TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1913
miRNA Sequence: UCUGCCCCCUCCGCUGCUGCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51466 ------
NM_000214chr2011616 ------
NM_000232chr443121 2828 2764 1232 12865 ----
NM_000248chr3----12005 --
NM_000267chr1742725 2678 1022 596 ------
NM_000304chr17--1451 ----
NM_000314chr1022723 721 ------
NM_000330chrX1273 1130 ----
NM_000333chr3--1130 ----
NM_000362chr2232972 2775 2371 1951 --13388
NM_000390chrX22356 2136 11297 ----
NM_000555chrX25368 2870 --33111 1817 239 --
NM_000597chr21249 ------
NM_000599chr242862 1201 1072 368 1626 ----
NM_000609chr102543 94 21020 587 11917 --
NM_000615chr11----12152 1637
NM_000680chr81160 ------
NM_000719chr1276598 6407 4412 2481 2236 506 228 14530 1449 --
NM_000724chr101263 ------
NM_000813chr532241 2191 2150 12060 ----
NM_000831chr185555 4962 4297 4041 3823 1991 1607 635 34780 506 42 24838 1556 --
NM_000903chr1611153 ------
NM_001001436chr161313 --1321 --
NM_001001938chr943881 3790 2690 790 23387 1156 ----
NM_001002243chr21217 ------
NM_001002295chr102998 332 ------
NM_001002906chrY1415 ------
NM_001003794chr333058 2537 1987 2497 57 1610 12790
NM_001003800chr933461 139 113 ----1370
NM_001004317chr61540 --23202 2960 24366 1207
NM_001005739chr2123 ------
NM_001005743chr14----153 --
NM_001005744chr14----153 --
NM_001005745chr14----153 --
NM_001005861chr31276 ----1749
NM_001007099chr11252 ------
NM_001007100chr11252 ------
NM_001007102chr611414 ----1316
NM_001007466chr624697 1508 1640 14588 --
NM_001008220chr53811 582 425 --12957 23479 2873
NM_001008701chr1982351 1235 760 696 568 555 372 56 --21095 382 --
NM_001010867chr186389 6143 5502 2663 2107 1665 779 515 25614 704 26415 1121 --
NM_001011666chr746384 5526 1249 411 ------
NM_001012393chr1143904 3764 3577 199 --1190 --
NM_001012751chr101286 ------
NM_001013622chr47486 424 363 301 177 116 54 ----1905
NM_001013693chr192563 2399 1848 1067 978 806 705 366 352 --62028 1172 1113 1092 823 185 --
NM_001013693chr192563 2399 1848 1067 978 806 705 366 352 --62028 1172 1113 1092 823 185 --
NM_001014797chr1057075 7014 6453 5695 1135 --25427 2646 17477
NM_001017440chr747305 2082 1721 1567 32300 2217 62 25961 914 --
NM_001020825chr51417 ------
NM_001024858chr1462512 2237 787 513 331 51 22027 1085 22784 271 12001
NM_001025079chr341329 961 459 267 ------
NM_001025580chrX--1170 ----
NM_001029863chr612234 12702 ----
NM_001029883chr242998 2450 2033 1247 12191 11951 --
NM_001030007chr1633350 1270 433 ------
NM_001031679chr1251420 1315 588 385 105 11404 ----
NM_001031732chr423418 3289 ----1234
NM_001032282chr8--11050 ----
NM_001032380chr1011895 ------
NM_001033112chr51811 ------
NM_001033551chr1773327 3284 2987 2904 1010 714 684 23987 273 23486 3446 --
NM_001039618chr1165253 4226 3833 1766 1716 729 ----11375
NM_001039937chr1323731 1251 ----1780
NM_001040153chr13173 ------
NM_001042492chr1742725 2678 1022 596 ------
NM_001042533chr313084 ------
NM_001042599chr236693 5350 2477 45290 5000 4769 3069 ----
NM_001128chr1633350 1270 433 ------
NM_001149chr1021107 1052 ------
NM_001186chr21--13022 ----
NM_001206chr93975 357 332 1939 --1376
NM_001256chr17----1235 --
NM_001270chr51965 ------
NM_001356chrX----11944 --
NM_001387chr522977 2645 --1435 128
NM_001408chr141640 1420 537 160 ----1636
NM_001412chrX--1232 ----
NM_001416chr17----1184 --
NM_001431chr6--1905 ----
NM_001655chr1112101 ------
NM_001701chr9----1486 --
NM_001707chr7179 ------
NM_001777chr341329 961 459 267 ------
NM_001830chrX63749 3026 1502 637 405 254 ------
NM_001904chr31948 ------
NM_001946chr121317 1300 ----
NM_002025chrX21497 182 23062 2804 11309 --
NM_002051chr102998 332 ------
NM_002128chr1322591 628 ------
NM_002130chr531646 488 53 ------
NM_002137chr71564 ------
NM_002139chrX1417 ------
NM_002146chr172903 66 ----1304
NM_002223chr1223254 275 14005 1307 --
NM_002271chr13--1429 ----
NM_002293chr12748 722 12035 144 1333
NM_002309chr2232772 2096 791 --31936 882 802 --
NM_002310chr524067 634 --15587 --
NM_002336chr12----1136 --
NM_002469chr121378 ------
NM_002522chr1743226 1485 1216 1174 --1578 12468
NM_002545chr1143904 3764 3577 199 --1190 --
NM_002577chr31343 ------
NM_002636chr61216 ----1498
NM_002698chr1952693 2520 2470 2064 1044 22047 848 32023 2014 29 1682
NM_002713chr12798 425 ------
NM_002717chr82604 217 ------
NM_002742chr141476 ------
NM_002755chr151298 ------
NM_002833chr15--11007 ----
NM_002834chr1253494 3049 1598 1231 1041 ------
NM_002901chr111128 ------
NM_002923chr11144 ------
NM_002941chr3------1577
NM_002958chr31276 ----1749
NM_002979chr11252 ------
NM_003016chr17----164 --
NM_003072chr19177 ------
NM_003107chr621815 273 1265 3978 792 37 1799
NM_003108chr252523 2333 2326 2066 1896 25968 4659 2411 406 11935
NM_003131chr652128 1810 1548 564 125 ----11445
NM_003149chr321050 358 11606 ----
NM_003173chrX1568 1921 ----
NM_003179chrX3954 900 37 ----1501
NM_003199chr1834190 3637 594 --21480 858 --
NM_003222chr202979 785 ------
NM_003482chr1211873 --41965 1046 944 796 22230 152
NM_003487chr17195 ------
NM_003489chr2112200 ------
NM_003498chr1662590 1974 1938 1860 218 59 --11821 --
NM_003559chr1733453 2958 2533 23631 1050 23712 743 --
NM_003583chr1211498 --1480 --
NM_003644chr1756015 5751 5694 2071 398 21529 447 --11434
NM_003657chr201796 ------
NM_003722chr332320 492 378 ------
NM_003740chr651590 1561 595 287 219 11239 21657 100 --
NM_003744chr14----153 --
NM_003913chr621616 1533 ----13799
NM_004035chr1725098 1566 24351 1925 15078 --
NM_004085chrX1568 ------
NM_004171chr1189499 9132 8837 6373 6308 6171 5878 1873 ------
NM_004227chr732487 693 61 --42763 755 708 433 --
NM_004330chr151731 ------
NM_004370chr641855 1715 1644 1354 ------
NM_004427chr14364 319 122 104 11077 --1193
NM_004449chr2111090 ------
NM_004472chr5----1245 --
NM_004497chr194697 557 463 170 ------
NM_004504chr21211 ------
NM_004588chr1153535 863 844 526 316 --2911 869 22537 323
NM_004660chrY----11873 --
NM_004677chrY1415 ------
NM_004687chr171208 ------
NM_004723chr11369 ------
NM_004730chr511405 ------
NM_004734chr1332446 2073 1124 12249 12067 --
NM_004748chr1543254 2591 1524 809 11002 ----
NM_004768chr1----1899 --
NM_004776chr2033215 3019 433 --41316 1085 1078 1071 --
NM_004804chr232769 525 311 22635 134 ----
NM_004822chr1793391 3245 1199 982 466 403 198 42 22 --62432 365 342 220 149 127 --
NM_004824chr61420 ------
NM_004904chr746384 5526 1249 411 ------
NM_004949chr1822064 1393 ------
NM_004961chrX41152 1024 490 25 --1621 --
NM_004976chr1174547 3373 3319 948 794 454 132 23840 3711 44119 4113 356 295 --
NM_004992chrX48208 1732 906 73 1836 26464 2910 16559
NM_004992chrX48208 1732 906 73 1836 26464 2910 16559
NM_005063chr1033477 691 449 --11514 --
NM_005065chr1424777 866 --11530 --
NM_005165chr171344 ------
NM_005206chr17----11152 --
NM_005233chr31201 ------
NM_005235chr236693 5350 2477 45290 5000 4769 3069 ----
NM_005256chr111607 ------
NM_005277chr411526 ------
NM_005312chr972522 2421 477 214 145 48 38 1495 12533 --
NM_005313chr151266 ------
NM_005316chr11--1460 ----
NM_005339chr424215 477 --23616 3228 --
NM_005376chr131018 824 191 1816 ----
NM_005453chr6----126 --
NM_005497chr1715901 ------
NM_005595chr11904 ------
NM_005596chr935786 5001 3880 11392 ----
NM_005598chr1------11297
NM_005602chr3----1879 --
NM_005655chr8--11050 ----
NM_005668chr523795 1777 11731 13627 --
NM_005717chr13950 824 90 ------
NM_005751chr71468 ------
NM_005875chr31158 ------
NM_005909chr521071 483 ------
NM_005920chr153435 2995 1014 958 815 1797 53721 3643 2981 1533 1511 --
NM_005937chr17104138 3331 1442 1030 1009 953 851 841 651 533 21300 476 23627 584 --
NM_006047chr20--128 --12552
NM_006048chr141122 902 326 288 ------
NM_006073chr621610 1517 ------
NM_006085chr1--1401 ----
NM_006141chr161226 --1107 1777
NM_006160chr1721454 1408 1478 31294 371 142 11209
NM_006212chr144795 1028 393 218 ----14154
NM_006224chr1721666 410 --12206 --
NM_006226chr21113 ------
NM_006244chr112555 506 ----1609
NM_006247chr19----1160 2167 74
NM_006252chr165933 5757 2835 1716 1133 125 22363 1293 ----
NM_006267chr2--1482 ----
NM_006279chr14588 354 342 274 --1115 --
NM_006282chr2023476 1853 1493 --1950
NM_006294chr81348 ------
NM_006373chr1711247 ------
NM_006465chr1542234 2166 629 542 11812 2198 179 --
NM_006482chr1211498 --1480 --
NM_006546chr1794961 4764 4719 4674 4174 2467 1313 1076 849 145 26560 2595 11981
NM_006547chr71537 ------
NM_006574chr3----245 31 --
NM_006575chr1411123 1141 ----
NM_006598chr521265 53 1241 --11466
NM_006624chr102671 189 ------
NM_006650chr53811 582 425 --12957 23479 2873
NM_006662chr16----1151 --
NM_006690chr2022252 1680 12242 2165 71 1882
NM_006722chr3----12005 --
NM_006763chr11476 1544 --1286
NM_006791chr151156 ------
NM_006802chr1--11012 ----
NM_006805chr5----2390 39 --
NM_006885chr1633893 3882 3373 1624 ----
NM_006888chr14----12728 --
NM_006898chr2--1690 181 161
NM_006899chr20--1118 ----
NM_006920chr241589 732 651 517 ------
NM_006939chr141395 ------
NM_006988chr21----1973 1141
NM_007011chr1546325 4975 4900 124 45436 4865 4807 4687 46425 6407 5010 4893 --
NM_007027chr3181 ------
NM_007053chr14793 754 265 160 ------
NM_007112chr11188 ------
NM_007283chr333058 2537 1987 2497 57 1610 12790
NM_007292chr1725098 1566 24351 1925 15078 --
NM_007375chr112557 ------
NM_012141chr1323731 1251 ----1780
NM_012193chr1144974 4860 3975 1499 ----13398
NM_012199chr124087 3722 13841 2272 102 --
NM_012218chr1962747 2682 1897 923 881 584 1243 12588 --
NM_012248chr16--1227 ----
NM_012262chr11855 15171 ----
NM_012281chr71565 ------
NM_012290chr21379 11335 ----
NM_012297chr411631 ------
NM_012306chr1273175 2728 2204 1327 698 518 501 23439 2572 33286 685 484 --
NM_012316chr134527 3849 72 25495 4981 --22224 297
NM_012384chr203855 307 97 174 12212 1931
NM_012416chr9--11104 ----
NM_012421chr1--1106 ----
NM_013231chr1424113 3065 2935 390 ----
NM_013252chr731015 579 464 --12166 --
NM_013261chr433341 2987 386 11021 ----
NM_013277chr12------1252
NM_013330chr11206 ------
NM_013443chr91265 1258 21217 507 1451
NM_014110chr12798 425 ------
NM_014117chr161758 --1893 --
NM_014155chr1147485 6677 6153 4581 --16731 --
NM_014232chr1721559 1285 11142 11136 --
NM_014232chr1721559 1285 11142 11136 --
NM_014233chr1721881 23 --1155 2703 580
NM_014288chr1--1308 ----
NM_014331chr417135 ----26847 4721
NM_014345chr61432 ----1868
NM_014393chr82661 618 ------
NM_014423chr5----14862 11289
NM_014437chr1--1180 2721 21 1699
NM_014515chr12144 ------
NM_014517chr311821 ------
NM_014547chr15--186 ----
NM_014547chr15--186 ----
NM_014554chr12----12310 --
NM_014647chr161513 ------
NM_014661chr1063708 3249 2673 1216 898 314 43043 2795 947 706 32877 2722 800 --
NM_014683chr17------12044
NM_014729chr8--12244 ----
NM_014730chr1274905 4569 4276 4204 3923 3698 3672 --21983 1011 1485
NM_014730chr1274905 4569 4276 4204 3923 3698 3672 --21983 1011 1485
NM_014731chr2041383 1181 244 230 1509 11650 --
NM_014751chr831973 833 615 --1330 --
NM_014761chr162891 859 ------
NM_014765chr1--11848 21827 1724 11765
NM_014770chr1261272 942 844 529 417 387 21124 61 2936 824 1345
NM_014820chr311337 11930 ----
NM_014828chr1411774 ----12130
NM_014836chr1011895 ------
NM_014906chr171504 23305 3042 ----
NM_014921chr1982351 1235 760 696 568 555 372 56 --21095 382 --
NM_014935chr183428 3173 3078 2985 1315 1073 719 705 --12427 11082
NM_014952chr1551440 793 339 139 58 11391 51674 1337 787 327 52 --
NM_014989chr611988 ------
NM_014991chr411037 ----1180
NM_015009chr3------151
NM_015020chr1653587 1259 1073 644 550 12808 149 --
NM_015035chr2046071 4205 2662 1428 26436 1545 44499 4310 2152 906 --
NM_015045chr101800 ------
NM_015049chr223217 448 1740 ----
NM_015077chr1754192 3661 1817 1092 963 14405 ----
NM_015094chr2283806 3795 3742 3651 3405 2924 335 86 22915 1103 14227 13961
NM_015107chrX42355 2307 1715 67 ------
NM_015124chr22--12280 11855 22010 262
NM_015178chr842079 2012 1908 867 1511 22644 1842 12220
NM_015192chr20----12342 --
NM_015239chr9--1436 ----
NM_015250chr911763 ------
NM_015270chr123916 365 88 --52092 1849 1468 828 232 --
NM_015275chr12--1858 ----
NM_015291chr122792 571 11326 ----
NM_015299chr1463163 2979 1350 603 342 333 --12554 --
NM_015315chr522257 179 13073 32761 2370 41 --
NM_015318chr1931703 607 377 21215 385 31257 1252 401 --
NM_015349chr622526 2018 ------
NM_015365chrX--1170 ----
NM_015374chr2271332 1319 1275 1224 605 374 145 --11055 --
NM_015393chr423734 2362 12660 --1627
NM_015457chr11--11028 1196 --
NM_015525chr61309 ------
NM_015609chr132909 575 327 --22301 685 12396
NM_015649chr19------1148
NM_015678chr1311186 ------
NM_015686chrX52273 2162 1617 637 380 --31952 627 109 12495
NM_015726chr11409 --123 1711
NM_015872chr12512 96 --41534 1429 670 635 1177
NM_015981chr543165 2683 2069 748 21137 449 33144 2001 927 --
NM_015987chr12161 ------
NM_016009chr114324 ------
NM_016053chr12141 ------
NM_016076chr1--12808 ----
NM_016162chr123794 581 342 162 1356 --
NM_016178chr11103 ------
NM_016206chr336623 2805 2632 ------
NM_016231chr172536 524 1625 ----
NM_016235chr16------1332
NM_016247chr3--1441 ----
NM_016250chr144602 568 312 75 1108 ----
NM_016396chr15--1757 ----
NM_016436chr204437 394 41 28 ------
NM_016480chr51811 ------
NM_016516chr2123 ------
NM_016588chr61626 ------
NM_016607chrX21658 622 21290 1173 1583 --
NM_016621chr1174409 4146 4136 3914 3502 3049 1113 1371 34211 4177 3545 --
NM_016622chr232107 1837 1352 ------
NM_016953chr234376 3937 269 25413 2131 1200 14236
NM_017420chr1423655 2859 ------
NM_017551chr1052234 557 342 334 169 2849 818 1885 --
NM_017590chr2252518 2059 1035 431 81 1455 12479 --
NM_017628chr413438 14016 14702 --
NM_017634chr811930 --1257 --
NM_017635chr111644 ------
NM_017657chr21217 ------
NM_017719chr312047 ------
NM_017728chr1752980 2849 2545 327 201 --32690 2595 102 32743 2497 2076
NM_017742chr18--1539 --11617
NM_017811chr942829 2174 814 428 ------
NM_017848chrX21823 1567 23288 696 23492 3456 --
NM_017907chr11--1174 ----
NM_017944chr11298 69 --12360 12475
NM_017953chr1184 ------
NM_018014chr22550 524 ----1999
NM_018067chr11510 ------
NM_018086chr2--1152 ----
NM_018205chr1022300 1642 --22233 103 2897 35
NM_018214chr61291 ------
NM_018239chr1022300 1642 --22233 103 2897 35
NM_018240chr14366 306 77 22 ----137
NM_018244chr201185 ------
NM_018247chr622808 640 ------
NM_018263chr212555 ------
NM_018334chr71210 ------
NM_018416chr1252589 2164 2081 1742 1731 ------
NM_018444chr811691 2878 52 ----
NM_018452chr6_random43273 2757 1340 687 1107 ----
NM_018475chr41578 ------
NM_018482chr81189 ------
NM_018660chr832943 2463 2153 ----1514
NM_018945chr61252 22830 54 --1648
NM_018994chr11477 ------
NM_019084chr1021629 1041 12203 ----
NM_019089chr172602 2385 1366 995 525 325 49 12855 1610 1750
NM_019116chr1613287 ----23257 3239
NM_019885chr242149 668 616 466 --22143 495 12207
NM_020116chr41348 ------
NM_020122chr235592 3938 1284 24032 2250 ----
NM_020123chr1011534 ------
NM_020135chr61358 ------
NM_020141chr1------1915
NM_020150chr1031978 1539 279 ----1624
NM_020178chr1711137 ------
NM_020193chr1111106 ------
NM_020205chr133278 3117 1256 23143 352 1589 1825
NM_020245chr624603 1414 1546 14494 --
NM_020317chr1197 ------
NM_020346chr111649 ------
NM_020403chr1321662 1226 ------
NM_020418chr34494 478 380 219 --3527 178 27 --
NM_020443chr111148 16632 --11785
NM_020654chr311449 ------
NM_020699chr154725 3981 3712 1196 609 --23969 3685 1564
NM_020713chr2062082 1213 1004 748 713 447 1942 32034 929 132 --
NM_020717chrX23644 1798 --23173 1787 --
NM_020739chr1543254 2591 1524 809 11002 ----
NM_020740chr171379 ------
NM_020748chr171361 ------
NM_020768chr5--1184 ----
NM_020772chr1747420 3292 2753 1533 --1668 11248
NM_020807chr165567 304 207 198 149 1526 11447 --
NM_020819chr61395 11110 ----
NM_020856chr191533 ------
NM_020888chr141868 1537 781 267 --1605 --
NM_020899chr172734 278 --1243 11993
NM_020956chr1964293 4064 3980 3709 3604 2956 13543 14384 1939
NM_020958chr141125 ----1260
NM_020983chr123916 365 88 --52092 1849 1468 828 232 --
NM_020987chr1021107 1052 ------
NM_021116chr7138037 7837 6035 5936 5868 3495 3301 3199 1804 1785 1726 1313 491 42663 2165 2046 1818 25874 1671 --
NM_021638chr483930 3872 3670 3394 3218 1875 940 481 --1885 --
NM_021785chrX2333 273 ------
NM_021911chr532241 2191 2150 12060 ----
NM_021984chrX41152 1024 490 25 --1621 --
NM_021987chrX41152 1024 490 25 --1621 --
NM_021990chrX41152 1024 490 25 --1621 --
NM_022140chr5123 ------
NM_022143chr731319 363 236 ----11169
NM_022340chr341366 1031 415 69 1341 1128 --
NM_022465chr1232380 2224 1940 11990 1393 --
NM_022477chr201475 --11456 --
NM_022481chr5128 ------
NM_022483chr511470 ------
NM_022491chr1212308 23389 2325 --1492
NM_022553chr6182 ------
NM_022648chr213602 44119 3086 1444 239 34100 3481 456 13801
NM_022652chr121317 1300 ----
NM_022831chr12442 322 ------
NM_022900chr711135 ------
NM_023010chrX1122 ------
NM_024046chr34402 193 131 37 --126 1985
NM_024522chr141475 1451 1298 238 --31706 228 223 11238
NM_024551chr121534 ----1706
NM_024551chr121534 ----1706
NM_024665chr323873 1847 ------
NM_024911chr11599 ------
NM_024947chr327864 6317 ------
NM_024953chr1211780 ------
NM_025129chr19----199 --
NM_025146chr322424 1723 1335 1603 --
NM_025160chr112903 --11669 --
NM_025191chr1--1857 --13195
NM_025222chr361843 720 709 640 419 39 22308 2057 12734 --
NM_030627chr511429 ------
NM_030647chr7--21934 216 15716 11485
NM_030762chr12----1411 --
NM_030885chr31138 ------
NM_030918chr125158 4489 13789 --14304
NM_030963chr61117 ------
NM_030964chr573301 2986 2892 1459 1312 1032 852 1838 22863 253 --
NM_031243chr71564 ------
NM_031372chr411601 ------
NM_031417chr1992711 2583 2485 2273 761 626 560 402 127 32574 2043 1856 2632 566 --
NM_031435chr12--13355 ----
NM_031442chrX1710 ----12015
NM_031468chr747305 2082 1721 1567 32300 2217 62 25961 914 --
NM_031886chr1942126 1788 538 57 --21038 288 --
NM_031891chr18--1160 ----
NM_032013chr201475 --11456 --
NM_032189chr1311600 ----11822
NM_032193chr1141472 594 219 210 1745 1543 --
NM_032311chr2232007 1712 594 ----134
NM_032320chr111319 ------
NM_032345chr12191 1329 ----
NM_032434chr21328 ------
NM_032438chr611414 ----1316
NM_032440chr10--1761 ----
NM_032457chr431453 1150 57 ------
NM_032458chrX22582 2196 --12979 --
NM_032466chr8----11196 --
NM_032580chr174496 113 106 61 --123 2420 42
NM_032778chr313084 ------
NM_032859chr13--13437 ----
NM_033008chr34494 478 380 219 --3527 178 27 --
NM_033009chr34494 478 380 219 --3527 178 27 --
NM_033010chr34494 478 380 219 --3527 178 27 --
NM_033133chr1733034 1397 212 1675 1428 --
NM_033315chr1731708 84 49 1562 21673 73 21968 1475
NM_033389chr1723015 1594 --152 11906
NM_033551chr522257 179 13073 32761 2370 41 --
NM_033656chr2125552 1099 25670 5105 --1226
NM_052896chr132111 792 644 12192 2891 68 --
NM_052900chr8--1371 1733 --
NM_052906chr22154668 4403 4321 4094 3679 3224 2030 1827 1787 1780 1014 929 917 425 79 13205 33779 3191 1892 --
NM_052966chr12497 56 ----12380
NM_057749chr8--147 ----
NM_080546chr92804 399 1695 ----
NM_080632chrX1122 ------
NM_080645chr641855 1715 1644 1354 ------
NM_080669chr1794718 4599 3855 1920 1796 1541 1369 719 115 23538 1342 24047 1070 --
NM_130395chr61358 ------
NM_133370chr423418 3289 ----1234
NM_133445chr92520 197 ------
NM_133631chr3------1577
NM_134268chr173891 864 765 1217 --1772
NM_138357chr10----11286 197
NM_138385chr42927 283 --11354 1500
NM_138396chr123245 131 97 2705 176 ----
NM_138415chr2281837 1246 1177 556 542 246 231 211 --31774 483 339 --
NM_138558chr12798 425 ------
NM_138559chr22540 514 ----1989
NM_138959chr156548 2481 1907 848 484 11341 16470 16167
NM_138980chr41537 ------
NM_138982chr41537 ------
NM_139215chr17195 ------
NM_139280chr1751177 1071 983 514 404 1914 31282 190 44 --
NM_144568chr141632 --173 1178
NM_144579chr232785 2525 635 --21964 55 22477 310
NM_144582chr241604 363 318 28 --2641 309 --
NM_144595chr13173 ------
NM_144967chrX148 ------
NM_145025chr6----1159 --
NM_145244chr42507 39 ------
NM_145251chr1411425 ------
NM_145644chr22349 79 ------
NM_145891chr1611448 ------
NM_145892chr1611448 ------
NM_145893chr1611570 ------
NM_145912chr2274267 3611 1823 1350 657 420 388 1725 33309 3219 51 --
NM_147171chr71468 ------
NM_147185chr71468 ------
NM_147202chr941982 571 454 50 160 2652 30 --
NM_152253chr2233385 1522 215 24095 3070 23589 1449 --
NM_152261chr121724 ------
NM_152263chr135151 4530 3939 24782 4064 11009 --
NM_152265chr11276 ------
NM_152271chr81341 ------
NM_152462chr171241 ------
NM_152622chr5----1529 --
NM_152678chr3--1133 ----
NM_152733chr696285 6115 5847 5461 5215 4114 2467 2223 1455 26446 1897 22502 1536 25913 4537
NM_152774chr72824 177 ------
NM_152838chr20--128 --12552
NM_152890chr11857 ------
NM_152924chr1546325 4975 4900 124 45436 4865 4807 4687 46425 6407 5010 4893 --
NM_153182chr313084 ------
NM_153260chr15194 ------
NM_153321chr17--1451 ----
NM_153322chr17--1451 ----
NM_153341chr1------184
NM_153695chr9--1241 ----
NM_170607chr1711530 ------
NM_170751chr61420 ------
NM_170752chr61420 ------
NM_171825chr543165 2683 2069 748 21137 449 33144 2001 927 --
NM_172071chr127169 4579 12845 160 --
NM_173470chrX22553 61 ------
NM_173511chr213065 ------
NM_173595chr1275096 5043 5025 4849 4839 3706 1732 34088 3845 799 31328 1117 519 25057 115
NM_173800chr511136 ------
NM_173808chr112953 ------
NM_173832chr883311 2830 2763 2514 2374 865 388 92 --42536 2452 1509 1495 --
NM_174856chr20--1118 ----
NM_174924chr161102 --2117 111 --
NM_174963chr14588 354 342 274 --1115 --
NM_174964chr14588 354 342 274 --1115 --
NM_174965chr14607 373 361 293 --1134 --
NM_174966chr14588 354 342 274 --1115 --
NM_174967chr14607 373 361 293 --1134 --
NM_174968chr14588 354 342 274 --1115 --
NM_174969chr14588 354 342 274 --1115 --
NM_174970chr14607 373 361 293 --1134 --
NM_174971chr14588 354 342 274 --1115 --
NM_175058chr1121284 1206 --122 --
NM_175709chr2282923 2343 1173 1133 876 525 240 225 --42773 498 485 81 --
NM_177553chr111607 ------
NM_177947chrX21658 622 21290 1173 1583 --
NM_177948chrX21658 622 21290 1173 1583 --
NM_177963chr1141566 1357 670 344 --32044 1336 512 --
NM_177999chr94965 857 599 355 13159 --13091
NM_178136chr2232007 1712 594 ----134
NM_178148chr6------1223
NM_178151chrX25368 2870 --33111 1817 239 --
NM_178152chrX25368 2870 --33111 1817 239 --
NM_178153chrX25368 2870 --33111 1817 239 --
NM_178450chr51484 ------
NM_178585chr411037 ----1180
NM_181351chr11----12152 1637
NM_181521chr1656862 5487 2588 1745 160 --22071 1474 --
NM_181532chrX--1289 ----
NM_181701chr961959 886 867 611 515 190 --12039 --
NM_182548chr61674 ------
NM_182580chr152477 2145 1995 1882 1697 11602 22325 607 --
NM_182898chr746384 5526 1249 411 ------
NM_182899chr746384 5526 1249 411 ------
NM_182918chr2111090 ------
NM_182944chr141376 ------
NM_183387chr14--1313 ----
NM_194314chr111808 14686 ----
NM_197941chr552317 2118 2026 836 676 --12380 --
NM_198040chr14364 319 122 104 11077 --1193
NM_198081chr612574 1607 --12464
NM_198123chr8--1371 1733 --
NM_198124chr8--1371 1733 --
NM_198158chr3----12005 --
NM_198159chr3----12005 --
NM_198177chr3----12005 --
NM_198178chr3----12005 --
NM_198204chr1711530 ------
NM_198205chr1711530 ------
NM_198225chr1011895 ------
NM_198484chr31754 1480 ----
NM_198507chr51100 ------
NM_198560chr373645 2944 2538 2316 1318 1179 695 11010 42888 2675 2370 1530 12824
NM_198595chr483930 3872 3670 3394 3218 1875 940 481 --1885 --
NM_198679chr972522 2421 477 214 145 48 38 1495 12533 --
NM_198793chr341325 957 455 263 ------
NM_198794chr1411123 1141 ----
NM_198859chr3--11190 ----
NM_199133chr51272 ------
NM_199245chr1262290 2038 1932 1843 1779 280 1145 1711 --
NM_199262chr175780 732 376 152 40 12192 32335 1954 1860 --
NM_199487chr201185 ------
NM_201432chr1756015 5751 5694 2071 398 21529 447 --11434
NM_201433chr1756015 5751 5694 2071 398 21529 447 --11434
NM_201535chr144602 568 312 75 1108 ----
NM_201536chr144602 568 312 75 1108 ----
NM_201537chr144602 568 312 75 1108 ----
NM_201538chr144602 568 312 75 1108 ----
NM_201539chr144602 568 312 75 1108 ----
NM_201540chr144602 568 312 75 1108 ----
NM_201541chr144602 568 312 75 1108 ----
NM_201570chr101263 ------
NM_201571chr101263 ------
NM_201572chr101263 ------
NM_201590chr101263 ------
NM_201591chr411526 ------
NM_201592chr411526 ------
NM_201593chr101263 ------
NM_201596chr101263 ------
NM_201597chr101263 ------
NM_203382chr511410 ----11350
NM_203437chr21217 ------
NM_203487chr1321662 1226 ------
NM_203504chr411631 ------
NM_203505chr411631 ------
NM_206839chr151156 ------
NM_206866chr21--13022 ----
NM_207111chr751971 1762 786 355 117 1409 21794 45 --
NM_207116chr751971 1762 786 355 117 1409 21794 45 --
NM_207119chr1022300 1642 --22233 103 2897 35
NM_207337chr122975 941 ------
NM_207406chr445751 4606 2202 1706 2801 323 22209 350 --
NM_207481chr2------1189
NM_212554chr1021198 1054 --11499 --
NM_212559chrX1200 ------