TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1911-5p
miRNA Sequence: UGAGUACCGCCAUGUCUGUUGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51468 ------
NM_000038chr53757 634 400 ------
NM_000084chrX66468 2390 2261 1293 940 494 --1684 --
NM_000108chr71129 ------
NM_000109chrX22503 202 ------
NM_000125chr663401 3327 2664 1030 890 494 ------
NM_000138chr1531879 677 422 1496 --11914
NM_000161chr1451837 1442 1325 674 446 1794 ----
NM_000165chr631331 222 56 --11287 1105
NM_000170chr91527 --1206 --
NM_000176chr543856 2748 746 684 --12886 11566
NM_000192chr1231544 1202 518 ------
NM_000214chr2011231 ------
NM_000248chr332938 558 485 ------
NM_000267chr1723472 2664 --1582 --
NM_000282chr131211 ------
NM_000314chr102682 493 12524 ----
NM_000330chrX12096 ------
NM_000332chr667062 6930 5813 5467 2131 1943 12195 15425 --
NM_000338chr152767 67 ------
NM_000346chr1711333 ------
NM_000361chr2031782 843 795 ------
NM_000388chr321251 1043 ------
NM_000430chr171784 1158 ----
NM_000435chr191909 --1859 --
NM_000439chr522307 204 --12542 --
NM_000449chr11235 ------
NM_000461chr333040 1633 655 --1172 --
NM_000480chr1121280 1178 21290 578 --11219
NM_000484chr212445 192 --1742 --
NM_000489chrX33255 2646 1013 1451 ----
NM_000492chr721010 463 --1227 --
NM_000533chrX11237 --1345 --
NM_000555chrX57739 6909 5650 620 95 15969 163 --
NM_000572chr12857 280 ------
NM_000610chr1132341 682 316 12786 ----
NM_000615chr1112887 22660 656 ----
NM_000627chr21599 ------
NM_000633chr1844566 4288 3698 1761 ------
NM_000640chrX129 ------
NM_000663chr1623117 1147 ------
NM_000702chr122232 2220 1889 ----
NM_000756chr8166 1178 ----
NM_000813chr533594 1975 254 13876 ----
NM_000814chr1554148 3564 855 737 487 ------
NM_000817chr21811 ------
NM_000826chr442413 1673 1631 567 22211 1950 ----
NM_000829chr1152329 2220 1520 1487 892 22066 1513 ----
NM_000844chr33990 705 350 ------
NM_000868chrX42541 636 602 143 12251 ----
NM_000876chr61343 11439 ----
NM_000899chr1244317 4011 2820 1743 --13823 --
NM_000902chr322792 711 --12429 --
NM_000908chr51749 ------
NM_000926chr1199224 7308 6541 5979 1914 1708 1309 781 736 13352 --18616
NM_000935chr31909 ------
NM_000949chr51269 ------
NM_000950chrX43584 2587 1187 632 1459 ----
NM_000958chr51465 188 1870 --
NM_000964chr171495 ------
NM_001001323chr1242199 2073 474 378 12546 ----
NM_001001389chr1132341 682 316 12786 ----
NM_001001390chr1132341 682 316 12786 ----
NM_001001391chr1132341 682 316 12786 ----
NM_001001392chr1132387 728 362 12832 ----
NM_001001419chr533687 3609 417 33408 1667 175 ----
NM_001001420chr533687 3609 417 33408 1667 175 ----
NM_001001549chr722815 2723 21777 429 1915 --
NM_001001550chr722815 2723 21777 429 1915 --
NM_001001555chr722815 2723 21777 429 1915 --
NM_001001852chr221921 ------
NM_001001890chr2121692 743 1827 ----
NM_001001995chrX31603 1190 1183 11369 ----
NM_001002838chrX41853 1793 1167 150 11654 ----
NM_001002919chr22521 194 ------
NM_001003652chr1888202 7738 7187 5936 3238 2091 1897 1059 26091 1240 36600 1670 1588 --
NM_001003681chr2221990 1983 12124 ----
NM_001003688chr421166 50 11140 ----
NM_001003712chr1262700 2663 1615 325 300 136 ------
NM_001003800chr973463 3100 1170 978 827 611 77 --23261 2829 12361
NM_001003927chr172180 63 ------
NM_001004051chrX1224 ------
NM_001004317chr624172 542 ----12992
NM_001004346chr431210 249 105 ------
NM_001005335chr192292 96 ------
NM_001005360chr191818 ------
NM_001005361chr191818 ------
NM_001005362chr191818 ------
NM_001005526chr2146 ------
NM_001005739chr2--1842 ----
NM_001005910chr3--1553 ----
NM_001005911chr3--1553 ----
NM_001006600chr542328 897 525 417 --1872 --
NM_001006636chr21653 --1676 --
NM_001006945chr11604 1477 ----
NM_001007027chr111105 ------
NM_001007097chr975077 4453 4057 3887 3221 319 40 ------
NM_001007102chr631647 1329 193 ------
NM_001007246chr2121375 349 --11437 --
NM_001007466chr654737 4699 4227 1274 474 11514 ----
NM_001007559chr1832043 1791 1409 ------
NM_001008239chr1842613 1264 1000 761 --11512 --
NM_001008405chr721809 675 ------
NM_001008495chr822082 634 ----12040
NM_001008564chr13------1868
NM_001008895chr1311078 ------
NM_001008897chr62171 135 ------
NM_001009554chr434698 3060 1807 ------
NM_001009554chr434698 3060 1807 ------
NM_001009571chr71546 21688 493 ----
NM_001009881chr11622 ------
NM_001009882chr11622 ------
NM_001009899chr365897 5845 4614 1146 867 214 --11502 --
NM_001009909chr1133716 509 314 ------
NM_001009959chr242442 1975 426 375 ------
NM_001009960chr732834 786 189 --12863 --
NM_001010844chr6126 ------
NM_001010853chr63892 840 192 12562 ----
NM_001010891chr555794 2455 1167 169 96 16464 14597 11253
NM_001010908chr102735 510 ------
NM_001010986chrX22067 596 --1255 --
NM_001011515chr421056 751 ------
NM_001011516chr421056 751 ------
NM_001011537chr332304 2291 619 1325 11613 --
NM_001011553chr7--2945 196 ----
NM_001012337chr3149 ------
NM_001012514chr2194 --1889 --
NM_001012516chr2194 --1889 --
NM_001012732chr421231 1186 --11248 --
NM_001012755chrX63562 1719 1568 1521 1053 179 ----11656
NM_001012968chrX52071 710 606 228 176 ------
NM_001013620chr1263282 3243 2466 1650 1417 790 32475 1466 1148 ----
NM_001013843chr151808 ------
NM_001014283chr1322039 1403 ------
NM_001015877chrX32826 2746 2270 12219 13089 --
NM_001017371chr21341 --1209 --
NM_001017395chr3--12809 12949 --
NM_001017405chr42243 179 ------
NM_001017424chr111780 ------
NM_001017425chr111780 ------
NM_001017523chr1221292 1183 ------
NM_001017922chr111749 ------
NM_001018037chr92397 112 21215 571 ----
NM_001018041chr6------190
NM_001018064chr951560 769 434 163 37 ------
NM_001018065chr964742 2256 1383 782 715 189 ------
NM_001018066chr964742 2256 1383 782 715 189 ------
NM_001018067chr154869 4212 1704 1221 635 ----15012
NM_001018068chr154869 4212 1704 1221 635 ----15012
NM_001018069chr154869 4212 1704 1221 635 ----15012
NM_001018072chr1221292 1183 ------
NM_001018074chr543856 2748 746 684 --12886 11566
NM_001018075chr543856 2748 746 684 --12886 11566
NM_001018076chr543856 2748 746 684 --12886 11566
NM_001018077chr543856 2748 746 684 --12886 11566
NM_001018088chr15----1175 --
NM_001018090chr1532130 939 215 12631 ----
NM_001018091chr1532240 1049 325 12741 ----
NM_001018102chr1532130 939 215 12631 ----
NM_001020825chr521331 223 --1361 --
NM_001023587chr31397 --11141 --
NM_001024071chr143859 347 191 ------
NM_001024094chr543856 2748 746 684 --12886 11566
NM_001024463chr151768 11178 152 --
NM_001024649chr542770 2685 2220 438 ------
NM_001024666chrX1627 ------
NM_001024809chr171495 ------
NM_001024847chr312171 12368 ----
NM_001024855chr351910 1672 1485 1395 252 ----11880
NM_001024916chr91118 ------
NM_001024947chr51757 ------
NM_001024948chr133351 2613 1361 ------
NM_001025076chr1066164 6077 4873 2469 1160 789 14624 11104 15014
NM_001025077chr1077522 7435 6231 2518 2147 479 243 35982 5103 4799 12462 16372
NM_001025079chr342608 1225 1128 898 --23912 676 13163
NM_001025105chr521549 1158 --1980 --
NM_001025108chr21578 ------
NM_001025201chr22669 540 ------
NM_001025252chr822098 2003 13223 11176 --
NM_001025253chr822098 2003 13223 11176 --
NM_001025266chr331544 1526 1483 13080 11364 --
NM_001025366chr621748 1305 ----11233
NM_001025366chr621748 1305 ----11233
NM_001025367chr621748 1305 ----11233
NM_001025367chr621748 1305 ----11233
NM_001025368chr621748 1305 ----11233
NM_001025368chr621748 1305 ----11233
NM_001025369chr621764 1321 ----11249
NM_001025369chr621764 1321 ----11249
NM_001025370chr621748 1305 ----11233
NM_001025370chr621748 1305 ----11233
NM_001025389chr1121280 1178 21290 578 --11219
NM_001025390chr1121280 1178 21290 578 --11219
NM_001025580chrX33046 3020 525 ------
NM_001025595chr421667 1046 21575 1406 ----
NM_001025603chr11235 ------
NM_001029860chr81259 ------
NM_001029884chr652578 2229 1667 647 553 ------
NM_001030001chr141137 ------
NM_001030006chr171318 ------
NM_001030007chr1663011 2852 2703 1196 913 435 23331 1490 22817 729 --
NM_001030055chr1464235 2899 1712 1507 1501 1064 11105 24668 143 13674
NM_001030287chr111176 11120 ----
NM_001031623chr61230 ------
NM_001031684chr21537 ------
NM_001031695chr2284840 3930 1629 1190 1038 859 708 422 15252 14392 --
NM_001031716chr21919 1386 --1894
NM_001031732chr423554 2602 ------
NM_001031738chr23499 490 96 ------
NM_001031812chr552150 1563 668 594 528 ------
NM_001032280chr611631 11600 11241 --
NM_001032289chrX1139 ------
NM_001032296chr1331850 1091 769 ----12560
NM_001033044chr131675 1607 384 ------
NM_001033056chr131675 1607 384 ------
NM_001033503chr51362 ------
NM_001033557chr211306 ------
NM_001033561chr171905 1215 ----
NM_001033756chr621682 1239 ----11167
NM_001033756chr621682 1239 ----11167
NM_001033925chr1021738 1457 21782 1579 ----
NM_001034841chr1641945 1886 1564 441 12061 ----
NM_001035260chr101410 ------
NM_001035521chr22602 522 ------
NM_001037132chr722108 444 11376 1219 --
NM_001037133chr722108 444 11376 1219 --
NM_001037174chr222185 1775 --22177 1414 --
NM_001037535chrX51386 1298 600 477 357 ------
NM_001037536chrX51386 1298 600 477 357 ------
NM_001037540chrX51386 1298 600 477 357 ------
NM_001037872chr2159 ------
NM_001037954chr1143393 963 833 559 1430 --1181
NM_001039457chr11277 ------
NM_001039577chr143688 3645 3369 3138 33464 1471 961 14037 --
NM_001039590chrX13587 12497 22667 1077 --
NM_001039591chrX13587 12497 22667 1077 --
NM_001039618chr1155495 4833 4354 3911 1190 25556 4324 15648 --
NM_001039762chr1012001 --1180 --
NM_001040152chr795075 4551 4204 1851 648 546 454 310 140 24740 668 ----
NM_001040284chr1675640 5053 4411 2187 1824 1214 819 1340 ----
NM_001040440chr54447 191 169 139 ------
NM_001040446chr51480 ------
NM_001040450chr1522680 583 1941 ----
NM_001040453chr1522680 583 1941 ----
NM_001040619chr111626 11570 ----
NM_001040665chr753616 3249 1769 1508 949 ------
NM_001040712chr922817 1070 11361 ----
NM_001040876chr431628 601 571 2707 371 ----
NM_001042404chr121776 499 1469 ----
NM_001042413chr963608 3249 1621 1420 940 68 11041 ----
NM_001042414chr131246 ------
NM_001042425chr611631 11600 11241 --
NM_001042453chrX21107 228 ------
NM_001042492chr1723472 2664 --1582 --
NM_001042493chr621520 1423 ------
NM_001042494chr1523574 3534 1355 ----
NM_001042495chr1523574 3534 1355 ----
NM_001042496chr1523574 3534 1355 ----
NM_001042497chr1523574 3534 1355 ----
NM_001042533chr342477 2260 2229 1213 --13124 --
NM_001042537chrX22336 908 ------
NM_001042543chr411396 ------
NM_001042555chr1243363 3187 1871 1259 24482 1885 1170 14667
NM_001042599chr216646 27017 2575 16620 15354
NM_001042603chr1264134 3894 1579 1533 908 401 13666 --1480
NM_001044385chr233752 3303 3159 ------
NM_001044722chr552150 1563 668 594 528 ------
NM_001044723chr552150 1563 668 594 528 ------
NM_001071775chr1321957 264 ------
NM_001076chr41164 ------
NM_001076chr41164 ------
NM_001079874chr142116 1828 1695 177 1597 ----
NM_001083620chr442411 1672 1630 566 22209 1948 ----
NM_001083621chr124287 4071 --1753 11693
NM_001099678chr346218 5833 5671 1319 46124 5729 2005 721 --14587
NM_001105518chr1----1836 --
NM_001106chr397596 7557 7343 6268 3181 2388 2226 650 258 --18484 --
NM_001128chr1663011 2852 2703 1196 913 435 23331 1490 22817 729 --
NM_001146chr842239 1886 1848 1539 1206 12274 --
NM_001153chr23918 253 194 --1771 --
NM_001156chr101425 1495 ----
NM_001167chrX65652 5222 4465 1757 536 184 26767 278 ----
NM_001173chr1464235 2899 1712 1507 1501 1064 11105 24668 143 13674
NM_001174chrX22126 635 12054 ----
NM_001177chr122586 72 ------
NM_001186chr2112069 ------
NM_001200chr20--1846 ----
NM_001204chr225948 5783 27328 1633 ----
NM_001206chr933124 775 54 12944 ----
NM_001241chr222368 2305 22399 2359 --11805
NM_001241chr222368 2305 22399 2359 --11805
NM_001256chr1752139 2004 1847 706 616 12609 --12572
NM_001257chr1651555 1134 392 319 164 ------
NM_001259chr744587 4179 4015 1078 46203 2305 1672 1546 25087 393 --
NM_001273chr12------1399
NM_001280chr191102 ------
NM_001282chr171318 ------
NM_001304chr1773009 2563 1472 804 461 185 137 ------
NM_001315chr631803 904 893 12231 ----
NM_001349chr21124 1572 --1134
NM_001357chr11268 ------
NM_001380chr101990 ------
NM_001386chr832339 1660 763 12001 ----
NM_001390chr1813479 ------
NM_001396chr2121717 998 ------
NM_001402chr621677 224 --11584 12018
NM_001408chr121596 1361 ----1164
NM_001412chrX23382 2725 13312 13087 --
NM_001423chr1231899 1627 207 ------
NM_001430chr232029 1806 84 --1766 --
NM_001438chr143522 2781 2626 859 11443 ----
NM_001483chr71717 ------
NM_001490chr911389 1328 --13519
NM_001521chr22602 522 ------
NM_001530chr141225 ------
NM_001533chr192292 96 ------
NM_001555chrX--1273 ----
NM_001564chr41142 ------
NM_001565chr43538 322 253 --1742 --
NM_001609chr1054465 4174 4074 735 561 ------
NM_001614chr171216 1569 ----
NM_001614chr171216 1569 ----
NM_001616chr243406 2391 2278 2239 --12551 --
NM_001642chr111457 ------
NM_001650chr1853578 3037 1627 796 607 11210 ----
NM_001656chr51153 ------
NM_001663chr1412717 --11890 --
NM_001665chr11----1219 --
NM_001674chr111176 11120 ----
NM_001678chr17193 ------
NM_001682chr1241913 1787 188 92 12260 ----
NM_001690chr332486 2014 354 --21933 412 --
NM_001695chr854274 3808 3763 738 78 11028 ----
NM_001714chr121428 ------
NM_001742chr731562 165 74 --1317 --
NM_001746chr542770 2685 2220 438 ------
NM_001753chr711726 ------
NM_001754chr2121692 743 1827 ----
NM_001755chr1651564 850 838 450 151 ------
NM_001759chr1255059 3845 1980 1401 912 11393 ----
NM_001769chr121291 1121 ----
NM_001777chr342608 1225 1128 898 --23912 676 13163
NM_001788chr7--2945 196 ----
NM_001797chr162705 76 ------
NM_001806chr1922687 1003 12092 12482 --
NM_001822chr22669 540 ------
NM_001827chr9--166 ----
NM_001829chr421006 222 ------
NM_001830chrX23888 3042 13654 11505 --
NM_001839chr12265 115 1556 ----
NM_001858chr663203 1904 1806 1673 1633 842 33868 3654 1163 1876 --
NM_001873chr4--1205 ----
NM_001882chr52173 109 ------
NM_001892chr521549 1158 --1980 --
NM_001918chr178975 5752 3319 3119 2671 970 243 27008 6652 11024 --
NM_001921chr421231 1186 --11248 --
NM_001924chr11353 ------
NM_001938chr121920 416 11394 1119 --
NM_001939chrX53871 3823 2601 1414 585 13072 13139 --
NM_001955chr6--1940 ----
NM_001962chr51518 ------
NM_001968chr42166 21 ------
NM_001977chr431383 411 227 1196 ----
NM_001978chr81964 ------
NM_001981chr172058 2018 1718 1483 912 407 36 --1953 --
NM_001993chr11206 --1866 1995
NM_002009chr1532275 734 666 --11841 --
NM_002015chr1352152 1012 907 874 33 13220 ----
NM_002024chrX32095 661 155 12043 ----
NM_002025chrX69144 7398 7036 6316 1815 1760 17940 ----
NM_002031chr62650 544 ------
NM_002040chr2121288 949 11083 ----
NM_002054chr2194 ------
NM_002065chr131675 1607 384 ------
NM_002073chr2211161 ------
NM_002077chr922090 704 11884 ----
NM_002092chr444907 1022 1000 406 ------
NM_002107chr11166 ------
NM_002114chr6--1426 ----
NM_002128chr1331712 1706 193 ------
NM_002130chr571215 1101 392 347 323 227 159 ------
NM_002140chr9141 ------
NM_002145chr171118 ------
NM_002146chr1721237 1160 11275 ----
NM_002147chr172906 601 ------
NM_002148chr21447 ------
NM_002149chr22767 629 ------
NM_002194chr2--1142 ----
NM_002196chr201345 ------
NM_002196chr201345 ------
NM_002203chr532628 439 125 23034 1349 ----
NM_002210chr263143 3032 2437 1232 991 219 ----1433
NM_002247chr1031535 717 395 22186 1871 ----
NM_002266chr17146 ------
NM_002267chr131795 ------
NM_002270chr545094 4999 4971 1624 ----1959
NM_002285chr21578 ------
NM_002293chr12538 391 ------
NM_002310chr565181 4667 2628 1966 1414 260 14471 ----
NM_002336chr1294894 4788 4642 4023 3994 3946 3740 3315 1577 ----13143
NM_002351chrX124 ------
NM_002382chr1421011 212 ------
NM_002387chr575036 4488 4289 4174 1628 1142 79 34696 4683 4594 ----
NM_002399chr1511293 ------
NM_002430chr2242567 1968 961 913 1692 1625 --
NM_002444chrX41952 1630 1403 1376 11934 1285 --
NM_002469chr122485 380 ------
NM_002481chr157909 6727 5936 4870 1310 17517 12959 --
NM_002487chr153592 227 170 3160 100 79 ----
NM_002500chr2188 1281 ----
NM_002524chr1188 11005 ----
NM_002544chr17--1103 ----
NM_002547chrX74146 3558 3341 2776 1558 556 201 ------
NM_002577chr343532 3266 1262 345 23114 2915 ----
NM_002581chr955117 2013 1440 747 59 15043 ----
NM_002590chr132154 144 ------
NM_002595chr1211613 ------
NM_002613chr1673732 3714 3377 1384 1024 789 237 --14362 --
NM_002623chr20--1188 ----
NM_002628chr31957 ------
NM_002633chr11489 189 ----
NM_002655chr854881 4477 4010 3778 204 35043 5032 4616 ----
NM_002656chr6129 ------
NM_002657chr201235 ------
NM_002667chr6--1168 ----
NM_002687chr1421100 162 ------
NM_002706chr21589 ------
NM_002709chr232668 1104 1097 ------
NM_002718chr322317 601 11060 ----
NM_002729chr10----1118 --
NM_002731chr132875 802 312 ----11034
NM_002734chr1711729 21833 259 ----
NM_002736chr741740 853 758 234 ------
NM_002738chr1621073 1032 1892 1380 --
NM_002740chr332045 626 24 22228 1972 ----
NM_002745chr2264556 4097 3823 3740 3607 248 44571 1154 788 39 11824 --
NM_002753chr4--1595 ----
NM_002764chrX163 ------
NM_002787chr71466 --2490 447 --
NM_002823chr21247 1506 ----
NM_002828chr18--1264 ----
NM_002833chr152597 490 ------
NM_002834chr1222880 2781 1764 ----
NM_002835chr7174 ------
NM_002839chr922817 1070 11361 ----
NM_002845chr183435 231 63 ------
NM_002851chr71252 ------
NM_002858chr121212 856 ------
NM_002865chr8--1196 ----
NM_002866chr19------1539
NM_002869chr111304 1695 ----
NM_002886chr321725 1290 --13939 --
NM_002890chr5--1994 ----
NM_002893chrX1246 ------
NM_002895chr201702 ------
NM_002940chr431628 601 571 2707 371 ----
NM_002970chrX------1309
NM_002971chr33862 234 40 ------
NM_002990chr1622282 1747 ------
NM_003016chr172653 548 11948 ----
NM_003028chr931097 450 119 12672 12466 --
NM_003034chr1286907 6689 6528 3113 2668 2213 1787 36 38053 7857 2683 37920 6275 3208 --
NM_003051chr131943 796 638 ----189
NM_003054chr101276 ------
NM_003069chrX--1231 1239 --
NM_003071chr31135 1303 ----
NM_003081chr20171 ------
NM_003095chr121384 190 ----
NM_003108chr235720 2602 907 24542 2162 ----
NM_003111chr21341 --1209 --
NM_003112chr753149 2153 404 367 129 ------
NM_003113chr21189 ------
NM_003133chr1183 133 ----
NM_003144chr621788 498 ------
NM_003157chr32960 309 ------
NM_003179chrX11399 ------
NM_003182chr71402 ------
NM_003182chr71402 ------
NM_003199chr1865449 5418 4690 3933 1669 436 ----1473
NM_003205chr1512246 --11607 --
NM_003220chr611631 11600 11241 --
NM_003221chr613689 ----13966
NM_003222chr2031254 1025 296 ------
NM_003242chr312171 12368 ----
NM_003246chr1541656 529 323 48 11287 ----
NM_003257chr1521057 219 ------
NM_003262chr341993 1574 727 271 ------
NM_003269chr621200 1175 11305 ----
NM_003272chr11244 --1650 --
NM_003274chr211625 --12894 --
NM_003290chr191270 ------
NM_003291chr131706 ------
NM_003298chr352428 1726 991 971 75 25153 4625 11694 --
NM_003319chr21722 ------
NM_003338chr10--1384 ----
NM_003339chr51188 1456 ----
NM_003340chr41513 ------
NM_003341chr31104 ------
NM_003342chr1743262 871 696 679 ------
NM_003344chr721640 1155 ------
NM_003350chr83945 862 248 ------
NM_003372chrX2939 214 ------
NM_003373chr1031822 653 212 ----11396
NM_003374chr51722 ------
NM_003376chr621748 1305 ----11233
NM_003376chr621748 1305 ----11233
NM_003380chr101238 ------
NM_003392chr344349 3727 3118 1354 13407 ----
NM_003400chr2166 ------
NM_003403chr141587 ----1782
NM_003406chr831818 1536 272 --1415 1731
NM_003410chrX22986 2656 22100 379 22037 325 --
NM_003411chrY1579 --1310 --
NM_003412chr32692 638 --12786 --
NM_003432chr51396 ------
NM_003442chr111844 1694 ----
NM_003453chr131133 ------
NM_003470chr1621882 1326 ------
NM_003474chr1022380 750 21676 941 2187 166 --
NM_003478chr113993 607 365 ------
NM_003489chr2123067 2581 --22188 354 --
NM_003507chr231715 1555 735 ------
NM_003566chr1222934 2337 161 12962 --
NM_003567chr11298 ------
NM_003574chr1865728 4546 1468 898 792 571 11057 1434 --
NM_003576chr1331850 1091 769 ----12560
NM_003589chr1311078 ------
NM_003590chr231598 548 39 1760 ----
NM_003597chr242115 1836 772 357 ----1404
NM_003603chr42525 467 ------
NM_003618chr21301 ------
NM_003626chr1111182 ------
NM_003631chr101823 1307 1782 1904
NM_003633chr542515 1865 1770 1590 ------
NM_003659chr21184 ------
NM_003663chr333355 3036 2165 13315 13303 --
NM_003670chr331319 1191 1084 --1421 --
NM_003672chr11257 ------
NM_003722chr332622 935 653 12014 12671 --
NM_003749chr1321831 422 --1860 --
NM_003750chr101297 ------
NM_003759chr453818 3409 2732 1619 1302 --1689 --
NM_003772chr11--1239 ----
NM_003774chr1242646 1207 1045 660 22494 2042 ----
NM_003796chr192560 148 ------
NM_003861chr144992 854 818 406 22098 926 --12253
NM_003872chr2----12921 --
NM_003873chr1032468 466 373 ------
NM_003876chr17--161 ----
NM_003885chr1722532 682 1208 ----
NM_003887chr241880 1856 1436 546 ------
NM_003895chr2121766 499 1256 129 --
NM_003901chr10--11801 12660 --
NM_003902chr11295 ------
NM_003916chrX11435 11104 ----
NM_003932chr2261826 1536 1176 765 566 118 21317 691 --1192
NM_003934chr91435 ------
NM_003939chr1033306 1092 53 ------
NM_003972chr102974 345 ------
NM_003983chr1663202 3120 1215 1099 638 353 22903 139 34012 3168 1280 11398
NM_003994chr1244317 4011 2820 1743 --13823 --
NM_004006chrX22503 202 ------
NM_004007chrX22503 202 ------
NM_004009chrX22503 202 ------
NM_004010chrX22503 202 ------
NM_004011chrX22503 202 ------
NM_004012chrX22503 202 ------
NM_004013chrX22503 202 ------
NM_004014chrX22503 202 ------
NM_004015chrX22503 202 ------
NM_004016chrX22417 116 ------
NM_004017chrX22503 202 ------
NM_004018chrX22417 116 ------
NM_004020chrX22503 202 ------
NM_004021chrX22417 116 ------
NM_004022chrX22417 116 ------
NM_004023chrX22417 116 ------
NM_004024chr111535 11479 ----
NM_004028chr1853578 3037 1627 796 607 11210 ----
NM_004034chr101425 1495 ----
NM_004047chr11277 ------
NM_004061chr52447 238 ------
NM_004067chr721470 144 --1352 --
NM_004075chr121478 ------
NM_004086chr143625 188 61 1698 ----
NM_004098chr10----1419 --
NM_004109chr1132191 1583 733 ------
NM_004124chr1453568 3025 2526 1306 847 23260 2880 11179 --
NM_004133chr82233 112 12531 ----
NM_004162chr321184 902 1448 --11324
NM_004170chr931476 1395 758 21558 1439 ----
NM_004171chr1169329 7418 7329 1659 1077 175 ------
NM_004172chr511302 ------
NM_004180chr2--1252 ----
NM_004215chr81518 ------
NM_004229chrX11833 --12037 --
NM_004232chr1812880 1355 ----
NM_004293chr932476 781 709 23776 140 ----
NM_004330chr151850 ------
NM_004342chr741941 1632 610 547 ------
NM_004346chr431148 377 66 --1113 --
NM_004354chr43688 275 212 1739 ----
NM_004356chr111103 ------
NM_004376chr1021284 1157 1234 1273 --
NM_004379chr21546 ------
NM_004384chr552150 1563 668 594 528 ------
NM_004389chr2--1874 ----
NM_004392chr132840 145 ------
NM_004397chr1153696 2661 1158 848 616 --13383 --
NM_004411chr73578 150 78 --1713 --
NM_004414chr2121263 293 --11452 --
NM_004415chr64642 561 546 87 ------
NM_004419chr102959 238 --1800 --
NM_004432chr922413 2299 ------
NM_004438chr233194 2790 235 22832 552 ----
NM_004440chr621699 1429 ------
NM_004457chr22438 235 11338 ----
NM_004458chrX52569 2200 1976 1679 542 12558 ----
NM_004481chr142594 789 559 114 ------
NM_004491chr1954306 3994 2973 1703 1547 --13905 12636
NM_004496chr14--1188 ----
NM_004499chr52462 423 ------
NM_004501chr144142 2989 2870 1303 ------
NM_004506chr6----178 --
NM_004525chr2189 ------
NM_004529chr921390 471 ------
NM_004540chr211306 ----1255
NM_004575chr421188 218 ------
NM_004586chrX85416 4901 4343 4246 3855 3518 3348 841 35030 1792 1303 1724 14122
NM_004593chr33805 715 187 --1320 --
NM_004612chr944039 3997 3970 993 13121 21071 807 --
NM_004671chr182209 105 ------
NM_004690chr62727 112 1267 --1258
NM_004709chrX31721 1705 1140 11629 11601 --
NM_004713chr14--2582 291 ----
NM_004717chr7--11322 --11491
NM_004725chr102218 54 ------
NM_004726chrX75763 4564 3637 1099 395 262 250 23931 2306 14328 --
NM_004748chr1533921 3345 526 ------
NM_004772chr541460 560 466 42 --1646 --
NM_004774chr1722467 875 22916 2391 ----
NM_004775chr1821997 1557 --11958 --
NM_004788chr1122281 1859 ------
NM_004801chr221356 1101 ------
NM_004817chr92300 287 1672 ----
NM_004836chr21609 --1792 --
NM_004842chr611347 ------
NM_004857chr1424751 1394 ------
NM_004866chr584921 4851 3933 3860 3165 1253 951 61 14845 --1305
NM_004869chr1841682 530 153 35 ------
NM_004872chr11165 ------
NM_004884chr1511413 ------
NM_004890chr171224 --1280 --
NM_004891chr21220 ------
NM_004896chr101325 ------
NM_004898chr4------12074
NM_004921chr142238 953 424 215 --1147 --
NM_004922chr102875 282 ------
NM_004938chr921190 1002 ------
NM_004945chr191818 ------
NM_004946chr51422 ------
NM_004947chr312493 12396 --12313
NM_004956chr734236 1006 548 ------
NM_004973chr621596 69 1178 ----
NM_004985chr1223667 191 ------
NM_004992chrX13306 18268 ----
NM_004992chrX13306 18268 ----
NM_004998chr152883 818 2829 707 --1872
NM_005010chr722108 444 11376 1219 --
NM_005056chr1264378 4138 1823 1777 1152 645 13910 --1724
NM_005063chr1043272 2610 926 130 ------
NM_005065chr1475086 5036 4669 3587 1830 868 375 ----13556
NM_005079chr822098 2003 13223 11176 --
NM_005086chr121705 ------
NM_005097chr101291 ------
NM_005116chr2044400 3907 3555 2798 ------
NM_005121chr1732945 1405 854 43491 2952 2834 418 --11295
NM_005123chr12--1343 ----
NM_005124chr62687 70 123 ----
NM_005135chr1523574 3534 1355 ----
NM_005156chr965408 4131 1973 1235 368 164 ------
NM_005159chr1532207 1490 45 ------
NM_005160chr2245997 5470 2694 1424 11653 14903 --
NM_005180chr1031267 615 298 ------
NM_005188chr1176066 5157 3052 2476 1595 732 506 12813 16440 --
NM_005197chr1435210 5191 3842 15463 ----
NM_005233chr362275 2030 1759 982 423 203 11719 ----
NM_005235chr216646 27017 2575 16620 15354
NM_005241chr321104 550 11225 11311 --
NM_005249chr14182 1742 ----
NM_005257chr1811144 ------
NM_005277chr451952 1808 1528 659 634 11962 ----
NM_005302chr72417 399 ------
NM_005311chr722815 2723 21777 429 1915 --
NM_005313chr151268 ------
NM_005318chr22--21114 223 ----
NM_005339chr444217 4006 2744 458 12712 12757 --
NM_005349chr41449 ------
NM_005358chr1331533 434 342 11322 ----
NM_005359chr1846341 1852 1038 767 ------
NM_005376chr11903 ------
NM_005387chr111635 ------
NM_005399chr164255 4151 3983 3433 1258 1249 11390 ----
NM_005400chr21475 33051 2915 1205 ----
NM_005414chr32303 209 ------
NM_005415chr2----2491 52 --
NM_005433chr1812095 12426 --12344
NM_005436chr1073626 3255 2722 1239 874 277 270 ------
NM_005443chr41519 ------
NM_005475chr1213203 ------
NM_005487chr2221990 1983 12124 ----
NM_005497chr1735754 5057 4958 46125 5623 4839 4632 45088 4187 3923 316 --
NM_005502chr943051 2199 1037 335 ------
NM_005503chr1511101 ------
NM_005504chr1235882 4131 296 --21967 1472 1721
NM_005506chr43689 425 281 21795 394 ----
NM_005517chr121050 30 --1910 --
NM_005519chr101180 1125 ----
NM_005570chr1821146 21 ------
NM_005585chr151445 ------
NM_005593chr121551 ------
NM_005596chr984401 2506 1979 1625 1328 1310 543 469 14658 16270 --
NM_005604chr611754 ------
NM_005613chr11374 1631 --1606
NM_005626chr11536 ------
NM_005637chr1832043 1791 1409 ------
NM_005668chr574594 4311 3512 3266 2967 1755 172 ------
NM_005715chr622525 877 --22465 2323 --
NM_005734chr11163 ------
NM_005739chr1532226 1836 109 ------
NM_005746chr752599 2245 2070 1788 253 22733 975 ----
NM_005751chr71470 1192 ----
NM_005756chrX1481 ------
NM_005759chr264634 4604 3477 3113 1037 886 23947 3940 ----
NM_005776chr142796 213 --1777 --
NM_005802chr91314 1574 ----
NM_005832chr31249 --1491 --
NM_005840chrX67530 7082 5684 2368 1314 523 26493 835 24968 1899 --
NM_005841chr431074 952 245 11103 ----
NM_005850chr11158 ------
NM_005862chr32841 796 ------
NM_005868chr731904 1682 1627 ------
NM_005872chr11196 ------
NM_005880chr1611268 ------
NM_005882chr42243 179 ------
NM_005898chr1131250 901 817 1742 ----
NM_005899chr1721564 1297 ------
NM_005900chr421166 50 11140 ----
NM_005901chr1888202 7738 7187 5936 3238 2091 1897 1059 26091 1240 36600 1670 1588 --
NM_005902chr1514000 --11483 --
NM_005903chr533687 3609 417 33408 1667 175 ----
NM_005906chr611332 --1126 --
NM_005909chr544138 3807 3177 1073 ------
NM_005911chr231110 923 388 ------
NM_005920chr133799 3543 664 --1988 12693
NM_005924chr71423 11110 ----
NM_005933chr1112523 ------
NM_005935chr434843 3993 975 13682 ----
NM_005941chr811250 ------
NM_005955chr135469 5352 898 ----1576
NM_005964chr1721456 1245 11197 ----
NM_005966chr232249 1877 1601 ------
NM_005977chr13--2746 374 ----
NM_005994chr171652 ------
NM_006011chr1533311 1525 1004 ------
NM_006033chr181337 11613 --12049
NM_006037chr274865 4453 3883 1427 1313 1164 416 13548 ----
NM_006047chr2042994 2490 2342 1328 --1364 11223
NM_006054chr1111664 ------
NM_006080chr732760 2009 479 13000 ----
NM_006094chr842413 691 639 247 1187 1404 --
NM_006095chr462942 2866 2838 822 298 215 ------
NM_006106chr1123270 1168 23181 3002 12758 13400
NM_006107chr171377 ------
NM_006113chr142116 1828 1695 177 1597 ----
NM_006133chr111413 12379 ----
NM_006135chr11363 --1410 --
NM_006136chr721182 65 ------
NM_006153chr31500 ------
NM_006164chr22451 361 ------
NM_006180chr951560 769 434 163 37 ------
NM_006206chr452264 2043 533 527 445 ------
NM_006210chr191279 --1453 --
NM_006216chr22649 167 1567 ----
NM_006223chrX3472 132 54 ----1209
NM_006226chr231180 944 115 ------
NM_006246chr1411006 ------
NM_006252chr127244 4767 36830 5374 568 ----
NM_006256chr162727 2560 2477 2375 991 188 ----1859
NM_006257chr101976 ------
NM_006267chr241709 515 232 218 1448 ----
NM_006268chr1111187 ------
NM_006275chr201705 ------
NM_006279chr1----1591 --
NM_006282chr2044116 3714 3177 475 ------
NM_006290chr621442 64 21617 519 ----
NM_006292chr11144 ------
NM_006306chrX72176 2088 1556 1104 701 222 201 2559 543 --1480
NM_006310chr1711244 ------
NM_006313chr1221577 155 ------
NM_006330chr841419 1372 509 194 ------
NM_006350chr51252 ------
NM_006359chrX22336 908 ------
NM_006363chr201154 --1213 --
NM_006364chr1421167 1127 21019 489 ----
NM_006372chr61497 ------
NM_006375chrX21247 324 ------
NM_006380chr1764375 3658 3398 3018 2782 1342 ----1420
NM_006393chr1034233 3959 230 ----11179
NM_006413chr102300 218 ------
NM_006416chr61702 ------
NM_006421chr811062 11045 1465 --
NM_006459chr101222 1667 1139 --
NM_006465chr1522202 170 ------
NM_006469chr121401 208 --21425 1117 --
NM_006471chr18----150 --
NM_006486chr222109 74 ------
NM_006504chr1022626 1015 ------
NM_006526chr2031949 506 456 ------
NM_006527chr41230 --1563 --
NM_006529chr411387 ------
NM_006534chr2052970 2588 1159 919 132 --12321 --
NM_006539chr16197 ------
NM_006540chr8----11336 --
NM_006544chr1444429 3928 2261 348 11296 ----
NM_006547chr732018 1907 539 12055 --1575
NM_006557chr921655 298 ------
NM_006558chr8----1443 --
NM_006561chr1066164 6077 4873 2469 1160 789 14624 11104 15014
NM_006570chr92363 314 ------
NM_006575chr1431104 308 132 ----11015
NM_006585chr211110 151 ----
NM_006599chr1697341 6772 6695 5667 5489 2441 1721 1055 577 13217 1840 --
NM_006609chr241896 1884 1873 525 --11978 1488
NM_006624chr1021385 213 ------
NM_006628chr1523607 1201 --14374 --
NM_006629chr1812396 ----1769
NM_006633chr51773 --1241 --
NM_006646chr1332989 2375 1070 --178 --
NM_006654chr1243363 3187 1871 1259 24482 1885 1170 14667
NM_006660chr151305 ------
NM_006704chr131335 ------
NM_006713chr51285 1645 ----
NM_006718chr6129 ------
NM_006722chr332938 558 485 ------
NM_006729chrX65499 5323 5041 3431 1616 737 ----15166
NM_006731chr935764 4587 3608 45715 4260 3548 1926 ----
NM_006738chr1553072 1510 1236 1039 562 14017 ----
NM_006742chr16--21991 1965 ----
NM_006746chrX51386 1298 600 477 357 ------
NM_006750chr1668063 7250 5768 5759 2816 437 16662 ----
NM_006751chr21275 ------
NM_006754chr71186 ------
NM_006766chr832669 2528 966 ------
NM_006775chr622912 949 1514 ----
NM_006777chrX42738 2345 2126 494 11873 ----
NM_006789chr62386 27 ------
NM_006805chr521411 1374 1633 ----
NM_006815chr122916 359 --1527 --
NM_006826chr24837 467 379 289 ------
NM_006851chr1221085 83 ------
NM_006874chr431069 478 450 11088 ----
NM_006888chr1463404 2927 2685 2456 564 555 13521 ----
NM_006915chrX32219 357 29 ------
NM_006922chr222440 696 ------
NM_006924chr1743524 3474 2973 2915 24078 3158 ----
NM_006930chr521856 1736 197 2638 314 --
NM_006939chr14291 38 ------
NM_006956chr71642 ------
NM_006965chr1821096 1068 ------
NM_007006chr1653447 2832 2790 2731 693 13406 ----
NM_007007chr1244813 4227 3032 1098 14218 ----
NM_007011chr1521430 1320 --25066 1454 --
NM_007013chr82790 755 ------
NM_007034chr11870 1723 ----
NM_007039chr141264 ----2537 206
NM_007052chrX----1130 --
NM_007054chr523953 3509 --13186 --
NM_007073chr643222 2852 1416 1271 ------
NM_007078chr1032936 443 244 ------
NM_007106chr1311780 ------
NM_007112chr11190 ------
NM_007124chr61257 ------
NM_007129chr131906 ------
NM_007145chr1931235 1106 406 ------
NM_007157chrX42791 1871 1036 436 22874 2761 ----
NM_007176chr1431308 1152 677 ------
NM_007184chr31554 ------
NM_007185chr12835 333 ------
NM_007190chr1021121 24 ------
NM_007200chr1553072 1510 1236 1039 562 14017 ----
NM_007212chr151931 1919 535 401 320 ----12107
NM_007214chr6--1896 ----
NM_007218chr8132 ------
NM_007235chr121473 ------
NM_007249chr1377617 6780 3761 3747 2692 2036 1345 39282 8377 8243 --11961
NM_007282chr33202 157 112 ------
NM_007287chr322792 711 --12429 --
NM_007288chr322792 711 --12429 --
NM_007289chr322792 711 --12429 --
NM_007331chr432730 2400 2303 --12287 1101
NM_007347chr1521204 1099 1898 188 12623
NM_007363chrX1170 ------
NM_007373chr101606 ------
NM_007375chr142690 2673 2159 1078 12730 12508 --
NM_012073chr5--1203 ----
NM_012081chr532957 753 248 ------
NM_012082chr81657 1220 ----
NM_012096chr323642 564 --1582 --
NM_012097chr222185 1775 --22177 1414 --
NM_012129chr732511 2129 769 --11689 --
NM_012158chr131587 11817 ----
NM_012183chr1----1576 --
NM_012214chr275675 5379 4827 2149 1235 649 260 --36267 5824 348 --
NM_012223chr211166 ------
NM_012229chr1031353 436 182 ------
NM_012234chr372701 2625 2338 861 540 253 204 11355 22652 928 12828
NM_012238chr1061349 694 641 419 226 178 1459 ----
NM_012244chr1411727 ------
NM_012250chr1131388 1309 1152 ------
NM_012252chr745311 4063 3606 51 23827 1296 --1948
NM_012255chr203429 303 105 ------
NM_012262chr195038 4693 3706 3224 2032 1408 909 879 458 ------
NM_012281chr72933 797 1701 ----
NM_012297chr422581 1988 --1487 --
NM_012300chr522488 763 1932 ----
NM_012302chr11248 ------
NM_012316chr123580 131 13436 1444 12020
NM_012327chr1841358 1260 517 127 ------
NM_012345chr1341690 1564 1502 1291 1617 ----
NM_012382chr534458 1513 303 11596 ----
NM_012405chr133195 3087 2527 --1614 --
NM_012411chr1--197 ----
NM_012416chr92925 459 11230 ----
NM_012419chr6------1500
NM_012443chr101809 ------
NM_012453chr731026 988 215 ------
NM_012464chr442676 1099 513 214 1634 ----
NM_012479chr762302 1715 1087 898 642 204 --1409 --
NM_013232chr5--1416 ----
NM_013233chr211288 ------
NM_013261chr463187 3011 2562 1424 632 478 ------
NM_013262chr611393 ------
NM_013279chr1122233 835 ------
NM_013281chr201420 11342 --1538
NM_013283chr5194 ------
NM_013296chr11421 ------
NM_013300chr122212 83 ------
NM_013316chr7--1736 ----
NM_013354chr811440 ------
NM_013357chr81603 ------
NM_013363chr3130 ------
NM_013374chr332160 541 102 23098 2293 ----
NM_013386chr111515 ------
NM_013390chr9--1228 ----
NM_013423chrX21088 343 11016 ----
NM_013427chrX21088 343 11016 ----
NM_013437chr811297 --11431 --
NM_013438chr911415 ----21747 1674
NM_013441chr11428 ------
NM_013448chr141508 ------
NM_013450chr211177 ------
NM_013956chr8158 ------
NM_013957chr8158 ------
NM_013960chr81734 ------
NM_013964chr8158 ------
NM_013995chrX61881 817 772 664 554 404 1825 ----
NM_013996chr71402 ------
NM_013996chr71402 ------
NM_013997chr71402 ------
NM_013997chr71402 ------
NM_013998chr71402 ------
NM_013998chr71402 ------
NM_014000chr1031822 653 212 ----11396
NM_014010chr9158 ------
NM_014011chr23675 585 269 ------
NM_014021chr142380 2311 1006 292 --2680 594 --
NM_014031chr51302 ------
NM_014035chr521389 1219 --1170 --
NM_014048chr1674735 4598 4382 3279 1410 886 623 21739 1698 1455 --
NM_014051chr6--2516 509 ----
NM_014089chr13------1868
NM_014112chr854882 4237 1833 1286 807 13355 ----
NM_014117chr1642418 663 583 157 1724 22017 761 --
NM_014141chr732100 377 280 ------
NM_014154chr321443 1433 11551 ----
NM_014155chr1196605 6016 5934 5683 2991 2035 1196 852 798 15964 12776 --
NM_014181chr232400 1889 414 ------
NM_014210chr172180 63 ------
NM_014217chr111780 ------
NM_014231chr1242196 2155 1886 256 ------
NM_014248chr221144 ------
NM_014250chr2221990 1983 12124 ----
NM_014253chrX21890 153 21838 220 ----
NM_014263chr1021464 1194 ------
NM_014280chr16896 886 718 706 295 254 ------
NM_014283chr111277 ------
NM_014289chrX21178 1136 11338 ----
NM_014290chr91196 ------
NM_014309chr2284830 3920 1619 1180 1028 849 698 412 15242 14382 --
NM_014317chr101259 ------
NM_014319chr1221918 762 1561 ----
NM_014345chr61412 ------
NM_014363chr133866 358 64 1519 ----
NM_014372chr121577 196 11359 ----
NM_014415chr311271 ------
NM_014423chr535451 5154 3686 --15316 14418
NM_014447chr421666 1045 21574 1405 ----
NM_014454chr651075 1030 1023 405 67 ------
NM_014458chr12147 39 11190 --1320
NM_014504chr712094 ------
NM_014517chr3--127 ----
NM_014521chr21408 ------
NM_014572chr1321670 1195 ------
NM_014577chr222853 716 1584 ----
NM_014586chr2144546 4395 4196 3996 1254 ----
NM_014603chr1711714 ------
NM_014612chr911295 11066 ----
NM_014615chr1653603 3550 3087 2369 771 13006 ----
NM_014634chr221726 ------
NM_014659chr151768 11178 152 --
NM_014667chr372479 2167 1845 974 961 701 165 22447 68 ----
NM_014670chr2--11567 ----
NM_014682chr862125 1897 1872 1598 722 259 ------
NM_014683chr171342 2749 412 11653 --
NM_014707chr711470 ------
NM_014711chr1611434 ------
NM_014717chr191864 ------
NM_014721chr6107401 6964 6939 6905 6899 6147 2934 2252 1628 154 17183 27309 5045 --
NM_014733chr531767 1614 669 21879 1426 --11827
NM_014735chrX2791 250 ------
NM_014741chr1122184 1372 22153 665 ----
NM_014746chr264280 3862 1319 1283 494 258 1857 ----
NM_014751chr821832 133 1874 ----
NM_014752chr1131459 1339 302 ------
NM_014755chr223152 689 24197 926 11701 --
NM_014757chr512257 11654 11555 12077
NM_014761chr1611167 1845 ----
NM_014772chr1813090 ------
NM_014795chr24878 478 440 176 ------
NM_014807chr111647 --2580 261 1319
NM_014810chr133354 3083 165 1111 ----
NM_014812chr121776 499 1469 ----
NM_014813chr11552 ------
NM_014824chr1131737 1232 805 ------
NM_014827chr12507 360 1385 ----
NM_014828chr1412022 2649 361 ----
NM_014829chr521560 361 --22165 140 --
NM_014830chr12--32899 2601 2378 --12743
NM_014839chr152010 1905 772 724 457 ------
NM_014840chr1253231 2916 1277 1252 277 ------
NM_014841chr611065 ------
NM_014864chr154320 4136 3850 3710 143 ------
NM_014870chr124287 4071 --1753 11693
NM_014873chr174381 4245 4176 2967 1624 851 601 13087 ----
NM_014877chr1767140 6607 6554 2715 2442 807 27707 1694 ----
NM_014892chr61457 ------
NM_014893chrY----1567 --
NM_014899chr523039 2312 ------
NM_014903chr1272341 1943 1837 813 622 447 63 ------
NM_014904chr1063862 3209 2720 612 269 263 13377 12520 --
NM_014907chr9--1113 ----
NM_014912chr1053115 2569 1156 709 217 --11166 --
NM_014915chr10------11449
NM_014917chr1--1703 ----
NM_014918chr1511582 --1540 11367
NM_014920chr623194 2890 --1501 --
NM_014923chr13--22217 633 ----
NM_014924chr1442828 2516 725 366 12205 ----
NM_014946chr243057 2851 2673 337 ------
NM_014947chr1--12772 ----
NM_014950chr1431730 1177 697 1462 ----
NM_014951chr1032557 703 526 ------
NM_014961chr432159 1602 1543 1544 ----
NM_014969chr111166 1311 ----
NM_014982chr1454949 3971 886 748 727 35275 5224 1566 ----
NM_014989chr631534 758 356 ------
NM_014990chr1421323 1211 ------
NM_014991chr422677 2389 ----13275
NM_014994chr152595 266 --1388 1420
NM_014996chr31742 --139 --
NM_015000chr1242016 1051 237 107 11161 ----
NM_015002chr1242115 2069 1516 163 1331 ----
NM_015008chr3--12809 12949 --
NM_015011chr132465 389 ------
NM_015020chr1663682 3206 2776 1469 1186 552 --13328 --
NM_015024chr821241 474 ------
NM_015026chr1231244 438 329 11746 ----
NM_015032chr1332737 572 423 ------
NM_015035chr2086281 5071 4913 4406 2622 1857 1828 1197 34236 2294 1667 16697 12648
NM_015037chr101233 ------
NM_015040chr212832 23302 3065 ----
NM_015042chr1543519 958 765 67 11300 13901 23314 221
NM_015062chr101190 ------
NM_015068chr743927 3403 3056 703 13592 1985 --
NM_015069chr161189 ------
NM_015092chr1623510 3497 ------
NM_015100chr12295 95 11257 ----
NM_015130chr41921 1380 ----
NM_015132chr721443 1424 11270 --1712
NM_015144chr1653917 3728 3705 2953 113 23051 2554 ----
NM_015158chr91621 ------
NM_015170chr811883 ------
NM_015176chr12717 504 ------
NM_015187chr4155 1695 ----
NM_015192chr201997 ----1778
NM_015199chr312629 ------
NM_015200chr4------12310
NM_015206chr1523756 497 --23693 1315 23575 702
NM_015225chr932937 1152 186 ------
NM_015245chr611924 ------
NM_015250chr931765 1402 495 --11563 1663
NM_015251chr161147 12297 11469 --
NM_015252chr21278 ------
NM_015265chr222285 1969 ------
NM_015267chr1211790 12058 ----
NM_015269chr11622 ------
NM_015271chr443918 1534 696 471 --1332 13043
NM_015277chr1841280 587 515 431 ------
NM_015278chr612187 1883 --1760
NM_015285chr1832092 1036 1018 1688 11628 --
NM_015291chr1163 ------
NM_015308chr112765 719 ------
NM_015310chr857932 5352 5289 1562 321 1805 ----
NM_015313chr1164678 3981 3680 3482 1099 570 1310 ----
NM_015314chr71926 32383 2221 132 ----
NM_015328chr721978 686 1117 --12052
NM_015336chr1221789 849 12528 ----
NM_015338chr2021955 1460 ------
NM_015339chr202763 87 11019 ----
NM_015344chr821795 114 --1124 --
NM_015349chr612702 12606 12005 --
NM_015355chr1721246 222 ------
NM_015358chr211126 1292 ----
NM_015361chr2168 ------
NM_015365chrX33046 3020 525 ------
NM_015375chr134990 4513 115 --14021 11190
NM_015378chr152097 928 775 512 225 12681 --12802
NM_015381chr22--22031 753 ----
NM_015382chr141505 ------
NM_015387chr2--32116 2002 1378 ----
NM_015409chr1222716 809 ------
NM_015423chr1121348 498 21410 54 21588 1231 --
NM_015429chr33995 383 256 11068 ----
NM_015436chr4--22377 910 1634 13176
NM_015446chr111568 11660 ----
NM_015458chr885229 4856 3845 3579 3508 1766 960 232 ------
NM_015508chr31447 1219 ----
NM_015520chr312157 ----11751
NM_015532chr1532130 939 215 12631 ----
NM_015548chr61905 1958 ----
NM_015550chr722686 513 --23483 2669 --
NM_015554chr1562874 2412 2354 1869 451 180 ------
NM_015555chr61230 ------
NM_015560chr352622 2489 2382 1978 481 ------
NM_015564chr522634 467 ------
NM_015569chr124143 1165 23301 1367 ----
NM_015570chr711167 ------
NM_015571chr632391 2071 1720 42632 2122 989 85 ----
NM_015578chr1942005 1529 521 276 ------
NM_015640chr154869 4212 1704 1221 635 ----15012
NM_015680chr2----1601 --
NM_015691chrX31970 426 357 22876 693 ----
NM_015726chr1--21739 601 21672 1247 --
NM_015874chr41449 ------
NM_015879chr1898558 8258 7488 7401 7121 6674 3448 1967 597 ----15403
NM_015886chr875400 4611 4020 4006 3901 1227 126 1809 ----
NM_015888chr132909 2088 123 ----11018
NM_015892chr1052466 2403 2355 2307 2050 1483 ----
NM_015902chr81769 ------
NM_015906chr164608 3965 2937 1715 1048 758 --23903 3030 --
NM_015980chr541359 1319 202 90 ------
NM_016018chr852728 2671 1938 1884 501 1859 ----
NM_016021chr632940 623 389 ------
NM_016072chr1212217 --22443 1580 --
NM_016073chr1511168 11008 ----
NM_016078chr172979 899 ------
NM_016083chr663835 3077 2810 2518 1410 1321 ----1174
NM_016103chr51362 ------
NM_016120chrX----11116 190
NM_016129chr41376 ------
NM_016206chr368688 6816 5492 2736 1819 1081 22104 1767 ----
NM_016221chr532011 1841 1464 --12322 --
NM_016224chr611744 1247 ----
NM_016227chr111277 ------
NM_016255chr633111 2083 877 12449 1276 --
NM_016260chr236981 6727 1044 ------
NM_016271chr182823 263 ------
NM_016275chr31571 --12697 --
NM_016277chr641559 1522 1171 553 ------
NM_016281chr121825 ------
NM_016289chr21678 ------
NM_016300chr3--195 1126 --
NM_016312chr122177 104 ------
NM_016315chr231712 1632 83 21207 322 ----
NM_016316chr2159 ------
NM_016322chr942609 2032 861 61 ----12425
NM_016357chr122996 304 ------
NM_016374chr131268 1222 352 ------
NM_016374chr131268 1222 352 ------
NM_016377chr611347 ------
NM_016395chr1531888 1291 175 2605 226 ----
NM_016410chr92540 425 ------
NM_016422chr1152697 2214 869 339 185 32743 2733 603 ----
NM_016424chr1721882 385 --1720 1708
NM_016485chr632205 763 685 --1779 --
NM_016507chr1742535 1249 774 136 ------
NM_016513chr623194 2890 --1501 --
NM_016516chr2--1842 ----
NM_016519chr41451 ------
NM_016530chr1552935 2812 1378 1342 443 21659 1143 ----
NM_016531chr443460 1074 687 335 23373 1161 11068 --
NM_016542chrX21107 228 ------
NM_016584chr121277 ------
NM_016603chr541532 122 68 43 ----2873 80
NM_016604chr51122 ------
NM_016617chr1331340 659 50 12162 ----
NM_016620chr121234 484 ------
NM_016623chr8143 ------
NM_016830chr122558 517 ------
NM_016930chr42148 68 ------
NM_016953chr265760 5533 4787 1721 487 475 ------
NM_017412chr81527 1910 ----
NM_017415chr544260 1677 573 43 --24345 199 13654
NM_017423chr4----21901 1776 --
NM_017426chr41427 ------
NM_017489chr831299 1278 181 1946 ----
NM_017534chr17185 ------
NM_017545chr201371 ------
NM_017548chr321997 671 ------
NM_017551chr1012402 ------
NM_017563chr355117 4262 1518 1233 138 25662 4724 14585 11838
NM_017599chr122715 388 ------
NM_017607chr191507 ------
NM_017628chr474877 4542 4280 3623 1492 1405 432 24686 4417 ----
NM_017629chr121444 1279 1751 ----
NM_017632chr4137 ------
NM_017634chr8------11694
NM_017635chr1121470 190 ------
NM_017637chr979135 8013 2438 1460 749 189 85 ------
NM_017641chr122453 52 179 1151 --
NM_017643chr1732681 2049 1948 11113 ----
NM_017644chr374708 3495 3210 3158 1902 1082 889 ------
NM_017645chr912651 12487 1843 --
NM_017650chr765894 5053 1915 1531 1047 696 22113 457 23734 558 --
NM_017658chr1454596 4441 3777 928 403 13793 31502 515 146 --
NM_017673chr1----1836 --
NM_017686chr12754 127 1375 ----
NM_017704chr114348 292 283 61 ------
NM_017719chr312330 1673 --11966
NM_017730chr31700 ------
NM_017737chr122060 70 ------
NM_017742chr1831804 1695 78 ------
NM_017761chr11180 11512 ----
NM_017769chr1433180 2278 2011 12784 1907 --
NM_017772chr631428 1264 197 ------
NM_017778chr8------11010
NM_017779chr12790 103 ------
NM_017780chr81297 ------
NM_017786chr81115 ------
NM_017812chr71667 --1287 --
NM_017813chr865466 5020 4421 2293 1346 344 15570 11155 --
NM_017826chr131709 ------
NM_017831chr1834655 4281 4176 11038 ----
NM_017848chrX34328 4021 1265 --13313 --
NM_017896chr2043450 2625 630 117 --12633 --
NM_017915chr122921 767 ------
NM_017919chr995821 5497 4443 4343 3941 3809 2202 2041 1237 23697 2253 --14245
NM_017944chr1122992 2022 21207 694 12723 --
NM_017953chr1186 1237 ----
NM_017954chr71546 21688 493 ----
NM_017994chr721899 436 ------
NM_018010chr331609 1092 102 ------
NM_018011chr132444 212 ------
NM_018014chr221170 486 1978 ----
NM_018030chr18--2908 216 ----
NM_018061chr121579 1114 ------
NM_018063chr10--1136 1351 --
NM_018064chr6----1294 --
NM_018078chr41405 ------
NM_018080chr15----1175 --
NM_018084chr242437 1284 832 340 13080 11032 --
NM_018086chr241390 509 365 109 11881 ----
NM_018126chr42601 420 --156 --
NM_018131chr101827 ------
NM_018133chr311981 1873 12160 --
NM_018145chr151504 1194 ----
NM_018155chr333085 2557 597 13176 --11348
NM_018156chr152097 928 775 512 225 12681 --12802
NM_018159chrX31485 424 187 --11570 --
NM_018167chr141782 1336 ----
NM_018195chr1141451 1335 472 199 --1804 11495
NM_018200chr1532470 2365 731 12282 --1656
NM_018202chr11290 ------
NM_018211chr121439 648 ------
NM_018238chr751426 1307 950 438 165 ------
NM_018247chr622978 2746 ------
NM_018270chr201640 ------
NM_018275chr71208 ------
NM_018293chr342753 2670 1981 773 12376 12557 --
NM_018312chr11--12178 ----
NM_018321chr5--153 ----
NM_018330chr1041489 1267 692 566 1320 ----
NM_018340chr1634273 3708 314 --11115 --
NM_018362chr1153559 1537 1301 528 316 23538 1065 12849 --
NM_018364chr131631 1243 403 13006 13027 12796
NM_018372chr11604 1477 ----
NM_018374chr734968 4706 70 --13781 --
NM_018375chr143728 455 118 ------
NM_018398chr31324 ------
NM_018403chr342809 2545 1053 1036 ------
NM_018409chr452851 2812 2766 2472 114 ------
NM_018427chr1621175 508 ------
NM_018439chr1822591 1727 ------
NM_018440chr898518 8338 7332 5938 5791 5268 3106 2572 715 11919 21286 827 15562
NM_018441chr2166 --1539 --
NM_018444chr832137 2027 900 12188 1140 --
NM_018464chr101360 ------
NM_018475chr4--1655 ----
NM_018482chr831829 518 381 21594 537 ----
NM_018488chr172698 584 --195 --
NM_018489chr1--1912 1293 1142
NM_018527chr132170 129 ------
NM_018557chr22284 191 1340 --11167
NM_018566chr114134 24695 3774 1886 --
NM_018641chr72448 167 ------
NM_018650chr111805 11407 ----
NM_018657chr32797 626 ------
NM_018691chr53984 440 186 1170 ----
NM_018695chr542328 897 525 417 --1872 --
NM_018710chr81338 11285 1988 --
NM_018712chr1111452 ------
NM_018834chr52234 107 ------
NM_018837chr202793 98 ------
NM_018841chr143852 3533 2960 844 1645 ----
NM_018844chr722051 192 ------
NM_018945chr632243 1417 709 --22472 298 --
NM_018970chr742955 2098 1242 282 ------
NM_018975chr161819 1540 ----
NM_018976chr121555 ------
NM_018999chr1044638 4353 3942 1549 23685 1528 ----
NM_019004chr74866 668 469 278 21680 196 ----
NM_019027chr442117 2059 1752 603 ------
NM_019042chr731100 1000 240 1462 ----
NM_019073chr1178 ------
NM_019106chr2242293 2084 218 111 ------
NM_019116chr1622930 161 12413 ----
NM_019117chrX31362 659 400 12657 ----
NM_019555chr31459 ----1250
NM_019593chr2052620 2233 1030 816 494 ----154
NM_019600chr152785 516 ------
NM_020066chr11243 ------
NM_020122chr245928 4255 3869 2002 --14148 --
NM_020123chr1011006 --1114 --
NM_020135chr61415 ------
NM_020144chr732080 733 419 ------
NM_020168chr15198 ------
NM_020177chr553312 2516 1106 650 115 ------
NM_020198chr1721211 322 ------
NM_020199chr531216 174 126 ----192
NM_020242chr32470 456 ------
NM_020245chr654643 4605 4133 1180 380 11420 ----
NM_020310chr1712714 ------
NM_020317chr11300 --1100 --
NM_020319chr71890 --1695 --
NM_020336chr2013366 23003 400 ----
NM_020337chr432343 2260 1139 1223 ----
NM_020340chr631908 1481 637 ----1614
NM_020341chr2021961 482 11975 ----
NM_020357chr31541 ------
NM_020390chr364766 4597 4360 3221 1504 364 ------
NM_020403chr13--2569 74 ----
NM_020425chr621520 1423 ------
NM_020443chr145644 2502 2292 160 45689 1545 1534 1360 ----
NM_020456chr13--1138 ----
NM_020529chr14--1104 1465 --
NM_020546chr542862 2130 658 404 1446 11236 --
NM_020647chr822091 1857 22196 2158 ----
NM_020654chr331328 352 335 --11452 --
NM_020665chrX1254 ------
NM_020686chr1623117 1147 ------
NM_020689chr2011117 ------
NM_020704chr732199 660 57 11971 ----
NM_020711chr242442 1975 426 375 ------
NM_020717chrX54071 3700 3537 3362 270 1340 ----
NM_020727chr2173710 3390 3007 1531 1219 543 358 13986 23538 1471 --
NM_020734chr121776 --12155 23288 1259
NM_020739chr1533921 3345 526 ------
NM_020752chr101587 ------
NM_020755chr631642 558 58 ----11114
NM_020760chr221933 141 11990 11503 --
NM_020766chrX34207 750 518 ------
NM_020771chr62961 501 ------
NM_020772chr1758473 5402 5333 1535 256 27809 3209 26574 914 --
NM_020773chr412119 11896 12534 --
NM_020774chr1854122 2343 2138 1132 842 ------
NM_020782chr1264504 4476 4403 4013 3513 1079 11799 ----
NM_020783chr1821855 897 ------
NM_020791chr1741324 1003 183 92 ------
NM_020792chr342414 2385 1705 1126 11870 ----
NM_020794chr111054 ------
NM_020796chr5--12283 --1159
NM_020800chr31117 21394 231 ----
NM_020801chr532560 2410 1795 22419 1619 ----
NM_020810chr1452892 2849 1123 316 109 ------
NM_020818chr14199 ----1302
NM_020824chr101233 ------
NM_020841chr1262700 2663 1615 325 300 136 ------
NM_020854chr1831197 73 64 ----1360
NM_020856chr1921025 396 11066 ----
NM_020858chr1552386 2329 856 214 191 2921 303 ----
NM_020918chr1053559 3496 2753 2338 1434 ------
NM_020922chrX41853 1793 1167 150 11654 ----
NM_020925chr111365 ------
NM_020927chr1642174 1664 1595 528 12396 ----
NM_020940chr1032230 1146 397 22464 1848 ----
NM_020948chr132539 2307 202 ------
NM_020981chr2166 ------
NM_021003chr14--1661 ----
NM_021005chr151430 11164 ----
NM_021033chr1333037 2895 475 ----11271
NM_021061chr864126 3454 2978 1179 1026 448 11405 ----
NM_021064chr621782 664 ------
NM_021069chr42525 467 ------
NM_021136chr143727 583 164 ------
NM_021155chr1932534 1930 551 22793 1188 ----
NM_021160chr61244 1178 ----
NM_021174chr82643 270 ------
NM_021205chr162877 2762 2566 992 801 147 12256 ----
NM_021222chr1--1397 21437 982 11060
NM_021238chr1242098 2053 1492 488 ------
NM_021239chr141164 11328 11033 --
NM_021252chr1031535 608 374 ------
NM_021619chr911287 ------
NM_021627chr331059 151 113 1352 ----
NM_021629chr323907 3763 24636 263 14738 14405
NM_021647chr434698 3060 1807 ------
NM_021648chr632713 2641 463 1443 12121 --
NM_021803chr4170 ------
NM_021818chr142366 76 --1245 --
NM_021825chr111342 ------
NM_021911chr533594 1975 254 13876 ----
NM_021912chr1554148 3564 855 737 487 ------
NM_021961chr11127281 7140 7109 4928 2406 1958 1584 1490 1381 1286 714 659 27473 6006 22782 2252 --
NM_021964chr336499 2075 943 34022 2054 753 ----
NM_021973chr4--1640 ----
NM_021998chrX11207 1512 ----
NM_022041chr161553 1366 ----
NM_022048chr1575713 5470 4947 4908 2057 1667 1519 14822 ----
NM_022080chr2062432 2082 627 506 280 248 2672 344 11794 --
NM_022105chr202206 200 --1593 --
NM_022118chr132427 69 ------
NM_022138chr61107 ------
NM_022164chr11646 ------
NM_022166chr1655775 5483 1624 1076 384 --12259 15343
NM_022170chr721747 346 ----1522
NM_022361chr61368 ------
NM_022373chr71964 ------
NM_022374chr21374 ------
NM_022459chr1344923 4885 4454 1396 --15620 15063
NM_022473chr1524470 481 ------
NM_022650chr5--1994 ----
NM_022658chr1251339 1222 467 383 335 ------
NM_022735chr11224 11262 --1725
NM_022739chr173818 453 299 ------
NM_022742chr7----138 --
NM_022753chr142509 2450 848 621 --12384 --
NM_022763chr332386 2246 578 22912 426 --12519
NM_022771chr12287 58 ------
NM_022776chr311433 21139 430 --11270
NM_022778chr111414 ------
NM_022828chr521721 1487 11611 ----
NM_022838chrX1285 ------
NM_022843chr1331494 396 390 11039 ----
NM_022845chr1651518 804 792 404 105 ------
NM_022898chr1454611 4604 1331 776 435 14047 24428 270 --
NM_022901chr931883 1682 329 ------
NM_022912chr213027 11964 --1488
NM_022918chr1132141 1652 1474 ------
NM_022977chrX52569 2200 1976 1679 542 12558 ----
NM_023012chr12------1707
NM_023016chr242796 924 581 501 1992 ----
NM_023076chr161227 1566 ----
NM_023929chr852661 2107 1796 838 581 ------
NM_023943chr31218 ------
NM_024007chr511033 ----12523
NM_024016chr171723 ------
NM_024089chr132164 150 --135 --
NM_024102chr111196 ------
NM_024332chrX41511 1340 1298 147 11347 ----
NM_024345chr935979 1241 153 ----11691
NM_024490chr151563 ------
NM_024491chr3138 ------
NM_024511chr443085 3048 1036 738 ----1211
NM_024524chr32670 24 141 ----
NM_024529chr12988 399 11004 ----
NM_024548chr321548 1274 2293 128 ----
NM_024558chr1441019 1003 815 286 ------
NM_024573chr62667 383 ------
NM_024612chr1731007 801 353 1767 ----
NM_024617chr91715 ----1284
NM_024636chr752866 2785 2602 2181 882 12948 ----
NM_024641chr612647 ------
NM_024659chr21653 --1676 --
NM_024665chr334046 3344 736 24213 1481 23679 1341 --
NM_024670chr1021275 462 1269 ----
NM_024674chr122895 490 22400 1290 13158 --
NM_024692chr231465 1247 711 ------
NM_024721chr822639 2383 --1871 --
NM_024744chr222700 618 ----12632
NM_024749chr14843 597 516 39 11819 ----
NM_024751chr41450 21911 120 ----
NM_024755chr151808 ------
NM_024761chr955050 4118 3882 3751 167 ----15347
NM_024817chr1555188 5102 1950 794 373 2779 584 ----
NM_024828chr92636 302 ------
NM_024854chr1231479 486 329 ------
NM_024911chr12601 326 ------
NM_024930chr552826 2122 962 355 313 1463 ----
NM_024947chr399105 8842 8602 8587 8576 8492 7715 1138 866 49373 6793 2404 2366 12016 --
NM_024948chr101596 ------
NM_024989chr288166 8143 7927 6910 6438 2087 1737 776 47482 7165 5089 1668 ----
NM_025047chr33492 405 388 ------
NM_025054chr863988 1410 1127 1022 878 685 11037 ----
NM_025074chr483011 2957 2509 2360 2004 557 277 66 ------
NM_025107chr6--1243 ----
NM_025133chr21789 21094 462 ----
NM_025134chr1611694 ------
NM_025138chr134913 589 472 220 ------
NM_025147chr211130 ------
NM_025160chr133882 1275 624 14174 ----
NM_025191chr153384 2698 1305 647 28 ------
NM_025222chr31474 23016 2682 --22809 2701
NM_030579chr1623369 1165 13620 ----
NM_030594chr152347 339 ------
NM_030627chr5--23672 3079 ----
NM_030647chr776182 5998 5780 5533 3866 2340 1286 14847 --11365
NM_030650chr254253 3340 1632 804 169 --1982 --
NM_030661chr711335 1676 ----
NM_030752chr62171 135 ------
NM_030755chr1453052 2936 2113 950 332 --1624 --
NM_030768chr2285 34 ------
NM_030786chr12562 81 ------
NM_030791chr1421797 723 11360 ----
NM_030806chr189251 9117 8437 7903 7126 7026 2489 1146 ------
NM_030816chr143385 3018 2920 697 23650 2667 ----
NM_030912chr101897 ------
NM_030920chr121957 1889 ------
NM_030926chr2194 --1889 --
NM_030934chr131762 1304 1200 ------
NM_030945chr5--1103 ----
NM_030948chr6171 ------
NM_031216chr1831614 1376 651 ------
NM_031263chr9141 ------
NM_031266chr52462 423 ------
NM_031268chr1673732 3714 3377 1384 1024 789 237 --14362 --
NM_031371chr131268 1222 352 ------
NM_031371chr131268 1222 352 ------
NM_031435chr1243499 3033 795 649 --12490 12991
NM_031442chrX22150 2143 ----1963
NM_031445chr23406 317 301 ------
NM_031469chr632643 1178 273 ----153
NM_031844chr144142 2989 2870 1303 ------
NM_031858chr1721564 1297 ------
NM_031862chr1721564 1297 ------
NM_031911chr422821 1072 --21723 852 --
NM_031935chr13929 158 116 --1148 --
NM_031992chr721747 346 ----1522
NM_032120chr7196 ------
NM_032121chrX22403 194 ------
NM_032124chr181153 ------
NM_032131chr61175 ------
NM_032144chr21154 1547 ----
NM_032160chr18--13330 ----
NM_032186chr121234 484 ------
NM_032199chr1033869 3050 661 23796 996 ----
NM_032208chr212773 1723 ----
NM_032226chr92833 816 ------
NM_032228chr1122831 2334 ------
NM_032229chr131445 ------
NM_032233chr142331 289 ------
NM_032239chr42924 152 156 ----
NM_032242chr373325 3088 2919 2603 2282 1271 613 --199 1251
NM_032246chr1531331 1154 861 1324 ----
NM_032283chr111837 ------
NM_032288chr332304 2291 619 1325 11613 --
NM_032327chr10----1465 --
NM_032352chr142943 134 21403 79 21114 237 --
NM_032373chr1052325 1117 806 412 219 25790 4790 ----
NM_032408chr711285 155 ----
NM_032424chr1131326 1021 650 ----1573
NM_032438chr631647 1329 193 ------
NM_032445chr1542526 938 419 31 ----12038
NM_032456chr41654 1188 ----
NM_032457chr423315 1055 12463 ----
NM_032458chrX33156 3076 2600 12549 13419 --
NM_032505chr352539 2386 819 722 330 22690 701 ----
NM_032521chr2033040 2771 2387 ------
NM_032560chr1411025 ------
NM_032581chr721925 91 11326 ----
NM_032682chr321455 224 --21205 253 12618
NM_032727chr1031037 562 299 ------
NM_032778chr342477 2260 2229 1213 --13124 --
NM_032826chr732089 1516 1375 ----15389
NM_032859chr1353452 3368 1594 457 360 1228 ----
NM_032866chr152821 513 22789 2284 ----
NM_032870chr61401 --1107 --
NM_032883chr20--1712 ----
NM_032905chr1031290 1025 997 ------
NM_032906chr42293 266 1797 ----
NM_032918chr1211066 --11150 --
NM_032932chr1765983 5514 4289 4275 330 254 ----26045 1231
NM_032949chr132154 144 ------
NM_032961chr421281 499 ------
NM_032968chrX63487 3182 3003 2609 449 76 13032 ----
NM_032969chrX63487 3182 3003 2609 449 76 13032 ----
NM_032973chrY63483 3177 2998 2608 449 76 13027 ----
NM_032975chr1813479 ------
NM_032980chr1813479 ------
NM_032991chr431148 377 66 --1113 --
NM_033020chr164608 3965 2937 1715 1048 758 --23903 3030 --
NM_033029chr31364 ------
NM_033121chr1221613 381 11309 --11871
NM_033138chr741941 1632 610 547 ------
NM_033139chr741941 1632 610 547 ------
NM_033140chr741941 1632 610 547 ------
NM_033157chr741941 1632 610 547 ------
NM_033181chr663835 3077 2810 2518 1410 1321 ----1174
NM_033211chr541849 1349 388 71 32026 2007 381 1177 --
NM_033222chr931016 575 174 1492 ----
NM_033224chr727475 1774 16968 21632 1558 --
NM_033285chr893722 3230 3064 1727 1351 1084 856 553 428 ------
NM_033305chr92397 112 21215 571 ----
NM_033326chr1132153 2131 30 12065 --1699
NM_033360chr1233788 312 136 ------
NM_033394chr261617 1483 1232 1157 567 410 ------
NM_033425chr1143393 963 833 559 1430 --1181
NM_033430chr463873 3585 3372 3316 3117 297 ------
NM_033437chr463873 3585 3372 3316 3117 297 ------
NM_033495chrX5969 921 307 276 154 1378 ----
NM_033512chr831062 474 251 --12811 --
NM_033550chr201197 --11810 --
NM_033624chr1242115 2069 1516 163 1331 ----
NM_033637chr1033306 1092 53 ------
NM_033644chr522488 763 1932 ----
NM_033645chr522488 763 1932 ----
NM_033656chr2155167 2345 2190 1570 962 --15555 --
NM_033666chr101793 1953 ----
NM_052832chr8--1605 12886 --
NM_052834chr1832092 1036 1018 1688 11628 --
NM_052857chr172383 313 ------
NM_052875chr1142037 1366 811 421 ------
NM_052879chr1234093 3467 3377 1697 ----
NM_052885chr1244251 1882 1593 1149 ----11397
NM_052886chr8--12177 ----
NM_052917chr233153 1003 114 ------
NM_052923chr6129 ------
NM_052927chr532041 1781 182 ------
NM_052932chr1132485 2143 1926 ------
NM_052937chr8--1157 ----
NM_053016chr9107987 7902 7883 7405 5559 2875 2705 2469 1010 40 ------
NM_053023chr1132412 2341 348 13075 1966 1682
NM_053024chr321279 221 ------
NM_053055chr111303 ------
NM_053274chr1142 ------
NM_054016chr111928 ------
NM_054016chr111928 ------
NM_054016chr111928 ------
NM_057175chr412167 12107 ----
NM_058172chr451675 1644 1383 645 539 ------
NM_058191chr212204 152 1671 1901 --
NM_058237chr141718 ------
NM_058241chr222268 2205 22299 2259 --11705
NM_058241chr222268 2205 22299 2259 --11705
NM_080546chr941486 918 638 213 ------
NM_080597chr18--2908 216 ----
NM_080618chr202894 275 ------
NM_080717chr1231544 1202 518 ------
NM_080737chrX------11217
NM_080742chr6190 ------
NM_080745chr15146 ------
NM_080759chr132840 145 ------
NM_080760chr132840 145 ------
NM_080764chr2262511 2452 1143 609 267 178 ------
NM_080796chr202206 200 --1593 --
NM_080818chr13--3703 225 111 ----
NM_080832chrX4576 525 245 200 ------
NM_080867chr1424925 4497 11069 ----
NM_080872chr863225 2920 1585 1030 639 397 ------
NM_080927chr331068 435 379 13228 ----
NM_130391chr922817 1070 11361 ----
NM_130392chr922817 1070 11361 ----
NM_130393chr922817 1070 11361 ----
NM_130395chr61415 ------
NM_130434chr151883 1288 ----
NM_130435chr1022626 1015 ------
NM_130436chr2121717 998 ------
NM_130438chr2122294 2178 ------
NM_130808chr3182 ------
NM_130809chr53790 468 326 2759 225 --12618
NM_130811chr20171 ------
NM_130831chr352622 2489 2382 1978 481 ------
NM_130832chr352622 2489 2382 1978 481 ------
NM_130833chr352622 2489 2382 1978 481 ------
NM_130834chr352622 2489 2382 1978 481 ------
NM_130835chr352622 2489 2382 1978 481 ------
NM_130836chr352622 2489 2382 1978 481 ------
NM_130837chr352622 2489 2382 1978 481 ------
NM_133264chr1732580 774 559 --21010 355 11496
NM_133266chr113971 957 363 ------
NM_133334chr466404 6069 5707 2237 1177 116 26309 5423 35305 5013 1550 --
NM_133370chr423554 2602 ------
NM_133378chr21722 ------
NM_133432chr21722 ------
NM_133437chr21722 ------
NM_133444chr1911662 --1452 --
NM_133493chr674623 3757 3626 3002 1118 719 289 14636 1307 --
NM_133496chr164121 1816 1665 1079 224 50 13193 ----
NM_133647chr1523574 3534 1355 ----
NM_134421chr22767 629 ------
NM_134442chr21546 ------
NM_134447chr192560 148 ------
NM_138270chrX33255 2646 1013 1451 ----
NM_138286chr1933375 1412 1109 2849 309 ----
NM_138288chr1452189 1533 849 815 244 ------
NM_138316chr1011097 ------
NM_138340chr183559 508 441 ------
NM_138426chr711737 --1512 --
NM_138437chrX1224 ------
NM_138444chr1353802 3499 3101 944 928 44960 3666 3410 1581 1314 --
NM_138459chr633575 3107 725 --4706 665 657 635 --
NM_138468chr255980 5765 1697 895 205 16291 1579 --
NM_138473chr1274562 3968 3590 3551 3173 2036 1148 11088 14800 --
NM_138494chr732834 786 189 --12863 --
NM_138559chr221160 476 1968 ----
NM_138576chr1454611 4604 1331 776 435 14047 24428 270 --
NM_138633chr611347 ------
NM_138713chr1697341 6772 6695 5667 5489 2441 1721 1055 577 13217 1840 --
NM_138714chr1697341 6772 6695 5667 5489 2441 1721 1055 577 13217 1840 --
NM_138735chr221338 1101 ------
NM_138927chr21------1991
NM_138980chr4--1464 ----
NM_138981chr4--1595 ----
NM_138982chr4--1464 ----
NM_139012chr631803 904 893 12231 ----
NM_139035chrX--1231 1239 --
NM_139076chr42604 172 --11428 --
NM_139131chr111635 ------
NM_139168chr5--21239 706 ----
NM_139245chr311421 ------
NM_139312chr1021464 1194 ------
NM_139321chr2034116 2690 1548 --22847 1541 --
NM_144578chr1434843 4575 154 15512 13725 --
NM_144631chr2--1201 ----
NM_144632chr221854 917 2584 538 11648 --
NM_144633chr31218 ------
NM_144642chr3--11176 ----
NM_144664chr1152565 2534 1802 506 282 ------
NM_144726chr52845 141 --11162 --
NM_144767chr1553072 1510 1236 1039 562 14017 ----
NM_144775chr1744807 3148 1768 1395 1374 13023 --
NM_144778chr1321761 750 ------
NM_144949chr23675 585 269 ------
NM_144963chr812729 ----1443
NM_144973chr1254982 4289 4093 861 343 --1790 --
NM_144979chr42707 116 ------
NM_145013chr1152943 2392 1978 393 30 --12856 --
NM_145025chr611135 1105 ----
NM_145029chr61271 ------
NM_145037chr321166 1016 ------
NM_145055chr1842613 1264 1000 761 --11512 --
NM_145112chr1421011 212 ------
NM_145113chr1421283 484 ------
NM_145117chr115651 631 539 527 230 22896 2606 ----
NM_145174chr2231511 1394 190 11468 ----
NM_145203chr131655 1389 ----
NM_145259chr266285 5688 5149 4635 2531 1854 --11455 --
NM_145268chr71835 1388 ----
NM_145284chrX32067 1702 919 ------
NM_145285chr101689 1697 ----
NM_145307chr1064260 4020 3941 3847 940 738 ------
NM_145320chr722686 513 --23483 2669 --
NM_145321chr722686 513 --23483 2669 --
NM_145322chr722686 513 --23483 2669 --
NM_145330chr21146 ------
NM_145690chr831818 1536 272 --1415 1731
NM_145753chr341581 1221 616 342 ------
NM_145756chr1851551 1504 1380 447 200 ------
NM_145891chr1631396 1112 602 1680 11130 --
NM_145892chr1631396 1112 602 1680 11130 --
NM_145893chr1631518 1234 724 --11252 --
NM_147147chr643222 2852 1416 1271 ------
NM_147156chr1011240 11360 ----
NM_147166chr72773 605 ------
NM_147171chr71470 1192 ----
NM_147175chrX31926 1872 1667 1845 ----
NM_147185chr71470 1192 ----
NM_147223chr211606 ------
NM_148977chr1011097 ------
NM_148978chr1011097 ------
NM_152261chr1262415 2283 1897 1807 1015 880 12493 ----
NM_152265chr131086 564 278 ------
NM_152277chr532117 2075 1575 ------
NM_152296chr19182 ------
NM_152309chr1032217 490 325 1426 ----
NM_152332chr1432620 2235 1109 32786 2503 962 ----
NM_152373chr11636 1656 ----
NM_152387chr211064 --21037 381 --
NM_152388chr233752 3303 3159 ------
NM_152407chr553121 3058 2948 1021 259 --23140 93 32723 1186 406
NM_152414chr811073 ------
NM_152487chr111398 11293 ----
NM_152519chr212218 11562 ----
NM_152520chr21444 ------
NM_152522chr231066 998 226 ------
NM_152542chr41529 ------
NM_152549chr54447 191 169 139 ------
NM_152556chr732086 2011 643 --12331 --
NM_152581chrX2928 549 --11222 --
NM_152594chr1511814 ----1915
NM_152606chr192590 505 ------
NM_152622chr533480 2843 2810 ----1807
NM_152624chr5157250 7243 7212 6255 5867 5451 4982 2624 2263 2123 1542 1467 833 490 283 12889 26943 5016 --
NM_152629chr963608 3249 1621 1420 940 68 11041 ----
NM_152636chr1122452 2173 ----1399
NM_152641chr1242751 982 808 149 12180 12594 --
NM_152666chr11763 1628 ----
NM_152671chr21100 ------
NM_152678chr342658 2483 343 261 --1555 --
NM_152682chr42502 83 1382 ----
NM_152707chr104962 759 132 123 ------
NM_152716chr1121644 1320 ------
NM_152739chr71209 ------
NM_152756chr543659 3255 1202 496 24373 2777 ----
NM_152758chr832510 2493 1910 12631 12582 1900
NM_152774chr73826 795 589 ------
NM_152787chrX33112 533 348 22442 150 ----
NM_152793chr753424 2020 1530 1492 431 14636 ----
NM_152835chr132625 2220 2159 12244 --12417
NM_152838chr2042994 2490 2342 1328 --1364 11223
NM_152890chr121073 523 31055 1032 446 ----
NM_152896chr9------1666
NM_152924chr1521430 1320 --25066 1454 --
NM_152995chr41117 1288 ----
NM_152999chr753616 3249 1769 1508 949 ------
NM_153020chr621622 1302 11182 ----
NM_153040chr151139 ------
NM_153042chr641479 1464 685 560 --11711 --
NM_153182chr342477 2260 2229 1213 --13124 --
NM_153183chrX31026 1019 232 ------
NM_153184chr331794 1486 666 ------
NM_153186chr91621 ------
NM_153188chr545094 4999 4971 1624 ----1959
NM_153207chr1221209 239 14036 ----
NM_153261chr161227 --21545 186 --
NM_153262chr132169 792 784 1610 ----
NM_153332chr822868 215 1830 1522 --
NM_153342chr23499 490 96 ------
NM_153354chr52368 150 ------
NM_153365chr412236 ------
NM_153607chr512893 --1857 --
NM_153616chr1552386 2329 856 214 191 2921 303 ----
NM_153617chr1552386 2329 856 214 191 2921 303 ----
NM_153618chr1552386 2329 856 214 191 2921 303 ----
NM_153619chr1543624 3567 1452 1429 ------
NM_153631chr711335 1676 ----
NM_153632chr711335 1676 ----
NM_153686chr43864 230 45 11510 11858 --
NM_153702chr41290 ------
NM_153810chr1034915 1841 882 33370 1576 66 24676 905 --
NM_153836chr21613 1242 11666 --
NM_170662chr32587 45 ------
NM_170665chr1241437 1008 950 663 14202 13766 --
NM_170672chr22325 258 ------
NM_170674chr1511293 ------
NM_170675chr151969 ------
NM_170676chr151969 ------
NM_170677chr1511293 ------
NM_170719chr134913 589 472 220 ------
NM_171998chrX22142 349 ------
NM_172037chr81165 ------
NM_172070chr221987 148 21815 1466 ----
NM_172071chr155174 2676 2498 504 389 24544 2947 ----
NM_172196chr21183 ------
NM_172240chr121883 --1959 --
NM_172242chr101816 ------
NM_172315chr1511293 ------
NM_172316chr1511293 ------
NM_173039chr111190 --1183 --
NM_173083chr121222 1210 ------
NM_173214chr1697341 6772 6695 5667 5489 2441 1721 1055 577 13217 1840 --
NM_173469chr151600 --21306 1007 --
NM_173470chrX2516 205 11785 ----
NM_173473chr1032647 2304 126 12472 ----
NM_173500chr15172 1483 ----
NM_173508chr12425 123 ------
NM_173531chr1943626 2983 2489 869 12646 13272 12581
NM_173552chr3----1335 1343
NM_173564chr71803 ------
NM_173576chr1011837 ------
NM_173582chr1155823 4454 3991 814 495 34700 4641 4171 1450 --
NM_173589chr113535 183 173 ------
NM_173607chr1432153 1957 617 ------
NM_173694chrX22133 662 --1321 --
NM_173803chr1621493 1432 1245 ----
NM_173814chr15----1171 --
NM_173824chr31245 ------
NM_173829chr565708 5329 4106 3827 1114 262 25439 888 15405 --
NM_173834chrX1107 ------
NM_173851chr823721 1534 ------
NM_173872chr42938 154 ------
NM_174890chr101611 ------
NM_174963chr1----1591 --
NM_174964chr1----1591 --
NM_174965chr1----1610 --
NM_174966chr1----1591 --
NM_174967chr1----1610 --
NM_174968chr1----1591 --
NM_174969chr1----1591 --
NM_174970chr1----1610 --
NM_174971chr1----1591 --
NM_175607chr331712 1238 158 ------
NM_175610chr1521057 219 ------
NM_175612chr331712 1238 158 ------
NM_175619chr42136 110 ------
NM_175736chr1286997 6904 6617 5475 4834 2875 2830 185 17836 14859 --
NM_175852chr1------13026
NM_175854chr1331909 1880 1111 ------
NM_175856chr52826 616 ------
NM_175910chr1932472 2312 72 ------
NM_175921chr554187 3743 3427 2921 1675 --14079 --
NM_176787chr1841358 1260 517 127 ------
NM_176814chr721105 94 11207 ----
NM_176823chr163802 3351 3168 3065 1077 418 --13664 --
NM_177424chr121485 246 ------
NM_177538chr258560 7272 5748 826 276 38528 3486 122 ----
NM_177952chr14--1661 ----
NM_177969chr21589 ------
NM_177985chr222185 1775 --22177 1414 --
NM_177990chr2021961 482 11975 ----
NM_178009chr131164 ------
NM_178126chr1741840 609 308 223 1336 21707 259 --
NM_178140chr512404 ------
NM_178151chrX57739 6909 5650 620 95 15969 163 --
NM_178152chrX57739 6909 5650 620 95 15969 163 --
NM_178153chrX57739 6909 5650 620 95 15969 163 --
NM_178527chr1130 ------
NM_178539chr1211490 ------
NM_178585chr422677 2389 ----13275
NM_178812chr821607 1377 ------
NM_178818chr1621823 1573 --22392 2056 --
NM_180989chr1332014 784 769 ------
NM_181054chr141371 ------
NM_181351chr1112887 22660 656 ----
NM_181356chr6--1742 ----
NM_181358chr11768 44071 3465 3179 1364 1251 --
NM_181361chr31249 --1491 --
NM_181442chr202763 87 11019 ----
NM_181459chr21880 ------
NM_181460chr21927 ------
NM_181486chr1231544 1202 518 ------
NM_181504chr553642 2549 1484 1038 337 ------
NM_181523chr553642 2549 1484 1038 337 ------
NM_181524chr553642 2549 1484 1038 337 ------
NM_181659chr2052970 2588 1159 919 132 --12321 --
NM_181659chr2052970 2588 1159 919 132 --12321 --
NM_181670chr1241160 953 302 278 ------
NM_181672chrX42007 824 411 379 ------
NM_181673chrX42007 824 411 379 ------
NM_181701chr922204 571 21470 225 ----
NM_181705chr565710 4170 3849 1792 332 31 35651 5040 4724 ----
NM_181714chr611694 11983 1299 --
NM_181723chr82577 309 1597 12220 --
NM_181783chr121506 ----1681
NM_181787chr843161 3111 1288 433 ------
NM_181836chr52293 68 1774 ----
NM_181838chr51188 1456 ----
NM_181844chr1721329 503 --1703 --
NM_181869chr122424 58 ------
NM_181886chr41513 ------
NM_181887chr41513 ------
NM_181888chr41513 ------
NM_181889chr41513 ------
NM_181890chr41513 ------
NM_181891chr41513 ------
NM_181892chr41560 ------
NM_181893chr41513 ------
NM_181897chr322317 601 11060 ----
NM_182314chrX21247 324 ------
NM_182485chr41801 ------
NM_182498chr193318 248 99 ------
NM_182580chr121960 1699 ----12481
NM_182643chr842413 691 639 247 1187 1404 --
NM_182646chr41801 ------
NM_182648chr141508 ------
NM_182666chr31104 ------
NM_182697chr721640 1155 ------
NM_182715chr71186 ------
NM_182728chr1411727 ------
NM_182767chr1221471 302 1828 ----
NM_182796chr5194 ------
NM_182943chr31909 ------
NM_182948chr132875 802 312 ----11034
NM_182964chr115651 631 539 527 230 22896 2606 ----
NM_183043chr13--2746 374 ----
NM_183044chr13--2746 374 ----
NM_183050chr642119 2028 1785 945 12445 ----
NM_183079chr2031502 1380 1267 ------
NM_183227chr641559 1522 1171 553 ------
NM_183353chrX----11116 190
NM_183380chr61905 1958 ----
NM_183381chr33202 157 112 ------
NM_183383chr33202 157 112 ------
NM_183384chr33202 157 112 ------
NM_194247chr243985 3365 1171 672 12940 ----
NM_194282chr41762 22152 2131 ----
NM_194285chr1133363 2319 221 1582 --1108
NM_194292chr141779 178 50 33 ------
NM_194301chr1421151 1039 ------
NM_194314chr164494 3586 2135 1841 1773 804 --25175 1588 11812
NM_194356chr1212087 22341 1894 ----
NM_194434chr1865728 4546 1468 898 792 571 11057 1434 --
NM_197968chr131133 ------
NM_198043chr10----1465 --
NM_198044chr10----1465 --
NM_198045chr10----1465 --
NM_198046chr10----1465 --
NM_198120chr81518 ------
NM_198128chr182823 263 ------
NM_198158chr332938 558 485 ------
NM_198159chr332938 558 485 ------
NM_198177chr332938 558 485 ------
NM_198178chr332938 558 485 ------
NM_198181chr1552777 2728 1973 808 763 ------
NM_198186chr9158 ------
NM_198187chr9158 ------
NM_198243chr153751 702 612 --1367 --
NM_198261chr12------1707
NM_198262chr12------1707
NM_198268chr11768 44071 3465 3179 1364 1251 --
NM_198269chr11768 44071 3465 3179 1364 1251 --
NM_198270chrX53216 2895 1406 576 395 ------
NM_198271chr341569 614 377 138 ------
NM_198273chr532423 1940 1082 1251 ----
NM_198279chrX1797 1189 ----
NM_198391chr201420 11342 --1538
NM_198401chr841724 1364 1336 479 1359 ----
NM_198404chr132623 312 ------
NM_198443chr16199 ------
NM_198465chrX22933 2871 32923 298 86 1202 --
NM_198467chr71587 ------
NM_198503chr132043 1634 1523 --1177 --
NM_198507chr53437 191 102 ------
NM_198513chr811646 11247 ----
NM_198578chr1221163 448 21195 285 --191
NM_198581chr247434 2078 242 165 35130 1610 1132 ----
NM_198597chr102875 282 ------
NM_198793chr342604 1221 1124 894 --23908 672 13159
NM_198794chr1431104 308 132 ----11015
NM_198859chr343501 3444 1855 1408 ----23112 974
NM_198880chr31700 ------
NM_198896chr111304 1695 ----
NM_198900chr1286997 6904 6617 5475 4834 2875 2830 185 17836 14859 --
NM_198935chr2042628 764 703 212 22840 137 ----
NM_198995chr181455 1387 ----
NM_199000chr732078 2004 1918 11470 ----
NM_199168chr1021182 372 ------
NM_199188chr1234093 3467 3377 1697 ----
NM_199189chr52234 107 ------
NM_199190chr1234093 3467 3377 1697 ----
NM_199205chr82643 270 ------
NM_199245chr1242602 2561 2292 662 ------
NM_199324chr453591 3091 2870 2613 688 21248 1177 ----
NM_199327chr431074 952 245 11103 ----
NM_199355chr1621811 647 --2510 194 --
NM_199421chr1424925 4497 11069 ----
NM_199423chr1641515 1506 1159 475 ------
NM_199436chr243057 2851 2673 337 ------
NM_199461chr104794 707 257 163 21128 1079 1610 --
NM_199462chr134990 4513 115 --14021 11190
NM_199478chrX11237 --1345 --
NM_199482chr2--32116 2002 1378 ----
NM_201266chr2----12921 --
NM_201269chr121234 484 ------
NM_201279chr2----12921 --
NM_201413chr212445 192 --1742 --
NM_201414chr212445 192 --1742 --
NM_201428chr1111664 ------
NM_201429chr1111664 ------
NM_201430chr1111590 ------
NM_201453chr91118 ------
NM_201542chr1----132 1297
NM_201591chr451952 1808 1528 659 634 11962 ----
NM_201592chr451952 1808 1528 659 634 11962 ----
NM_201629chr92300 287 1672 ----
NM_201999chr431069 478 450 11088 ----
NM_203283chr41449 ------
NM_203284chr41449 ------
NM_203301chr141168 ------
NM_203327chr2044400 3907 3555 2798 ------
NM_203372chr22438 235 11338 ----
NM_203390chr811365 11768 11183 --
NM_203394chr1222571 2489 12119 ----
NM_203417chr2121263 293 --11452 --
NM_203418chr2121263 293 --11452 --
NM_203446chr2112576 11066 1839 --
NM_203458chr143827 3702 2625 720 ------
NM_203487chr13--2569 74 ----
NM_203504chr422581 1988 --1487 --
NM_203505chr422581 1988 --1487 --
NM_206594chr143522 2781 2626 859 11443 ----
NM_206595chr143522 2781 2626 859 11443 ----
NM_206808chr13137 ------
NM_206852chr143727 583 164 ------
NM_206853chr642554 1253 1212 1186 23903 1346 ----
NM_206854chr643815 1181 713 142 25164 3310 13379 --
NM_206855chr684780 4086 3909 2146 1678 1107 888 698 36129 4275 562 14344 --
NM_206857chr143727 583 164 ------
NM_206866chr2112069 ------
NM_206876chr232668 1104 1097 ------
NM_206909chr857932 5352 5289 1562 321 1805 ----
NM_206914chr1221768 132 12098 11496 11671
NM_206943chr21599 ------
NM_207009chr102968 403 1981 ----
NM_207015chr322156 466 ------
NM_207036chr1512246 --11607 --
NM_207037chr1512246 --11607 --
NM_207038chr1512246 --11607 --
NM_207040chr1512246 --11607 --
NM_207171chr12295 95 11257 ----
NM_207304chr1321648 637 ------
NM_207337chr121345 ----1979
NM_207361chr1354619 2419 956 318 265 1230 --1782
NM_207418chr1_random1242 11089 ----
NM_207578chr11615 ------
NM_212471chr1711729 21833 259 ----
NM_212472chr1711729 21833 259 ----
NM_213589chr254510 4485 1460 1389 382 24252 2114 13955 --
NM_213651chr111515 ------
NM_213654chr321443 1433 11551 ----