 415 --
NM_031371chr11149 ------
NM_031371chr11149 ------
NM_031417chr1932600 2029 757 ----12675
NM_031422chr18----1106 --
NM_031442chrX12902 ------
NM_031445chr233409 3344 2312 ----1901
NM_031453chr1022263 2134 ------
NM_031459chr131519 1456 128 11463 --11623
NM_031461chr821502 378 ------
NM_031468chr742420 2195 567 152 ------
NM_031477chr161291 ------
NM_031483chr202527 430 --12896 --
NM_031845chr21642 ------
NM_031847chr21642 ------
NM_031938chr112775 418 ------
NM_031992chr721182 140 ------
NM_032012chr9--11191 ----
NM_032048chr181629 ------
NM_032102chr1142957 2165 593 364 ----22580 642
NM_032121chrX----1692 --
NM_032124chr1811066 ----1790
NM_032128chr4----1742 --
NM_032186chr111171 ------
NM_032195chr211418 ------
NM_032208chr212347 --12386 --
NM_032228chr113960 504 383 ----12463
NM_032233chr141829 ------
NM_032246chr1511042 ------
NM_032281chr1911263 ------
NM_032312chr21369 ------
NM_032352chr14--11261 ----
NM_032373chr1045171 1990 876 409 ------
NM_032420chr52839 344 ------
NM_032440chr101189 ------
NM_032445chr15--12592 1678 --
NM_032457chr431509 1305 1282 ----11022
NM_032458chrX22847 1184 ------
NM_032466chr811715 ------
NM_032468chr811715 ------
NM_032482chr194984 736 718 669 ------
NM_032505chr32203 22 ------
NM_032510chr182495 276 --1230 --
NM_032521chr2022903 2541 1345 21287 924 --
NM_032523chr21154 ----1450
NM_032560chr14----185 --
NM_032632chr142690 488 ------
NM_032711chr1764197 2869 2675 1187 562 542 ------
NM_032727chr1011190 1278 ----
NM_032741chr61213 ------
NM_032772chr101364 ------
NM_032796chrX1585 ------
NM_032812chr101313 ------
NM_032829chr1231086 379 364 142 11155 --
NM_032833chr12670 541 --11646 --
NM_032837chr1712164 147 ----
NM_032842chr7----1432 --
NM_032859chr1333737 3584 602 144 ----
NM_032870chr61471 ------
NM_032949chr131200 ------
NM_032961chr4--1199 ----
NM_032968chrX2721 263 ------
NM_032969chrX2721 263 ------
NM_032973chrY2721 263 ------
NM_032978chr181896 ------
NM_032979chr181896 ------
NM_032981chr181896 ------
NM_033020chr11330 ----1509
NM_033023chr72995 156 ----1346
NM_033116chr141114 ------
NM_033133chr1711261 --1558 --
NM_033138chr71350 ------
NM_033139chr71350 ------
NM_033140chr71350 ------
NM_033141chr1421968 1593 1363 ----
NM_033143chr41132 ------
NM_033157chr71350 ------
NM_033201chr1611092 ------
NM_033225chr812518 --1141 --
NM_033285chr821369 631 1710 1778 --
NM_033326chr112750 489 ------
NM_033331chr923409 2960 ------
NM_033389chr17--14854 ----
NM_033430chr4----1650 --
NM_033437chr4----1650 --
NM_033480chr6153 ------
NM_033481chr6153 ------
NM_033632chr421600 116 ------
NM_033637chr1023948 3411 --23777 3391 --
NM_033644chr512498 ------
NM_033645chr512498 ------
NM_033656chr2123728 699 15993 ----
NM_052834chr1812313 ------
NM_052851chr1322205 311 1517 ----
NM_052875chr1132052 2029 746 --11473 --
NM_052879chr1233791 1339 780 13079 ----
NM_052885chr1214689 1724 ----
NM_052898chr8--11472 ----
NM_052900chr821804 55 ------
NM_052905chr221352 511 ------
NM_052927chr51780 ------
NM_052937chr81516 ------
NM_053016chr935798 3139 2642 --12992 --
NM_053023chr1113154 ------
NM_053024chr31969 ------
NM_053025chr331795 1578 1380 --1220 --
NM_053026chr331795 1578 1380 --1220 --
NM_053027chr331795 1578 1380 --1220 --
NM_053028chr331795 1578 1380 --1220 --
NM_053031chr331795 1578 1380 --1220 --
NM_053032chr331795 1578 1380 --1220 --
NM_053043chr714288 177 1423 --
NM_053281chrX1426 ------
NM_054013chr53653 626 604 ------
NM_054025chr112332 285 ------
NM_057180chr121308 ------
NM_057749chr81446 ------
NM_058172chr431591 606 85 ------
NM_058241chr231911 832 688 ------
NM_058241chr231911 832 688 ------
NM_078483chr543806 3342 2918 1213 ------
NM_078487chr942303 872 611 201 2113 98 ----
NM_080391chr11563 ------
NM_080392chr11612 ------
NM_080425chr201321 ------
NM_080426chr201321 ------
NM_080599chr1011054 ------
NM_080607chr20149 ------
NM_080617chr2011038 ------
NM_080632chrX2743 620 ------
NM_080645chr611920 ------
NM_080676chr2022906 852 ----1630
NM_080679chr61747 ------
NM_080680chr61747 ------
NM_080681chr61747 ------
NM_080717chr121373 ------
NM_080738chr111527 --11449 --
NM_080797chr2043242 2429 870 134 ----11385
NM_080872chr81341 --13198 --
NM_130391chr931294 1240 866 ------
NM_130392chr931294 1240 866 ------
NM_130393chr931294 1240 866 ------
NM_130435chr1012773 ------
NM_130436chr21173 ------
NM_130438chr2122247 650 ------
NM_130439chr1012225 --21649 25 --
NM_130439chr1012225 --21649 25 --
NM_130446chr32664 43 --11161 --
NM_130795chr91510 ------
NM_130797chr721266 1196 ------
NM_130847chr1155163 5105 4600 3658 1164 23816 1940 ----
NM_130848chr521756 65 11392 ----
NM_133172chr51293 ------
NM_133173chr51293 ------
NM_133174chr51293 ------
NM_133369chr51904 ------
NM_133372chr522711 1854 ------
NM_133378chr2----1765 --
NM_133432chr2----1765 --
NM_133433chr51182 ------
NM_133437chr2----1765 --
NM_133445chr9----1155 --
NM_133452chr19--1849 ----
NM_133499chrX1905 ------
NM_133631chr321527 96 ------
NM_133633chr2211053 ------
NM_133646chr214587 15193 ----
NM_134265chr171361 ------
NM_134427chr91510 ------
NM_134440chr19--1146 ----
NM_138300chr1128 11497 ----
NM_138317chr141508 ------
NM_138318chr141508 ------
NM_138340chr182529 63 ------
NM_138357chr1011701 ------
NM_138375chr182923 482 ------
NM_138426chr71675 ------
NM_138444chr132915 844 ------
NM_138473chr1211562 ------
NM_138576chr141264 ------
NM_138621chr214052 --11382 --
NM_138638chr14--12202 ----
NM_138771chr7----11286 --
NM_138782chr51620 ------
NM_138793chr173670 572 64 ------
NM_138931chr31116 ------
NM_138967chr151276 1820 ----
NM_139014chr6--2917 496 11869 --
NM_139072chr2----1804 --
NM_139076chr41153 ------
NM_139078chr121134 ------
NM_139131chr111121 ------
NM_139156chr11874 ------
NM_139161chr192332 150 ------
NM_139168chr51478 11228 ----
NM_139169chr10--155 ----
NM_139239chr19163 ------
NM_139241chr12--1173 ----
NM_139316chr71742 ------
NM_139323chr2021779 1503 ------
NM_144488chr91510 ------
NM_144489chr91510 ------
NM_144570chr1612283 ------
NM_144571chr425338 1042 ------
NM_144578chr1424438 164 ------
NM_144579chr242675 2315 223 36 ------
NM_144600chr16----1271 --
NM_144604chr16----150 --
NM_144609chr17180 11289 ----
NM_144642chr31530 ------
NM_144664chr111270 ------
NM_144728chr12740 327 ------
NM_144729chr12740 327 ------
NM_144949chr222612 770 --21008 525 --
NM_144979chr41503 ------
NM_144982chr121651 ------
NM_145159chr142894 754 ------
NM_145259chr224902 4691 ----16119
NM_145284chrX11697 ------
NM_145320chr723398 2513 ------
NM_145321chr723398 2513 ------
NM_145322chr723398 2513 ------
NM_145686chr212586 2731 120 13084 --
NM_145687chr212586 2731 120 13084 --
NM_145725chr141465 ------
NM_145726chr141465 ------
NM_145730chr221438 --1191 --
NM_145739chr21154 ----1450
NM_145805chr151460 ------
NM_145808chr732692 2038 1906 ------
NM_145861chr111527 --11449 --
NM_145891chr16----11553 --
NM_145892chr16----11553 --
NM_145893chr16----11675 --
NM_147150chr92400 99 --11212 --
NM_147156chr1031324 582 355 11184 ----
NM_147175chrX12028 ------
NM_147189chr811438 1930 ----
NM_147223chr2--12073 ----
NM_147233chr2--11890 ----
NM_148174chr81782 ------
NM_148898chr71686 ------
NM_148899chr71686 ------
NM_152253chr2253486 2821 720 234 22 13354 ----
NM_152265chr121626 222 ------
NM_152291chr4------157
NM_152409chr51773 ------
NM_152418chr8180 ------
NM_152420chr9----1559 --
NM_152455chr1532159 1790 476 --1768 --
NM_152470chr182749 255 13696 11434 --
NM_152529chr243065 1427 1364 158 ------
NM_152538chr3----11531 --
NM_152557chr72486 56 --1541 --
NM_152570chr9198 ------
NM_152588chr1221890 583 ------
NM_152594chr1542211 447 378 183 ------
NM_152622chr52235 32 ------
NM_152624chr534541 2582 1901 ------
NM_152641chr1211130 ------
NM_152653chr32292 54 ------
NM_152660chr1--1350 ----
NM_152665chr11501 ------
NM_152699chr321410 319 --43008 2734 1046 542 --
NM_152723chr11----1355 --
NM_152739chr7--1898 ----
NM_152744chr713077 23516 2899 ----
NM_152758chr832775 2141 163 ------
NM_152780chrX2906 804 ------
NM_152789chr7139 ------
NM_152838chr20----11165 --
NM_152857chr61653 ------
NM_152858chr61653 ------
NM_152924chr1515116 ----16396
NM_153013chr51406 ------
NM_153020chr611223 ------
NM_153035chr1--12855 ----
NM_153038chr21740 ------
NM_153184chr311756 ------
NM_153188chr544509 1743 1490 402 --1858 --
NM_153251chr131183 ------
NM_153262chr11598 ------
NM_153321chr17135 ------
NM_153322chr17135 ------
NM_153331chr31657 ------
NM_153371chr13----1518 --
NM_153464chr191282 ------
NM_153499chr1222718 559 ------
NM_153500chr1222718 559 ------
NM_153607chr512833 ------
NM_153649chr111446 ------
NM_153685chr12122 ------
NM_153686chr432177 1525 791 ------
NM_153715chr71148 ------
NM_153746chr61573 ------
NM_153757chr4------1441
NM_153810chr1013380 ------
NM_153828chr2----1102 --
NM_170662chr3----1138 --
NM_170665chr1211495 34384 1639 674 ----
NM_170709chr822337 603 ------
NM_172058chr82120 25 ------
NM_172059chr82120 25 ------
NM_172060chr82120 25 ------
NM_172070chr21244 ------
NM_172071chr11548 --22246 1842 --
NM_172103chr622475 2365 12308 ----
NM_172105chr622475 2365 12308 ----
NM_172110chr201603 ------
NM_172111chr201603 ------
NM_172112chr201603 ------
NM_172113chr201603 ------
NM_172127chr421494 142 ------
NM_172128chr421450 98 ------
NM_172226chr1222718 559 ------
NM_172375chr141808 ------
NM_173074chr2128 ------
NM_173079chr1741718 724 228 141 ------
NM_173083chr1------11248
NM_173156chr11172 ------
NM_173172chr21228 ------
NM_173198chr91609 ------
NM_173199chr9179 ------
NM_173200chr91609 ------
NM_173354chr212363 274 --11516 --
NM_173468chr435756 5378 5357 ------
NM_173470chrX22690 619 ------
NM_173476chr1652161 662 486 416 111 ------
NM_173478chr17----1877 --
NM_173491chr5140 ----11145
NM_173495chrX32020 1963 1662 ------
NM_173519chr81386 --1748 --
NM_173531chr1922698 489 --13362 --
NM_173576chr1021634 592 ------
NM_173595chr1224822 1937 --11402 --
NM_173672chr611941 --11577 --
NM_173674chr6137 ------
NM_173694chrX--12416 ----
NM_173808chr121304 575 ------
NM_173829chr5----11856 15259
NM_173834chrX1391 ------
NM_173846chr14189 ------
NM_173872chr41178 --1236 --
NM_174887chr171254 ------
NM_174911chr81150 --1545 --
NM_174921chr4----1927 --
NM_174955chr171576 11189 1311 --
NM_175061chr721845 862 ------
NM_175736chr1227858 2312 ----12625
NM_175768chr611705 ------
NM_175863chr61262 --186 --
NM_175866chr11132 ------
NM_175898chr1531224 670 221 11550 2522 476 --
NM_175931chr1631955 317 204 1236 ----
NM_176792chr10----11373 --
NM_176871chr822595 691 23327 560 22506 1197 --
NM_177438chr141428 --13418 --
NM_177977chr1712036 --1623 --
NM_177983chr21107 ------
NM_177996chr2022386 903 ------
NM_177999chr923690 740 --1944 --
NM_178006chr1322205 311 1517 ----
NM_178007chr1322205 311 1517 ----
NM_178011chr1053053 1061 985 917 206 1563 ----
NM_178120chr2----11096 --
NM_178126chr17----2813 484 --
NM_178140chr522676 1887 ------
NM_178151chrX16451 11549 14958 --
NM_178152chrX16451 11549 14958 --
NM_178153chrX16451 11549 14958 --
NM_178507chr111750 ------
NM_178565chr82212 86 ------
NM_178585chr423175 2983 --1902 --
NM_178586chr1421499 149 --21616 247 --
NM_178812chr821200 516 11000 ----
NM_178815chr10----1138 --
NM_178835chr41319 --1302 --
NM_180989chr13147 ------
NM_181310chr611847 ------
NM_181332chrX1547 ------
NM_181358chr123755 1161 ------
NM_181361chr3190 ------
NM_181443chr2022127 38 ----12869
NM_181457chr2----11344 --
NM_181459chr2----11243 --
NM_181481chr1855510 5263 986 804 541 ------
NM_181482chr1855510 5263 986 804 541 ------
NM_181483chr1855510 5263 986 804 541 ------
NM_181486chr121373 ------
NM_181492chr2221206 48 ------
NM_181504chr522591 309 12914 ----
NM_181521chr1635258 5237 1445 ------
NM_181523chr522591 309 12914 ----
NM_181524chr522591 309 12914 ----
NM_181552chr71919 ------
NM_181659chr2043026 2524 716 707 ------
NM_181659chr2043026 2524 716 707 ------
NM_181671chr171887 ------
NM_181689chr203925 915 82 ------
NM_181698chr10--1534 1360 --
NM_181702chr82781 126 ------
NM_181704chr2141199 317 296 188 ------
NM_181782chr62849 443 ------
NM_181861chr1221792 107 --2923 625 --
NM_181868chr1221792 107 --2923 625 --
NM_181869chr1221877 192 --21008 710 --
NM_181886chr421168 983 ------
NM_181887chr421168 983 ------
NM_181888chr421168 983 ------
NM_181889chr421168 983 ------
NM_181890chr421168 983 ------
NM_181891chr421168 983 ------
NM_181892chr421215 1030 ------
NM_181893chr421168 983 ------
NM_182314chrX11856 ------
NM_182481chr2141104 394 102 81 ------
NM_182482chr2141104 394 102 81 ------
NM_182484chr2141199 317 296 188 ------
NM_182485chr431065 301 93 --1959 --
NM_182488chr131339 ------
NM_182492chr221218 ------
NM_182540chrX1621 ------
NM_182646chr431065 301 93 --1959 --
NM_182664chr1160 ----11609
NM_182691chr7----1994 --
NM_182692chr7----1994 --
NM_182700chr721351 417 11525 ----
NM_182715chr71965 --1796 --
NM_182797chr2041302 1247 417 394 ------
NM_182907chr621733 671 ------
NM_182911chr2178 ------
NM_182970chr2023091 1320 ------
NM_182972chr1------22371 1842
NM_182977chr51778 ------
NM_183004chr1443531 2461 1414 69 --11243 --
NM_183043chr131818 ------
NM_183044chr131818 ------
NM_183078chr622660 864 ------
NM_183238chr1212852 --11109 --
NM_183353chrX------1933
NM_183419chr81203 11053 ----
NM_183425chr2031663 260 35 1699 --11420
NM_184231chr3144 ------
NM_194247chr2----1220 --
NM_194250chr21151 ------
NM_194278chr1443123 1637 982 194 148 22657 464 --
NM_194282chr432762 991 52 11960 ----
NM_194314chr11203 ------
NM_194328chr923270 412 12479 ----
NM_194329chr923270 412 12479 ----
NM_194330chr923270 412 12479 ----
NM_194332chr923270 412 12479 ----
NM_194434chr1811413 ------
NM_197966chr2241399 1067 910 299 ------
NM_197967chr2241399 1067 910 299 ------
NM_198123chr821804 55 ------
NM_198124chr821804 55 ------
NM_198128chr1812134 --11536 --
NM_198158chr31230 12596 ----
NM_198159chr31230 12596 ----
NM_198177chr31230 12596 ----
NM_198178chr31230 12596 ----
NM_198181chr1522064 684 ------
NM_198217chr13----1727 --
NM_198218chr13----1727 --
NM_198219chr13----1727 --
NM_198225chr101535 ------
NM_198240chr12--179 ----
NM_198243chr151778 ------
NM_198268chr123755 1161 ------
NM_198269chr123755 1161 ------
NM_198270chrX13129 ------
NM_198376chr171224 1277 ----
NM_198377chr171224 1277 ----
NM_198378chr171224 1277 ----
NM_198379chr171224 1277 ----
NM_198380chr171224 1277 ----
NM_198382chr171224 1277 ----
NM_198383chr171224 1277 ----
NM_198384chr171224 1277 ----
NM_198385chr171224 1277 ----
NM_198386chr171224 1277 ----
NM_198387chr171224 1277 ----
NM_198388chr171224 1277 ----
NM_198391chr2011286 ------
NM_198392chr61205 ------
NM_198396chr17--1277 ----
NM_198401chr8187 ------
NM_198467chr71595 ------
NM_198503chr111558 ------
NM_198560chr31256 11476 13809 --
NM_198563chr3--154 ----
NM_198569chr612645 ------
NM_198679chr921659 86 142 ----
NM_198718chr11311 ------
NM_198900chr1227858 2312 ----12625
NM_198903chr51579 ------
NM_198904chr51579 ------
NM_198956chr721351 417 11525 ----
NM_198968chr1313758 ------
NM_198991chr18176 ------
NM_199131chr1021439 547 ------
NM_199169chr2032699 94 33 11391 ----
NM_199170chr2032699 94 33 11391 ----
NM_199171chr2032699 94 33 11391 ----
NM_199188chr1233791 1339 780 13079 ----
NM_199190chr1233791 1339 780 13079 ----
NM_199262chr171134 ------
NM_199478chrX------1673
NM_201269chr111171 ------
NM_201280chr611087 --1607 --
NM_201413chr211278 ------
NM_201414chr211278 ------
NM_201441chr12142 ------
NM_201443chr12142 ------
NM_201568chr11172 ------
NM_201569chr11172 ------
NM_201595chr14----1118 --
NM_201999chr4--1869 ----
NM_203349chr152836 113 ------
NM_203350chr1141 ------
NM_203351chr1722479 2404 ------
NM_203394chr1221826 509 ------
NM_203404chr11874 ------
NM_203406chr522211 1982 ------
NM_203417chr21------1433
NM_203418chr21------1433
NM_203446chr2122626 912 ------
NM_203459chr112164 --12340 1170
NM_203463chr23997 434 139 11528 1916 11003
NM_203504chr41384 ------
NM_203505chr41384 ------
NM_203506chr172640 298 ----1103
NM_206594chr132691 1320 696 12331 1721 --
NM_206595chr132691 1320 696 12331 1721 --
NM_206827chr13146 ------
NM_206852chr141257 ------
NM_206853chr624024 3963 ------
NM_206854chr635285 5224 678 ------
NM_206855chr636250 6189 1643 ------
NM_206857chr141257 ------
NM_206876chr21756 ------
NM_206907chr531118 544 207 --12252 --
NM_206909chr875832 5071 3269 3078 2527 2469 549 --15624 --
NM_206914chr122541 201 --1839 --
NM_207012chr1033520 3146 383 ------
NM_207396chr12452 444 --11805 --
NM_207429chr11----1438 --
NM_207520chr2----1102 --
NM_207521chr2----1102 --
NM_207645chr1131148 1089 280 11294 11103 --
NM_207647chr92176 56 ------
NM_212460chr71643 ------
NM_212471chr173387 344 247 ------
NM_212472chr173387 344 247 ------
NM_212502chr1------11380
NM_212503chr1------11380
NM_213611chr12158 ------