TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1911-3p
miRNA Sequence: CACCAGGCAUUGUGGUCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1272429 2241 2218 2091 1710 225 192 ------
NM_000052chrX33336 2364 882 --11217 --
NM_000061chrX2330 22 ------
NM_000068chr1911543 138 ----
NM_000084chrX64435 2188 1728 1523 1378 1153 24487 2259 24677 1278 --
NM_000092chr224480 152 23832 1740 14527 --
NM_000093chr941944 1797 622 239 ------
NM_000109chrX----1830 --
NM_000125chr663457 1387 1243 991 566 354 --11366 --
NM_000129chr621283 1012 ------
NM_000138chr1522215 761 ------
NM_000142chr451599 1450 1393 1371 466 ------
NM_000163chr522329 907 ------
NM_000176chr513410 13854 23314 518 --
NM_000189chr241750 617 175 107 --21913 163 --
NM_000192chr121396 ------
NM_000208chr1974556 4432 4001 3666 1677 1527 55 11037 11267 --
NM_000226chr173298 245 21 ------
NM_000234chr192159 23 ------
NM_000240chrX22168 1429 ------
NM_000245chr712119 --1189 --
NM_000248chr322753 2723 --1604 12936
NM_000259chr15106020 5804 5621 4946 4597 4097 2261 1704 1292 1131 25193 4242 ----
NM_000264chr922723 567 ------
NM_000266chrX1926 1212 ----
NM_000271chr18----1529 --
NM_000278chr1032218 1982 265 ------
NM_000296chr161733 ------
NM_000304chr172988 949 ------
NM_000317chr11--1342 ----
NM_000318chr872721 2244 1944 867 854 729 669 ------
NM_000319chr1231026 457 272 1215 ----
NM_000332chr646374 6189 5329 1159 25938 2165 ----
NM_000337chr544164 1889 1661 966 16472 ----
NM_000362chr2252319 1436 1335 687 239 --11414 --
NM_000368chr944204 4171 3671 1817 13319 33762 1350 444 --
NM_000376chr1252418 904 516 102 26 ------
NM_000378chr111168 --1240 --
NM_000399chr102859 473 ------
NM_000408chr223092 625 ------
NM_000429chr10111736 1661 1476 1353 1294 1182 640 404 180 73 44 --123 --
NM_000435chr192940 236 1872 ----
NM_000449chr131350 493 157 ------
NM_000461chr373253 1756 1681 1668 1609 1099 303 ------
NM_000462chr1511432 ------
NM_000480chr112610 316 ----11204
NM_000505chr5131 ------
NM_000520chr153510 468 126 ------
NM_000555chrX86477 5753 5243 2478 2277 1911 701 617 ------
NM_000572chr11865 --1700 --
NM_000615chr1172837 2163 2115 2040 1147 922 380 ------
NM_000617chr1222303 1800 ------
NM_000626chr174350 177 152 67 ------
NM_000633chr1844343 1087 1002 611 --11011 --
NM_000719chr1296111 5521 5334 4177 2225 2013 1283 1023 146 ------
NM_000721chr141658 1074 632 379 1809 ----
NM_000724chr1011947 ----1210
NM_000738chr113968 882 627 ------
NM_000756chr81444 ------
NM_000767chr1931188 965 378 --11322 --
NM_000800chr541104 243 237 58 ------
NM_000801chr202958 58 ------
NM_000806chr53189 165 157 ------
NM_000814chr1523466 563 ------
NM_000817chr211002 --11015 --
NM_000826chr4--11671 ----
NM_000829chr1122314 1558 ------
NM_000831chr1146027 5914 5900 5838 4700 2180 1648 1352 1151 912 501 182 94 30 ------
NM_000834chr124321 170 148 94 ------
NM_000836chr195906 879 148 125 32 ------
NM_000841chr63878 727 169 --1125 --
NM_000859chr531092 452 134 ------
NM_000865chr62200 93 ------
NM_000868chrX21622 781 12269 ----
NM_000875chr15116686 6118 5969 5951 5630 5540 5263 4803 927 914 889 ------
NM_000891chr1753060 2409 1293 1206 291 13523 ----
NM_000899chr123440 416 102 --1664 --
NM_000901chr432428 642 399 1339 ----
NM_000902chr322555 2312 1709 ----
NM_000912chr863094 2877 2319 1199 547 285 12866 ----
NM_000924chr1231348 923 452 11287 ----
NM_000933chr20----1300 --
NM_000944chr432152 1713 808 12296 ----
NM_000945chr2----11554 --
NM_000950chrX33509 3315 3046 --13564 --
NM_000958chr5----11261 --
NM_000959chr133909 2892 548 12826 ----
NM_000960chr192526 241 ----1608
NM_000962chr972425 2268 2084 1254 624 289 97 ------
NM_000963chr112484 ------
NM_000966chr123781 354 251 ------
NM_000977chr162357 81 ------
NM_001001323chr1222288 2275 ------
NM_001001344chrX2944 834 --12446 --
NM_001001419chr541896 1549 1383 1006 1938 13954 --
NM_001001420chr541896 1549 1383 1006 1938 13954 --
NM_001001433chr2052655 2415 2325 422 59 ------
NM_001001436chr161173 ------
NM_001001481chr812743 13347 ----
NM_001001484chr1022362 1815 ------
NM_001001549chr742687 1855 1052 285 ------
NM_001001550chr742687 1855 1052 285 ------
NM_001001555chr742687 1855 1052 285 ------
NM_001001557chr851392 783 226 131 69 ------
NM_001001560chr222215 55 --1118 --
NM_001001665chr262652 2409 2360 2245 1042 832 ------
NM_001001701chr442223 1929 1762 1524 11467 ----
NM_001001740chr11238 ------
NM_001001740chr11238 ------
NM_001001852chr225895 631 371 174 126 ------
NM_001001890chr2111705 13998 22669 941 --
NM_001001933chr11242 ------
NM_001001936chr10146 ------
NM_001002031chr12----140 --
NM_001002032chr172545 524 ------
NM_001002033chr172645 624 ------
NM_001002252chr122268 58 ------
NM_001002257chr223447 934 ------
NM_001002258chr2--12026 ----
NM_001002762chr10122843 2715 2070 2019 1792 1011 989 682 636 597 345 83 22850 411 21880 125 --
NM_001002860chr1453796 1176 1038 913 754 12878 ----
NM_001002877chr221176 ------
NM_001002878chr221176 ------
NM_001002879chr221176 ------
NM_001002914chr1751055 994 444 367 300 ------
NM_001003406chr22163152 3092 3009 2839 2736 2671 2501 2162 2010 1163 926 742 473 459 356 153 --1949 --
NM_001003652chr18118581 8334 7369 6863 6421 6197 5584 2713 2541 1542 1375 25420 5300 13428 --
NM_001003676chr111120 1933 21051 293 --
NM_001003677chr11157 1489 1607 --
NM_001003688chr4--1176 ----
NM_001003698chr631547 578 316 1586 ----
NM_001003699chr631547 578 316 1586 ----
NM_001003722chr91283 --11107 --
NM_001003794chr382639 2584 2263 1153 1091 1085 335 32 --1432 --
NM_001003800chr993738 2618 2446 1496 1277 933 797 785 340 --13144 --
NM_001003940chr15133728 3370 3156 2962 2945 2934 2874 2781 2619 1004 777 714 45 --12519 --
NM_001003942chr15133728 3370 3156 2962 2945 2934 2874 2781 2619 1004 777 714 45 --12519 --
NM_001003943chr15133732 3374 3160 2966 2949 2938 2878 2785 2623 1008 781 718 49 --12523 --
NM_001004065chr943888 1218 883 36 12527 1246 --
NM_001004105chr5138 --1101 --
NM_001004125chr92806 165 --1178 --
NM_001004127chr131863 1189 ----
NM_001004128chr12607 215 --2475 45 --
NM_001004329chr12--21480 1145 ----
NM_001004342chr1116017 5882 4800 3810 2338 2049 1940 1832 1723 1603 515 25040 1463 32211 1740 967 --
NM_001004419chr1234152 3794 493 --24412 1633 --
NM_001005209chr22514 108 --2639 124 --
NM_001005266chr152758 193 1263 ----
NM_001005267chr152758 193 1263 ----
NM_001005268chr152758 193 1263 ----
NM_001005269chr152758 193 1263 ----
NM_001005271chr1741106 867 403 236 ------
NM_001005273chr1741106 867 403 236 ------
NM_001005386chr23893 704 137 ------
NM_001005404chr1743671 1736 151 89 1301 1638 --
NM_001005463chr1022449 2285 ------
NM_001005473chr556511 5975 5147 5039 4944 16658 ----
NM_001005474chr32561 21 ------
NM_001005476chr2----1237 --
NM_001005505chr341459 1268 1240 402 --1141 --
NM_001005609chrX63711 3559 3400 1471 992 899 --11483 --
NM_001005612chrX3447 365 294 ------
NM_001005743chr1431148 1087 895 ------
NM_001005744chr1431148 1087 895 ------
NM_001005745chr1431148 1087 895 ------
NM_001005781chr2121 ------
NM_001005782chr21703 1123 ----
NM_001005909chr32164 106 ------
NM_001005920chr162921 801 ------
NM_001006115chr3112573 2400 2001 1846 1728 971 775 619 276 268 150 11819 ----
NM_001006600chr511499 ------
NM_001006617chr92234 208 ------
NM_001006619chr92234 208 ------
NM_001006620chr92234 208 ------
NM_001006621chr92234 208 ------
NM_001006624chr161980 1419 728 521 487 112 11325 ----
NM_001006636chr22667 118 ------
NM_001006658chr13531 497 35 ------
NM_001006684chrX--1128 ----
NM_001006932chr632249 928 77 --1535 --
NM_001006946chr251828 1410 387 193 127 --1774 --
NM_001007027chr11168 --1193 --
NM_001007099chr11248 ------
NM_001007100chr11248 ------
NM_001007156chr151406 141 ----
NM_001007226chr1731112 350 233 ------
NM_001007227chr1731112 350 233 ------
NM_001007228chr1731112 350 233 ------
NM_001007229chr1731112 350 233 ------
NM_001007230chr1731112 350 233 ------
NM_001007237chr121841 183 --11147 --
NM_001007246chr2111664 ----1539
NM_001007277chr112400 280 ------
NM_001007553chr13950 213 56 --1912 --
NM_001007794chr11593 ------
NM_001008220chr5103840 3735 3159 2893 2696 2607 2510 1046 563 443 --13602 --
NM_001008222chrX21358 325 ------
NM_001008223chr122155 100 ------
NM_001008239chr1842804 1403 807 269 --13049 --
NM_001008495chr8------12036
NM_001008528chr1721329 219 ------
NM_001008529chr1741304 1248 1068 151 ------
NM_001008541chr1031967 1737 496 ------
NM_001008541chr1031967 1737 496 ------
NM_001008660chr1121383 353 ------
NM_001008701chr1982970 2733 2684 1046 839 809 628 65 12160 ----
NM_001008707chr14164 ------
NM_001008726chr1411496 2629 308 ----
NM_001008738chr512152 12810 1474 --
NM_001009554chr494626 4034 3610 2963 1419 1270 1254 1057 498 ------
NM_001009554chr494626 4034 3610 2963 1419 1270 1254 1057 498 ------
NM_001009555chr421416 268 ------
NM_001009566chr121473 284 --31144 184 145 --
NM_001009909chr1122676 1115 --1256 --
NM_001009944chr161733 ------
NM_001009960chr711929 22110 739 ----
NM_001009993chr2123984 3709 3667 3224 3169 3061 2851 1640 1560 1170 635 221 --23654 677 --
NM_001010854chr141501 ------
NM_001010862chrX43135 2710 687 115 ------
NM_001010867chr1236653 6445 6363 6332 5960 4759 4619 4165 2671 2574 2334 1936 1739 1479 1114 888 511 396 361 296 156 116 46 16109 16259 --
NM_001010888chrX24312 4026 ------
NM_001010924chr101824 --21227 1105 --
NM_001010926chr13565 540 102 --1533 --
NM_001010971chr11912 ------
NM_001010986chrX1359 21547 534 ----
NM_001011513chr432934 779 613 --11391 --
NM_001011537chr342082 808 405 377 11610 ----
NM_001011553chr72303 51 ------
NM_001011666chr745105 1487 583 211 1246 ----
NM_001011708chr242403 2353 487 427 --1838 --
NM_001011713chr1411063 ------
NM_001011718chr206875 361 308 250 237 35 ------
NM_001012329chr1102256 2245 2176 2117 2109 1939 1750 940 521 353 ------
NM_001012393chr1143895 1852 1510 84 32052 1586 1153 ----
NM_001012418chr643873 2934 2759 1644 1111 1203 --
NM_001012614chr42607 32 ------
NM_001012755chrX64888 4367 3351 3323 1341 49 14006 1707 --
NM_001012761chr522578 1798 --1308 --
NM_001012958chr141309 1032 433 181 ------
NM_001012958chr141309 1032 433 181 ------
NM_001012977chrX31075 1003 421 ------
NM_001012989chrX1644 ------
NM_001013031chr1053360 3079 921 648 184 11328 ----
NM_001013399chr61842 ------
NM_001013415chr41129 ------
NM_001013438chr31617 ------
NM_001013635chr1221186 984 ------
NM_001013690chr1252198 1828 1591 1014 399 12290 ----
NM_001014283chr1321759 1659 --11358 --
NM_001014431chr142722 33 ------
NM_001014432chr142722 33 ------
NM_001014434chr11680 --1139 --
NM_001014809chr44819 686 648 181 ------
NM_001014839chr16875 791 777 745 311 221 ------
NM_001014841chr16875 791 777 745 311 221 ------
NM_001015053chr173573 374 283 --11509 --
NM_001015887chr321274 1161 ------
NM_001017365chr1157 ------
NM_001017366chr1157 ------
NM_001017367chr1157 ------
NM_001017368chr1762514 868 438 237 54 45 ------
NM_001017371chr21123 ------
NM_001017392chr1941350 1182 265 80 ------
NM_001017395chr342889 2861 2836 402 12978 13624 --
NM_001017535chr1252418 904 516 102 26 ------
NM_001017920chr2127 ----1102
NM_001017923chr14--182 11252 --
NM_001017924chr102416 32 ------
NM_001017926chr821822 1273 ------
NM_001017977chr11285 ------
NM_001018008chr153564 515 469 1432 ----
NM_001018050chr2293417 3370 3178 2619 2438 2256 2091 1041 894 --22725 565 --
NM_001018052chr2293417 3370 3178 2619 2438 2256 2091 1041 894 --22725 565 --
NM_001018053chr12134 58 ------
NM_001018057chr111200 --1194 --
NM_001018065chr935967 4785 296 --12038 --
NM_001018066chr935967 4785 296 --12038 --
NM_001018067chr165302 4220 3993 3776 944 25 11985 14933 --
NM_001018068chr165302 4220 3993 3776 944 25 11985 14933 --
NM_001018069chr165302 4220 3993 3776 944 25 11985 14933 --
NM_001018074chr513410 13854 23314 518 --
NM_001018075chr513410 13854 23314 518 --
NM_001018076chr513410 13854 23314 518 --
NM_001018077chr513410 13854 23314 518 --
NM_001018108chr1551738 1541 1462 798 48 --1287 --
NM_001020658chr121620 413 --11208 --
NM_001020658chr121620 413 --11208 --
NM_001020818chr1941834 1744 1328 1161 ------
NM_001020819chr1941834 1744 1328 1161 ------
NM_001020820chr1941834 1744 1328 1161 ------
NM_001020821chr1941834 1744 1328 1161 ------
NM_001023567chr1522441 1622 ------
NM_001024094chr513410 13854 23314 518 --
NM_001024226chr11836 1209 ----
NM_001024227chr11836 1209 ----
NM_001024228chr11836 1209 ----
NM_001024463chr153243 75 41 ------
NM_001024660chr331313 1264 427 --11105 --
NM_001024808chr1262704 1986 999 601 496 459 ------
NM_001025076chr1035936 5094 1986 ------
NM_001025077chr1057294 6452 4873 495 426 ------
NM_001025079chr331218 1179 380 ------
NM_001025105chr521511 123 11156 ----
NM_001025107chr132578 2102 193 ----11761
NM_001025107chr132578 2102 193 ----11761
NM_001025108chr253432 3130 3004 2745 33 ----11241
NM_001025205chr31140 ------
NM_001025266chr354037 928 883 522 237 13277 160 --
NM_001025366chr621310 587 ------
NM_001025366chr621310 587 ------
NM_001025367chr621310 587 ------
NM_001025367chr621310 587 ------
NM_001025368chr621310 587 ------
NM_001025368chr621310 587 ------
NM_001025369chr621326 603 ------
NM_001025369chr621326 603 ------
NM_001025370chr621310 587 ------
NM_001025370chr621310 587 ------
NM_001025389chr112610 316 ----11204
NM_001025390chr112610 316 ----11204
NM_001025579chr173366 163 32 ------
NM_001025580chrX23974 71 ------
NM_001025603chr131350 493 157 ------
NM_001025780chr921201 1071 ------
NM_001029835chr72404 93 ------
NM_001029858chr632985 1127 522 ------
NM_001029871chr2061786 1574 1380 660 563 25 ------
NM_001029875chr521890 1001 12504 12166 --
NM_001029989chr151968 122 ----
NM_001030007chr1621080 325 1577 ----
NM_001030055chr1464247 3931 3615 3608 1793 508 ------
NM_001031679chr1222306 1193 ------
NM_001031684chr221462 1187 21220 1089 ----
NM_001031690chr763077 2872 2464 2441 2056 197 --1236 --
NM_001031692chr72333 213 ------
NM_001031695chr2284374 4045 1694 1612 519 499 419 52 11036 --14389
NM_001031716chr22900 124 ------
NM_001031717chr32242 88 --1277 --
NM_001031804chr1643819 2938 1041 265 ------
NM_001032221chr91361 ------
NM_001032283chr12130 ------
NM_001032284chr12130 ------
NM_001032288chr2051212 1001 520 431 364 ------
NM_001032289chrX3835 699 210 155 ----
NM_001032296chr1332549 1152 415 ------
NM_001032363chr131881 1587 135 ------
NM_001032363chr131881 1587 135 ------
NM_001032393chrX1138 ------
NM_001033044chr131357 532 388 --1625 --
NM_001033056chr131357 532 388 --1625 --
NM_001033059chr621608 660 --11824 --
NM_001033081chr151308 1201 655 445 108 ------
NM_001033082chr151308 1201 655 445 108 ------
NM_001033087chr203738 526 347 13140 ----
NM_001033117chr363971 3632 3382 1089 118 64 ------
NM_001033506chr11150 ------
NM_001033507chr141689 1564 1381 1347 ------
NM_001033564chr621507 62 171 21427 660 --
NM_001033667chr12297 214 --1283 --
NM_001033723chr842412 2000 1782 218 --12054 --
NM_001033756chr621244 521 ------
NM_001033756chr621244 521 ------
NM_001034025chr123675 655 218 --1167 --
NM_001035521chr22277 112 ------
NM_001037163chr7174 ------
NM_001037334chr182808 708 ------
NM_001037954chr1142749 573 166 36 23084 177 12472 --
NM_001038707chr142157 874 335 149 ------
NM_001038707chr142157 874 335 149 ------
NM_001039029chr1251989 1804 1753 1450 216 ------
NM_001039140chr202492 336 ------
NM_001039199chr20134847 4473 4306 3719 3552 3412 1980 1663 1511 1345 799 706 304 24155 1194 ----
NM_001039457chr11284 1275 196 --
NM_001039459chr71410 ------
NM_001039465chr141335 186 ----
NM_001039479chr143846 789 131 --1981 --
NM_001039538chr213382 ----13293
NM_001039550chr24763 648 263 122 ------
NM_001039569chr232977 2523 1220 ------
NM_001039570chr22124256 4158 4096 3954 3777 2970 1606 1314 1014 848 610 184 13374 ----
NM_001039571chr22124256 4158 4096 3954 3777 2970 1606 1314 1014 848 610 184 13374 ----
NM_001039573chr17--1466 ----
NM_001039577chr164434 4225 3355 3252 3199 688 1413 23366 983 --
NM_001039580chr42991 983 14014 ----
NM_001039583chr223189 108 53 ------
NM_001039584chr223189 108 53 ------
NM_001039585chr134166 3149 805 13083 ----
NM_001039590chrX43210 2585 2565 73 ------
NM_001039591chrX43210 2585 2565 73 ------
NM_001039690chr1682039 2032 1683 1601 782 726 612 173 --22341 344 --
NM_001039693chr263642 3538 3202 3050 3000 2883 13284 ----
NM_001039711chr13929 848 186 ------
NM_001039712chr13929 848 186 ------
NM_001039770chr352151 1513 391 166 123 ------
NM_001039771chr1421093 811 ------
NM_001039840chrX75771 5624 4799 4558 4267 4152 2084 ------
NM_001039933chr174350 177 152 67 ------
NM_001039960chr125501 157 118 105 56 ------
NM_001040020chr721597 106 ------
NM_001040101chr421357 1200 1633 ----
NM_001040113chr163838 337 50 ------
NM_001040144chr1682039 2032 1683 1601 782 726 612 173 --22341 344 --
NM_001040146chr1682039 2032 1683 1601 782 726 612 173 --22341 344 --
NM_001040152chr744310 3571 1458 137 11989 1607 1985
NM_001040159chr41328 ------
NM_001040167chr73971 857 258 139 ----
NM_001040280chr641307 509 449 256 ------
NM_001040284chr1645039 4749 3946 846 --11006 14718
NM_001040402chr422869 2775 ------
NM_001040409chr21858 ----11038
NM_001040429chr1353447 2917 2911 2313 70 11163 ----
NM_001040436chr122625 459 ------
NM_001040446chr541741 1691 774 736 --11099 --
NM_001040455chr1161293 1168 1141 444 393 148 ------
NM_001040697chr11----1119 --
NM_001040709chr152536 837 433 241 111 --12343 --
NM_001040712chr913349 ------
NM_001042353chr201558 1123 ----
NM_001042355chr1635030 3304 619 --11479 --
NM_001042357chr1051148 618 271 172 116 ------
NM_001042358chr1051148 618 271 172 116 ------
NM_001042360chr1051148 618 271 172 116 ------
NM_001042361chr1041179 302 203 147 ------
NM_001042363chr1051148 618 271 172 116 ------
NM_001042364chr1041179 302 203 147 ------
NM_001042365chr1041179 302 203 147 ------
NM_001042368chr9121 ------
NM_001042371chr1662103 1571 1546 1466 1408 216 --11872 --
NM_001042387chr1041179 302 203 147 ------
NM_001042388chr181357 --1719 --
NM_001042389chr1051148 618 271 172 116 ------
NM_001042390chr1051148 618 271 172 116 ------
NM_001042392chr1051148 618 271 172 116 ------
NM_001042393chr1041179 302 203 147 ------
NM_001042395chr1051148 618 271 172 116 ------
NM_001042396chr1041179 302 203 147 ------
NM_001042397chr1041179 302 203 147 ------
NM_001042403chr121694 ------
NM_001042404chr1----195 --
NM_001042412chr1635030 3304 619 --11479 --
NM_001042413chr984010 3605 2695 1284 1263 937 750 204 23773 1418 ----
NM_001042453chrX21562 638 ------
NM_001042473chr1021974 1373 ------
NM_001042486chr2011472 ------
NM_001042498chrX4972 836 347 94 1192 ----
NM_001042555chr1211868 ------
NM_001042573chr1741701 1547 271 163 --12063 --
NM_001042595chr194331 109 68 50 ------
NM_001042599chr246391 5528 3106 71 15836 14875 --
NM_001042601chr32394 238 --12936 --
NM_001042603chr1274033 3506 3448 3390 3332 1471 411 1476 23245 1680 --
NM_001042604chr334172 3194 3015 13538 ----
NM_001042632chr2072217 1894 1038 549 543 475 335 ------
NM_001042633chr2072217 1894 1038 549 543 475 335 ------
NM_001042681chr132094 804 731 --1744 --
NM_001042682chr132094 804 731 --1744 --
NM_001042682chr132094 804 731 --1744 --
NM_001042683chr621226 137 1371 ----
NM_001042724chr191137 ------
NM_001042728chr123781 354 251 ------
NM_001043318chr1432906 1257 112 ------
NM_001043351chr142107 2085 1486 1435 ------
NM_001044385chr253850 3422 2528 863 643 --13105 --
NM_001045556chr861155 645 449 249 189 59 1508 ----
NM_001045557chr861155 645 449 249 189 59 1508 ----
NM_001046chr532887 2654 1959 ------
NM_001048183chr1103516 3302 2749 2495 2378 1423 1254 957 814 436 --23693 879 --
NM_001066chr182108 2020 1704 866 700 593 319 75 ------
NM_001077628chr12202 29 ------
NM_001079874chr131911 1459 321 ------
NM_001083620chr4--11670 ----
NM_001087chr2----129 --
NM_001092chr1752271 1905 1882 524 52 ------
NM_001095chr1271940 1824 1783 1739 1556 624 400 ------
NM_001099678chr375578 5400 4989 4823 4261 3906 121 14406 ----
NM_001106chr3169365 7047 6614 6450 3837 3624 3290 3006 2746 2176 2143 2078 1726 1686 1675 1136 26881 1933 ----
NM_001111chr132578 2102 193 ----11761
NM_001121chr1021602 1548 ------
NM_001128chr1621080 325 1577 ----
NM_001130chr192671 265 --1221 --
NM_001144chr164972 548 263 245 ------
NM_001146chr832121 1908 1725 ------
NM_001160chr1222492 862 12799 ----
NM_001172chr14188 1265 ----
NM_001173chr1464247 3931 3615 3608 1793 508 ------
NM_001174chrX3940 801 284 ------
NM_001177chr1252154 1993 1974 1776 1674 11664 ----
NM_001186chr2142753 2148 738 671 ------
NM_001189chr45924 785 726 318 248 ------
NM_001191chr2061347 1094 1062 1026 541 142 ------
NM_001198chr631729 1663 45 ------
NM_001201chr423415 2963 ------
NM_001203chr41227 ------
NM_001204chr236786 5079 830 16686 --1409
NM_001219chr73614 277 54 11771 ----
NM_001222chr1041595 1412 395 385 ------
NM_001237chr42833 323 ------
NM_001237chr42833 323 ------
NM_001241chr221860 453 12040 ----
NM_001241chr221860 453 12040 ----
NM_001256chr1742092 1912 1135 365 22002 704 ----
NM_001261chr93901 768 433 ------
NM_001265chr132595 286 ------
NM_001293chr112485 54 ----1359
NM_001294chr191407 ------
NM_001295chr34967 274 152 70 1205 ----
NM_001304chr1733374 3078 2467 1788 ----
NM_001310chr1252062 1889 1199 1120 219 ------
NM_001313chr44819 686 648 181 ------
NM_001326chr111387 ------
NM_001328chr42607 32 ------
NM_001333chr9145 ------
NM_001356chrX12210 ------
NM_001357chr1--1266 ----
NM_001364chr1143881 3829 3736 1873 --11332 --
NM_001365chr173220 55 22 ------
NM_001383chr173277 185 120 --1284 --
NM_001387chr553201 2841 2641 1203 402 --13041 --
NM_001396chr2121768 326 12187 --12740
NM_001397chr172568 2357 2150 2008 1805 269 91 12173 ----
NM_001399chrX63711 3559 3400 1471 992 899 --11483 --
NM_001408chr121246 142 11594 ----
NM_001420chr1953121 513 430 363 263 ------
NM_001421chrX31530 1427 247 11582 1141 --
NM_001423chr1241959 1408 433 293 ------
NM_001432chr433535 2608 1565 --2281 44 --
NM_001438chr1----11173 --
NM_001440chr851984 1125 720 627 185 ------
NM_001453chr61283 ------
NM_001493chrX3541 522 142 ------
NM_001497chr962739 2585 2339 1883 1829 1710 --12352 --
NM_001514chr12530 139 ------
NM_001521chr22277 112 ------
NM_001527chr634818 4346 4301 ------
NM_001530chr142118 95 ------
NM_001541chr111158 ------
NM_001542chr121841 183 --11147 --
NM_001543chr582988 1725 1505 1178 964 602 555 421 1270 23491 134 --
NM_001546chr611047 ------
NM_001567chr114600 504 259 250 ------
NM_001584chr11--1449 ----
NM_001609chr1063741 1368 810 552 144 29 --1425 --
NM_001616chr2----11171 --
NM_001624chr611877 ----1649
NM_001634chr621608 660 --11824 --
NM_001649chrX52306 2287 409 364 97 --12206 --
NM_001655chr1121959 510 --11927 --
NM_001658chr11836 1209 ----
NM_001659chr1222714 2348 22518 2393 ----
NM_001660chr33556 254 81 --1184 --
NM_001663chr141153 1324 ----
NM_001664chr32383 181 ------
NM_001665chr112204 57 ------
NM_001668chr112202 --11542 --
NM_001670chr225680 673 318 93 46 ------
NM_001682chr1232002 1989 1013 ------
NM_001689chr2--12026 ----
NM_001690chr331830 912 252 --12418 --
NM_001701chr921359 624 ------
NM_001709chr1132316 1763 875 ------
NM_001731chr12----1734 --
NM_001742chr7--1163 1660 --
NM_001753chr72116 56 ----11384
NM_001754chr2111705 13998 22669 941 --
NM_001755chr1611885 ------
NM_001759chr1273835 3462 2078 1125 1076 62 45 21892 1096 1928 --
NM_001777chr331218 1179 380 ------
NM_001788chr72303 51 ------
NM_001789chr321393 117 --11194 --
NM_001797chr16139 ------
NM_001806chr1931161 367 189 ------
NM_001823chr14152 1133 ----
NM_001829chr41719 --1837 --
NM_001845chr131441 ------
NM_001851chr62738 55 --143 --
NM_001854chr1146 ------
NM_001859chr973817 3651 2497 1409 1095 765 599 --11346 11363
NM_001865chr6----127 --
NM_001873chr41655 ------
NM_001892chr521511 123 11156 ----
NM_001893chr171361 ------
NM_001895chr202771 74 ------
NM_001904chr32190 84 ------
NM_001918chr1138686 7194 7059 3636 3380 3097 2445 2066 1876 1569 1431 549 383 12827 48578 2610 1765 1622 --
NM_001933chr1411271 --189 1879
NM_001938chr11100 ------
NM_001939chrX83135 1499 1272 925 666 518 150 43 ----13673
NM_001945chr551409 1368 1182 1141 1052 11248 ----
NM_001946chr12136 ------
NM_001949chr632115 1027 367 12481 ----
NM_001955chr61381 --1701 --
NM_001964chr51770 ------
NM_001969chr1443806 3580 2626 1580 1540 13202 --
NM_001970chr173390 221 71 --1395 --
NM_001978chr841036 959 757 240 ------
NM_001991chr1751521 866 697 505 488 --1205 12175
NM_001995chr4--11361 ----
NM_002009chr1511041 12235 ----
NM_002010chr131146 ------
NM_002015chr13103080 2975 2597 2443 2435 2335 2140 1038 315 109 22470 2395 13294 --
NM_002018chr17----128 --
NM_002025chrX139044 8732 8675 8391 7318 6892 6830 6071 2950 2376 2119 1764 879 --27883 2759 --
NM_002031chr6------1223
NM_002040chr211362 ------
NM_002048chr92146 88 1918 ----
NM_002061chr131953 1788 1478 ------
NM_002065chr131357 532 388 --1625 --
NM_002072chr92953 37 ------
NM_002073chr2221226 418 11159 ----
NM_002074chr151575 1411 1212 586 429 ------
NM_002077chr931610 200 74 ------
NM_002078chr3188 ------
NM_002079chr101123 --1444 --
NM_002086chr1731975 1802 880 ------
NM_002092chr454736 4366 3980 3586 3404 --14585 --
NM_002112chr15----1214 --
NM_002126chr1721600 394 1417 ----
NM_002130chr53448 209 142 ------
NM_002131chr651302 1287 936 421 332 ------
NM_002133chr221567 ------
NM_002136chr122490 458 ------
NM_002137chr712243 ----11626
NM_002140chr91907 ------
NM_002141chr7--1280 ----
NM_002146chr1731000 133 119 ------
NM_002147chr173783 744 647 --1668 --
NM_002148chr22674 569 ------
NM_002149chr25754 614 260 197 114 --1729 --
NM_002158chr223215 2486 23069 1192 ----
NM_002196chr20143 --1377 --
NM_002196chr20143 --1377 --
NM_002198chr55576 309 282 184 169 1761 ----
NM_002204chr1741189 901 344 32 ------
NM_002205chr124819 640 633 76 ------
NM_002207chr3148 ------
NM_002223chr1223578 1177 ------
NM_002229chr19137 ----1314
NM_002232chr1156 ------
NM_002235chr1221673 1220 2484 389 ----
NM_002241chr162907 2863 2648 2060 293 31 160 22814 2399 --
NM_002249chr12401 65 --1156 --
NM_002254chr221480 242 --2463 81 --
NM_002264chr334062 1377 510 11668 ----
NM_002265chr172455 423 --1364 --
NM_002267chr132564 265 ------
NM_002268chr32489 116 ------
NM_002270chr525152 4407 14468 --14969
NM_002271chr1332471 693 616 ------
NM_002285chr253432 3130 3004 2745 33 ----11241
NM_002309chr22122631 2512 2454 2321 2270 2121 1135 970 737 684 652 139 --11204 --
NM_002336chr1224785 1184 2759 636 ----
NM_002355chr1251383 873 546 511 486 1471 ----
NM_002359chr17104243 4175 3766 3527 3201 1453 1377 1211 537 274 --11173 --
NM_002360chr782662 2559 2183 2108 1680 1035 989 773 ------
NM_002361chr191237 --1285 --
NM_002372chr5153 ------
NM_002373chr15----1853 --
NM_002374chr213382 ----13293
NM_002375chr361807 1610 1495 630 357 256 ------
NM_002384chr182295 137 --1375 --
NM_002387chr544605 3303 1954 307 ------
NM_002397chr531519 1399 431 ------
NM_002399chr1521143 1038 ------
NM_002401chr1782293 1852 1792 1671 929 813 422 343 ------
NM_002430chr2221796 632 --12478 --
NM_002442chr1231235 297 185 ------
NM_002444chrX11814 ------
NM_002480chr12180 ------
NM_002490chr222610 479 1142 ----
NM_002499chr1562289 972 449 188 180 38 12087 ----
NM_002501chr1963704 2795 852 503 434 27 --13914 --
NM_002505chr62426 168 ------
NM_002507chr1731727 1440 103 ------
NM_002508chr1165 ------
NM_002509chr201614 ------
NM_002516chr191248 --191 --
NM_002520chr5----1204 --
NM_002522chr1731514 1207 770 --1142 --
NM_002537chr154847 699 342 323 ------
NM_002545chr1143895 1852 1510 84 32052 1586 1153 ----
NM_002547chrX53723 3326 1578 553 460 ------
NM_002553chr71165 ------
NM_002599chr1121006 58 ------
NM_002605chr153285 208 79 1270 ----
NM_002609chr531910 598 68 ------
NM_002613chr16174978 4285 4080 3699 3367 2092 1889 1709 1662 1523 1405 1396 1389 604 569 327 58 --12030 --
NM_002618chr21174 --1166 --
NM_002655chr821430 575 14043 13594 --
NM_002657chr2051490 1095 727 403 146 --12700 --
NM_002662chr332180 2168 515 1629 ----
NM_002698chr1972863 2737 2516 843 352 341 329 --3129 118 60 --
NM_002699chr1167 --21222 546 --
NM_002705chr163854 92 69 ------
NM_002709chr223486 2306 1882 1366 --
NM_002714chr63740 200 140 ------
NM_002715chr511082 1819 ----
NM_002716chr1183403 3355 3133 2768 2553 2370 1337 338 --12383 --
NM_002717chr82663 529 ------
NM_002718chr342011 1899 1859 154 22388 642 ----
NM_002731chr122780 478 32893 782 497 ----
NM_002737chr1765545 5010 1647 1148 673 252 1662 15876 --
NM_002740chr332686 831 71 --1681 --
NM_002751chr2271186 1040 481 461 234 206 42 --170 --
NM_002752chr5167 ------
NM_002755chr152634 222 ------
NM_002756chr174970 366 336 285 ------
NM_002758chr17----1411 --
NM_002764chrX1620 161 ----
NM_002776chr1921338 715 ------
NM_002810chr11109 ------
NM_002821chr63582 147 27 ------
NM_002826chr12911 99 --3779 655 349 --
NM_002833chr1511173 ------
NM_002839chr913349 ------
NM_002840chr131223 1064 1010 ----11175
NM_002843chr1133175 2502 2444 --23126 2434 --
NM_002859chr1241388 689 566 303 ------
NM_002868chr1252334 2284 2147 1654 220 1877 ----
NM_002869chr1122159 654 --1344 --
NM_002874chr9168 1101 ----
NM_002883chr226948 869 780 736 331 30 ------
NM_002886chr365121 4077 803 595 336 208 ------
NM_002890chr51249 ------
NM_002892chr141420 ------
NM_002906chr11----1185 --
NM_002948chr31517 --1319 --
NM_002955chr631547 578 316 1586 ----
NM_002971chr31198 ------
NM_002979chr11248 ------
NM_002990chr1652151 1644 435 307 146 11745 12244 --
NM_002997chr251828 1410 387 193 127 --1774 --
NM_002999chr2051726 1682 1272 713 25 11967 11714 --
NM_003010chr1732219 1535 940 ------
NM_003011chr911243 11372 11545 --
NM_003013chr41117 --1331 --
NM_003016chr1732029 1669 792 ------
NM_003017chr611171 --199 --
NM_003036chr111084 --11091 --
NM_003043chr374141 4015 3622 3072 1209 1015 521 ------
NM_003045chr13104270 3637 3197 1549 1332 1038 986 772 214 193 21895 1569 23533 944 --
NM_003048chr22864 320 ------
NM_003069chrX1594 ------
NM_003070chr9--125 1325 --
NM_003074chr3102123 1950 1735 1692 1457 868 752 674 265 229 --11442 --
NM_003075chr122222 94 ------
NM_003076chr125542 303 244 91 82 ------
NM_003077chr173802 657 37 --2778 167 --
NM_003081chr201183 ------
NM_003088chr761081 912 805 468 281 225 ------
NM_003095chr12--1382 ----
NM_003108chr272575 2463 1966 1948 1102 475 316 17220 ----
NM_003111chr21123 ------
NM_003113chr21183 1588 --1212
NM_003127chr91112 ------
NM_003128chr232362 2228 417 --11025 --
NM_003131chr632100 1845 275 ------
NM_003137chr621898 213 ------
NM_003144chr622202 882 11786 ----
NM_003150chr1752092 1887 1471 920 374 ------
NM_003155chr821778 585 12649 185 --
NM_003156chr1121268 127 ------
NM_003161chr171641 --1429 --
NM_003170chr173538 50 24 ------
NM_003173chrX51409 1372 1126 930 360 ------
NM_003178chr342097 1899 1586 465 --1163 --
NM_003179chrX31342 495 410 --11263 --
NM_003189chr143115 2070 1224 312 --2979 566 12743
NM_003199chr1845125 3899 1591 813 --14494 --
NM_003200chr1992113 1914 1906 1723 1580 961 858 596 308 ----11964
NM_003214chr631355 994 60 --1485 --
NM_003216chr22123080 2940 2766 2721 2481 2402 1248 1054 598 586 356 53 --12184 --
NM_003217chr1231766 570 531 ------
NM_003221chr611572 ------
NM_003224chr207866 599 329 294 197 158 39 ------
NM_003236chr262582 2234 766 741 178 88 12456 22197 1133 --
NM_003239chr142762 100 ------
NM_003246chr15--11727 1757 --
NM_003250chr172446 326 ------
NM_003253chr2131789 1614 132 --11783 --
NM_003255chr1751624 572 363 234 173 11948 ----
NM_003257chr151980 ------
NM_003262chr344702 3745 1569 565 ------
NM_003274chr2152734 1989 1895 410 109 --1930 --
NM_003298chr3104996 4269 3938 2442 2419 2278 1744 1152 752 746 --1121 11174
NM_003304chr311299 --1255 --
NM_003305chr4------1379
NM_003319chr21669 ------
NM_003339chr51341 11203 ----
NM_003340chr41309 ------
NM_003342chr1722996 2150 --13083 1869
NM_003344chr721080 172 --11121 --
NM_003347chr2252078 2042 698 471 107 --32245 1555 1550 --
NM_003348chr1231116 634 278 ----11726
NM_003349chr2051212 1001 520 431 364 ------
NM_003352chr21703 1123 ----
NM_003356chr1141018 431 345 168 ------
NM_003359chr43986 392 258 1480 ----
NM_003374chr53654 225 89 ------
NM_003376chr621310 587 ------
NM_003376chr621310 587 ------
NM_003380chr101293 ------
NM_003385chr22284 119 ------
NM_003387chr241943 790 503 394 ------
NM_003392chr351595 1147 880 462 69 ------
NM_003394chr123720 461 95 ------
NM_003400chr21877 ------
NM_003404chr2021315 1303 11843 ----
NM_003405chr221537 ------
NM_003406chr811524 ----1727
NM_003409chr18129 --2211 137 --
NM_003412chr321950 749 ----1228
NM_003430chr192322 139 ------
NM_003439chr743163 2496 2331 1019 ------
NM_003458chr373121 3034 2475 1110 392 206 77 12569 ----
NM_003459chr21559 ------
NM_003463chr611167 12839 ----
NM_003474chr1031603 895 825 11864 ----
NM_003477chr111255 186 ----
NM_003478chr1153147 2977 2337 461 49 ------
NM_003482chr1222198 1837 11735 21896 1857 --
NM_003488chr17153 --1628 --
NM_003489chr2123292 2926 ------
NM_003507chr211332 ------
NM_003559chr1772920 2851 1137 1065 772 654 557 ------
NM_003563chr1731112 350 233 ------
NM_003564chr11636 ------
NM_003565chr1281668 1595 1440 1254 1242 629 259 198 --1550 --
NM_003576chr1332549 1152 415 ------
NM_003583chr1253648 3477 3222 2579 1051 13445 ----
NM_003597chr252162 1840 1629 1532 564 ------
NM_003598chr191172 ------
NM_003603chr442097 495 455 172 ------
NM_003607chr111202 --24113 3745 --
NM_003613chr152585 80 1603 ----
NM_003615chr31132 --11608 --
NM_003628chr2----1237 --
NM_003629chr153489 3120 2797 2689 519 --12454 --
NM_003656chr3144 ------
NM_003663chr333194 997 786 ------
NM_003664chr5149 ----1415
NM_003671chr922885 2657 23247 276 ----
NM_003678chr221176 ------
NM_003707chr33204 84 46 ------
NM_003713chr1--11125 ----
NM_003714chr53644 412 397 --2531 202 --
NM_003744chr1431148 1087 895 ------
NM_003749chr131536 1420 ----
NM_003750chr10--1319 ----
NM_003763chr2052655 2415 2325 422 59 ------
NM_003766chr173504 455 209 ------
NM_003774chr1233207 2277 1070 --1542 --
NM_003793chr113377 289 27 ------
NM_003794chr32881 765 1395 ----
NM_003796chr191632 ------
NM_003798chr9--1185 ----
NM_003800chr621572 552 --1557 --
NM_003822chr132957 2015 1978 12697 ----
NM_003825chr1511363 --1528 --
NM_003842chr872124 1812 1720 862 692 231 36 ------
NM_003858chr142685 241 ------
NM_003872chr232618 850 754 --1821 --
NM_003883chr52129 49 ------
NM_003913chr62558 434 ------
NM_003930chr74959 697 681 349 ------
NM_003934chr921157 374 --1495 --
NM_003939chr1053421 3061 3004 2941 2868 23304 3161 23604 1159 --
NM_003941chr711758 ----12335
NM_003946chr161573 ------
NM_003949chr1771818 1651 1480 1335 601 431 48 ------
NM_003957chr1131009 766 272 --1246 --
NM_003958chr663542 3152 2904 2832 2494 60 ------
NM_003966chr597593 5522 2902 2593 2574 1198 793 579 556 36973 2759 2097 1810 --
NM_003975chr15297 224 216 107 34 ------
NM_003982chr142112 42 --1248 --
NM_003983chr1651393 1191 1096 999 28 23200 291 13562 11277
NM_003987chr1032218 1982 265 ------
NM_003988chr1032295 2059 342 ------
NM_003989chr1032154 1918 201 ------
NM_003990chr1032154 1918 201 ------
NM_003994chr123440 416 102 --1664 --
NM_004006chrX----1830 --
NM_004007chrX----1830 --
NM_004009chrX----1830 --
NM_004010chrX----1830 --
NM_004011chrX----1830 --
NM_004012chrX----1830 --
NM_004013chrX----1830 --
NM_004014chrX----1830 --
NM_004015chrX----1830 --
NM_004016chrX----1744 --
NM_004017chrX----1830 --
NM_004018chrX----1744 --
NM_004020chrX----1830 --
NM_004021chrX----1744 --
NM_004022chrX----1744 --
NM_004023chrX----1744 --
NM_004047chr11284 1275 196 --
NM_004050chr1461768 1008 825 519 509 459 --12190 --
NM_004052chr10124 ------
NM_004067chr711129 --1245 --
NM_004068chr31140 ------
NM_004077chr12------1206
NM_004093chr1362709 998 585 403 383 187 --12613 --
NM_004094chr1442760 2261 1976 1217 ------
NM_004103chr82532 257 --1282 --
NM_004132chr1021021 150 1207 11135 --
NM_004134chr51624 ------
NM_004157chr32855 49 ------
NM_004161chr221406 1087 ------
NM_004171chr11138597 8389 8261 8033 6641 6344 6075 3705 3546 2607 2099 1505 849 26791 2349 38513 6484 989 --
NM_004200chr1162878 2332 1218 797 592 442 ------
NM_004202chrY2188 82 ------
NM_004205chr113396 214 162 ------
NM_004227chr733074 2678 1976 --12391 --
NM_004229chrX2739 606 ----12034
NM_004232chr1812930 ------
NM_004233chr641307 509 449 256 ------
NM_004263chr291567 1533 1321 1262 355 345 168 158 80 ------
NM_004272chr52641 619 1632 ----
NM_004273chr10123988 3815 3760 3644 3287 1851 1261 1045 1000 432 418 310 --11347 --
NM_004274chr1441175 1059 101 52 ------
NM_004281chr10------1109
NM_004288chr21985 --171 --
NM_004290chr5------11182
NM_004295chr172427 272 ------
NM_004302chr1251870 970 819 754 333 --1588 --
NM_004308chr1171702 1671 1610 695 673 549 255 2461 35 ----
NM_004309chr176941 890 715 322 142 125 ------
NM_004311chr1052865 2568 2426 1907 1075 ------
NM_004321chr2143390 3199 3168 2897 2781 2475 2429 2345 2200 1182 705 591 547 222 --21353 1212 --
NM_004349chr811082 ------
NM_004364chr1941258 1216 179 136 ------
NM_004370chr631390 748 360 ------
NM_004379chr241766 1599 620 49 ------
NM_004380chr1632322 1967 190 ------
NM_004389chr22843 182 ------
NM_004392chr1341812 1003 965 931 --12603 --
NM_004393chr372010 1972 721 658 160 140 43 ------
NM_004395chr54706 546 278 101 ------
NM_004397chr1144300 3993 3839 928 --33262 3182 2722 --
NM_004405chr23769 310 203 ------
NM_004420chr1182239 2167 2057 1849 932 903 567 276 ----1206
NM_004423chr352460 1951 1789 806 346 ----190
NM_004426chr122580 457 165 ----
NM_004429chrX61128 1107 568 501 476 43 1560 1968 --
NM_004430chr811798 12199 ----
NM_004433chr151592 1381 442 347 264 ------
NM_004434chr14164 ------
NM_004438chr232750 2583 589 --3563 480 147 --
NM_004441chr321335 865 ------
NM_004442chr13497 312 71 ------
NM_004443chr33728 541 88 ------
NM_004450chr14138 1383 ----
NM_004451chr11186 ------
NM_004472chr5163 --1463 --
NM_004474chr12815 332 ------
NM_004475chr1751164 925 878 364 96 11199 11153 --
NM_004491chr19114014 3172 2994 2762 1706 1284 947 851 597 214 190 23902 3195 23428 1092 --
NM_004494chr14437 310 279 49 ------
NM_004496chr14126 ------
NM_004497chr193619 584 74 ------
NM_004498chr151281 ------
NM_004501chr143454 1626 668 323 ------
NM_004502chr172514 404 ------
NM_004516chr193871 441 199 ------
NM_004529chr941166 956 474 266 ------
NM_004530chr164409 302 88 58 1140 ----
NM_004540chr211110 ------
NM_004549chr1121076 1059 --11481 --
NM_004554chr1441566 1279 1144 93 --1183 --
NM_004560chr93908 280 216 ------
NM_004566chr1052581 1932 1746 897 150 ------
NM_004575chr411152 --11502 --
NM_004577chr71498 ------
NM_004586chrX75245 3852 3551 2153 1737 1570 566 ----14341
NM_004588chr1193908 3128 1375 955 859 442 386 357 83 --13574 --
NM_004598chr51624 12789 ----
NM_004603chr7--11142 ----
NM_004606chrX123 ------
NM_004612chr934539 2953 402 ------
NM_004615chrX1314 ------
NM_004626chr113284 175 74 ------
NM_004630chr114883 400 206 172 ------
NM_004635chr341012 393 299 25 --11002 --
NM_004646chr193360 117 72 ------
NM_004654chrY172 ------
NM_004660chrY1938 --1927 12133
NM_004687chr172236 80 1136 1315 --
NM_004690chr6--2305 254 ----
NM_004711chr2293629 3537 3341 3122 2922 1112 855 691 374 --1448 --
NM_004713chr14--1644 ----
NM_004725chr1021167 977 ------
NM_004730chr532161 1605 534 ------
NM_004734chr1312212 --22938 908 --
NM_004736chr11187 12090 ----
NM_004742chr321753 375 ------
NM_004745chr831474 231 73 --12504 11820
NM_004748chr1532580 830 676 ------
NM_004760chr72853 844 ------
NM_004762chr1761715 1366 629 582 564 332 1299 21769 619 --
NM_004774chr1742522 2362 1250 198 ------
NM_004783chr164606 474 205 180 ------
NM_004788chr1142722 2352 2164 76 22279 2114 ----
NM_004796chr1441686 554 320 133 ------
NM_004798chr2032566 2290 152 --13355 --
NM_004805chr23296 136 68 ------
NM_004808chr1073159 2994 2515 2487 2239 966 885 --11135 --
NM_004815chr164565 4558 4149 3854 3666 870 11813 ----
NM_004822chr17102696 2520 1566 1306 1116 1084 704 602 578 312 --13106 --
NM_004824chr62365 118 ------
NM_004827chr421758 247 11800 ----
NM_004839chr153694 625 525 ------
NM_004840chrX2717 187 ------
NM_004858chr12131 ------
NM_004860chr171128 --1533 --
NM_004862chr1671224 1202 1156 514 360 188 91 --174 --
NM_004863chr14175207 5199 4745 4355 4214 4164 3932 3764 3443 1770 1603 981 860 792 709 632 397 25321 1690 15247 --
NM_004866chr544896 4354 3078 904 ------
NM_004867chrX--127 ----
NM_004879chr112278 158 ------
NM_004902chr201585 --1706 1653
NM_004904chr745105 1487 583 211 1246 ----
NM_004921chr121721 245 12024 11742 --
NM_004922chr102918 864 1646 1720 --
NM_004924chr1951039 964 419 228 51 --1973 1234
NM_004926chr1421679 713 ------
NM_004929chr81571 ------
NM_004948chr1811445 ----1374
NM_004953chr34391 168 158 63 ------
NM_004956chr734526 728 280 --13010 13532
NM_004958chr1------1820
NM_004959chr94350 236 197 54 ------
NM_004963chr122138 125 ------
NM_004972chr91267 ------
NM_004976chr11164744 4520 4283 4019 3948 3827 3223 2077 2042 1684 1317 1267 1071 393 109 94 --1288 --
NM_004979chrX6962 871 849 817 211 92 ------
NM_004992chrX98171 6547 6051 6024 5935 5322 2836 820 571 22843 1514 25863 1903 --
NM_004992chrX98171 6547 6051 6024 5935 5322 2836 820 571 22843 1514 25863 1903 --
NM_004998chr152274 115 1128 ----
NM_005003chr16159 ------
NM_005032chrX1773 11073 ----
NM_005044chrX73962 3609 1047 996 880 285 49 1645 ----
NM_005045chr72367 108 ------
NM_005056chr1274277 3750 3692 3634 3576 1715 655 1720 33489 1924 256 --
NM_005063chr1043249 2490 2364 1507 ------
NM_005068chr631302 1286 1172 ------
NM_005072chr164160 111 64 24 ------
NM_005076chr1104076 3464 2968 1434 1309 1001 835 716 694 271 34200 3840 1037 13618 --
NM_005095chr121569 678 ------
NM_005103chr111277 ------
NM_005105chr141546 1539 1501 797 12066 ----
NM_005116chr2044103 3315 1491 24 --32915 1659 1587 --
NM_005119chr11308 --1829 --
NM_005121chr1723250 1368 11291 13621 --
NM_005124chr61270 ------
NM_005134chr181357 --1719 --
NM_005137chr2282188 1634 814 642 400 361 96 29 ------
NM_005151chr182808 708 ------
NM_005156chr944386 4135 3565 1410 --34926 4372 1239 11128
NM_005157chr9--11793 ----
NM_005161chr1162126 1526 1420 861 307 24 ------
NM_005163chr142722 33 ------
NM_005169chr114555 513 261 92 ------
NM_005176chr12----140 --
NM_005180chr1011355 ------
NM_005181chr82577 73 --155 --
NM_005187chr1691912 1880 1848 1816 1784 1752 1531 93 79 ------
NM_005188chr11107958 7354 6922 6303 5426 5388 3232 2397 964 644 --17746 --
NM_005190chr61842 ------
NM_005197chr1466064 6055 5693 4755 4412 1657 11649 ----
NM_005207chr2252756 2739 2391 1022 866 ------
NM_005215chr182673 657 ------
NM_005219chr531435 1125 177 ------
NM_005220chr1731072 461 287 ------
NM_005235chr246391 5528 3106 71 15836 14875 --
NM_005238chr1142779 1033 960 425 ------
NM_005241chr31278 ------
NM_005252chr141286 1498 ----
NM_005266chr161534 1463 1371 650 304 105 1621 11308 --
NM_005271chr1031228 950 376 ------
NM_005279chr22641 122 ------
NM_005281chr14880 854 780 706 ------
NM_005311chr742687 1855 1052 285 ------
NM_005324chr1711807 ------
NM_005327chr41252 ------
NM_005328chr8----1660 --
NM_005336chr25699 437 267 179 149 --21516 686 --
NM_005339chr4----13735 --
NM_005342chrX42454 1914 1063 191 ------
NM_005358chr13--21551 163 ----
NM_005359chr1896277 6158 5658 4733 4297 4173 2487 2237 1638 26065 2204 26488 2620 --
NM_005375chr61735 ------
NM_005376chr121085 35 ------
NM_005385chr311915 ----1759
NM_005387chr111526 ------
NM_005392chr92722 562 --11541 --
NM_005402chr76703 685 625 544 383 337 ------
NM_005407chr143544 277 153 --11350 --
NM_005415chr21662 1488 ----
NM_005417chr2061934 1906 1329 739 562 34 ------
NM_005418chr113648 68 50 ------
NM_005430chr124986 839 279 182 --1765 --
NM_005433chr18--12093 11882 --
NM_005435chr7----1180 --
NM_005436chr1054036 3860 3811 1005 305 14010 ----
NM_005455chr151286 1200 1173 184 78 ------
NM_005456chr114743 698 255 232 ------
NM_005465chr131467 805 636 11246 ----
NM_005466chr142397 24 ------
NM_005474chr173573 374 283 --11509 --
NM_005475chr1241315 1107 898 869 12864 11017 --
NM_005476chr931149 1128 352 197 11084 --
NM_005477chr1532410 1812 808 ------
NM_005477chr1532410 1812 808 ------
NM_005479chr1031457 1331 1074 ------
NM_005488chr222706 79 ------
NM_005497chr17105721 5556 5380 5214 4776 4475 4310 2450 873 94 13834 1955 11367
NM_005499chr19------1545
NM_005502chr92711 659 1796 ----
NM_005504chr1246500 6327 4354 1295 1202 ----
NM_005505chr124828 674 346 34 ------
NM_005506chr422300 2269 22519 1040 ----
NM_005512chr1191931 1879 1844 1710 1698 1629 1317 643 103 --1682 1357
NM_005517chr121053 35 ------
NM_005520chr52668 148 ------
NM_005523chr781564 1447 1438 1019 1008 426 249 151 ------
NM_005530chr1531389 1139 1127 1231 ----
NM_005539chr1011299 --11418 --
NM_005540chr1--1100 ----
NM_005562chr111507 --11205 --
NM_005563chr12790 266 ------
NM_005576chr151275 ------
NM_005578chr333881 3177 316 14750 ----
NM_005587chr152955 267 ------
NM_005596chr922133 502 14935 12321 --
NM_005598chr151658 1543 1387 512 419 1663 ----
NM_005599chr131516 210 159 ------
NM_005603chr181460 --1349 --
NM_005627chr61327 ------
NM_005638chrX21723 1199 ------
NM_005639chr121576 ------
NM_005647chrX32138 993 253 --1684 --
NM_005665chr164717 3864 3648 1923 813 653 ------
NM_005667chr21377 ------
NM_005668chr52949 815 11692 ----
NM_005678chr15--1771 1397 --
NM_005721chr2172 ------
NM_005722chr23893 704 137 ------
NM_005724chr152549 132 ------
NM_005730chr1233150 2231 631 23003 1247 32654 2267 818 --
NM_005736chr101207 --31590 1240 495 --
NM_005737chr262847 2826 772 718 684 647 ------
NM_005740chr224913 707 594 83 ------
NM_005746chr71695 22243 251 ----
NM_005748chr1242751 2339 601 497 ------
NM_005749chr17----1116 --
NM_005752chr1611204 ------
NM_005766chr1311153 ----178
NM_005776chr142764 247 ------
NM_005779chr523276 2371 1323 ----
NM_005780chr13151 ------
NM_005785chr1241738 1625 285 237 ------
NM_005786chr183233 122 64 1376 ----
NM_005789chr1771732 1692 1679 866 501 59 36 1817 ----
NM_005795chr232749 1073 193 --11899 --
NM_005813chr222533 403 22558 1917 ----
NM_005828chr17104291 3921 3672 3517 3456 3209 1914 730 689 594 --11049 --
NM_005836chr8125 ------
NM_005839chr12880 673 ------
NM_005840chrX57358 6219 5195 1221 158 12718 ----
NM_005842chr131221 ------
NM_005851chr113340 121 28 ------
NM_005852chr1741106 867 403 236 ------
NM_005853chr161607 ------
NM_005863chr1021124 456 --11018 1242
NM_005869chr5----1123 --
NM_005872chr1----1190 --
NM_005880chr1621544 1242 1279 ----
NM_005895chr12104148 3992 3713 3503 2726 2712 1156 1147 1042 373 ------
NM_005898chr1122508 2382 ------
NM_005900chr4--1176 ----
NM_005901chr18118581 8334 7369 6863 6421 6197 5584 2713 2541 1542 1375 25420 5300 13428 --
NM_005902chr1534004 254 34 ----11252
NM_005903chr541896 1549 1383 1006 1938 13954 --
NM_005911chr221279 415 --11453 --
NM_005917chr2--1139 ----
NM_005920chr173475 2768 2635 1039 971 695 583 ------
NM_005933chr112537 287 --22273 495 --
NM_005935chr424417 1927 24841 1669 11807 11984
NM_005937chr1794077 3603 3308 3124 2789 1140 679 151 70 ------
NM_005938chrX61361 1184 1172 963 952 420 --1124 --
NM_005941chr8--11382 ----
NM_005955chr1105568 5239 3967 3773 3725 2001 1003 762 638 457 --12136 --
NM_005962chr1031967 1737 496 ------
NM_005962chr1031967 1737 496 ------
NM_005964chr171318 ------
NM_005966chr22775 628 ------
NM_005967chr123616 474 181 ------
NM_005969chr1141057 771 311 92 --1414 --
NM_005984chr222401 204 --1126 --
NM_005990chr552337 1992 726 714 423 --22648 32 --
NM_005994chr174275 158 143 62 ------
NM_005996chr123963 302 120 ------
NM_006007chr923938 3157 --1556 11149
NM_006010chr31219 ------
NM_006011chr1533944 3049 348 ------
NM_006015chr111013 11347 ----
NM_006022chr132254 178 ------
NM_006030chr341459 1268 1240 402 --1141 --
NM_006034chr1152223 1822 1604 207 35 --12135 11699
NM_006035chr1431223 1103 1064 ------
NM_006037chr274709 3355 1832 1029 797 694 194 ------
NM_006040chr164890 445 385 222 ------
NM_006047chr2011258 --1120 --
NM_006048chr11322 ------
NM_006054chr1121634 455 ------
NM_006079chr61259 ------
NM_006089chrX21813 1348 ------
NM_006090chr11593 ------
NM_006095chr413315 2408 255 189 --
NM_006106chr1152717 2111 1088 876 833 ------
NM_006113chr131911 1459 321 ------
NM_006121chr12162 ------
NM_006133chr11122284 2068 2051 1920 1677 990 898 635 543 462 250 61 ------
NM_006136chr721202 1196 ------
NM_006145chr191251 ------
NM_006147chr12479 434 ------
NM_006148chr1762959 2437 1044 698 438 215 ------
NM_006158chr811791 ------
NM_006160chr1721353 505 ------
NM_006166chr1262286 2209 2123 1942 628 460 ------
NM_006177chr143946 893 102 ------
NM_006185chr114448 203 162 56 --1155 --
NM_006186chr2----1362 --
NM_006191chr121183 --1317 --
NM_006195chr9--1135 ----
NM_006203chr545300 4992 1801 1446 ----25512 244
NM_006206chr41100 ------
NM_006211chr81122 ------
NM_006224chr1722069 2023 --1189 --
NM_006237chr1332119 1799 877 22294 1897 1885 --
NM_006238chr641316 575 547 101 --21952 1698 --
NM_006241chr322000 1725 ------
NM_006243chr12950 864 ------
NM_006245chr611008 ------
NM_006246chr141956 ------
NM_006251chr523086 472 ----13080
NM_006256chr141848 925 890 407 ------
NM_006257chr10170 --1422 --
NM_006265chr82990 620 --11473 --
NM_006266chr9121 ------
NM_006267chr2----1723 --
NM_006277chr21565 ------
NM_006279chr12849 127 ------
NM_006293chr154957 243 199 42 --1408 --
NM_006306chrX84027 3719 2240 1040 838 605 170 29 11157 15066 11201
NM_006310chr171369 ------
NM_006315chr444128 3882 3054 3046 ------
NM_006321chr341930 1831 902 687 ------
NM_006330chr811491 ------
NM_006335chr11846 --2837 337 --
NM_006336chr961495 1394 1181 1052 546 396 ------
NM_006338chr13524 119 68 ------
NM_006345chr411388 1447 ----
NM_006352chr12626 547 ------
NM_006362chr11188 --161 --
NM_006367chr11762 ------
NM_006371chr384647 3745 3636 3337 1983 1670 1664 842 ------
NM_006372chr61135 ------
NM_006373chr172469 206 ------
NM_006375chrX--1322 11160 --
NM_006380chr1743888 3598 1471 219 --12971 --
NM_006386chr2222296 213 ------
NM_006390chr1241807 1447 526 457 ------
NM_006393chr1033196 227 218 11155 1509 --
NM_006401chr9--1184 ----
NM_006403chr61445 --166 --
NM_006430chr22416 69 --1114 --
NM_006454chr462740 2593 1882 796 247 141 1644 12996 --
NM_006457chr432934 779 613 --11391 --
NM_006458chr113297 66 21 ------
NM_006460chr171635 ------
NM_006474chr161980 1419 728 521 487 112 11325 ----
NM_006480chr51461 ------
NM_006482chr1253648 3477 3222 2579 1051 13445 ----
NM_006496chr111933 1523 ----
NM_006500chr1131190 873 33 ------
NM_006516chr141427 619 476 114 ------
NM_006526chr20131 ------
NM_006532chr191144 ------
NM_006534chr2031143 787 404 12643 ----
NM_006538chr263122 1159 1130 1003 760 81 13036 13752 --
NM_006546chr1796387 6242 5295 5255 4163 4048 2368 2136 1104 --11896 --
NM_006547chr711810 12016 ----
NM_006549chr1252638 2555 1932 661 127 1772 21938 1847 --
NM_006557chr92643 130 ------
NM_006561chr1035936 5094 1986 ------
NM_006565chr161455 ------
NM_006566chr181362 ----1453
NM_006591chr1151776 1664 1593 346 153 ------
NM_006595chr1111577 ------
NM_006599chr1647716 6456 5618 1410 15930 17594 --
NM_006601chr121906 ------
NM_006609chr232462 2055 142 12221 ----
NM_006614chr333556 2681 350 --1402 --
NM_006618chr131431 1312 1200 1532 ----
NM_006621chr111928 ------
NM_006624chr10----11927 --
NM_006629chr1832140 499 188 12394 ----
NM_006634chr2268 51 ------
NM_006636chr21858 ----11038
NM_006646chr1332710 1004 883 --1356 1547
NM_006650chr5103840 3735 3159 2893 2696 2607 2510 1046 563 443 --13602 --
NM_006651chr441124 511 420 235 ------
NM_006654chr1211868 ------
NM_006690chr2072293 1997 760 532 428 202 30 ------
NM_006691chr113248 201 115 ------
NM_006693chr74818 772 529 311 ------
NM_006695chr172307 76 ------
NM_006696chr5161 ------
NM_006698chr2041416 429 306 294 ------
NM_006699chr162124 969 852 748 638 307 12249 ----
NM_006700chr121306 ------
NM_006705chr92134 21 1348 ----
NM_006706chr51285 ------
NM_006717chr91756 12423 --11336
NM_006722chr322753 2723 --1604 12936
NM_006729chrX45161 4853 4103 1496 14521 ----
NM_006732chr1922130 1548 ------
NM_006734chr611058 --11035 1216
NM_006736chr291773 1658 1523 1430 1273 588 516 468 201 1320 ----
NM_006738chr1553576 1507 969 795 519 --44280 3856 1581 493 --
NM_006748chr861155 645 449 249 189 59 1508 ----
NM_006749chr8--11266 143 --
NM_006763chr141813 1305 487 190 ------
NM_006772chr61531 ------
NM_006775chr642520 2460 2059 1066 ------
NM_006788chr1862082 1993 1409 861 621 21 1440 2774 535 --
NM_006804chr173428 215 139 ------
NM_006805chr541607 1319 277 21 --11419 --
NM_006811chr20--11006 1630 --
NM_006815chr12156 ------
NM_006822chr17--1250 ----
NM_006826chr231271 1179 190 1287 ----
NM_006827chr1453314 2642 504 366 66 ------
NM_006832chr141921 1429 ----
NM_006836chr123513 426 90 ------
NM_006852chr1752609 1857 1780 993 815 12111 1701 --
NM_006854chr711816 --11691 --
NM_006856chr12------1826
NM_006857chr22821 44 ------
NM_006875chrX4891 622 89 21 ------
NM_006885chr1624026 277 ----12794
NM_006889chr321007 451 ------
NM_006898chr21590 1276 --1784
NM_006922chr212371 ------
NM_006924chr1744170 4141 3938 274 23051 2913 ----
NM_006925chr141335 186 ----
NM_006927chr1632026 1850 154 ----12233
NM_006931chr1262147 1950 1784 1588 488 262 ------
NM_006940chr1231565 1254 171 ------
NM_006941chr221145 --182 --
NM_006950chrX3887 789 291 ------
NM_006951chr101132 ------
NM_006991chr31395 --1149 --
NM_006996chr14625 542 372 55 11772 1378 --
NM_006999chr541951 1853 759 414 --11416 --
NM_007006chr1622860 569 13445 ----
NM_007011chr15136479 5635 5469 5300 4281 4224 2307 1534 1099 685 673 468 273 15144 12289 --
NM_007014chr1631346 631 199 ------
NM_007017chr51738 ------
NM_007030chr575124 4670 1759 1690 785 708 569 ------
NM_007033chr142065 1936 1428 568 ------
NM_007038chr2155287 4664 4495 3816 428 21133 407 --14482
NM_007039chr141219 ------
NM_007046chr21374 ------
NM_007047chr652393 2106 949 634 427 --136 --
NM_007050chr2096722 6453 5024 2151 1338 1247 796 626 515 25305 2889 16409 --
NM_007052chrX163 1127 ----
NM_007054chr562932 2629 1421 1255 692 51 --12945 --
NM_007064chr331313 1264 427 --11105 --
NM_007067chr1741288 1164 374 212 ------
NM_007073chr694198 3799 3768 3719 3476 3460 3362 1521 1164 ------
NM_007084chr131960 ----11109
NM_007106chr1311808 11954 12383 --
NM_007107chr311743 12013 ----
NM_007111chr132727 718 ------
NM_007146chr1752754 2655 2644 2142 2039 ------
NM_007153chr1953206 3090 1778 762 740 13268 ----
NM_007157chrX22943 2814 ------
NM_007158chr13950 213 56 --1912 --
NM_007159chr3--1295 ----
NM_007166chr1121383 353 ------
NM_007174chr1221900 1820 ------
NM_007175chr822770 976 ------
NM_007187chr13----1901 --
NM_007189chr771356 1214 1116 1083 461 429 228 ------
NM_007200chr1553576 1507 969 795 519 --44280 3856 1581 493 --
NM_007202chr172711 61 ------
NM_007203chr943888 1218 883 36 12527 1246 --
NM_007207chr14936 840 755 69 ------
NM_007212chr141681 1626 692 647 ------
NM_007216chr113758 447 389 ------
NM_007222chr821822 1273 ------
NM_007246chr42793 704 ------
NM_007249chr13108483 6892 3381 2798 2736 2464 1831 1118 730 210 --22519 1169 --
NM_007275chr331137 341 305 --1317 --
NM_007283chr382639 2584 2263 1153 1091 1085 335 32 --1432 --
NM_007287chr322555 2312 1709 ----
NM_007288chr322555 2312 1709 ----
NM_007289chr322555 2312 1709 ----
NM_007313chr9--11793 ----
NM_007320chr191134 ------
NM_007349chr7155 ------
NM_007358chr121573 74 ------
NM_007375chr122009 864 ------
NM_012064chr122878 807 ------
NM_012081chr543267 2386 1152 186 ----13375
NM_012083chr105979 524 435 342 97 ------
NM_012093chr13474 360 171 ------
NM_012095chr1043251 3085 2930 1321 1605 ----
NM_012098chr941448 1269 587 52 ------
NM_012099chr1941253 1027 228 120 ------
NM_012102chr132094 804 731 --1744 --
NM_012104chr1173752 3514 3484 1352 1151 1002 240 ------
NM_012104chr1173752 3514 3484 1352 1151 1002 240 ------
NM_012110chr4173 --162 --
NM_012156chr2062463 2382 1334 773 416 30 11286 11305 --
NM_012168chr12224 34 ------
NM_012193chr1194392 4221 3836 3436 1317 1250 1180 959 279 13339 ----
NM_012199chr1114418 4306 4041 3529 3317 3291 2945 2856 1835 1642 1110 --11758 1346
NM_012207chr102947 43 ------
NM_012210chr931054 610 62 ------
NM_012214chr2114378 4317 4276 4025 2282 2244 2183 2162 1721 1587 1512 14544 --12080
NM_012215chr1031886 1838 379 --11808 --
NM_012218chr19122908 2732 2051 1164 934 843 794 712 645 553 474 238 --12445 --
NM_012232chr1782201 2173 2117 1972 1421 839 249 201 --1759 --
NM_012234chr3--12824 ----
NM_012249chr243531 3521 2959 325 ------
NM_012250chr1111061 --11055 --
NM_012252chr71312 ------
NM_012272chr122325 165 --192 --
NM_012279chr521332 472 --11931 --
NM_012285chr172443 28 --1113 --
NM_012287chr32119 34 ------
NM_012288chr6104254 3731 3533 1609 1446 1073 540 482 464 33 11701 25691 3780 --
NM_012301chr741820 651 161 122 11860 ----
NM_012308chr1122563 981 11738 2601 378 --
NM_012309chr1143913 3884 3619 1628 1125 ----
NM_012316chr1185365 5178 4865 4699 4521 4300 3889 3619 2177 2151 2108 1664 1324 1005 656 625 544 66 --21438 1305 13710
NM_012324chr221283 --1766 --
NM_012325chr2041612 1378 665 482 ------
NM_012326chr22740 146 --1718 --
NM_012329chr1711359 ------
NM_012333chr11338 ------
NM_012384chr202585 325 ----12454
NM_012395chr72888 792 12800 ----
NM_012402chr1131392 174 107 ------
NM_012405chr122788 49 --1631 --
NM_012407chr223189 108 53 ------
NM_012416chr91199 1457 ----
NM_012428chr15169 ------
NM_012458chr193844 304 175 ------
NM_012461chr143707 246 95 ------
NM_012473chr223287 97 21 ------
NM_012478chr174747 352 241 74 ------
NM_012479chr71232 --12517 --
NM_012482chr11704 ----1669
NM_013229chr1222492 862 12799 ----
NM_013230chrY21430 67 ------
NM_013231chr1474268 3788 3776 2931 1370 704 371 ----23339 2979
NM_013240chr2154103 3673 3253 1469 956 --11356 --
NM_013253chr111200 --1194 --
NM_013261chr432812 614 281 --1345 --
NM_013269chr1234079 3721 420 --24339 1560 --
NM_013272chr151340 ------
NM_013279chr1141831 870 667 625 --2943 712 22231 533
NM_013286chr363709 2401 986 810 471 344 33216 2581 1527 13227 11470
NM_013304chr16151 ------
NM_013305chr184733 651 209 58 ------
NM_013333chr193409 361 22 ------
NM_013341chr242403 2353 487 427 --1838 --
NM_013351chr173703 519 248 ------
NM_013354chr82531 67 ------
NM_013357chr81821 ------
NM_013365chr222215 55 --1118 --
NM_013368chr19151 --1169 --
NM_013372chr1522879 2590 11317 1316 --
NM_013374chr353055 2406 2083 859 87 32990 827 539 --12365
NM_013376chr192260 108 --1223 128
NM_013381chr121591 ------
NM_013382chr1471847 1664 1500 845 722 621 25 1405 ----
NM_013388chr23157 65 31 ----1449
NM_013390chr971742 1562 1232 550 454 429 153 --11696 --
NM_013396chr212503 329 ------
NM_013399chr1671773 1388 1273 1154 492 452 39 1689 2641 254 --
NM_013401chr113820 185 87 ------
NM_013411chr141979 1856 427 244 --11119 --
NM_013423chrX------1296
NM_013427chrX------1296
NM_013433chr193693 243 91 11637 11768 --
NM_013436chr22176 46 ------
NM_013442chr9128 ------
NM_013446chr741322 1210 926 459 ------
NM_013447chr1933219 2625 250 32416 2357 1406 ----
NM_013450chr2--1876 ----
NM_013943chr1--12730 ----
NM_013952chr242592 852 644 127 --22071 539 --
NM_013953chr242592 852 644 127 --22071 539 --
NM_013992chr242592 852 644 127 --22071 539 --
NM_013995chrX22471 1783 ----11587
NM_014001chr1771294 1104 1040 562 512 296 68 ------
NM_014016chr33592 572 26 ------
NM_014021chr143400 3041 2755 218 ------
NM_014023chr1042155 1974 1945 957 --11167 --
NM_014039chr112893 192 ------
NM_014106chr152727 34 ------
NM_014112chr835441 4910 4732 --1585 --
NM_014117chr1631956 559 479 ------
NM_014153chr162619 171 ------
NM_014155chr1197132 6967 5341 2868 1858 1805 1406 1026 158 15681 1322 --
NM_014157chr1683436 2800 1519 1411 1222 872 397 176 --1100 --
NM_014181chr222220 60 ------
NM_014191chr121223 ------
NM_014216chr1441488 1437 611 286 --21052 536 --
NM_014231chr1241778 1533 649 526 --1457 --
NM_014232chr1721507 552 ------
NM_014232chr1721507 552 ------
NM_014233chr1771697 1676 1607 555 516 398 266 --11510 --
NM_014238chr1761425 1143 629 531 457 260 ------
NM_014240chr353477 3420 2796 2699 754 --12973 --
NM_014253chrX1968 1929 ----
NM_014263chr1031068 966 576 --11275 --
NM_014268chr1821359 345 --21071 155 --
NM_014275chr54591 137 127 115 --1846 --
NM_014283chr11167 ------
NM_014284chr16875 791 777 745 311 221 ------
NM_014286chr983358 3220 2731 2493 2441 2333 424 25 --2710 519 --
NM_014292chr2231241 656 28 ------
NM_014309chr2284364 4035 1684 1602 509 489 409 42 11026 --14379
NM_014323chr221309 1223 1920 --
NM_014325chr1241517 1451 626 52 ------
NM_014333chr112969 135 ------
NM_014361chr11------142
NM_014368chr941985 1488 467 155 --1541 --
NM_014392chr421357 1200 1633 ----
NM_014397chr921237 555 181 ----
NM_014415chr32151 90 ------
NM_014417chr192832 173 ------
NM_014423chr513864 ------
NM_014452chr62990 984 ------
NM_014454chr62887 402 ------
NM_014458chr111043 11123 1929 --
NM_014470chr122312 129 ------
NM_014480chr192821 633 ------
NM_014488chr111207 ------
NM_014554chr1242215 1946 348 335 11848 11840 --
NM_014573chr1711257 --11441 --
NM_014574chr1421131 37 --1107 --
NM_014577chr222668 171 ------
NM_014584chr14--11659 --11636
NM_014586chr21104514 4312 3894 3478 3202 1898 1657 1403 1109 290 ------
NM_014588chr201233 ------
NM_014604chr174285 227 171 135 ------
NM_014616chr323371 846 --1247 --
NM_014630chr1542929 2461 942 243 --23225 497 --
NM_014646chr183491 232 218 --2876 32 --
NM_014647chr1621895 1712 ------
NM_014659chr153243 75 41 ------
NM_014663chr12990 449 --1806 --
NM_014665chr873682 2333 1112 538 293 284 76 --12751 --
NM_014667chr322230 2185 ----1173
NM_014670chr231336 628 71 11166 ----
NM_014676chr121620 413 --11208 --
NM_014678chr224635 600 67 33 ------
NM_014682chr81877 ------
NM_014683chr1722117 263 ------
NM_014686chr1932402 1693 234 ------
NM_014690chr763077 2872 2464 2441 2056 197 --1236 --
NM_014705chr721952 528 ------
NM_014709chr22488 147 ------
NM_014717chr19--2862 713 ----
NM_014719chr721125 1009 ------
NM_014726chr1761358 430 346 340 222 158 ------
NM_014729chr8--1805 11725 --
NM_014730chr12135149 4975 4772 4315 3458 3336 1978 1958 1594 1478 1355 1066 182 ----11163
NM_014730chr12135149 4975 4772 4315 3458 3336 1978 1958 1594 1478 1355 1066 182 ----11163
NM_014731chr2051313 1187 612 462 353 --1618 --
NM_014736chr151993 147 ----
NM_014739chr6------14178
NM_014741chr1161951 1448 1325 776 650 344 11783 ----
NM_014743chr431119 840 490 ------
NM_014747chr1185061 4994 4736 4717 4701 4621 4559 4469 3787 1160 1127 947 853 748 434 394 241 224 11537 44985 4233 1315 384 --
NM_014748chr21369 ------
NM_014751chr8--21872 680 ----
NM_014755chr221443 1352 1231 ----
NM_014757chr541991 232 141 100 12335 1682 --
NM_014759chr861453 1445 1081 515 385 272 1172 1196 --
NM_014762chr1102598 2541 2150 2089 1711 899 780 680 649 67 ------
NM_014765chr112717 22512 57 ----
NM_014772chr1893527 3341 2241 1317 998 389 251 141 47 --12883 --
NM_014782chrX1257 ------
NM_014784chr1----1165 --
NM_014786chr112446 299 ------
NM_014800chr71410 ------
NM_014807chr112829 85 --2702 293 --
NM_014810chr131486 743 395 22263 163 13524 --
NM_014812chr1----195 --
NM_014819chr531773 780 482 12073 --1712
NM_014820chr321450 569 ------
NM_014822chr4156 1506 ----
NM_014824chr1121332 47 ----1145
NM_014826chr111202 --24113 3745 --
NM_014828chr1452497 2396 1933 743 252 188 ----
NM_014829chr5--1144 ----
NM_014830chr1251418 1268 922 868 706 32891 2732 105 ----
NM_014832chr1311743 --1658 --
NM_014840chr1232733 753 441 ------
NM_014841chr621167 1110 ------
NM_014849chr151033 828 802 414 371 ------
NM_014850chr363971 3632 3382 1089 118 64 ------
NM_014864chr144109 3024 2856 108 14324 ----
NM_014868chr122819 33 ----1735
NM_014871chr121522 ------
NM_014872chr962299 2273 1879 1856 1616 672 ------
NM_014873chr154766 3964 3782 2998 1359 33318 2965 599 ----
NM_014876chr2252070 1778 1549 662 390 ------
NM_014877chr1786954 6830 6623 6195 5696 5684 5510 5309 ------
NM_014888chr721597 106 ------
NM_014891chr781540 1491 1324 1127 493 418 298 128 11594 11379 1333
NM_014897chr1743266 2502 2163 936 1866 1360 --
NM_014901chr51668 --21465 561 --
NM_014902chr2011472 ------
NM_014903chr1222344 1537 ------
NM_014904chr1023450 701 --21049 993 --
NM_014906chr1732567 1393 386 ------
NM_014912chr1023297 2886 --13511 1254
NM_014921chr1982970 2733 2684 1046 839 809 628 65 12160 ----
NM_014926chr3--11142 1854 --
NM_014932chr3----1639 --
NM_014934chr1343073 2710 1562 1014 --21567 487 --
NM_014938chr1242172 1812 458 329 --11582 --
NM_014939chr1811037 ------
NM_014943chr831130 1104 138 ------
NM_014944chr121473 284 --31144 184 145 --
NM_014946chr221186 271 --13046 --
NM_014947chr172577 2287 1205 1118 1070 761 670 ------
NM_014951chr101530 --1851 --
NM_014952chr15101978 1661 1579 1552 1278 706 528 458 220 81 --11285 --
NM_014961chr42719 605 ------
NM_014964chr1762079 1752 1653 730 328 195 --11667 --
NM_014969chr11325 ------
NM_014978chr1011777 ------
NM_014991chr443134 2757 2089 67 --11327 --
NM_014992chr141194 ------
NM_014994chr1531670 263 91 ------
NM_015000chr12163 ------
NM_015001chr11636 ------
NM_015008chr342889 2861 2836 402 12978 13624 --
NM_015023chr121737 1377 ----11476
NM_015025chr21569 ------
NM_015026chr1224198 908 --1380 --
NM_015035chr20166278 6139 5781 5739 5520 5202 5012 4808 4577 4544 2510 2282 2086 1166 523 37 12421 25632 4413 --
NM_015037chr101205 1231 ----
NM_015039chr1124086 3527 3221 1661 1591 1562 1397 1358 953 387 348 309 ------
NM_015042chr15104003 3932 3801 3309 2768 970 926 871 650 352 11193 ----
NM_015044chr1663076 2397 1278 764 467 232 13207 1423 12695
NM_015049chr233029 2081 511 1352 175 --
NM_015050chr621074 213 ------
NM_015051chr932156 2094 1131 ------
NM_015053chr172332 2139 1732 476 458 424 256 2807 225 1331 --
NM_015063chr193363 351 75 ------
NM_015064chr1273648 3598 3488 2585 974 628 194 --12812 --
NM_015068chr743162 2423 1178 310 2982 841 21593 1486 --
NM_015069chr161471 ------
NM_015071chr555726 4683 4210 4011 151 12104 ----
NM_015075chrX62173 1704 1524 1464 1439 248 ------
NM_015076chr654533 3611 2894 1585 307 ------
NM_015080chr11186 --1645 --
NM_015090chr1105167 4323 2332 2112 2074 2004 1764 717 648 255 --1898 --
NM_015092chr1654349 4021 1768 1129 488 --126 --
NM_015093chr621232 227 ------
NM_015094chr22123791 3241 3139 3133 3026 1408 962 819 691 445 324 302 11649 13306 --
NM_015100chr111658 --11529 --
NM_015107chrX31621 958 790 ------
NM_015110chr922325 208 --11582 --
NM_015113chr1771756 1557 1538 1526 1497 447 311 --11544 --
NM_015115chr422869 2775 ------
NM_015120chr2----181 --
NM_015132chr731730 1438 518 11422 ----
NM_015138chr1562549 2502 2150 2075 1014 229 11800 ----
NM_015144chr161372 --21210 198 --
NM_015149chr132110 1863 369 --11906 --
NM_015150chr33304 115 87 ------
NM_015155chr1052885 2305 2212 863 635 ------
NM_015156chr1442962 1075 828 26 ------
NM_015161chr1611103 11162 ----
NM_015170chr81219 --1105 --
NM_015171chr16191 ------
NM_015176chr12470 423 ------
NM_015200chr432184 1023 295 ------
NM_015206chr1553753 2684 2531 2514 850 12393 ----
NM_015208chr1824059 4009 11311 ----
NM_015215chr142729 2087 1946 919 ------
NM_015216chr511080 ------
NM_015229chr1751035 984 888 869 152 ------
NM_015231chr113598 213 200 --135 --
NM_015239chr9150 ------
NM_015247chr1635030 3304 619 --11479 --
NM_015250chr922040 748 --21446 468 --
NM_015263chr151987 ------
NM_015268chr32234 98 ------
NM_015270chr1242080 712 361 145 --11908 --
NM_015271chr4--22725 2631 ----
NM_015282chr212520 2986 337 ----
NM_015285chr1821611 531 --1304 --
NM_015288chr531514 1407 35 --1888 --
NM_015299chr14113830 3691 3682 3542 3275 2993 989 972 667 574 533 ------
NM_015310chr897822 7204 6607 6290 2994 2888 2596 1152 964 166 ----
NM_015313chr1144770 4707 3985 3908 1880 ----
NM_015315chr593068 2949 2843 1376 1015 1009 480 376 105 --12121 --
NM_015317chr232854 2089 1118 ----1388
NM_015326chr162913 2559 2308 635 545 80 2293 168 ----
NM_015327chr131274 451 221 ------
NM_015328chr752599 2351 2275 640 412 ------
NM_015335chr1232019 1784 580 ------
NM_015338chr2041904 657 567 173 ------
NM_015346chr1431405 1172 222 ------
NM_015347chr1222184 185 ------
NM_015361chr2------166
NM_015365chrX23974 71 ------
NM_015374chr2251303 1271 1037 387 336 --11296 --
NM_015375chr1114685 4370 3486 3432 3123 1988 1796 1536 945 778 620 11496 23362 492 24206 4018
NM_015393chr43941 533 505 1176 23292 1316 --
NM_015407chr34175 48 39 28 ------
NM_015443chr174953 482 447 354 --2990 259 --
NM_015455chr523666 291 --11563 --
NM_015470chr251249 1209 1181 1073 795 ------
NM_015472chr31400 --1156 --
NM_015472chr31400 --1156 --
NM_015475chr22959 121 ------
NM_015477chr152632 156 --11035 --
NM_015481chr121994 ------
NM_015484chr12717 193 ------
NM_015488chr251532 1313 712 648 501 ------
NM_015503chr162589 51 --1244 --
NM_015508chr32499 336 11247 --1344
NM_015513chr3154 --189 --
NM_015514chr141423 ------
NM_015523chr11279 50 1222 ----
NM_015530chr2156 ------
NM_015534chr13324 219 200 ------
NM_015535chr232637 1472 431 --12772 --
NM_015537chr951118 852 845 273 108 ------
NM_015541chr32370 75 ------
NM_015559chr18--21071 752 ----
NM_015564chr522822 567 --12272 --
NM_015568chr2063950 3433 1589 1471 239 31 1297 11268 --
NM_015575chr261364 1192 1179 978 965 755 ------
NM_015577chr531754 1449 1432 --21525 266 --
NM_015602chr121827 653 ------
NM_015605chr1041179 302 203 147 ------
NM_015609chr142804 2370 807 772 22764 1166 12563 --
NM_015627chr151780 1472 1170 742 608 ------
NM_015640chr165302 4220 3993 3776 944 25 11985 14933 --
NM_015642chr3------1250
NM_015651chr972043 1975 1918 1502 855 757 122 ------
NM_015680chr22584 194 --1233 --
NM_015686chrX31960 1678 1623 --11858 --
NM_015691chrX32711 2245 727 --1186 --
NM_015719chr192784 234 ------
NM_015726chr121486 52 ------
NM_015840chr132578 2102 193 ----11761
NM_015841chr132578 2102 193 ----11761
NM_015844chr182295 137 --1375 --
NM_015845chr18173 --1153 --
NM_015846chr182295 137 --1375 --
NM_015847chr182295 137 --1375 --
NM_015850chr851871 1534 731 401 291 ----1545
NM_015872chr151365 1113 454 357 92 ------
NM_015878chr8----152 --
NM_015879chr1848467 7845 3187 1444 36753 6708 6495 11711 --
NM_015881chr111200 --1194 --
NM_015885chr111107 ------
NM_015886chr855403 4346 4264 4003 964 ------
NM_015888chr133017 2507 1195 ------
NM_015892chr103404 330 271 ------
NM_015906chr133993 1806 1402 1341 ----
NM_015912chr852137 2031 1801 1741 1708 ------
NM_015916chr10141 ------
NM_015932chr13----1562 --
NM_015948chr61432 ------
NM_015976chr1----1242 --
NM_015980chr51615 1200 ----
NM_015981chr563182 2692 2334 2256 1935 643 --12515 --
NM_015995chr15135425 5132 5024 4187 3983 2121 2046 1731 1289 912 883 541 399 --24501 383 14142
NM_016009chr133443 1305 522 11528 ----
NM_016018chr822743 2190 12649 2895 105 --
NM_016022chr13779 421 186 ------
NM_016032chrX21358 325 ------
NM_016072chr1222081 1532 ------
NM_016076chr142708 2491 2386 565 1756 ----
NM_016083chr642515 1046 994 81 13075 ----
NM_016131chr22620 556 12330 ----
NM_016147chr1121129 923 ------
NM_016172chr92318 45 ------
NM_016185chr172645 624 ------
NM_016192chr2141 ------
NM_016200chr7----1200 --
NM_016206chr368890 7234 7119 2744 2687 2416 ------
NM_016219chr94506 455 406 188 ------
NM_016223chr113313 249 40 ------
NM_016227chr11167 ------
NM_016231chr1731683 1330 55 ------
NM_016248chr1313756 ------
NM_016250chr144712 705 691 618 ------
NM_016256chr16155 ------
NM_016264chr192369 195 ------
NM_016272chr2232598 2198 1843 ------
NM_016277chr621426 176 ----1551
NM_016281chr1211006 ------
NM_016287chr121786 453 ------
NM_016291chr32164 106 ------
NM_016306chr3----1239 --
NM_016308chr121534 647 ------
NM_016315chr221845 1245 ------
NM_016322chr923254 858 ------
NM_016374chr11217 1547 --1234
NM_016374chr11217 1547 --1234
NM_016396chr1511191 11074 ----
NM_016427chr181108 ------
NM_016431chr221283 --1766 --
NM_016441chr21348 1367 ----
NM_016453chr32185 61 1240 ----
NM_016472chr1421231 417 ------
NM_016485chr651734 1684 760 751 101 ----12203
NM_016486chr1281 57 ------
NM_016488chr1221926 1483 21713 1360 ----
NM_016507chr1732151 1050 527 ------
NM_016522chr1131557 1459 271 ------
NM_016525chr92861 327 --1632 --
NM_016530chr1521637 633 42947 1509 1078 481 1452 --
NM_016531chr423965 3237 --12899 --
NM_016542chrX21562 638 ------
NM_016545chr11675 ------
NM_016569chr123963 302 120 ------
NM_016577chr353477 3290 1451 912 498 --14236 13265
NM_016578chr11--1235 ----
NM_016598chr361356 607 378 369 280 259 ------
NM_016603chr532218 788 125 11595 ----
NM_016605chr542135 2054 1902 91 ------
NM_016620chr111181 ------
NM_016621chr1173971 3639 3553 3294 1839 1735 1566 34499 3350 1051 23598 730 --
NM_016626chr181694 ------
NM_016639chr161146 --1182 --
NM_016821chr3286 39 ------
NM_016824chr1021602 1548 ------
NM_016950chr41328 ------
NM_016952chr1133807 720 62 --13107 --
NM_017409chr121729 --167 --
NM_017412chr8--1371 --1258
NM_017413chrX42466 1740 883 569 ------
NM_017415chr594429 3890 1574 1547 1033 779 513 94 73 --11363 13411
NM_017423chr41411 ------
NM_017447chr2134379 4217 1426 ------
NM_017449chr13497 312 71 ------
NM_017455chr15169 ------
NM_017456chr1761715 1366 629 582 564 332 1299 21769 619 --
NM_017482chr221573 247 ----1313
NM_017488chr2------11516
NM_017544chrX1713 ----1812
NM_017546chr21788 --190 --
NM_017548chr321461 1437 11831 1871 --
NM_017549chr751486 1224 1163 997 526 ------
NM_017551chr1042242 2166 865 562 --11720 --
NM_017582chr141698 1434 691 622 ------
NM_017590chr2252267 892 353 271 252 ------
NM_017594chr921269 479 ------
NM_017596chr1184211 4175 4161 4006 3981 3801 3786 3715 3645 3371 3128 1801 1705 1506 943 622 261 143 --14023 --
NM_017599chr121135 11551 ----
NM_017607chr191488 ------
NM_017610chr151631 151 ----
NM_017626chr1031681 1553 630 11688 1718 --
NM_017633chr643061 2558 2400 133 --12899 --
NM_017634chr831287 341 272 ------
NM_017637chr958729 8326 3024 1097 364 --1940 --
NM_017643chr17--22933 2131 ----
NM_017644chr334625 3517 982 --13971 --
NM_017650chr754339 4273 1364 521 350 25051 2021 25882 1912 --
NM_017664chr131674 144 --1360
NM_017670chr113730 604 193 ------
NM_017672chr15--11162 ----
NM_017679chr174614 469 436 70 ------
NM_017681chrX----1846 --
NM_017686chr1126 1125 1993 --
NM_017693chr1321371 550 ------
NM_017699chr351805 1300 1249 404 42 ------
NM_017709chr184198 4040 3915 3903 2834 1531 1229 619 23408 1324 ----
NM_017730chr33291 278 271 ------
NM_017737chr11765 ------
NM_017741chr452801 2321 2155 1924 425 ------
NM_017742chr1831453 195 187 ------
NM_017744chr141602 1528 836 725 ------
NM_017745chrX1711 ------
NM_017758chr174977 573 452 143 1206 ----
NM_017778chr81997 11006 1140 --
NM_017780chr81169 1286 ----
NM_017786chr81191 1113 ----
NM_017787chr1072240 2147 1783 1111 680 365 109 --12561 --
NM_017789chr23551 175 105 ------
NM_017798chr2011050 1833 168 --
NM_017799chr1441853 1578 1278 57 ------
NM_017811chr91766 12400 12104 --
NM_017813chr825630 4461 --21477 1182 --
NM_017848chrX43697 3674 1688 205 --13217 --
NM_017849chr272769 2570 2493 1277 1013 678 554 ------
NM_017902chr1095745 5608 4894 4796 4744 4609 4331 3616 1607 14225 ----
NM_017905chr132464 268 ------
NM_017921chr1792314 2224 2202 2105 2003 1927 1640 923 427 --31482 506 451 --
NM_017938chrX2515 392 ------
NM_017943chr14----11038 --
NM_017987chr101550 ------
NM_017988chr122332 81 ------
NM_017994chr772455 2447 2309 2027 744 75 69 ------
NM_018010chr321598 253 ------
NM_018014chr211183 ------
NM_018027chr1032773 2418 357 ----12567
NM_018030chr18177 ------
NM_018046chr541790 1578 1568 1508 ------
NM_018067chr14534 463 103 66 ------
NM_018078chr42240 126 ------
NM_018086chr221781 356 ------
NM_018098chr3193 ------
NM_018103chr11256 ------
NM_018121chr102455 387 22085 806 ----
NM_018128chr1741234 1224 1064 996 --11139 --
NM_018151chr22788 326 ------
NM_018159chrX41354 421 177 119 ------
NM_018171chr12------1828
NM_018195chr1121866 469 1197 11396 --
NM_018198chr161389 1273 1085 1038 345 224 ------
NM_018206chr16--1190 ----
NM_018211chr122017 1676 11437 ----
NM_018222chr1121674 473 ------
NM_018227chr412588 12428 ----
NM_018241chr4173 152 ----
NM_018245chr101161 ------
NM_018299chr812743 13347 ----
NM_018313chr342568 1898 355 337 ------
NM_018315chr41129 ------
NM_018320chr111110 --1434 --
NM_018327chr201167 --11353 --
NM_018362chr1133795 3643 3548 ------
NM_018364chr143901 1279 675 553 1478 ----
NM_018374chr734946 4698 882 ------
NM_018388chrX21309 359 ------
NM_018403chr353002 2523 2506 903 682 ------
NM_018416chr1222526 2181 ------
NM_018424chr931728 414 341 11581 ----
NM_018425chr1062007 1871 1855 881 242 53 --11060 --
NM_018440chr867797 7001 6394 6225 500 43 15558 22021 1615 --
NM_018442chr11285 ------
NM_018444chr851954 1943 1673 852 354 --1184 --
NM_018469chr1741365 601 464 191 ------
NM_018490chr11--11733 1107 --
NM_018534chr22396 185 ------
NM_018553chr1741645 1386 1360 696 ------
NM_018566chr134032 3654 1615 ------
NM_018584chr111006 1139 ----
NM_018644chr1162188 1990 1826 869 654 585 ------
NM_018660chr892913 2738 2607 2396 1197 1162 819 596 502 ------
NM_018667chr1641779 1000 761 89 ------
NM_018689chr1551976 1718 377 162 108 12451 ----
NM_018695chr511499 ------
NM_018697chr731460 239 123 ------
NM_018710chr81102 151 ----
NM_018711chr12145 ----1284
NM_018712chr1141165 1027 438 140 ------
NM_018715chr122129 636 --22243 780 --
NM_018717chr441099 880 746 315 --11811 --
NM_018841chr153644 3488 3336 800 122 1222 ----
NM_018898chr51389 --1193 --
NM_018899chr51389 --1193 --
NM_018900chr51389 --1193 --
NM_018901chr51389 --1193 --
NM_018902chr51389 --1193 --
NM_018903chr51389 --1193 --
NM_018904chr51389 --1193 --
NM_018905chr51389 --1193 --
NM_018906chr51389 --1193 --
NM_018907chr51389 --1193 --
NM_018908chr51389 --1193 --
NM_018909chr51389 --1193 --
NM_018910chr51389 --1193 --
NM_018911chr51389 --1193 --
NM_018951chr73462 414 362 --1191 --
NM_018959chr193740 507 157 ----1602
NM_018970chr732907 2868 748 22096 1240 ----
NM_018976chr121303 12640 ----
NM_018977chrX2789 353 ------
NM_018983chr42221 108 ------
NM_018992chr1671444 1131 427 367 354 338 78 --11254 --
NM_018999chr1044329 4296 3742 895 14745 ----
NM_019001chr334172 3194 3015 13538 ----
NM_019004chr7--22171 713 ----
NM_019041chr632400 2129 1925 12288 ----
NM_019042chr721132 1111 ------
NM_019064chr171832 ------
NM_019066chr152127 80 1326 ----
NM_019074chr154833 825 782 199 ------
NM_019083chr11274 ------
NM_019084chr10------11732
NM_019096chr63713 241 166 --1751 --
NM_019106chr221509 ----1109
NM_019114chr922358 1997 11951 ----
NM_019116chr1693643 3448 3186 2468 2397 1222 888 873 855 23505 1309 11278 --
NM_019555chr32502 231 ------
NM_019557chr13589 281 131 ------
NM_019593chr2033056 2376 2116 12618 ----
NM_019594chr951386 1358 1256 619 126 1347 ----
NM_019595chr21565 ------
NM_019596chr2142856 723 683 359 --1191 --
NM_019597chrX1138 ------
NM_019613chr1741349 928 883 118 ------
NM_019857chrX51703 1646 1265 1233 635 1496 ----
NM_019903chr1021602 1548 ------
NM_020039chr1271940 1824 1783 1739 1556 624 400 ------
NM_020116chr41119 ------
NM_020121chr13167 ------
NM_020122chr2105045 5024 4949 4784 4393 4267 4017 1947 1690 349 --14839 --
NM_020123chr1021214 215 ------
NM_020137chrX3339 332 106 ------
NM_020142chr121443 ------
NM_020144chr7--12086 11897 --
NM_020150chr102405 109 ------
NM_020159chr4146 ------
NM_020168chr1511208 ------
NM_020184chr262364 2070 1680 1492 943 736 ------
NM_020189chr81200 ------
NM_020193chr111254 --138 --
NM_020194chr22614 138 --1476 --
NM_020204chr11680 --1139 --
NM_020205chr143011 2522 2295 118 --13036 --
NM_020231chr32121 79 ------
NM_020235chr3--1293 ----
NM_020239chr142157 874 335 149 ------
NM_020248chr1102256 2245 2176 2117 2109 1939 1750 940 521 353 ------
NM_020307chr3135 ------
NM_020310chr17132787 2443 2272 2244 1756 1711 1034 978 870 811 805 591 558 1196 1383 --
NM_020336chr2033566 2598 1528 ------
NM_020337chr412899 ------
NM_020338chr1093126 2836 2492 841 791 703 416 240 207 ------
NM_020342chr221771 717 ------
NM_020344chr91126 ------
NM_020346chr111602 ------
NM_020347chr311916 11741 2927 191 --
NM_020357chr31394 ------
NM_020378chr192510 154 --1575 --
NM_020383chr101265 ------
NM_020384chrX41659 1351 645 320 ------
NM_020443chr184985 4816 2499 2391 1502 1430 939 157 12620 ----
NM_020444chr531201 357 191 125 ----
NM_020465chr1631922 1743 537 --21421 733 --
NM_020466chr685010 4813 4656 4350 3497 658 552 385 --1435 --
NM_020526chr161724 680 648 253 204 177 ------
NM_020546chr563185 3068 3017 2567 2227 330 ------
NM_020640chr342286 1467 625 204 ------
NM_020644chr112728 407 ------
NM_020647chr821607 125 ------
NM_020649chr17156 ------
NM_020651chr22487 96 ------
NM_020672chr12566 51 ------
NM_020673chr2066628 2952 1949 1448 1235 401 11242 17437 --
NM_020682chr103888 363 194 ------
NM_020689chr201617 21530 1115 ----
NM_020699chr185072 5040 4991 4864 4307 2086 1944 719 ------
NM_020708chr20----12003 --
NM_020717chrX74594 4224 4025 3771 1592 1307 1096 11568 ----
NM_020726chr5268 32 1425 ----
NM_020728chr742864 2693 2241 2231 ------
NM_020734chr1212274 12152 ----
NM_020739chr1532580 830 676 ------
NM_020750chr66925 577 541 510 133 115 --11373 --
NM_020752chr101707 1219 12111 --
NM_020764chr1641327 912 167 79 ------
NM_020766chrX24547 1578 23893 3539 12798 --
NM_020769chrX3834 379 281 ------
NM_020772chr1757540 6351 2326 1707 1402 ------
NM_020783chr182521 84 ------
NM_020794chr1--11052 ----
NM_020795chr1761703 1573 1547 1484 715 517 --11799 --
NM_020796chr522702 2005 --2971 907 --
NM_020801chr541804 756 591 522 --11792 --
NM_020804chr632419 2049 204 --32475 1843 390 --
NM_020805chr1821948 117 ------
NM_020808chr12299 222 1358 ----
NM_020825chr1683694 3374 2913 2624 1277 508 364 249 --1521 --
NM_020845chr1271756 1667 724 672 314 99 70 --22397 919 --
NM_020850chr1672910 2725 2673 2362 1187 962 124 12375 ----
NM_020856chr1911243 ------
NM_020870chr42607 197 12041 11367 11534
NM_020886chr1131080 465 29 ------
NM_020888chr131341 550 505 --1158 --
NM_020896chr111858 ------
NM_020899chr1731980 1725 471 ------
NM_020918chr1043398 2851 1446 420 ------
NM_020920chr14127 ------
NM_020935chr224187 1128 11023 11307 --
NM_020939chr651165 365 359 116 34 --21419 1343 --
NM_020946chr971457 1408 1319 529 486 200 170 ------
NM_020948chr122933 40 ------
NM_020951chr19----21624 1537 --
NM_020956chr1944355 3792 3200 633 --24146 505 --
NM_020962chr1542028 810 497 463 12120 1607 --
NM_020964chr1844315 3976 731 688 14436 13115 --
NM_020972chr43841 282 268 --1243 --
NM_020981chr22632 173 1525 ----
NM_020983chr1242080 712 361 145 --11908 --
NM_020993chr1262704 1986 999 601 496 459 ------
NM_021020chr883214 3194 3148 3137 2814 1281 1194 26 ------
NM_021033chr131668 12444 --13035
NM_021038chr3----23242 52 --
NM_021069chr442097 495 455 172 ------
NM_021072chr51562 ------
NM_021079chr1763222 3058 2533 1282 871 207 ------
NM_021096chr22163152 3092 3009 2839 2736 2671 2501 2162 2010 1163 926 742 473 459 356 153 --1949 --
NM_021097chr232906 2838 959 ------
NM_021100chr202296 32 ------
NM_021132chr101234 --11156 --
NM_021135chr632249 928 77 --1535 --
NM_021136chr14143 ------
NM_021137chr1781998 1956 1648 742 381 364 148 90 ------
NM_021141chr21231 1993 ----
NM_021155chr1953014 2667 1152 864 150 --12547 --
NM_021159chr42557 437 1295 ----
NM_021183chrX--1111 ----
NM_021184chr62535 491 ------
NM_021190chr12445 151 ------
NM_021194chr1----1108 --
NM_021200chr113810 386 35 ----11125
NM_021202chr2072717 2045 821 625 525 271 205 --12157 --
NM_021224chr9167 ------
NM_021239chr142195 171 ------
NM_021240chr91532 ------
NM_021252chr10--1372 --1606
NM_021259chr162748 252 --2259 73 --
NM_021260chr1451290 1130 529 511 154 ------
NM_021602chr174350 177 152 67 ------
NM_021627chr321243 867 ------
NM_021629chr334029 3275 244 14700 1747 --
NM_021637chrX--11345 ----
NM_021643chr251865 612 248 124 86 ------
NM_021644chr102947 43 ------
NM_021647chr494626 4034 3610 2963 1419 1270 1254 1057 498 ------
NM_021705chr62426 168 ------
NM_021728chr141388 ------
NM_021729chr111302 ------
NM_021809chr2042391 2337 1550 589 --22211 310 --
NM_021813chr644757 4368 1557 1404 ------
NM_021814chr6198 ------
NM_021818chr142411 80 ------
NM_021912chr1523466 563 ------
NM_021945chr662427 2296 1416 1006 44 34 ------
NM_021946chrX51430 1291 1204 1196 592 ------
NM_021947chr171912 1390 11051 --
NM_021949chrX21865 1129 --12741 --
NM_021959chr62241 36 ------
NM_021960chr142683 2677 2408 2263 --1567 --
NM_021961chr1156919 5436 2904 2804 2403 1212 24820 2226 1629
NM_021962chr1752271 1905 1882 524 52 ------
NM_021964chr336420 2256 1078 14752 14324 --
NM_021979chr141317 ------
NM_021988chr2051212 1001 520 431 364 ------
NM_022048chr1562491 1928 1684 1220 511 351 --2809 260 --
NM_022054chr142784 598 ------
NM_022060chr1451343 1277 1263 1002 958 ------
NM_022062chr1131772 1527 1312 ------
NM_022105chr20--2590 193 ----
NM_022114chr194083 3764 3317 3243 1835 1526 931 617 598 --14287 --
NM_022143chr721433 1060 1282 ----
NM_022152chr27911 786 506 223 215 177 78 ------
NM_022153chr1093536 2885 2495 2259 1432 1377 1329 99 39 --33435 1033 639 --
NM_022166chr16115540 5336 4888 4388 4300 1716 971 804 613 407 243 24160 1397 ----
NM_022337chr11------125
NM_022340chr362660 1469 1027 741 391 39 ----12327
NM_022371chr11269 ------
NM_022372chr163493 437 424 --126 --
NM_022374chr2175 ------
NM_022442chr2051212 1001 520 431 364 ------
NM_022457chr11238 ------
NM_022459chr1335869 4404 1892 26190 2083 1492 --
NM_022462chr19113541 3078 2737 2673 2492 2473 1484 1386 665 490 278 13802 21304 1095 --
NM_022469chr142691 2622 1091 742 --2964 103 --
NM_022473chr1574300 4155 3830 1365 1141 144 88 --11526 --
NM_022474chr1412619 ------
NM_022479chr731087 982 29 1277 ----
NM_022484chr721316 559 1983 ----
NM_022491chr1242614 2392 613 486 ------
NM_022497chr382645 1432 1216 1050 423 251 239 88 ------
NM_022552chr21996 ------
NM_022566chr151473 ------
NM_022572chr251532 1313 712 648 501 ------
NM_022574chr762200 1885 1633 794 788 472 ------
NM_022644chr171177 --189 --
NM_022648chr2104546 4192 3400 3071 2966 2932 1403 1295 897 776 ------
NM_022650chr51249 ------
NM_022652chr12136 ------
NM_022659chr81151 ------
NM_022719chr2273294 3107 3048 2890 752 264 97 --11325 --
NM_022726chr621200 91 --1645 --
NM_022730chr22713 35 ------
NM_022735chr121396 21 ------
NM_022756chr141166 1120 583 355 ------
NM_022758chr632911 2642 2250 ------
NM_022771chr122801 705 185 ----
NM_022780chr251686 1657 1497 1419 205 ------
NM_022781chr941274 809 563 263 ------
NM_022784chr151179 ------
NM_022817chr22586 53 ------
NM_022823chr2------1131
NM_022831chr121625 505 ------
NM_022832chr43289 177 126 ------
NM_022843chr131247 ------
NM_022844chr163838 337 50 ------
NM_022845chr1611839 ------
NM_022893chr243092 2038 1167 968 ------
NM_022898chr1444820 3486 3005 1758 ----14602
NM_022910chr1631922 1743 537 --21421 733 --
NM_022918chr1111429 11472 ----
NM_022965chr451599 1450 1393 1371 466 ------
NM_023000chr141420 ------
NM_023001chr141420 ------
NM_023009chr14716 183 76 69 1559 ----
NM_023012chr12--1703 ----
NM_023016chr242280 1929 1762 958 22794 579 ----
NM_023034chr81223 --1167 --
NM_023037chr13194 ------
NM_023039chr5144 ------
NM_023071chr123948 782 228 ------
NM_023076chr1682535 2189 2169 2044 1088 1040 164 85 --1289 --
NM_023079chr1751770 1675 1543 440 406 1732 ----
NM_023105chr851871 1534 731 401 291 ----1545
NM_023106chr851871 1534 731 401 291 ----1545
NM_023110chr851871 1534 731 401 291 ----1545
NM_023111chr851871 1534 731 401 291 ----1545
NM_023923chr1103516 3302 2749 2495 2378 1423 1254 957 814 436 --23693 879 --
NM_023927chr51553 --11157 --
NM_023929chr8--32245 2188 1836 ----
NM_023931chr1621414 143 ------
NM_024007chr522597 676 --1835 --
NM_024015chr173964 831 95 ------
NM_024019chr41366 ------
NM_024052chr1721084 369 1973 --1425
NM_024076chr1991689 1635 957 814 795 746 645 282 123 ------
NM_024086chr1793286 3266 3240 2943 2863 2699 1525 565 337 23114 436 ----
NM_024092chr1131121 1057 214 --11215 --
NM_024117chr92234 208 ------
NM_024294chr632911 2642 2250 ------
NM_024295chr831915 1764 1268 --1492 --
NM_024297chr172467 88 ------
NM_024306chr163222 204 94 1183 1934 --
NM_024324chr221156 ------
NM_024345chr965797 2064 264 156 114 34 ----16109
NM_024423chr1864094 3325 2907 1426 1024 925 ------
NM_024424chr111168 --1240 --
NM_024425chr111168 --1240 --
NM_024426chr111168 --1240 --
NM_024430chr181389 11915 ----
NM_024509chr191171 ------
NM_024519chr164267 234 227 24 ------
NM_024527chr191149 --128 --
NM_024528chrX152 ------
NM_024539chrX2979 388 --11293 --
NM_024545chr21694 ------
NM_024551chr1222112 654 ------
NM_024551chr1222112 654 ------
NM_024554chr131131 155 113 --195 --
NM_024556chr113397 345 178 ------
NM_024595chr151229 1147 894 861 169 --1468 --
NM_024598chr1631302 1054 1021 ------
NM_024659chr22667 118 ------
NM_024665chr323804 1829 ------
NM_024674chr162393 2300 1976 731 303 120 --12685 --
NM_024686chr1----1494 --
NM_024721chr812394 ----1468
NM_024738chr122211 28 ------
NM_024742chr1691918 1588 1581 1506 1417 1283 1249 414 184 1343 21274 230 --
NM_024744chr231686 827 34 1678 ----
NM_024757chr92951 804 ------
NM_024761chr955340 4700 3994 1679 47 ------
NM_024762chr193379 329 262 ------
NM_024770chr244111 2168 1804 731 11823 ----
NM_024771chr1182194 1840 1738 1607 986 762 417 60 --22307 2025 --
NM_024792chr1741123 1064 468 432 ------
NM_024804chr12348 25 ------
NM_024811chr114774 737 278 171 ------
NM_024834chr1021861 1761 --11622 1136
NM_024873chr42955 790 --1127 --
NM_024884chr1474221 3583 1080 798 629 416 295 --1463 --
NM_024887chr14780 173 118 71 --1237 --
NM_024896chr931708 766 594 ------
NM_024917chrX4999 888 843 151 ------
NM_024939chr16--2377 88 11263 --
NM_024944chr2121276 74 ------
NM_024947chr389532 8208 6401 3835 3379 2179 736 76 --28699 3810 --
NM_024949chr454030 3151 3048 556 351 1237 ----
NM_024953chr1231921 449 77 --1411 --
NM_024963chr7175519 5497 5099 4846 4352 3955 3807 2353 1527 1503 1299 1170 1004 334 279 75 56 14496 ----
NM_024969chr21835 ------
NM_024993chr21342 11189 1335 --
NM_024997chr162898 169 11287 ----
NM_025061chr192774 171 1213 ----
NM_025073chr124152 522 --1550 --
NM_025074chr432021 1095 703 11138 ----
NM_025076chr21668 ------
NM_025138chr1311241 1429 ----
NM_025141chr15----1509 --
NM_025146chr322766 2694 ------
NM_025160chr173814 3226 1640 1536 832 318 62 --1513 --
NM_025179chr184343 4013 3834 3147 1974 1593 1254 1033 24289 3929 14783 --
NM_025182chr9--21041 380 ----
NM_025187chr1631243 556 450 ------
NM_025191chr133474 2536 403 --11302 --
NM_025219chr2072412 2184 757 606 580 431 41 --31502 726 467 --
NM_025222chr352506 2097 415 401 199 --2820 762 --
NM_025244chr2198 ------
NM_025248chr1762883 1979 1247 1148 1139 630 --22008 984 --
NM_025250chr773030 2793 2776 1169 1091 879 737 --22488 783 --
NM_030576chr1772658 2548 2292 1806 1714 571 39 12005 ----
NM_030621chr14--12909 ----
NM_030625chr1021669 403 ------
NM_030629chr1631751 576 96 ------
NM_030630chr174700 618 106 48 ------
NM_030634chr132026 1675 293 11924 ----
NM_030647chr794766 4236 2485 1798 1347 516 191 85 61 15778 --14002
NM_030648chr465492 5071 4333 2157 1469 650 ------
NM_030650chr264261 3535 2760 1482 893 398 13797 ----
NM_030661chr731389 1041 202 11101 ----
NM_030664chr1022362 1815 ------
NM_030674chr1255620 4021 3965 1601 793 1710 --11368
NM_030780chr82651 355 ------
NM_030786chr131462 768 755 ------
NM_030802chr173886 258 46 ------
NM_030805chr251260 1109 1000 191 81 ------
NM_030808chr172280 77 ------
NM_030809chr1252242 1551 1532 633 469 --22440 1695 --
NM_030816chr123402 3154 ----13058
NM_030881chr2222296 213 ------
NM_030884chr361807 1610 1495 630 357 256 ------
NM_030906chr111219 ------
NM_030912chr103822 367 224 ------
NM_030918chr174554 4502 4285 4257 3828 3346 1435 11610 ----
NM_030925chr1341968 1716 1557 1524 ------
NM_030927chr1041279 1034 1028 351 ------
NM_030937chr151398 1189 319 216 163 --1330 --
NM_030938chr1731150 1026 898 ------
NM_030953chr52432 191 ------
NM_030962chr111499 --1187 --
NM_030964chr593360 3288 2547 2438 1495 1292 431 42 33 12851 23501 2561 --
NM_031157chr122490 458 ------
NM_031231chr203282 263 241 --1117 --
NM_031232chr203282 263 241 --1117 --
NM_031243chr712243 ----11626
NM_031262chr91850 ------
NM_031263chr91907 ------
NM_031268chr16174978 4285 4080 3699 3367 2092 1889 1709 1662 1523 1405 1396 1389 604 569 327 58 --12030 --
NM_031309chr821685 844 ------
NM_031371chr11217 1547 --1234
NM_031371chr11217 1547 --1234
NM_031407chrX1425 ------
NM_031411chr51389 --1193 --
NM_031419chr32561 21 ------
NM_031424chr201558 1123 ----
NM_031427chr1485694 4387 4220 1980 1837 1777 1666 1317 25864 4072 1886 --
NM_031439chr82446 356 1302 ----
NM_031442chrX43086 2176 1292 1281 ------
NM_031443chr72404 93 ------
NM_031445chr273379 2904 2624 2438 839 420 83 --12860 1299
NM_031453chr1022624 332 11960 ----
NM_031459chr121427 55 ------
NM_031469chr62537 387 149 ----
NM_031483chr2063185 2999 2352 2278 951 827 1408 12784 --
NM_031844chr143454 1626 668 323 ------
NM_031845chr213382 ----13293
NM_031847chr213382 ----13293
NM_031849chr51389 --1193 --
NM_031857chr51389 --1193 --
NM_031860chr51389 --1193 --
NM_031886chr1932122 1709 364 ------
NM_031890chr2272988 2203 1937 1163 939 595 163 --11168 --
NM_031935chr1--1145 ----
NM_031954chr1241003 786 496 108 --21161 712 --
NM_032012chr944849 1683 396 150 ------
NM_032028chr5--1145 ----
NM_032042chr521126 274 --12218 --
NM_032047chr322245 433 1490 ----
NM_032050chr221309 1223 1920 --
NM_032052chr222973 942 --11305 --
NM_032102chr1111006 ------
NM_032105chr1127149 7028 6517 5827 3176 3129 2434 1975 1873 1580 967 959 --27058 5570 15346
NM_032121chrX42813 1737 1033 340 12729 11088 --
NM_032122chr6123 ------
NM_032144chr21506 --1194 --
NM_032147chr121694 ------
NM_032153chr332518 1800 185 ------
NM_032186chr111181 ------
NM_032189chr1353792 3656 2025 1718 110 --13865 --
NM_032199chr1063427 3372 3200 2981 1513 1196 --12437 --
NM_032221chr202620 273 --12054 --
NM_032246chr152241 153 ------
NM_032268chr1663111 2185 1165 947 666 94 ------
NM_032271chr1641376 1331 1103 339 ------
NM_032281chr1953121 513 430 363 263 ------
NM_032288chr342082 808 405 377 11610 ----
NM_032294chr1741678 619 413 321 ------
NM_032298chr191444 ------
NM_032316chr3112416 2336 2313 1560 1538 940 629 576 210 122 52 --11916 11854
NM_032325chr1161748 1553 1390 180 159 60 ------
NM_032376chr171187 --1673 --
NM_032389chr1141160 978 904 446 ------
NM_032435chr122336 2239 ------
NM_032471chr6183 1365 ----
NM_032482chr1952392 1952 1869 1104 816 --32307 1681 412 --
NM_032492chr34182 108 77 23 ------
NM_032514chr204446 331 70 26 ------
NM_032536chr93589 554 468 ------
NM_032538chr642644 2056 1963 1075 --22607 355 --
NM_032550chr10146 ------
NM_032560chr141223 ------
NM_032569chr1641316 1262 346 75 12028 ----
NM_032582chr17130 ------
NM_032595chr1761463 1144 609 517 192 96 --1280 --
NM_032596chr91113 --131 --
NM_032600chr3122 ------
NM_032632chr141626 ------
NM_032638chr341206 1104 1072 375 ------
NM_032682chr321339 106 12639 --12393
NM_032701chr193626 563 483 ------
NM_032711chr17104243 4175 3766 3527 3201 1453 1377 1211 537 274 --11173 --
NM_032737chr1982150 1753 1055 792 578 444 298 292 ------
NM_032786chr121467 126 ----
NM_032804chr1052448 1825 1679 654 80 1210 ----
NM_032818chr982361 2308 2101 1935 1842 890 266 131 ------
NM_032833chr111639 ------
NM_032837chr171777 12070 ----
NM_032859chr1331075 714 626 ------
NM_032869chr821260 61 ------
NM_032871chr1141809 1324 327 140 1375 ----
NM_032873chr1123130 406 1605 ----
NM_032885chr191137 ------
NM_032900chr1083701 3624 2763 2653 1544 1377 860 83 ------
NM_032905chr1021190 218 ------
NM_032918chr121112 ------
NM_032932chr17156271 5937 5898 4573 4345 4183 3949 2380 2261 2159 2039 1963 1841 984 939 15617 23991 970 --
NM_032993chr42221 108 ------
NM_032998chr13929 848 186 ------
NM_033020chr133993 1806 1402 1341 ----
NM_033025chr196630 366 213 206 111 68 ----1750
NM_033027chr33306 273 131 ------
NM_033058chr83718 147 92 1839 ----
NM_033082chr12160 ------
NM_033133chr1763165 2374 1339 904 857 312 13091 ----
NM_033136chr551285 1158 424 418 239 ------
NM_033137chr551285 1158 424 418 239 ------
NM_033141chr1422217 1585 --1489 --
NM_033161chr981611 732 634 475 278 227 197 25 21467 116 ----
NM_033181chr642515 1046 994 81 13075 ----
NM_033211chr521407 46 --1332 --
NM_033224chr757659 5328 5162 3186 746 ------
NM_033225chr832315 354 229 ------
NM_033226chr163189 181 99 ------
NM_033251chr162357 81 ------
NM_033259chr31621 --1358 --
NM_033267chr53771 105 41 ------
NM_033274chr573454 3079 2934 1302 782 691 88 --22721 533 --
NM_033278chr113297 66 21 ------
NM_033281chr51171 ------
NM_033285chr833982 1293 34 --1991 --
NM_033290chrX73781 3653 3133 2853 2755 507 284 --12564 --
NM_033309chr162296 138 --1266 --
NM_033310chr112105 61 ------
NM_033315chr1732140 1886 1567 --21437 378 --
NM_033331chr922885 2657 23247 276 ----
NM_033343chr11294 ------
NM_033389chr1764765 4517 4205 3246 3054 123 ------
NM_033393chr432808 1181 621 --1883 --
NM_033394chr221221 52 ------
NM_033396chr111138 ------
NM_033401chr161139 ------
NM_033420chr1941005 896 244 196 1806 1948 --
NM_033425chr1142749 573 166 36 23084 177 12472 --
NM_033430chr41321 11644 ----
NM_033437chr41321 11644 ----
NM_033449chr521631 495 ------
NM_033503chr15133728 3370 3156 2962 2945 2934 2874 2781 2619 1004 777 714 45 --12519 --
NM_033512chr882912 2480 2071 789 759 510 272 45 22998 1182 ----
NM_033551chr593068 2949 2843 1376 1015 1009 480 376 105 --12121 --
NM_033631chr173708 2900 2411 2399 2384 397 344 22813 1496 12980 11357
NM_033632chr41129 ------
NM_033637chr1053421 3061 3004 2941 2868 23304 3161 23604 1159 --
NM_044472chr13551 475 281 ------
NM_052834chr1821611 531 --1304 --
NM_052840chr1521402 138 --11487 --
NM_052845chr1242039 1066 81 23 --1724 --
NM_052846chr203853 492 286 11258 ----
NM_052849chr151290 ------
NM_052855chr174484 246 196 106 ------
NM_052860chr52936 79 ------
NM_052879chr121332 13375 ----
NM_052880chr2221337 91 ------
NM_052885chr1221676 90 ------
NM_052886chr821601 145 12120 ----
NM_052900chr821475 32 ------
NM_052905chr231877 1275 336 11188 ----
NM_052907chr1212944 --1116 1252
NM_052911chr181736 ----1369
NM_052918chr1053559 3278 1120 847 383 ------
NM_052925chr191741 ------
NM_052927chr512035 ------
NM_052934chr162101 660 478 118 70 39 1580 1227 --
NM_052950chr1332151 776 247 ------
NM_052954chr2131695 535 46 1585 ----
NM_052978chr142253 172 21691 1544 ----
NM_052996chr1621484 1432 ----11507
NM_053002chr321046 958 ------
NM_053016chr977273 7100 6844 6268 2012 884 402 --11922 --
NM_053023chr111691 --13018 --
NM_053025chr311713 11117 ----
NM_053026chr311713 11117 ----
NM_053027chr311713 11117 ----
NM_053028chr311713 11117 ----
NM_053031chr311713 11117 ----
NM_053032chr311713 11117 ----
NM_053046chr192489 420 --1122 --
NM_053056chr1143090 3058 973 669 ------
NM_053064chr142219 151 12349 ----
NM_053279chr8102719 2710 2224 1149 870 860 772 676 595 43 ------
NM_054013chr54591 137 127 115 --1846 --
NM_054025chr1162188 1990 1826 869 654 585 ------
NM_057161chr61218 198 ----
NM_057178chr1762514 868 438 237 54 45 ------
NM_058172chr411149 11624 ----
NM_058241chr221760 353 11940 ----
NM_058241chr221760 353 11940 ----
NM_078471chr1761064 912 880 456 291 51 --11140 --
NM_078474chr15----1509 --
NM_078485chr62738 55 --143 --
NM_080391chr11568 156 ----
NM_080392chr12617 446 1105 ----
NM_080544chr331320 1211 1188 --11196 --
NM_080546chr931716 1656 921 ------
NM_080552chr203227 121 95 ------
NM_080591chr972425 2268 2084 1254 624 289 97 ------
NM_080597chr18177 ------
NM_080600chr192414 28 --1462 --
NM_080616chr202227 54 --1601 --
NM_080629chr1146 ------
NM_080630chr1146 ------
NM_080645chr631390 748 360 ------
NM_080664chr1411593 136 --12010
NM_080666chr1411496 2629 308 ----
NM_080671chr222056 263 1121 177 --
NM_080676chr203738 526 347 13140 ----
NM_080679chr63664 634 171 ------
NM_080680chr63664 634 171 ------
NM_080681chr63664 634 171 ------
NM_080717chr121396 ------
NM_080732chr192489 420 --1122 --
NM_080737chrX2936 409 11213 ----
NM_080738chr182035 1853 1728 1669 1427 1344 1279 748 ------
NM_080743chr642135 1873 1017 472 ------
NM_080759chr1341812 1003 965 931 --12603 --
NM_080760chr1341812 1003 965 931 --12603 --
NM_080764chr2222288 195 ----11141
NM_080792chr2042125 2034 1793 278 --1555 --
NM_080796chr20--2590 193 ----
NM_080865chr33702 161 87 --1119 --
NM_080872chr821436 39 32924 1396 395 ----
NM_080881chr54706 546 278 101 ------
NM_130385chr1142581 2415 2031 1966 --12978 --
NM_130387chr3--1931 154 --
NM_130391chr913349 ------
NM_130392chr913349 ------
NM_130393chr913349 ------
NM_130436chr2121768 326 12187 --12740
NM_130438chr2122345 903 12764 --13317
NM_130439chr1031967 1737 496 ------
NM_130439chr1031967 1737 496 ------
NM_130440chr131223 1064 1010 ----11175
NM_130442chr71410 ------
NM_130459chr961520 1386 1060 662 507 121 --11631 --
NM_130798chr1511363 --1528 --
NM_130808chr32390 179 ------
NM_130811chr201183 ------
NM_130838chr1511432 ------
NM_130839chr1511432 ------
NM_130848chr54822 447 113 98 ------
NM_133170chr2096722 6453 5024 2151 1338 1247 796 626 515 25305 2889 16409 --
NM_133171chr2051061 979 234 172 70 ------
NM_133329chr221590 362 1112 ----
NM_133367chr653399 1256 1205 687 535 22421 944 ----
NM_133372chr512152 12810 1474 --
NM_133378chr21669 ------
NM_133432chr21669 ------
NM_133437chr21669 ------
NM_133444chr1941760 1462 1319 291 1601 21513 441 195
NM_133446chr10132 ------
NM_133457chr751394 1196 1092 249 169 11325 11348 --
NM_133468chr73763 496 35 --11948 --
NM_133477chr42578 510 ------
NM_133486chrX1388 ------
NM_133494chr1----179 --
NM_133496chr1--148 --12842
NM_133499chrX3957 859 361 ------
NM_133510chr14171 ------
NM_133634chr2121653 73 ------
NM_134421chr25754 614 260 197 114 --1729 --
NM_134428chr91342 ------
NM_134442chr241766 1599 620 49 ------
NM_134447chr191632 ------
NM_138288chr1441850 1677 1383 411 --12131 --
NM_138300chr171416 1212 1064 634 617 173 80 --11112 --
NM_138338chr2293417 3370 3178 2619 2438 2256 2091 1041 894 --22725 565 --
NM_138353chr193278 170 47 ------
NM_138355chr173122 51 24 ------
NM_138373chr1941834 1744 1328 1161 ------
NM_138395chr21340 1916 ----
NM_138396chr123761 337 155 ------
NM_138413chr1041018 984 906 230 ------
NM_138415chr223552 281 61 ------
NM_138426chr7----12058 --
NM_138444chr1354231 1648 990 568 478 ------
NM_138459chr633669 2349 375 42481 703 662 632 --1654
NM_138468chr265345 5097 4907 3972 2439 2273 1576 15153 --
NM_138473chr1255099 4811 3587 775 509 11643 13211 --
NM_138479chr121515 286 --1773 --
NM_138494chr711929 22110 739 ----
NM_138571chr6135 ------
NM_138576chr1444820 3486 3005 1758 ----14602
NM_138578chr2061347 1094 1062 1026 541 142 ------
NM_138619chr1771294 1104 1040 562 512 296 68 ------
NM_138621chr263122 1159 1130 1003 760 81 13036 13752 --
NM_138713chr1647716 6456 5618 1410 15930 17594 --
NM_138714chr1647716 6456 5618 1410 15930 17594 --
NM_138727chr141602 1528 836 725 ------
NM_138728chr141602 1528 836 725 ------
NM_138731chr1431126 41 22 ------
NM_138732chr11186 --1645 --
NM_138734chr11186 --1645 --
NM_138771chr71981 ------
NM_138811chr721128 155 ----1774
NM_138923chrX123 ------
NM_138970chr1441686 554 320 133 ------
NM_138971chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138971chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138972chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138972chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138973chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138973chr1173752 3514 3484 1352 1151 1002 240 ------
NM_138992chr213976 705 178 ------
NM_138994chr161139 ------
NM_139014chr642189 1555 545 89 ------
NM_139015chr1221352 1240 ----21444 85
NM_139035chrX1594 ------
NM_139045chr9--125 1325 --
NM_139062chr172443 40 ------
NM_139067chr122222 94 ------
NM_139068chr52478 198 ------
NM_139069chr52478 198 ------
NM_139070chr5167 ------
NM_139071chr125542 303 244 91 82 ------
NM_139131chr111526 ------
NM_139135chr111013 11347 ----
NM_139157chr113648 68 50 ------
NM_139159chr192342 211 1871 ----
NM_139168chr521877 1585 ------
NM_139207chr121395 197 ----
NM_139246chr932093 851 358 --1275 --
NM_139276chr1752092 1887 1471 920 374 ------
NM_139279chr252639 1390 1276 1118 23 1543 ----
NM_139283chr1232575 2164 1849 12138 ----
NM_139312chr1031068 966 576 --11275 --
NM_139321chr2054266 3130 2843 1512 1292 ------
NM_139323chr2021315 1303 11843 ----
NM_144499chr331179 385 377 142 ----
NM_144571chr4--16348 1854 --
NM_144578chr1453909 3796 945 610 488 35161 4841 1373 11119 --
NM_144579chr2142841 2774 2735 2632 2606 2594 2582 2510 2492 2385 2058 1916 809 437 --12191 --
NM_144580chr11235 ------
NM_144582chr262621 2609 2300 2242 391 165 --12615 --
NM_144590chr102832 404 ------
NM_144599chr1564694 4657 3930 3598 338 212 13452 23646 130 --
NM_144632chr211876 --1793 --
NM_144633chr3178 1603 ----
NM_144636chr33664 635 558 ------
NM_144685chr191205 ------
NM_144703chr2031119 445 432 11053 ----
NM_144728chr14936 840 755 69 ------
NM_144729chr14936 840 755 69 ------
NM_144767chr1553576 1507 969 795 519 --44280 3856 1581 493 --
NM_144775chr17124132 3919 1575 1258 1040 314 264 229 196 176 112 106 11393 ----
NM_144778chr1322568 642 ------
NM_144963chr821995 1938 1439 ----
NM_144967chrX1719 1890 1185 --
NM_145010chr1042234 2121 1947 1893 ------
NM_145025chr641046 366 280 154 ------
NM_145049chr51121 ------
NM_145055chr1842804 1403 807 269 --13049 --
NM_145056chr192222 148 ------
NM_145068chr173259 252 39 ------
NM_145109chr174970 366 336 285 ------
NM_145166chr3102716 2680 2673 2348 1911 867 412 347 99 36 ----12842
NM_145185chr1941622 689 488 439 --11724 --
NM_145203chr13----1239 --
NM_145206chr1032703 2256 1077 1749 12769 --
NM_145239chr1611119 ------
NM_145245chr1941147 904 268 227 ------
NM_145253chr162243 235 --1157 --
NM_145259chr225815 1691 --24380 568 --
NM_145284chrX2682 196 ------
NM_145296chr196205 166 139 95 35 29 ------
NM_145303chr61187 1207 ----
NM_145313chr1041319 1280 1207 504 --1436 --
NM_145349chr1771908 1577 899 579 490 333 314 --12044 --
NM_145350chr1721260 251 --11396 --
NM_145638chr111858 ------
NM_145690chr811524 ----1727
NM_145698chr1021974 1373 ------
NM_145727chr641130 937 387 45 --1282 --
NM_145735chr1322291 953 1524 ----
NM_145808chr722063 921 12381 ----
NM_145861chr182035 1853 1728 1669 1427 1344 1279 748 ------
NM_145888chr1921338 715 ------
NM_145891chr16------11127
NM_145892chr16------11127
NM_145893chr16------11249
NM_145899chr651302 1287 936 421 332 ------
NM_145901chr651302 1287 936 421 332 ------
NM_145902chr651302 1287 936 421 332 ------
NM_145903chr651302 1287 936 421 332 ------
NM_145904chr651302 1287 936 421 332 ------
NM_145905chr651302 1287 936 421 332 ------
NM_147147chr694198 3799 3768 3719 3476 3460 3362 1521 1164 ------
NM_147150chr943888 1218 883 36 12527 1246 --
NM_147161chr131057 833 71 --21005 483 --
NM_147166chr7--1603 ----
NM_147168chr91113 --131 --
NM_147189chr832255 2239 187 ------
NM_148174chr8----152 --
NM_148571chr173294 251 226 ----1243
NM_148894chr4165 ------
NM_148921chr1762079 1752 1653 730 328 195 --11667 --
NM_152222chr1141809 1324 327 140 1375 ----
NM_152238chr1----1242 --
NM_152247chr223934 237 188 ------
NM_152253chr2294320 3623 3574 3156 2770 552 461 361 288 --128 --
NM_152261chr1221822 812 22122 216 ----
NM_152263chr185258 4262 3814 2351 1668 1214 908 97 11868 ----
NM_152265chr11253 --1511 --
NM_152267chr223714 690 66 21722 421 ----
NM_152272chr821199 889 21373 1315 ----
NM_152280chr132758 1266 526 --12709 --
NM_152284chr81702 ------
NM_152305chr32121 79 ------
NM_152380chr121492 1177 --11413 11087
NM_152387chr22389 236 ------
NM_152388chr253850 3422 2528 863 643 --13105 --
NM_152409chr553364 1150 984 96 64 ------
NM_152414chr81359 --1347 --
NM_152424chrX83159 3085 1732 1611 776 621 544 146 13761 ----
NM_152437chr1212232 1458 ----
NM_152448chr152512 452 ------
NM_152482chr1941546 1152 1108 23 ------
NM_152522chr21861 ------
NM_152538chr321274 1161 ------
NM_152542chr42857 667 ------
NM_152546chr531457 1290 1131 11064 ----
NM_152556chr72722 95 ------
NM_152589chr121236 ------
NM_152594chr1532220 1964 237 1735 --1102
NM_152608chr131713 771 256 12016 1198 --
NM_152622chr523491 685 ------
NM_152624chr5117465 6939 6877 5490 5296 5249 1923 1799 1714 628 287 36275 1765 1461 14496 --
NM_152629chr984010 3605 2695 1284 1263 937 750 204 23773 1418 ----
NM_152636chr1132397 253 188 1555 ----
NM_152638chr121376 ------
NM_152641chr1222041 1044 12141 1543 --
NM_152663chr11329 ------
NM_152682chr431637 1182 312 181 --11141
NM_152688chr61268 ------
NM_152695chrX11870 ----1528
NM_152704chr1331064 965 372 ------
NM_152733chr6176303 6149 6090 6046 5965 5644 5633 5284 5166 4492 4447 2533 2123 1234 796 586 29 --14313 --
NM_152742chr74460 384 217 71 ------
NM_152745chr73810 474 93 ------
NM_152756chr524100 3859 ------
NM_152758chr832354 2242 1907 --1644 --
NM_152787chrX33642 2647 413 22734 2485 ----
NM_152793chr723398 1260 23915 236 23193 1096 --
NM_152838chr2011258 --1120 --
NM_152860chr1251486 1323 1259 493 149 ------
NM_152890chr1--11222 1520 --
NM_152919chr1933219 2625 250 32416 2357 1406 ----
NM_152924chr15136479 5635 5469 5300 4281 4224 2307 1534 1099 685 673 468 273 15144 12289 --
NM_152989chr1231565 1254 171 ------
NM_153035chr153247 3081 2412 2188 438 ------
NM_153188chr525152 4407 14468 --14969
NM_153207chr1244111 3025 2984 1485 13132 1685 1979
NM_153260chr1521005 589 11419 --1328
NM_153261chr1611053 ------
NM_153273chr3112573 2400 2001 1846 1728 971 775 619 276 268 150 11819 ----
NM_153321chr172988 949 ------
NM_153322chr172988 949 ------
NM_153332chr812532 1526 ----
NM_153333chrX--1128 ----
NM_153335chr1761340 1245 320 308 302 101 ------
NM_153347chr1162451 2445 2272 2236 898 99 11796 ----
NM_153367chr1073490 2850 1588 1126 685 242 220 --23432 858 --
NM_153371chr1342114 825 320 192 ------
NM_153437chr9----197 --
NM_153499chr1262736 2653 2030 759 225 106 1870 22036 1945 --
NM_153500chr1262736 2653 2030 759 225 106 1870 22036 1945 --
NM_153607chr522425 2151 ----12306
NM_153620chr73621 571 212 ------
NM_153631chr731389 1041 202 11101 ----
NM_153632chr731389 1041 202 11101 ----
NM_153634chr1231345 667 516 --165 --
NM_153649chr142107 2085 1486 1435 ------
NM_153686chr422401 952 12375 ----
NM_153689chr211523 ------
NM_153712chr253582 3506 2440 2347 308 ------
NM_153715chr73462 414 362 --1191 --
NM_153756chr151502 1240 769 490 401 ----11658
NM_153759chr21996 ------
NM_153810chr1053966 3647 3125 769 147 ------
NM_153812chr142165 2085 811 96 1888 ----
NM_153836chr22413 24 ------
NM_170607chr1731376 1221 125 --1535 --
NM_170662chr31130 ------
NM_170674chr1521143 1038 ------
NM_170675chr152819 714 ------
NM_170676chr152819 714 ------
NM_170677chr1521143 1038 ------
NM_170706chr1124086 3527 3221 1661 1591 1562 1397 1358 953 387 348 309 ------
NM_170711chr193916 683 333 ----1778
NM_170719chr1311241 1429 ----
NM_170731chr1132316 1763 875 ------
NM_170732chr1132316 1763 875 ------
NM_170733chr1132316 1763 875 ------
NM_170734chr1132316 1763 875 ------
NM_170735chr1132316 1763 875 ------
NM_170750chrX2155 114 ------
NM_170751chr62365 118 ------
NM_170752chr62365 118 ------
NM_170782chr12401 65 --1156 --
NM_171825chr563182 2692 2334 2256 1935 643 --12515 --
NM_171998chrX2759 287 1347 1564 --
NM_171999chr181239 ------
NM_172020chr761777 1767 707 482 449 385 --21421 686 --
NM_172070chr211973 ----1153
NM_172071chr146613 6524 2837 1720 ------
NM_172169chr1041595 1412 395 385 ------
NM_172170chr1041595 1412 395 385 ------
NM_172171chr1041595 1412 395 385 ------
NM_172173chr1041595 1412 395 385 ------
NM_172206chr1741678 619 413 321 ------
NM_172216chr1252638 2555 1932 661 127 1772 21938 1847 --
NM_172226chr1262736 2653 2030 759 225 106 1870 22036 1945 --
NM_172315chr1521143 1038 ------
NM_172316chr1521143 1038 ------
NM_172337chr141388 ------
NM_172344chr221590 362 1112 ----
NM_173054chr72367 108 ------
NM_173074chr2156 ------
NM_173156chr111614 2661 269 ----
NM_173163chr162437 213 ------
NM_173165chr162318 94 ------
NM_173171chr2----1362 --
NM_173172chr21256 ------
NM_173173chr2----1362 --
NM_173174chr82532 257 --1282 --
NM_173175chr82532 257 --1282 --
NM_173176chr82532 257 --1282 --
NM_173201chr163292 284 262 ------
NM_173214chr1647716 6456 5618 1410 15930 17594 --
NM_173454chr153285 208 79 1270 ----
NM_173468chr442256 1764 1254 241 ------
NM_173472chr32194 52 ------
NM_173473chr1062143 2011 1845 357 129 25 ------
NM_173475chr1631655 1102 236 --1629 --
NM_173491chr531366 1063 106 ------
NM_173510chr2222922 662 ------
NM_173515chr62947 29 ------
NM_173519chr821715 562 ------
NM_173527chr143572 521 94 ------
NM_173552chr311838 1339 ----
NM_173576chr10--22093 1835 ----
NM_173595chr12125251 4590 4509 3882 1801 1365 741 560 299 269 184 173 2473 215 11217 14731
NM_173602chr1253538 3194 2967 2876 1479 12628 ----
NM_173609chr152758 193 1263 ----
NM_173662chr4147 ------
NM_173672chr642558 1683 615 303 1904 ----
NM_173683chr831566 1333 528 --11497 --
NM_173794chrX1163 ------
NM_173808chr124192 1175 24005 67 14388 --
NM_173829chr555307 3835 3761 2457 2400 15333 ----
NM_173854chr142287 1920 1541 301 --1648 --
NM_173872chr41651 --1769 --
NM_174858chr13474 360 171 ------
NM_174869chrX1300 --1147 1349
NM_174890chr101175 ------
NM_174911chr892839 2638 1436 1346 1280 914 396 286 98 2409 302 --11447
NM_174921chr421008 436 ------
NM_174934chr1163576 3411 2891 2225 655 106 --11314 --
NM_174963chr12849 127 ------
NM_174964chr12849 127 ------
NM_174965chr12868 146 ------
NM_174966chr12849 127 ------
NM_174967chr12868 146 ------
NM_174968chr12849 127 ------
NM_174969chr12849 127 ------
NM_174970chr12868 146 ------
NM_174971chr12849 127 ------
NM_174976chr1421983 1692 ------
NM_175061chr711678 ------
NM_175566chr11------142
NM_175575chr1731032 829 98 ------
NM_175607chr31497 1432 ----
NM_175610chr151980 ------
NM_175612chr31497 1432 ----
NM_175624chr1245483 5318 2280 1321 ------
NM_175625chr1245483 5318 2280 1321 ------
NM_175629chr21996 ------
NM_175630chr23612 86 47 ------
NM_175634chr811082 ------
NM_175635chr811082 ------
NM_175636chr811082 ------
NM_175709chr2272698 2129 1949 1880 1013 884 44 13064 1373 --
NM_175736chr12157518 7001 6500 5683 5342 4738 2656 2543 2375 2274 2001 1837 1404 396 182 ------
NM_175748chr142841 602 --1485 --
NM_175854chr1332665 2214 2015 ----11017
NM_175856chr53628 142 125 ------
NM_175859chrX51703 1646 1265 1233 635 1496 ----
NM_175862chr321007 451 ------
NM_175866chr1--1340 ----
NM_175873chr551173 946 302 90 24 ------
NM_175884chr72930 355 11140 ----
NM_175931chr1691912 1880 1848 1816 1784 1752 1531 93 79 ------
NM_176792chr1011033 ------
NM_176863chr1771732 1692 1679 866 501 59 36 1817 ----
NM_176871chr8133254 3155 3117 3045 2819 2662 2650 2368 2358 686 633 500 253 12033 ----
NM_177398chr141689 1564 1381 1347 ------
NM_177399chr141689 1564 1381 1347 ------
NM_177414chr1--11125 ----
NM_177438chr14--12909 ----
NM_177559chr202771 74 ------
NM_177560chr202771 74 ------
NM_177949chrX1257 ------
NM_177968chr232150 2068 465 ------
NM_177977chr1771818 1651 1480 1335 601 431 48 ------
NM_177996chr2062463 2382 1334 773 416 30 11286 11305 --
NM_177999chr9103444 3149 2821 2676 1044 961 824 747 360 193 ------
NM_178010chr1231565 1254 171 ------
NM_178037chr1273648 3598 3488 2585 974 628 194 --12812 --
NM_178038chr1273648 3598 3488 2585 974 628 194 --12812 --
NM_178151chrX86477 5753 5243 2478 2277 1911 701 617 ------
NM_178152chrX86477 5753 5243 2478 2277 1911 701 617 ------
NM_178153chrX86477 5753 5243 2478 2277 1911 701 617 ------
NM_178313chr21115 ------
NM_178424chr52475 179 ------
NM_178426chr112302 --11642 --
NM_178427chr112202 --11542 --
NM_178441chr1451290 1130 529 511 154 ------
NM_178493chr171128 ------
NM_178498chr1123149 655 --2309 128 --
NM_178500chr174848 617 291 148 ------
NM_178565chr821137 343 ------
NM_178585chr443134 2757 2089 67 --11327 --
NM_178818chr1642248 2064 1583 177 --11875 --
NM_178841chr165969 953 945 738 30 --1201 --
NM_180976chr611008 ------
NM_180977chr611008 ------
NM_181054chr142264 241 ------
NM_181351chr1172837 2163 2115 2040 1147 922 380 ------
NM_181354chr82619 234 ------
NM_181358chr133413 3270 2785 --23246 1567 --
NM_181457chr2----139 --
NM_181486chr121396 ------
NM_181491chr982902 2415 2319 872 267 250 113 46 --1955 --
NM_181492chr221304 ------
NM_181507chr113758 447 389 ------
NM_181508chr113758 447 389 ------
NM_181509chr204446 331 70 26 ------
NM_181659chr2031143 787 404 12643 ----
NM_181659chr2031143 787 404 12643 ----
NM_181672chrX51890 767 642 269 249 ------
NM_181673chrX51890 767 642 269 249 ------
NM_181701chr951742 1668 860 810 151 --31623 1607 112 --
NM_181703chr161534 1463 1371 650 304 105 1621 11308 --
NM_181704chr2131269 1167 266 11136 ----
NM_181712chr121981 1641 ------
NM_181784chr231873 469 438 1131 ----
NM_181787chr823108 2921 ------
NM_181794chr6183 1365 ----
NM_181795chr6183 1365 ----
NM_181838chr51341 11203 ----
NM_181844chr1791964 1809 1592 1395 1369 627 498 277 81 1700 --11334
NM_181861chr1222492 862 12799 ----
NM_181868chr1222492 862 12799 ----
NM_181869chr1222577 947 22884 56 ----
NM_181886chr41309 ------
NM_181887chr41309 ------
NM_181888chr41309 ------
NM_181889chr41309 ------
NM_181890chr41309 ------
NM_181891chr41309 ------
NM_181892chr41356 ------
NM_181893chr41309 ------
NM_181897chr342011 1899 1859 154 22388 642 ----
NM_182314chrX--1322 11160 --
NM_182481chr2141174 1072 947 51 1921 ----
NM_182482chr2141174 1072 947 51 1921 ----
NM_182484chr2131269 1167 266 11136 ----
NM_182493chr1665062 3553 1916 1203 687 674 13298 ----
NM_182503chr655337 5307 4831 3499 1656 11688 11325 --
NM_182509chr1441294 1180 220 171 ------
NM_182515chr1956541 4798 4253 1039 96 --26721 4096 14432
NM_182526chr1482780 2576 2288 2004 1969 1233 866 24 11257 11070 --
NM_182543chr101264 ------
NM_182551chr223447 934 ------
NM_182557chr1162170 1911 1676 865 447 87 --21741 1686 --
NM_182562chr154793 642 80 44 ----1662
NM_182697chr721080 172 --11121 --
NM_182700chr71480 --2610 516 1398
NM_182717chr1021320 310 ------
NM_182720chr1021320 310 ------
NM_182721chr1021320 310 ------
NM_182722chr1021320 310 ------
NM_182723chr1021320 310 ------
NM_182763chr142672 2666 2397 2252 --1556 --
NM_182764chr2051061 979 234 172 70 ------
NM_182765chr1021631 507 --11844 --
NM_182797chr20----1320 --
NM_182853chr1021320 310 ------
NM_182898chr745105 1487 583 211 1246 ----
NM_182899chr745105 1487 583 211 1246 ----
NM_182907chr631729 1663 45 ------
NM_182911chr2198 ------
NM_182917chr34391 168 158 63 ------
NM_182920chr331340 1289 583 ------
NM_182925chr551525 655 380 101 90 --1347 --
NM_182935chr342464 2289 1748 182 --12115 --
NM_182948chr122780 478 32893 782 497 ----
NM_182970chr20154142 3363 3284 3192 3186 2822 2769 1721 1483 1463 1152 679 619 242 36 11594 11653 --
NM_183004chr1443806 3580 2626 1580 1540 13202 --
NM_183006chr2011472 ------
NM_183011chr1021320 310 ------
NM_183012chr1021320 310 ------
NM_183013chr1021320 310 ------
NM_183041chr6123 ------
NM_183057chr8----1202 --
NM_183061chr31125 ------
NM_183078chr653448 3058 2810 2738 2400 ------
NM_183227chr621426 176 ----1551
NM_183376chr151157 --12334 --
NM_183398chr5------11182
NM_183399chr5------11182
NM_183400chr5------11182
NM_183401chr5------11182
NM_183422chr132254 178 ------
NM_184085chr82606 35 1727 ----
NM_184086chr82606 35 1727 ----
NM_184087chr82606 35 1727 ----
NM_184231chr32185 61 1240 ----
NM_184234chr201585 --1706 1653
NM_194071chr7114617 3312 1987 1856 1778 1427 1121 676 471 180 145 ----12000
NM_194247chr243373 3224 1401 850 12875 24186 3277 --
NM_194248chr22967 258 --143 --
NM_194250chr21325 ------
NM_194272chr1521013 915 136 ----
NM_194278chr1432906 1257 112 ------
NM_194282chr433008 2851 249 13073 ----
NM_194285chr1133360 2791 2700 ------
NM_194286chr12166191 6154 6052 5429 4276 4106 2344 2056 1840 1221 1169 1041 959 611 221 81 15801 ----
NM_194291chr822034 839 12630 ----
NM_194314chr121167 713 ----15172
NM_194322chr22967 258 --143 --
NM_194328chr941274 809 563 263 ------
NM_194329chr941274 809 563 263 ------
NM_194330chr941274 809 563 263 ------
NM_194332chr941274 809 563 263 ------
NM_194358chr1241738 1625 285 237 ------
NM_194359chr1241738 1625 285 237 ------
NM_194452chr111110 --1434 --
NM_194453chr111110 --1434 --
NM_194463chrX2979 388 --11293 --
NM_197941chr542096 2080 616 409 ------
NM_198081chr632402 2217 504 --11863 --
NM_198123chr821475 32 ------
NM_198124chr821475 32 ------
NM_198147chr1731232 916 206 ------
NM_198148chr105920 794 337 114 28 156 ----
NM_198158chr322753 2723 --1604 12936
NM_198159chr322753 2723 --1604 12936
NM_198177chr322753 2723 --1604 12936
NM_198178chr322753 2723 --1604 12936
NM_198181chr1512806 12307 ----
NM_198204chr1731376 1221 125 --1535 --
NM_198205chr1731376 1221 125 --1535 --
NM_198236chr1----1165 --
NM_198241chr34391 168 158 63 ------
NM_198242chr34391 168 158 63 ------
NM_198243chr153968 792 232 1355 ----
NM_198244chr34391 168 158 63 ------
NM_198261chr12--1703 ----
NM_198262chr12--1703 ----
NM_198268chr133413 3270 2785 --23246 1567 --
NM_198269chr133413 3270 2785 --23246 1567 --
NM_198270chrX21298 23 --11333 --
NM_198273chr51198 --12710 --
NM_198279chrX11207 ------
NM_198281chr433013 1358 915 12793 ----
NM_198291chr2061934 1906 1329 739 562 34 ------
NM_198324chr12------1206
NM_198353chr41534 ------
NM_198390chr1631751 576 96 ------
NM_198513chr82700 231 ------
NM_198516chr11192 ------
NM_198530chr1741244 1188 1008 91 ------
NM_198560chr3163566 3445 2680 2668 2494 1511 1444 1398 1186 746 397 375 360 294 170 159 11363 23687 3253 --
NM_198573chr95380 152 116 86 56 ------
NM_198581chr255904 5759 5431 2642 1048 ------
NM_198597chr102918 864 1646 1720 --
NM_198793chr331214 1175 376 ------
NM_198859chr3114979 4661 4321 3690 3231 3201 2021 1547 1144 969 328 --1245 --
NM_198880chr33291 278 271 ------
NM_198896chr1122159 654 --1344 --
NM_198900chr12157518 7001 6500 5683 5342 4738 2656 2543 2375 2274 2001 1837 1404 396 182 ------
NM_198902chr152549 132 ------
NM_198956chr71480 --2610 516 1398
NM_198968chr1343073 2710 1562 1014 --21567 487 --
NM_198969chr192671 265 --1221 --
NM_198970chr192671 265 --1221 --
NM_198993chr1761705 553 505 416 384 43 --11082 --
NM_199054chr1971530 1457 1427 799 691 510 108 --1518 --
NM_199129chr2061236 1171 949 388 374 23 1263 ----
NM_199131chr10103423 3069 2306 1268 1223 1068 845 445 84 35 13354 ----
NM_199138chr1331064 965 372 ------
NM_199144chr2051212 1001 520 431 364 ------
NM_199160chr941926 1429 408 96 --1482 --
NM_199168chr1021176 428 ------
NM_199185chr5----1204 --
NM_199188chr121332 13375 ----
NM_199190chr121332 13375 ----
NM_199203chr2051212 1001 520 431 364 ------
NM_199229chr261732 1713 1580 1523 1097 479 ------
NM_199245chr1282184 1939 932 366 318 252 124 66 --1863 1311
NM_199262chr17102246 1987 1855 1744 1636 835 567 534 413 394 ------
NM_199320chr432581 910 819 --12723 --
NM_199320chr432581 910 819 --12723 --
NM_199324chr422982 2951 ------
NM_199330chr153694 625 525 ------
NM_199331chr153694 625 525 ------
NM_199332chr153694 625 525 ------
NM_199334chr173482 464 48 ------
NM_199424chr1631346 631 199 ------
NM_199436chr221186 271 --13046 --
NM_199454chr194083 3764 3317 3243 1835 1526 931 617 598 --14287 --
NM_199462chr1114685 4370 3486 3432 3123 1988 1796 1536 945 778 620 11496 23362 492 24206 4018
NM_201266chr232618 850 754 --1821 --
NM_201267chr22396 185 ------
NM_201269chr111181 ------
NM_201279chr232618 850 754 --1821 --
NM_201428chr1121634 455 ------
NM_201429chr1121634 455 ------
NM_201430chr1121560 381 ------
NM_201535chr144712 705 691 618 ------
NM_201536chr144712 705 691 618 ------
NM_201537chr144712 705 691 618 ------
NM_201538chr144712 705 691 618 ------
NM_201539chr144712 705 691 618 ------
NM_201540chr144712 705 691 618 ------
NM_201541chr144712 705 691 618 ------
NM_201567chr321393 117 --11194 --
NM_201568chr111614 2661 269 ----
NM_201569chr111614 2661 269 ----
NM_201570chr1011947 ----1210
NM_201571chr1011947 ----1210
NM_201572chr1011947 ----1210
NM_201590chr1011947 ----1210
NM_201593chr1011947 ----1210
NM_201596chr1011947 ----1210
NM_201597chr1011947 ----1210
NM_201630chr13524 119 68 ------
NM_203301chr14------1393
NM_203318chr1761064 912 880 456 291 51 --11140 --
NM_203327chr2044103 3315 1491 24 --32915 1659 1587 --
NM_203344chr19151 --1169 --
NM_203346chr25699 437 267 179 149 --21516 686 --
NM_203349chr15--11962 ----
NM_203350chr131181 1095 79 ------
NM_203351chr1782293 1852 1792 1671 929 813 422 343 ------
NM_203364chr1121238 1094 ------
NM_203394chr1212072 12411 ----
NM_203399chr12790 266 ------
NM_203401chr12790 266 ------
NM_203458chr132747 2402 426 1718 1434 --
NM_203459chr112391 12599 ----
NM_203494chr151169 --1187 --
NM_203506chr1731975 1802 880 ------
NM_205768chr12626 547 ------
NM_205842chr22176 46 ------
NM_205860chr132957 2015 1978 12697 ----
NM_205861chr14780 173 118 71 --1237 --
NM_206594chr1----11173 --
NM_206595chr1----11173 --
NM_206852chr14143 ------
NM_206853chr624046 4034 22967 733 ----
NM_206854chr635307 5295 139 24228 1994 ----
NM_206855chr646272 6260 1104 524 15193 1861 --
NM_206857chr14143 ------
NM_206866chr2142753 2148 738 671 ------
NM_206876chr223486 2306 1882 1366 --
NM_206907chr523086 472 ----13080
NM_206909chr897822 7204 6607 6290 2994 2888 2596 1152 964 166 ----
NM_206914chr1221501 129 ----11667
NM_207012chr1043251 3085 2930 1321 1605 ----
NM_207121chr201558 1123 ----
NM_207170chr12717 193 ------
NM_207171chr111658 --11529 --
NM_207292chr3----23242 52 --
NM_207293chr3----23242 52 --
NM_207294chr3----23242 52 --
NM_207295chr3----23242 52 --
NM_207296chr3----23242 52 --
NM_207297chr3----23267 77 --
NM_207304chr1322455 529 ------
NM_207337chr12--1157 ----
NM_207349chr203533 508 287 ------
NM_207372chr1022420 684 ------
NM_207411chr883478 3200 3115 2909 2794 2744 2273 746 ------
NM_207577chr1162798 2742 952 457 329 119 ------
NM_212558chr922619 78 42850 481 137 111 24271 459 --
NM_213589chr234572 1157 468 21440 95 11278 --
NM_213606chr1031001 451 429 1702 ----
NM_213609chr31923 ------
NM_213618chr113648 68 50 ------