TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1914-3p
miRNA Sequence: GGAGGGGUCCCGCACUGGGAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521342 61 1180 ----
NM_000024chr51381 --1446 --
NM_000025chr831153 990 54 --2863 230 --
NM_000034chr163164 76 48 ------
NM_000037chr8152276 2193 2167 2066 1767 1667 1659 922 610 589 183 171 158 61 31 22519 2230 ----
NM_000044chrX143 --183 --
NM_000051chr1132215 701 23 22205 1228 ----
NM_000075chr123217 105 48 ------
NM_000080chr174918 834 602 88 1249 1364 --
NM_000081chr131520 1230 323 --1431 --
NM_000084chrX136163 5849 5562 5363 5220 4815 4540 4423 2506 2490 1862 1481 1457 25418 1210 ----
NM_000088chr1771218 1187 1125 402 395 382 28 190 11169 --
NM_000089chr72552 189 ------
NM_000090chr22812 618 ------
NM_000092chr294477 4464 3181 3073 2978 2918 1402 989 746 23961 3598 13472 13551
NM_000109chrX31807 446 102 ------
NM_000110chr111046 ------
NM_000125chr694215 3329 3130 1478 1443 1201 836 241 36 --13950 --
NM_000129chr631362 1180 438 ------
NM_000138chr15--12457 1923 --
NM_000166chrX4597 574 138 57 --1248 --
NM_000168chr773053 2737 2637 2154 2062 766 284 --32804 2490 2111 12815
NM_000170chr92478 41 ------
NM_000175chr194192 54 38 25 ------
NM_000176chr533696 3364 1281 33519 3086 1101 ----
NM_000183chr21100 ------
NM_000188chr102490 30 --1204 --
NM_000189chr251923 1582 539 284 74 --194 --
NM_000202chrX92766 2694 2685 2631 2591 2411 764 234 41 11565 33936 2716 2480 --
NM_000208chr1994538 3480 3218 3029 1660 1533 1397 1381 751 1841 ----
NM_000216chrX53826 3753 3240 1353 619 13152 13224 --
NM_000217chr1295225 4936 3681 3449 3356 1956 1605 1335 792 14062 11002 --
NM_000233chr21134 --1735 --
NM_000237chr851561 1439 716 508 143 --1706 --
NM_000238chr72128 65 ------
NM_000243chr164988 681 349 262 1319 ----
NM_000248chr332386 2359 451 22038 778 1508 --
NM_000259chr1584886 4877 4814 4519 4258 4235 1915 406 ------
NM_000260chr113491 198 73 --1210 --
NM_000264chr982116 2075 1213 1056 822 284 250 59 --11084 --
NM_000266chrX1256 ------
NM_000267chr1763486 1151 1126 891 885 388 --160 12426
NM_000276chrX51503 509 465 447 270 --2433 150 --
NM_000278chr10142224 1789 1710 1645 1619 1612 1603 908 865 822 750 543 251 170 11892 11541 1157
NM_000298chr15185 171 108 47 34 --2467 83 --
NM_000304chr1741037 923 413 382 ------
NM_000314chr1033248 2690 1183 --1412 --
NM_000318chr822746 1871 --1805 --
NM_000319chr122987 65 ----1823
NM_000321chr1331282 429 37 ------
NM_000322chr641302 387 372 22 2239 71 ----
NM_000330chrX42182 1643 1586 437 167 ----
NM_000332chr685909 5482 4948 4887 4628 4410 788 443 22325 939 ----
NM_000334chr17172101 2085 2033 1996 1957 1940 1892 1869 1795 1782 670 661 514 411 289 272 233 2601 335 --1436
NM_000335chr372084 1895 1748 1546 1407 850 524 ------
NM_000337chr596378 4919 4655 4294 4279 948 933 704 537 35784 5455 1689 --24462 1301
NM_000345chr4--1871 ----
NM_000347chr14164 --1141 --
NM_000353chr162945 250 2180 68 ----
NM_000354chrX------1262
NM_000365chr122377 322 1354 125 --
NM_000368chr984374 4030 4010 1570 727 690 455 199 21914 221 34355 3012 913 --
NM_000378chr11----2320 79 --
NM_000386chr171143 1231 ----
NM_000389chr681479 1282 1024 977 532 417 332 286 41099 525 263 126 21430 1136 --
NM_000393chr221392 743 ----1466
NM_000399chr104261 146 97 86 2422 334 ----
NM_000411chr2173322 3068 2773 2452 1226 355 256 22048 990 ----
NM_000421chr17--1130 ----
NM_000428chr1471991 1744 1008 993 882 844 494 32444 1022 603 1358 --
NM_000430chr1743486 1346 1260 21 ------
NM_000435chr194950 735 717 631 51000 649 297 269 218 ----
NM_000442chr17380 64 25 ------
NM_000445chr85870 792 724 235 216 1227 ----
NM_000448chr1152232 1010 393 79 46 11988 ----
NM_000449chr14943 116 62 33 11063 ----
NM_000450chr13607 95 79 1391 ----
NM_000458chr178771 763 678 669 627 243 223 197 1635 ----
NM_000459chr92819 53 ------
NM_000461chr393391 3336 3307 2895 1156 1148 1063 583 157 44136 3586 3208 1232 21709 850 12874
NM_000462chr1531289 1153 169 ------
NM_000474chr71260 124 ----
NM_000478chr14647 619 214 160 3494 96 69 ----
NM_000484chr211698 1319 11051 --
NM_000489chrX33320 3067 295 1109 11220 --
NM_000493chr621015 195 ------
NM_000500chr62508 430 1382 165 1170
NM_000503chr831543 1385 141 ------
NM_000505chr5125 ------
NM_000508chr4--1824 ----
NM_000516chr201119 1235 ----
NM_000522chr721264 137 ------
NM_000523chr221174 270 2868 145 ----
NM_000525chr1151481 1232 1204 563 203 21146 1057 1233 --
NM_000530chr14815 372 270 244 1776 --1409
NM_000533chrX4758 190 178 21 --11829 --
NM_000554chr1953312 3281 974 182 43 --1159 --
NM_000555chrX227662 7619 7297 6994 6986 6942 6789 6619 5629 5500 5239 4936 2703 2580 2573 2012 1956 1830 1742 515 439 177 15843 27647 3024 14995
NM_000557chr203173 59 47 1392 --1363
NM_000572chr14851 411 137 92 --1115 --
NM_000578chr251632 1308 1213 466 213 21548 1331 11768 --
NM_000595chr62620 202 --197 --
NM_000598chr7------1530
NM_000599chr2154588 4316 4103 3980 3653 3495 3462 3197 2990 610 598 566 223 69 33 33616 1452 26 1550 --
NM_000609chr1082745 2487 2366 2313 2080 854 499 26 11087 32782 2663 288 12303
NM_000611chr11116334 6014 4742 4562 2610 2181 1723 1238 967 870 407 27042 5013 26326 2173 15057
NM_000612chr11163778 3677 3665 3629 3526 3314 2973 2898 2633 2359 631 508 318 178 169 51 32927 2745 694 12416 1247
NM_000615chr1162869 2010 1178 1094 896 563 --11079 --
NM_000618chr12106018 5958 5599 5516 5285 4783 4179 2151 2051 350 65645 4661 4226 534 501 297 22613 1262 15114
NM_000618chr12106018 5958 5599 5516 5285 4783 4179 2151 2051 350 65645 4661 4226 534 501 297 22613 1262 15114
NM_000627chr21673 ------
NM_000633chr1874826 3200 3183 1460 1261 1046 286 --23397 1211 --
NM_000635chr1961641 1580 1029 445 291 22 1506 ----
NM_000660chr193231 220 210 ------
NM_000678chr205797 614 588 276 136 1635 --1622
NM_000684chr1031115 808 430 ------
NM_000687chr20----156 --
NM_000693chr1521751 1396 31433 424 154 ----
NM_000704chr192359 26 ------
NM_000719chr12166461 6438 6318 6306 5658 5198 5011 4546 4442 4226 4212 2655 2354 2139 1277 250 86324 5887 5204 4702 4232 2049 1911 839 15671 16606
NM_000721chr172534 2118 1893 661 308 302 192 22686 441 21834 1815 --
NM_000723chr1791622 1292 1285 1096 1074 1058 488 251 108 31625 474 281 ----
NM_000724chr101458 ------
NM_000725chr1241000 262 248 204 4833 642 317 184 ----
NM_000726chr211473 11102 11348 --
NM_000738chr112780 288 --123 --
NM_000757chr15891 731 331 185 163 3787 323 303 176 --
NM_000761chr1551395 1363 1256 1115 587 --11288 --
NM_000791chr542364 2139 713 36 ----1337
NM_000795chr1191127 1051 935 921 756 708 262 108 67 1155 ----
NM_000800chr551329 1170 360 282 177 1515 ----
NM_000801chr2061005 965 697 201 194 178 1999 21063 1016 --
NM_000806chr52325 151 ------
NM_000809chr478552 6856 6726 6152 6063 2647 390 --39272 3332 3108 --
NM_000811chr5------1176
NM_000813chr564196 2176 2040 1790 1167 806 142 --1363
NM_000814chr1583938 3840 2926 2885 1674 1239 959 524 --12818 --
NM_000817chr2266 44 --1238 --
NM_000826chr412014 11863 ----
NM_000827chr572166 2112 2009 741 589 575 204 --2462 22 165
NM_000831chr1185894 5573 5239 4932 4723 4611 4154 4101 3978 3897 1765 1632 1624 1312 581 571 297 263 54426 3843 1070 288 197 1524 --
NM_000833chr1611269 11389 --11172
NM_000836chr197936 854 805 791 625 601 29 2994 187 --1820
NM_000837chr86468 367 198 130 88 58 1530 1404 --
NM_000841chr64848 594 312 253 --2609 346 --
NM_000842chr111655 ----1123
NM_000844chr331056 1040 919 ------
NM_000845chr7179 ------
NM_000855chr111274 --126 --
NM_000859chr531373 424 288 1370 --1183
NM_000864chr11271 --21014 951 --
NM_000865chr61197 ------
NM_000868chrX31619 962 258 ----12357
NM_000870chr551329 654 601 423 234 11309 ----
NM_000872chr1011083 11323 ----
NM_000875chr15196678 6668 5064 4965 4780 4631 4416 4373 2158 2109 1988 1720 1578 1495 1479 1335 721 338 223 31938 613 297 12799 --
NM_000883chr75623 502 481 226 70 3629 517 164 ----
NM_000883chr75623 502 481 226 70 3629 517 164 ----
NM_000891chr1723285 1185 --13137 --
NM_000899chr1234345 3145 1308 --13090 --
NM_000901chr421029 396 ------
NM_000914chr63406 139 131 --1302 --
NM_000918chr176727 683 647 627 321 146 1633 2126 37 --
NM_000922chr1121049 169 ------
NM_000924chr1281361 1339 1143 1124 1019 970 460 164 21135 418 --1256
NM_000935chr311069 ------
NM_000941chr73344 301 62 --1129 --
NM_000944chr42673 217 ------
NM_000945chr231606 1313 686 1823 ----
NM_000949chr51715 ------
NM_000950chrX43028 2293 1462 844 ------
NM_000965chr31308 ----1162
NM_000966chr12101044 1022 917 761 672 437 335 192 171 103 --4927 880 738 113 --
NM_000984chr172294 136 1440 1446 --
NM_001001132chr2111279 2546 26 11367 --
NM_001001323chr1252935 2367 1943 241 170 22875 107 ----
NM_001001331chr351901 1842 357 266 161 22520 1876 ----
NM_001001342chr1041489 1122 1060 982 ----1196
NM_001001344chrX72410 1999 1904 1682 1650 1001 980 2854 202 ----
NM_001001394chr21450 ------
NM_001001395chr1232660 2561 2538 ----1827
NM_001001396chr1153660 3547 3320 2981 1780 1688 1629 1324 969 864 616 533 417 309 108 21795 1244 23502 835 --
NM_001001433chr2072708 2697 2648 2426 1958 1143 473 22030 476 23049 147 --
NM_001001438chr211120 ------
NM_001001481chr852820 2615 2428 685 393 13154 12230 --
NM_001001484chr1022359 958 ------
NM_001001523chr1276 26 --11230 --
NM_001001549chr772019 1932 1014 972 601 405 207 ------
NM_001001550chr772019 1932 1014 972 601 405 207 ------
NM_001001555chr772019 1932 1014 972 601 405 207 ------
NM_001001557chr82743 657 21591 661 1842 --
NM_001001661chr7--2602 505 ----
NM_001001664chr233756 1171 1051 22564 1206 145 --
NM_001001890chr2184250 4170 4084 2857 2788 2636 1724 378 12949 ----
NM_001001924chr841486 1388 1302 464 ------
NM_001001925chr841486 1388 1302 464 ------
NM_001001931chr841486 1388 1302 464 ------
NM_001001995chrX3551 350 329 ------
NM_001002006chr21601 1784 ----
NM_001002009chr7----2178 26 1193
NM_001002010chr7----2178 26 1193
NM_001002233chr841619 1359 771 691 31589 1362 117 ----
NM_001002243chr22878 48 1360 ----
NM_001002255chr62291 141 ------
NM_001002296chr83932 174 79 140 ----
NM_001002762chr10112376 2308 2301 2154 1187 964 826 632 518 144 65 22164 2042 32034 530 249 --
NM_001002814chr863615 1359 1003 952 771 691 31362 1006 117 13624 --
NM_001002838chrX21897 672 1104 ----
NM_001002840chr75638 621 608 580 187 ------
NM_001002843chr151806 ------
NM_001002860chr1464125 3212 1497 802 742 516 ------
NM_001002909chr1761637 1404 376 347 314 220 1209 1272 1640
NM_001003406chr22103218 3133 2857 2646 1267 1255 1245 983 453 188 32894 2330 676 ----
NM_001003407chr1075081 5037 4869 3983 3886 3594 1095 11445 ----
NM_001003408chr1075081 5037 4869 3983 3886 3594 1095 11445 ----
NM_001003652chr18118305 5566 3414 2865 2814 2450 2113 2080 1857 1539 1015 ------
NM_001003676chr115741 264 239 148 28 21043 800 3995 375 346 --
NM_001003677chr11176 1599 1551 --
NM_001003682chr14528 513 412 364 21251 539 1560 --
NM_001003688chr41114 ------
NM_001003694chr34569 432 146 48 ------
NM_001003698chr691990 1955 1740 1698 1651 1599 1430 439 327 21553 1494 1243 --
NM_001003699chr691990 1955 1740 1698 1651 1599 1430 439 327 21553 1494 1243 --
NM_001003712chr1231118 639 302 ------
NM_001003760chr663282 2840 809 408 179 67 13489 ----
NM_001003792chr31450 ------
NM_001003793chr31450 ------
NM_001003800chr963386 3192 1483 1357 1298 605 32833 352 200 --1189
NM_001003809chr185269 82 76 61 43 ------
NM_001003810chr41155 --1693 --
NM_001003940chr15143648 3608 3582 3464 3150 2907 2822 2764 2567 2511 2503 2386 1250 1027 33028 2590 1036 11001 22376 661
NM_001003942chr15143648 3608 3582 3464 3150 2907 2822 2764 2567 2511 2503 2386 1250 1027 33028 2590 1036 11001 22376 661
NM_001003943chr15143652 3612 3586 3468 3154 2911 2826 2768 2571 2515 2507 2390 1254 1031 33032 2594 1040 11005 22380 665
NM_001004106chr58949 844 774 753 727 396 191 155 3806 213 149 ----
NM_001004127chr133845 787 636 --1294 --
NM_001004196chr321011 331 ----1204
NM_001004317chr654099 3744 1641 628 353 --11222 --
NM_001004342chr1205816 5552 4980 4620 4506 3807 3754 2067 2006 1985 1906 1677 1147 835 817 801 748 704 607 232 21425 457 35561 2361 1407 11348
NM_001004419chr1264365 4047 3691 1625 1016 440 14041 ----
NM_001004439chr15101076 940 924 860 818 527 510 249 227 153 21023 283 1479 --
NM_001004720chr22677 76 --1297 --
NM_001004722chr22846 245 --1466 --
NM_001005158chr32363 338 ------
NM_001005159chr32363 338 ------
NM_001005210chr1192482 2178 2110 2004 1673 1607 620 608 230 1758 121 22369 539
NM_001005271chr1771122 1103 1075 1056 991 149 135 41059 859 719 23 2128 101 --
NM_001005273chr1771122 1103 1075 1056 991 149 135 41059 859 719 23 2128 101 --
NM_001005291chr173394 210 28 ------
NM_001005336chr93570 74 66 1179 2493 87 --
NM_001005353chr121077 176 ------
NM_001005353chr121077 176 ------
NM_001005354chr12--125 1518 --
NM_001005366chr121772 ------
NM_001005375chrY11379 197 ----
NM_001005377chr19154 --2113 46 --
NM_001005386chr22443 99 12165 ----
NM_001005404chr1763360 3080 1566 1380 1230 968 --22900 1333 1982
NM_001005473chr5106376 6305 5785 5683 5473 5464 2304 2166 372 337 ----11340
NM_001005474chr331509 1132 1033 ------
NM_001005505chr351165 1124 514 377 325 21660 103 1241 --
NM_001005527chr351200 543 231 169 79 ------
NM_001005609chrX133568 3553 3449 2656 2579 2438 2354 1542 852 824 413 68 32 33391 3032 1033 ----
NM_001005746chr211473 11102 11348 --
NM_001005747chr211473 11102 11348 --
NM_001005782chr22367 216 2204 31 ----
NM_001005785chrY11379 197 ----
NM_001005786chrY11379 197 ----
NM_001005845chr8--2381 54 1166 --
NM_001005849chr171138 1565 ----
NM_001005920chr161822 ------
NM_001006115chr392443 2274 2237 2034 874 719 683 390 265 41933 1793 209 196 22350 28 --
NM_001006600chr511811 ------
NM_001006605chr12946 107 ------
NM_001006605chr12946 107 ------
NM_001006623chr262325 2052 1716 1704 1691 237 --11978 --
NM_001006634chr16167 1529 ----
NM_001006636chr22851 185 ------
NM_001006657chr21243 23036 2312 --22579 2373
NM_001006684chrX1588 ------
NM_001006946chr251647 1423 297 122 22 ------
NM_001007024chr17103862 3021 1307 1286 1272 1072 957 478 461 432 13884 13518 --
NM_001007025chr17103862 3021 1307 1286 1272 1072 957 478 461 432 13884 13518 --
NM_001007026chr126436 429 413 397 386 380 ------
NM_001007027chr11135 ------
NM_001007097chr944701 3827 3720 74 33697 3339 3097 ----
NM_001007156chr1551762 1676 719 195 142 11688 ----
NM_001007226chr1751422 1348 1342 1023 533 ------
NM_001007227chr1751422 1348 1342 1023 533 ------
NM_001007228chr1751422 1348 1342 1023 533 ------
NM_001007229chr1751422 1348 1342 1023 533 ------
NM_001007230chr1751422 1348 1342 1023 533 ------
NM_001007237chr152145 1031 372 359 168 1592 ----
NM_001007257chr141413 975 516 271 ------
NM_001007267chr25723 715 234 166 154 ------
NM_001007273chr103149 30 23 ------
NM_001007277chr112781 249 177 1445 --
NM_001007471chr9174 ------
NM_001007553chr131118 947 79 --189 --
NM_001007559chr1821841 627 ------
NM_001007792chr11206 ------
NM_001007793chr102306 200 ------
NM_001008220chr5123909 3782 3659 3571 3530 3257 2532 1034 698 621 589 118 63864 639 258 170 158 147 33315 2627 880 --
NM_001008222chrX81138 1105 1001 425 302 293 283 213 1929 ----
NM_001008223chr124468 460 89 32 --1118 --
NM_001008239chr1883510 3226 2821 1009 792 153 140 37 1219 ----
NM_001008272chr33290 226 94 ------
NM_001008273chr33290 226 94 ------
NM_001008391chr11----1259 --
NM_001008392chr352389 906 342 320 44 --11157 --
NM_001008410chr291945 1932 1464 901 853 803 533 500 394 ------
NM_001008495chr821692 208 ------
NM_001008529chr1731221 1029 446 ----11296
NM_001008539chr854912 4780 3971 1512 830 1155 --12133
NM_001008541chr1041680 1497 1454 94 --32254 707 387 --
NM_001008541chr1041680 1497 1454 94 --32254 707 387 --
NM_001008563chr951196 979 839 489 304 ------
NM_001008564chr1321561 853 ------
NM_001008566chr223380 368 72 1443 ----
NM_001008660chr111272 ----1257
NM_001008701chr19172959 2935 2842 2752 2741 2283 2017 1997 1228 875 868 702 686 657 619 434 320 2148 124 1331 11246
NM_001008726chr1421653 1597 ----11608
NM_001008738chr522025 1051 ------
NM_001008777chr171231 ------
NM_001008800chr1149 ------
NM_001008801chr1921543 715 ------
NM_001008883chr1149 ------
NM_001008925chr463013 2799 2764 2718 2675 1262 ----12348
NM_001009183chr141423 ------
NM_001009184chr86468 367 198 130 88 58 1530 1404 --
NM_001009552chr8--1505 ----
NM_001009554chr453995 3422 1826 1756 107 ------
NM_001009554chr453995 3422 1826 1756 107 ------
NM_001009566chr151415 1067 959 316 223 --21114 118 --
NM_001009880chr22144558 4372 4308 4300 4215 4156 3590 3329 3154 1943 1505 1499 1485 193 --14332 --
NM_001009899chr375853 5462 4498 2343 2279 2198 652 25821 5741 25293 2264 --
NM_001009955chr13527 435 131 1123 ----
NM_001009955chr13527 435 131 1123 ----
NM_001009958chr72417 80 170 ----
NM_001009993chr293768 3748 3738 3661 3189 1661 1465 1302 660 14115 --14382
NM_001009996chr31199 1205 ----
NM_001010000chr1853165 2703 2381 538 388 12553 ----
NM_001010853chr673080 2622 1309 1146 1069 731 589 ------
NM_001010861chr162682 2246 1939 1878 173 42 ------
NM_001010862chrX43339 3118 2606 200 1143 --1307
NM_001010867chr1166116 5859 5764 5657 4090 2606 2273 2062 1674 1518 1458 1426 875 811 634 139 32323 1891 645 15948 --
NM_001010891chr585626 5504 5304 5035 2723 2579 2279 347 ------
NM_001010895chr91166 1640 ----
NM_001010908chr101231 ------
NM_001010924chr1051006 992 775 334 210 --1808 --
NM_001010926chr12113 55 ------
NM_001010934chr711166 --1237 --
NM_001010984chr151041 859 836 695 505 --1391 --
NM_001011538chr44781 300 187 64 ------
NM_001011645chrX143 --183 --
NM_001011666chr7116002 5233 4961 4729 4698 4512 4445 2469 1844 1004 317 --35954 4781 572 1102
NM_001011708chr242793 2022 1158 1060 12658 ----
NM_001012264chr1410934 815 784 767 682 241 209 114 68 24 1227 ----
NM_001012267chr931685 1352 370 31981 1832 1567 ----
NM_001012300chr125266 226 211 62 30 ------
NM_001012329chr1122213 2156 2127 1930 1737 1689 1552 830 703 680 105 89 11718 ----
NM_001012338chr15265 41 ------
NM_001012393chr1174165 4023 3789 944 891 732 606 1297 23209 274 11359
NM_001012426chr6203342 2875 2498 2479 2461 2422 2383 1328 1240 1113 960 945 918 886 707 566 458 309 204 83 52466 1306 909 899 339 63074 2994 1371 1185 245 39 1379
NM_001012427chr6203342 2875 2498 2479 2461 2422 2383 1328 1240 1113 960 945 918 886 707 566 458 309 204 83 52466 1306 909 899 339 63074 2994 1371 1185 245 39 1379
NM_001012513chr18250 26 ------
NM_001012614chr41557 ------
NM_001012643chr191552 --2188 34 --
NM_001012661chr112177 157 --130 --
NM_001012751chr1021750 1259 ------
NM_001012968chrX41133 970 815 571 --1324 --
NM_001012977chrX4490 201 179 150 1921 21315 187 --
NM_001012989chrX1248 1608 ----
NM_001013031chr10113357 2417 1095 935 818 704 686 663 582 483 230 12407 ----
NM_001013251chr112177 157 --130 --
NM_001013398chr7------1530
NM_001013415chr4299 55 ------
NM_001013439chr31320 ------
NM_001013615chr171208 1099 1081 1073 886 507 448 178 2957 790 1175
NM_001013624chr1781149 1126 1037 1022 380 352 52 43 1911 --1838
NM_001013635chr1281219 1153 1115 1050 893 293 274 138 11125 21011 453 --
NM_001013690chr12112397 2361 2181 1934 902 520 470 433 335 305 37 32125 889 366 21599 653 1494
NM_001013693chr192473 2243 2154 1830 675 440 203 89 29 ------
NM_001013693chr192473 2243 2154 1830 675 440 203 89 29 ------
NM_001014435chr166614 569 513 426 414 162 ----1181
NM_001014797chr10137731 7605 7447 7418 7238 5847 2337 2258 2211 1796 964 664 484 15834 1790 --
NM_001014809chr45824 800 293 249 55 ------
NM_001014831chr196784 673 625 590 582 538 --188 --
NM_001014832chr196784 673 625 590 582 538 --188 --
NM_001014834chr196784 673 625 590 582 538 --188 --
NM_001014835chr196784 673 625 590 582 538 --188 --
NM_001014839chr171038 1028 892 739 425 408 92 1192 1905 1164
NM_001014841chr171038 1028 892 739 425 408 92 1192 1905 1164
NM_001015045chr41115 1576 ----
NM_001015048chr1443227 3146 2498 2038 ------
NM_001015049chr1443227 3146 2498 2038 ------
NM_001015053chr17111529 1451 1237 1116 522 515 416 235 189 128 118 11481 1553 --
NM_001015508chr81706 ------
NM_001015877chrX1658 23006 816 ----
NM_001017368chr17102493 2321 2216 2203 2005 1793 767 409 177 145 12502 41860 1729 929 334 11723
NM_001017392chr194334 250 214 63 1274 1988 --
NM_001017395chr352779 1320 1049 962 703 22765 591 1416 --
NM_001017424chr151498 738 555 543 271 --1504 --
NM_001017425chr151498 738 555 543 271 --1504 --
NM_001017440chr7167390 6410 6187 5943 3210 2248 2093 1958 1853 1739 1690 1603 1520 1259 899 885 21997 1922 17345 33018 2372 595
NM_001017916chr17131697 1661 1569 814 790 773 755 703 615 552 430 166 50 21714 237 ----
NM_001017917chr17131697 1661 1569 814 790 773 755 703 615 552 430 166 50 21714 237 ----
NM_001017920chr21130 ------
NM_001017923chr1431697 538 32 ------
NM_001017926chr8--11732 ----
NM_001017969chr91505 ------
NM_001017970chr1482534 1766 387 318 307 295 151 68 1640 21894 23 --
NM_001017973chr52152 23 ------
NM_001017974chr52152 23 ------
NM_001017981chr221569 --138 --
NM_001017995chr5204596 4495 4296 4005 3777 3627 3430 3374 3247 3059 3029 2955 1669 1428 1272 1050 735 553 255 176 24209 3135 61621 1166 863 475 273 190 --
NM_001017999chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_001017999chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_001018000chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_001018000chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_001018001chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_001018004chr15------171
NM_001018005chr15133 --157 --
NM_001018006chr15------171
NM_001018007chr15------171
NM_001018020chr15------171
NM_001018025chrX3275 252 90 ------
NM_001018050chr22132870 2813 2786 2715 2692 2562 2522 2487 2350 2132 1257 176 154 33227 2789 1227 22614 250 23427 3307
NM_001018052chr22132870 2813 2786 2715 2692 2562 2522 2487 2350 2132 1257 176 154 33227 2789 1227 22614 250 23427 3307
NM_001018054chr12990 481 11239 ----
NM_001018056chr92231 97 ------
NM_001018057chr115958 557 355 244 122 ------
NM_001018065chr985855 5719 5215 4611 3962 3856 243 131 54336 2123 1677 1262 1078 --1206
NM_001018066chr985855 5719 5215 4611 3962 3856 243 131 54336 2123 1677 1262 1078 --1206
NM_001018070chr115263 220 213 43 31 ------
NM_001018074chr533696 3364 1281 33519 3086 1101 ----
NM_001018075chr533696 3364 1281 33519 3086 1101 ----
NM_001018076chr533696 3364 1281 33519 3086 1101 ----
NM_001018077chr533696 3364 1281 33519 3086 1101 ----
NM_001018108chr1571823 1816 1406 850 516 173 34 31509 1437 162 21764 213 --
NM_001018111chr743233 888 879 120 1295 2690 608 13790
NM_001020658chr131410 1381 129 31385 451 25 ----
NM_001020658chr131410 1381 129 31385 451 25 ----
NM_001023567chr15--1187 ----
NM_001023587chr31807 ------
NM_001024094chr533696 3364 1281 33519 3086 1101 ----
NM_001024226chr161082 983 915 897 761 214 1942 127 --
NM_001024227chr161082 983 915 897 761 214 1942 127 --
NM_001024228chr161082 983 915 897 761 214 1942 127 --
NM_001024401chr16162810 2290 2268 2080 2062 2013 1877 1805 948 784 696 589 531 472 445 184 32794 2299 2178 12561 --
NM_001024455chrX62617 1765 974 467 325 56 22697 769 2350 37 12309
NM_001024460chr641110 1053 444 425 1988 ----
NM_001024463chr151848 1335 1126 --
NM_001024647chr1297419 6350 4999 4966 4911 1086 569 435 113 --15587 --
NM_001024649chr53915 457 39 1465 --12224
NM_001024660chr341421 1309 1043 128 ------
NM_001024807chr192116 43 3309 220 22 ----
NM_001024808chr12102751 2381 2128 1905 823 735 700 538 477 444 11837 12414 --
NM_001024845chr18995 958 903 883 859 782 772 313 ------
NM_001024847chr352112 1978 120 79 43 31992 751 47 ----
NM_001024858chr14142690 2659 2632 2573 2560 2106 1992 1166 755 315 302 238 185 70 42770 2048 890 342 32703 2283 678 --
NM_001024912chr1951783 1493 409 297 90 21829 1199 --11175
NM_001024934chr62555 120 ------
NM_001024935chr62555 120 ------
NM_001024936chr62555 120 ------
NM_001024937chr1712708 651 606 583 513 284 276 249 150 143 84 74 1719 1692 --
NM_001024948chr11335 --11226 --
NM_001024957chr11257 32 ------
NM_001024959chr35872 845 797 778 650 134 ----
NM_001024960chr35872 845 797 778 650 134 ----
NM_001025076chr10155237 5120 5045 5030 4903 4736 4340 4268 4156 2253 1967 1908 1439 1408 1186 35929 5217 4283 ----
NM_001025077chr10166595 6478 6403 6388 6261 6094 5698 5626 5514 4881 2797 2766 2544 1335 1052 224 47287 6575 5641 1173 1440 --
NM_001025079chr383728 3537 3205 2954 1133 903 781 142 1636 23095 717 --
NM_001025105chr531341 1288 461 11382 ----
NM_001025109chr181003 951 882 866 736 323 310 176 2939 788 2109 48 --
NM_001025205chr35302 179 91 66 42 1342 ----
NM_001025252chr862850 2369 2105 381 191 172 ----12683
NM_001025253chr862850 2369 2105 381 191 172 ----12683
NM_001025266chr374398 4321 3959 3285 1661 1609 492 11282 14083 --
NM_001025366chr641245 697 604 245 128 ----
NM_001025366chr641245 697 604 245 128 ----
NM_001025367chr641245 697 604 245 128 ----
NM_001025367chr641245 697 604 245 128 ----
NM_001025368chr641245 697 604 245 128 ----
NM_001025368chr641245 697 604 245 128 ----
NM_001025369chr641261 713 620 261 144 ----
NM_001025369chr641261 713 620 261 144 ----
NM_001025370chr641245 697 604 245 128 ----
NM_001025370chr641245 697 604 245 128 ----
NM_001025579chr1771129 807 762 181 122 43 21 21178 78 1154 --
NM_001025580chrX114026 3848 3668 3604 2964 2701 706 596 394 44 33 13261 14094 13155
NM_001025596chr112536 110 ------
NM_001025603chr14943 116 62 33 11063 ----
NM_001025616chr4--11737 1351 --
NM_001025780chr931275 1136 994 ------
NM_001029863chr642643 2143 1159 995 --1976 12652
NM_001029864chr2092120 1644 1606 1593 659 513 374 179 162 12453 32412 307 266 11573
NM_001029882chr15545 182 168 159 112 --172 --
NM_001029882chr15545 182 168 159 112 --172 --
NM_001029976chr8143 --152 --
NM_001029998chr431351 924 368 ------
NM_001030007chr1673013 2716 1235 770 390 302 184 23634 2472 1264 --
NM_001030055chr1424218 835 ------
NM_001030287chr12161 99 ------
NM_001031677chr51388 ------
NM_001031679chr1283531 3154 2803 2728 1024 358 304 254 12361 22628 2240 --
NM_001031680chr1102011 1957 1865 1015 823 746 635 472 448 428 21920 546 12111 --
NM_001031690chr7112756 2744 2097 1135 1122 954 840 723 473 133 68 32118 1067 945 12738 --
NM_001031695chr22115265 5199 5084 4992 4963 3908 3608 3472 1727 610 600 11878 14922 13300
NM_001031702chr3191 1831 1594 --
NM_001031711chr5111767 1224 1165 1128 743 735 585 540 489 221 166 1315 2632 288 --
NM_001031732chr433037 661 140 ------
NM_001031801chr223450 127 119 1157 ----
NM_001031803chr172328 247 ------
NM_001031804chr16104399 4169 4084 3985 3180 3142 2908 1772 577 134 23598 451 ----
NM_001031812chr532318 2092 2023 ------
NM_001032280chr671193 1178 325 245 200 177 23 11524 21060 92 --
NM_001032288chr205626 577 546 517 26 1385 21056 616 --
NM_001032289chrX8716 338 234 221 172 116 108 68 --149 1792
NM_001032296chr13102847 2744 2170 1028 725 677 659 463 391 55 12498 ----
NM_001032394chr652472 942 930 667 25 ------
NM_001033025chr151251 1233 1224 292 235 ------
NM_001033044chr161781 1546 1202 591 65 30 --21775 1662 11453
NM_001033045chr224367 292 14370 21411 99 --
NM_001033047chr431862 70 27 --1628 --
NM_001033056chr161781 1546 1202 591 65 30 --21775 1662 11453
NM_001033057chr31508 ------
NM_001033081chr171585 1391 1358 697 608 193 62 --11593 --
NM_001033082chr171585 1391 1358 697 608 193 62 --11593 --
NM_001033085chr21241 ------
NM_001033117chr3154467 4436 4301 4163 3480 1865 1614 1568 1479 1444 1344 1321 877 812 319 34045 1333 708 1197 1769
NM_001033507chr151972 1479 1408 1235 302 11776 11504 --
NM_001033551chr17224069 3711 3672 3479 3359 3249 2936 2877 2833 2688 1646 1433 1376 1087 1023 593 499 425 379 239 224 75 ------
NM_001033561chr176824 815 801 341 335 48 --1313 1111
NM_001033566chr171758 ------
NM_001033568chr171758 ------
NM_001033578chr832029 843 302 ------
NM_001033581chr1142 ------
NM_001033581chr1142 ------
NM_001033582chr1142 ------
NM_001033659chr1741537 1458 1228 63 ------
NM_001033723chr832705 1995 1766 ------
NM_001033756chr641179 631 538 179 ------
NM_001033756chr641179 631 538 179 ------
NM_001033925chr1021893 438 ------
NM_001033952chr113243 74 30 ------
NM_001033953chr11143 --1453 --
NM_001034025chr12160 ----1266
NM_001034837chr52742 290 1264 ----
NM_001034838chr52742 290 1264 ----
NM_001034845chr41494 ------
NM_001034850chr521320 134 ------
NM_001034954chr1052651 2296 1248 1188 267 ----1540
NM_001034955chr1052651 2296 1248 1188 267 ----1540
NM_001034956chr1052651 2296 1248 1188 267 ----1540
NM_001034957chr1052651 2296 1248 1188 267 ----1540
NM_001035003chr4155 ------
NM_001035004chr4155 ------
NM_001035235chr53504 243 71 1464 1222 --
NM_001035254chr9152455 2395 2124 1821 1725 1635 758 732 637 554 392 228 165 119 93 31883 723 83 11945 --
NM_001035260chr104479 456 131 122 ------
NM_001035267chr121279 ------
NM_001035511chr16750 723 716 615 119 83 ------
NM_001035512chr16857 830 823 722 226 190 ------
NM_001035513chr16857 830 823 722 226 190 ------
NM_001035521chr24639 206 141 54 1228 ----
NM_001035534chr981378 1245 1218 1178 1048 1030 289 46 31097 1010 323 11432 --
NM_001037131chr25501 407 299 124 99 --11165 1176
NM_001037132chr732140 1694 398 22229 72 ----
NM_001037133chr732140 1694 398 22229 72 ----
NM_001037165chr7268928 7592 7552 7533 7362 7204 6561 6451 6384 6131 5617 5408 3406 3285 3251 3209 2273 1780 1768 1238 1064 718 500 345 270 256 46077 3243 2308 1536 26707 1807 --
NM_001037317chr162682 2246 1939 1878 173 42 ------
NM_001038493chr231215 310 223 ----1139
NM_001038640chr151867 ------
NM_001038707chr1122144 1902 1724 1532 1429 728 448 373 187 173 164 72 1562 2111 84 --
NM_001038707chr1122144 1902 1724 1532 1429 728 448 373 187 173 164 72 1562 2111 84 --
NM_001039140chr205410 201 186 172 92 2138 32 1402 1475
NM_001039459chr77467 404 322 293 163 140 25 1129 ----
NM_001039468chr112243 187 ------
NM_001039469chr113283 221 127 ------
NM_001039538chr232810 873 745 ------
NM_001039547chr3107623 7145 6082 5960 5287 5108 2836 2697 1241 1004 32415 2394 557 ----
NM_001039548chr11--171 ----
NM_001039550chr21748 193 ----
NM_001039574chr14952 914 904 888 1340 1868 --
NM_001039577chr194222 3926 3072 1814 1352 1336 1287 942 135 34350 3516 832 11213 --
NM_001039583chr224429 220 208 130 ------
NM_001039584chr224429 220 208 130 ------
NM_001039590chrX33838 2609 1366 12882 11089 --
NM_001039591chrX33838 2609 1366 12882 11089 --
NM_001039618chr1155934 4816 4668 893 174 21780 512 25078 37 --
NM_001039690chr1672218 2199 2163 1586 575 147 38 11570 ----
NM_001039711chr171050 909 899 830 196 102 47 --2167 85 --
NM_001039712chr171050 909 899 830 196 102 47 --2167 85 --
NM_001039770chr3112070 1927 1550 605 563 349 324 259 120 85 24 11459 1772 11974
NM_001039771chr1491055 1030 978 859 314 116 97 58 36 ------
NM_001039802chr13427 180 173 21141 1041 11425 --
NM_001039840chrX96000 5235 2343 1692 885 682 546 389 47 ------
NM_001039877chr197886 813 763 742 611 548 208 --2844 162 --
NM_001039888chr1----1790 --
NM_001039905chr1561134 1113 453 443 349 202 11119 ----
NM_001039916chr1231032 1021 242 ------
NM_001039917chr1231032 1021 242 ------
NM_001039918chr1231032 1021 242 ------
NM_001039919chr1231032 1021 242 ------
NM_001039920chr1231032 1021 242 ------
NM_001039937chr1333702 1365 331 1290 ----
NM_001040002chr174600 362 327 105 1517 11061 --
NM_001040020chr71501 11502 ----
NM_001040056chr164752 661 633 223 2567 68 1313 --
NM_001040057chr72452 416 ----1985
NM_001040100chr321126 322 ------
NM_001040110chr731453 1253 697 21313 560 ----
NM_001040113chr162831 27 ----1301
NM_001040134chr1991439 1396 1367 1332 1306 1071 591 578 60 11046 ----
NM_001040142chr222015 158 ------
NM_001040143chr222015 158 ------
NM_001040144chr1672218 2199 2163 1586 575 147 38 11570 ----
NM_001040146chr1672218 2199 2163 1586 575 147 38 11570 ----
NM_001040151chr11154603 4579 4024 3930 3765 3141 3005 1221 1118 1079 649 361 269 202 177 64268 3998 3833 1824 826 114 12892 --
NM_001040152chr7115045 5021 5005 4993 4910 4752 4338 1813 1717 1706 1271 13133 15052 12049
NM_001040158chr5--2432 72 197 --
NM_001040172chr551329 654 601 423 234 11309 ----
NM_001040173chr551329 654 601 423 234 11309 ----
NM_001040181chr31975 ----2397 73
NM_001040182chr31975 ----2397 73
NM_001040183chr31975 ----2397 73
NM_001040199chr31975 ----2397 73
NM_001040200chr31975 ----2397 73
NM_001040214chr62271 206 12220 1345 --
NM_001040272chr982344 1455 929 455 335 289 136 105 11519 1126 --
NM_001040284chr1665630 5274 4163 747 719 71 ------
NM_001040402chr452899 2567 2372 2341 716 1868 ----
NM_001040424chr2142834 2240 931 192 2475 283 --1857
NM_001040429chr1312908 --165 13075
NM_001040431chr17141 2311 44 ----
NM_001040439chr1671352 1176 1140 409 356 140 96 11429 --1110
NM_001040441chr144058 3968 3725 1626 --15116 --
NM_001040446chr56931 770 718 601 534 57 ------
NM_001040450chr1522346 513 ------
NM_001040453chr1522346 513 ------
NM_001040458chr541688 701 356 135 3735 727 114 2473 452 --
NM_001040619chr15611 549 412 171 132 1206 ----
NM_001040697chr111510 ------
NM_001040708chr811132 ------
NM_001040709chr172073 912 429 278 96 82 42 51681 891 744 622 170 1473 --
NM_001040712chr933465 1301 426 141 ----
NM_001040715chr1661028 815 457 391 376 55 11002 1953 1427
NM_001042357chr102970 424 255 22 ----
NM_001042358chr102970 424 255 22 ----
NM_001042360chr102970 424 255 22 ----
NM_001042361chr1021001 455 286 53 ----
NM_001042363chr102970 424 255 22 ----
NM_001042364chr1021001 455 286 53 ----
NM_001042365chr1021001 455 286 53 ----
NM_001042387chr1021001 455 286 53 ----
NM_001042388chr181110 ------
NM_001042389chr102970 424 255 22 ----
NM_001042390chr102970 424 255 22 ----
NM_001042392chr102970 424 255 22 ----
NM_001042393chr1021001 455 286 53 ----
NM_001042395chr102970 424 255 22 ----
NM_001042396chr1021001 455 286 53 ----
NM_001042397chr1021001 455 286 53 ----
NM_001042404chr151754 1326 364 282 117 1290 ----
NM_001042413chr963132 1596 1330 760 430 299 23170 2759 11124 --
NM_001042424chr472778 2294 2091 407 344 288 131 1653 --22571 243
NM_001042425chr671193 1178 325 245 200 177 23 11524 21060 92 --
NM_001042453chrX3686 634 268 ------
NM_001042459chr3----170 --
NM_001042472chr205562 461 160 42 33 1244 ----
NM_001042473chr1011988 ------
NM_001042475chr6------1292
NM_001042476chr1661933 1784 774 668 477 467 1122 42096 705 362 21 21613 217
NM_001042486chr20101557 1530 1509 1369 1150 1132 574 528 408 170 1472 ----
NM_001042492chr1763486 1151 1126 891 885 388 --160 12426
NM_001042494chr1543521 2886 2587 1253 1210 ----
NM_001042495chr1543521 2886 2587 1253 1210 ----
NM_001042496chr1543521 2886 2587 1253 1210 ----
NM_001042497chr1543521 2886 2587 1253 1210 ----
NM_001042498chrX8853 371 358 309 253 245 205 100 --1186 1929
NM_001042506chrX51154 490 201 179 150 1921 1187 --
NM_001042510chr851935 1775 1343 426 146 --1577 --
NM_001042511chr851935 1775 1343 426 146 --1577 --
NM_001042537chrX42028 1602 1568 577 --11678 --
NM_001042539chr169935 401 364 265 248 239 164 120 99 --21065 982 --
NM_001042543chr411040 ----11532
NM_001042555chr12114151 4141 4134 3545 3532 3039 3033 2983 534 172 91 24777 1177 ----
NM_001042599chr287591 7432 7137 7060 6539 5251 446 59 17624 ----
NM_001042601chr322171 664 ------
NM_001042603chr1275023 4726 4394 3896 1548 1367 1087 1131 15333 1619
NM_001042604chr354147 3002 1795 1717 1381 ------
NM_001042632chr20101905 1747 1574 995 885 768 661 508 495 364 11577 21661 1615 12181
NM_001042633chr20101905 1747 1574 995 885 768 661 508 495 364 11577 21661 1615 12181
NM_001042663chr1111436 1353 1198 1076 1050 975 523 366 328 220 127 ------
NM_001042664chr1111436 1353 1198 1076 1050 975 523 366 328 220 127 ------
NM_001042665chr1111436 1353 1198 1076 1050 975 523 366 328 220 127 ------
NM_001042669chr4--11737 1351 --
NM_001042681chr152427 2155 2062 873 685 ----1345
NM_001042682chr152427 2155 2062 873 685 ----1345
NM_001042682chr152427 2155 2062 873 685 ----1345
NM_001042683chr62544 220 ------
NM_001042724chr196755 723 251 155 81 43 --2564 268 1300
NM_001042728chr12101044 1022 917 761 672 437 335 192 171 103 --4927 880 738 113 --
NM_001042749chrX1387 ------
NM_001042750chrX1387 ------
NM_001042751chrX1387 ------
NM_001043318chr14133999 3529 3457 2836 2556 2509 1359 1063 887 812 729 500 226 33414 1598 752 23438 3003 --
NM_001044305chr631574 620 348 1286 ----
NM_001044385chr263807 3772 3339 1487 882 774 1417 ----
NM_001044722chr532318 2092 2023 ------
NM_001044723chr532318 2092 2023 ------
NM_001046chr5--1852 1675 --
NM_001048183chr133440 3016 1067 11125 33418 547 316 --
NM_001049chr14102352 2258 1858 1850 1590 1560 651 509 455 397 --1288 --
NM_001050chr17--1204 --21153 91
NM_001065chr121416 --1131 --
NM_001069chr6----1137 --
NM_001077628chr1121 1185 1480 --
NM_001079874chr161942 1866 1816 624 137 127 11446 ----
NM_001080418chr13612 538 212 2582 228 ----
NM_001083620chr412012 11861 ----
NM_001083621chr1154616 4176 4031 3371 3270 3168 2990 1836 855 804 561 519 497 232 80 --21314 638 --
NM_001087chr24326 148 58 52 ------
NM_001092chr1771888 1725 843 618 521 229 43 2623 467 --12412
NM_001094chr173579 202 28 --1341 --
NM_001095chr12101683 1665 1515 1430 1281 1221 704 366 255 162 3590 487 75 11707 --
NM_001100108chr1167852 7472 6517 5850 5522 3225 3194 2789 2339 2151 1794 1781 1153 1100 298 134 17653 36816 6752 6002 --
NM_001106chr3139228 7286 7075 7004 6610 3483 2250 1838 1638 1133 980 509 494 12965 --11206
NM_001113490chrX82863 2699 2271 1172 772 655 201 59 22459 1347 ----
NM_001117chr182758 389 12025 ----
NM_001121chr1021851 1367 1655 ----
NM_001122679chr521342 61 1180 ----
NM_001126chr13777 363 29 ------
NM_001127chr2210987 874 453 349 324 218 174 153 78 54 ----1402
NM_001128chr1673013 2716 1235 770 390 302 184 23634 2472 1264 --
NM_001130chr194630 332 201 168 ------
NM_001140chr171230 --2193 58 --
NM_001144chr162512 325 1203 ----
NM_001146chr821935 106 11676 11856 --
NM_001148chr41501 ------
NM_001149chr10--1926 ----
NM_001152chrX2219 80 ------
NM_001157chr102531 276 --1141 1217
NM_001163chr9101017 1004 972 952 889 330 147 94 71 40 --2877 810 --
NM_001167chrX55827 4518 2538 2077 1520 26289 4980 ----
NM_001173chr1424218 835 ------
NM_001174chrX--1119 11575 --
NM_001175chr12397 72 26 ------
NM_001177chr1242209 1773 1620 300 1389 31989 1518 45 --
NM_001188chr66849 814 369 207 145 39 61251 1086 1068 983 242 96 ----
NM_001189chr441003 882 348 256 1994 ----
NM_001190chr192295 229 ------
NM_001191chr2081395 1335 1137 1118 487 376 315 38 1574 --1323
NM_001198chr641699 1637 808 266 1126 1550 --
NM_001199chr82256 202 --2184 26 --
NM_001200chr20--1819 ----
NM_001204chr296346 6337 5217 2465 1502 1489 1078 116 108 35373 5319 2012 ----
NM_001206chr942782 1976 214 150 22812 2202 ----
NM_001219chr772106 1582 1502 1398 1390 595 150 --1358 --
NM_001221chr41103 ------
NM_001222chr1061640 1612 1316 391 177 151 21696 1420 21804 1258 11956
NM_001237chr421140 744 ------
NM_001237chr421140 744 ------
NM_001241chr242059 1591 872 191 ------
NM_001241chr242059 1591 872 191 ------
NM_001256chr1732505 964 63 --1602 1836
NM_001257chr1621053 192 ------
NM_001259chr786259 6130 6095 5463 5429 4559 1551 44 166 ----
NM_001265chr132358 319 --186 173
NM_001271chr1552998 2801 2121 893 196 ----1552
NM_001273chr123437 416 180 ------
NM_001275chr143340 274 60 ------
NM_001277chr115918 808 767 690 67 ------
NM_001283chr75459 192 163 104 65 1152 ----
NM_001290chr42717 202 ------
NM_001292chr153973 875 736 --1856 --
NM_001300chr101128 ------
NM_001304chr1722938 173 --23593 642 12623
NM_001313chr45824 800 293 249 55 ------
NM_001317chr17141 --128 --
NM_001319chr196836 416 311 305 235 44 ------
NM_001326chr11129 ------
NM_001328chr41557 ------
NM_001329chr101436 1556 ----
NM_001331chr11101735 1109 1100 1055 1021 870 574 309 216 204 2713 625 1741 --
NM_001332chr511249 11284 ----
NM_001343chr521342 695 21213 358 ----
NM_001345chr122242 95 ------
NM_001351chr311353 ------
NM_001352chr19136 ------
NM_001364chr11154574 4529 3961 3802 3703 3351 3314 3288 3172 3123 3077 970 935 498 255 43712 3320 3043 296 13262 --
NM_001365chr172550 99 --2162 108 --
NM_001383chr172557 256 ------
NM_001385chr8--154 ----
NM_001387chr5103001 2857 2560 2529 2313 2269 2070 1238 1009 223 12581 12099 22772 917
NM_001390chr1873261 3191 2862 2602 1001 332 187 --127 --
NM_001391chr183480 451 388 --1303 11102
NM_001396chr2142592 1912 1101 429 ------
NM_001397chr1122502 2365 2287 2276 2235 2082 1825 1719 706 585 540 497 42561 2025 932 709 22555 984 --
NM_001399chrX133568 3553 3449 2656 2579 2438 2354 1542 852 824 413 68 32 33391 3032 1033 ----
NM_001400chr12466 315 2472 320 1480 --
NM_001401chr92217 35 ------
NM_001406chr17141473 1381 1357 1161 554 498 453 410 274 217 116 83 52 38 5583 538 374 308 119 21622 125 1565
NM_001408chr181262 652 598 445 360 353 230 36 51501 1309 462 405 213 21295 1050 1521
NM_001412chrX83615 3226 3154 3061 3048 2396 1087 967 ------
NM_001416chr173377 368 171 ------
NM_001417chr1241776 1464 518 71 ------
NM_001418chr112663 486 ------
NM_001418chr112663 486 ------
NM_001419chr19144050 3851 3666 3604 3577 3490 3192 3052 3033 1740 1714 929 314 278 ----11455
NM_001420chr19122929 2827 2810 2742 2584 2520 2459 2148 1172 1163 396 29 22944 1156 22938 2552 --
NM_001421chrX101668 1469 1435 1412 1363 1286 394 325 179 86 21255 695 11335 --
NM_001423chr1252082 1374 525 450 176 21569 696 ----
NM_001424chr16--1705 1566 --
NM_001426chr26639 612 587 263 65 34 ------
NM_001427chr781767 831 812 792 767 738 716 688 2838 694 ----
NM_001428chr1122 --150 --
NM_001430chr281852 1538 1422 484 472 302 184 29 ------
NM_001431chr64929 812 761 45 ------
NM_001438chr173140 2611 2581 438 432 385 366 --11326 --
NM_001439chr151251 1233 1224 292 235 ------
NM_001444chr81178 ------
NM_001447chr561240 1226 1032 963 535 528 ------
NM_001448chrX31437 1172 382 ------
NM_001449chrX41055 995 508 104 2866 362 ----
NM_001453chr651524 1164 370 355 109 1394 1146 --
NM_001454chr175861 665 637 216 24 --1874 --
NM_001455chr684841 4086 3926 3350 3040 1705 203 72 1180 11730 1284
NM_001461chr12228 191 ------
NM_001463chr2----1184 --
NM_001465chr541820 1618 837 518 --11873 --
NM_001478chr122955 929 2820 344 4968 791 219 177 --
NM_001482chr152310 203 ------
NM_001483chr71133 ------
NM_001489chr9--122 ----
NM_001493chrX8733 707 501 238 210 182 49 21 ------
NM_001494chr10--1142 ----
NM_001495chr851036 981 925 909 142 1278 1311 --
NM_001497chr952058 1009 496 116 46 186 ----
NM_001508chr21676 1738 1774 --
NM_001518chr72908 804 ------
NM_001520chr165483 458 229 52 21 1578 ----
NM_001521chr24639 206 141 54 1228 ----
NM_001530chr142305 139 ------
NM_001542chr152145 1031 372 359 168 1592 ----
NM_001543chr5103555 3335 1918 1871 1804 1604 1580 1568 328 215 63580 1398 906 528 368 304 24527 699 --
NM_001554chr11433 ------
NM_001555chrX2195 31 ----1206
NM_001584chr1111023 ------
NM_001587chrX51503 509 465 447 270 --2433 150 --
NM_001616chr252983 1370 827 269 134 22555 580 --13320
NM_001619chr1151006 935 416 264 28 1361 ----
NM_001635chr73969 954 272 ------
NM_001642chr1141297 1239 910 843 1897 ----
NM_001650chr1842986 2559 491 34 1619 1878 --
NM_001654chrX----2415 308 --
NM_001655chr116838 756 680 667 575 300 --1105 --
NM_001658chr161082 983 915 897 761 214 1942 127 --
NM_001659chr12142629 2501 2401 2076 2018 672 588 446 414 380 269 189 157 38 11818 41682 1087 755 76 12284
NM_001660chr32527 338 ------
NM_001662chr71251 ----176
NM_001663chr142548 76 ------
NM_001664chr32943 222 1925 1770 --
NM_001665chr115485 429 382 197 29 --1105 --
NM_001668chr171666 1523 500 164 136 129 94 22113 109 ----
NM_001674chr12161 99 ------
NM_001678chr17101733 1635 1600 1400 1190 638 581 573 561 445 11620 61697 1478 725 599 415 71 --
NM_001681chr121236 ------
NM_001682chr1222649 2081 12589 ----
NM_001683chr351901 1842 357 266 161 22520 1876 ----
NM_001699chr1951666 1636 1458 635 152 21693 29 --11788
NM_001701chr921545 555 11297 ----
NM_001703chr1192 1205 ----
NM_001707chr72696 675 --1769 1578
NM_001709chr1152221 1907 881 871 865 ------
NM_001717chr153529 503 192 1535 --1977
NM_001719chr202107 23 ------
NM_001723chr6--2330 196 ----
NM_001730chr1311516 143 ----
NM_001730chr1311516 143 ----
NM_001731chr122619 69 ------
NM_001735chr9145 1266 ----
NM_001737chr52184 64 ------
NM_001741chr113243 74 30 ------
NM_001742chr71521 ------
NM_001746chr53915 457 39 1465 --12224
NM_001753chr731248 1209 1159 11764 ----
NM_001754chr2184250 4170 4084 2857 2788 2636 1724 378 12949 ----
NM_001759chr12144938 4904 4698 4025 4015 3702 3577 3377 3323 1870 1418 1056 385 225 24366 2134 21155 1034 --
NM_001760chr67875 816 802 734 390 328 212 1117 ----
NM_001773chr1131369 1317 1248 1232 1102 969 542 193 116 91 80 74 49 21305 1154 2475 414 --
NM_001777chr383728 3537 3205 2954 1133 903 781 142 1636 23095 717 --
NM_001789chr351468 1383 481 49 39 11279 ----
NM_001791chr13427 180 173 21141 1041 11425 --
NM_001792chr1811147 ------
NM_001796chr16--164 ----
NM_001802chr162675 48 1933 1781 --
NM_001823chr142129 74 ------
NM_001830chrX42797 1363 740 336 42826 2457 1384 982 11043 --
NM_001842chr93537 460 430 2249 203 1487 --
NM_001843chr12----1176 150
NM_001844chr122387 152 2324 130 ----
NM_001845chr131167 ------
NM_001852chr13570 508 57 --1597 --
NM_001859chr943526 143 96 85 13055 13262 --
NM_001891chr4126 ------
NM_001892chr531341 1288 461 11382 ----
NM_001893chr172300 278 ------
NM_001894chr2241096 1086 936 208 ------
NM_001895chr2031016 280 53 21053 1022 11172 --
NM_001915chr17131697 1661 1569 814 790 773 755 703 615 552 430 166 50 21714 237 ----
NM_001920chr12----2770 654 --
NM_001927chr25695 458 207 175 40 1111 2144 127 --
NM_001932chr172656 190 162 ----
NM_001933chr143904 346 189 168 ----
NM_001939chrX123832 3218 3029 2916 1451 1059 825 817 506 438 351 38 23367 597 2970 954 --
NM_001940chr126436 429 413 397 386 380 ------
NM_001945chr571448 1127 1001 257 246 108 43 21058 279 ----
NM_001946chr121939 143 ----
NM_001949chr651230 1153 1129 929 83 ------
NM_001951chr8134 ------
NM_001954chr612527 290 279 269 231 205 180 171 115 91 84 21 127 ----
NM_001964chr55836 399 252 188 134 2379 336 1326 --
NM_001965chr22210 67 --189 --
NM_001970chr174458 236 170 60 4537 247 178 152 3577 487 105 --
NM_001973chr12382 363 ------
NM_001978chr84990 878 275 138 3286 178 32 ----
NM_001980chr1241942 1507 703 590 11650 ----
NM_001981chr142222 1745 1519 234 ----1707
NM_001990chr14155 147 44 26 ------
NM_001991chr1792237 2055 1747 1732 1554 796 557 421 126 --22121 1993 --
NM_001995chr42521 507 --1545 --
NM_001999chr5--11337 ----
NM_002006chr445439 3605 1754 1419 --1554 --
NM_002009chr1531803 1061 305 --12396 --
NM_002010chr132545 190 ------
NM_002013chr141184 ------
NM_002014chr126576 482 279 211 202 24 1606 ----
NM_002015chr1323059 1189 11325 12350 --
NM_002025chrX188841 8781 8688 8353 7853 7567 7547 7532 7375 6817 6682 6242 2526 1861 1198 908 640 46 11403 --27583 6645
NM_002026chr231051 1024 1017 ------
NM_002033chr1153694 2745 1626 901 776 33038 2776 1260 ----
NM_002035chr1821505 1292 --11408 --
NM_002045chr33350 92 39 ------
NM_002048chr92223 195 ------
NM_002060chr13483 200 73 1376 ----
NM_002061chr121635 191 ------
NM_002062chr62467 150 31600 565 552 ----
NM_002063chrX1234 ------
NM_002065chr161781 1546 1202 591 65 30 --21775 1662 11453
NM_002068chr194626 217 192 69 2680 163 ----
NM_002071chr183512 451 145 1154 ----
NM_002072chr95816 792 393 225 31 ------
NM_002073chr2251453 1273 1223 409 307 1310 1124 --
NM_002074chr141652 1492 1120 552 1115 21659 1607 --
NM_002076chr1272819 2171 1100 799 783 245 32 33236 2540 2441 ----
NM_002080chr162834 722 1864 ----
NM_002082chr59912 807 737 716 690 396 359 154 118 3769 176 112 ----
NM_002083chr14--1120 ----
NM_002086chr1781943 1878 1700 1665 1436 1421 252 243 22037 135 11849 --
NM_002089chr42642 574 ------
NM_002092chr474809 4802 4728 4373 3999 3761 729 23252 881 14788 --
NM_002094chr16--1335 1101 --
NM_002103chr195927 824 775 149 37 11043 ----
NM_002112chr15------158
NM_002126chr1783803 3316 2798 2781 989 335 321 302 3995 344 242 11043 13300
NM_002128chr1321584 70 --12081 --
NM_002130chr53667 521 264 ------
NM_002131chr691296 1241 1174 1081 967 915 906 398 378 2855 24 188 --
NM_002138chr41155 --1693 --
NM_002139chrX3610 603 134 ------
NM_002141chr72584 32 --181 --
NM_002145chr17170 ------
NM_002146chr1731367 502 147 --1187 --
NM_002147chr174357 246 166 58 ------
NM_002148chr21199 ------
NM_002149chr23496 209 157 1190 ----
NM_002160chr93426 172 137 ------
NM_002161chr92358 34 ------
NM_002166chr21609 ------
NM_002167chr11140 --172 --
NM_002181chr23666 639 119 155 1236 1512
NM_002187chr511135 --1957 --
NM_002196chr205852 739 312 221 189 ------
NM_002196chr205852 739 312 221 189 ------
NM_002202chr51713 ------
NM_002204chr1781343 1337 1307 1271 1201 555 229 211 --11262 --
NM_002205chr122205 116 1921 2940 179 --
NM_002212chr201272 ------
NM_002214chr7114674 3691 3539 1928 1613 1409 1385 1243 647 394 324 11048 11092 --
NM_002221chr182927 2790 2355 2299 2246 1157 586 47 --12884 --
NM_002228chr11403 --1942 --
NM_002229chr193367 185 31 ------
NM_002230chr177989 900 288 281 213 47 27 --1957 1861
NM_002232chr15969 226 216 142 53 --1847 --
NM_002240chr212251 168 --123 --
NM_002241chr1102342 2192 2179 1232 1020 608 391 187 117 44 1652 ----
NM_002246chr27477 458 392 279 191 73 48 ----1113
NM_002247chr1051960 1472 664 182 106 11747 ----
NM_002249chr1----1443 --
NM_002251chr20102514 2347 2268 1890 904 878 817 561 392 33 ------
NM_002253chr42985 27 ------
NM_002254chr282253 2244 1737 1725 799 771 431 37 21823 622 21442 938 --
NM_002264chr3124491 4472 3606 3058 1643 1566 1548 1262 1022 684 498 246 24554 617 2342 196 --
NM_002265chr1711051 ------
NM_002267chr1322005 346 12157 12045 --
NM_002268chr331625 759 554 ------
NM_002270chr575058 4843 4551 1982 1655 689 93 ------
NM_002271chr13153 --11568 1640
NM_002289chr125243 195 52 41 24 ------
NM_002290chr6----11382 --
NM_002293chr182800 2413 2138 1119 1077 969 932 251 1379 3493 102 30 --
NM_002294chrX------162
NM_002296chr12257 31 ------
NM_002298chr1381579 1482 1110 1068 475 461 151 40 1508 1282 --
NM_002306chr14----1104 --
NM_002309chr2283004 2731 2490 2217 1127 475 294 226 1427 ----
NM_002310chr585610 2457 2432 1929 1793 1277 505 453 12407 --14400
NM_002313chr1075081 5037 4869 3983 3886 3594 1095 11445 ----
NM_002319chr77973 742 324 305 258 190 36 2121 23 129 1218
NM_002334chr1151509 769 690 312 106 ------
NM_002336chr1264963 1802 1423 1306 746 698 --15023 --
NM_002355chr1241165 1032 576 101 191 11369 --
NM_002359chr17194186 4155 3821 3790 3679 3323 3155 3048 2829 1684 1528 1417 1128 955 930 385 168 100 72 13835 53073 2821 1120 249 115 --
NM_002361chr19175 137 ----
NM_002372chr54593 585 566 521 1288 ----
NM_002373chr1581309 1088 977 476 373 332 268 162 1505 ----
NM_002374chr232810 873 745 ------
NM_002382chr1451312 491 416 345 309 1218 11038 --
NM_002383chr168758 352 297 224 187 88 71 62 --2888 805 --
NM_002384chr181209 ------
NM_002387chr5104727 3429 3163 1887 1775 1262 417 297 212 154 1757 ----
NM_002390chr1771816 1796 1635 1443 1258 361 125 --1400 1119
NM_002397chr531864 1637 783 --11788 --
NM_002398chr21432 ------
NM_002399chr15----1118 --
NM_002404chr176863 388 151 111 74 64 ------
NM_002406chr53410 95 26 1861 3742 702 351 --
NM_002409chr22123187 2908 2563 2534 2505 2340 2109 2074 965 892 403 52 12811 2905 194 1672
NM_002430chr22112174 1743 1731 842 746 708 614 450 347 36 23 166 31991 258 83 --
NM_002442chr12161569 1290 1277 1183 715 659 610 597 449 439 416 340 238 207 159 102 21576 1168 21590 306 --
NM_002448chr43687 167 131 --1594 --
NM_002449chr551205 1183 220 90 56 ------
NM_002465chr12----145 --
NM_002473chr22111280 997 501 495 285 207 196 152 116 80 56 1277 1446 --
NM_002479chr13267 230 143 ------
NM_002481chr1217630 7483 7395 6827 6682 6559 6458 5522 5199 2797 2683 1991 1940 1838 1700 1402 999 715 622 194 142 76848 6609 2728 1609 922 727 634 56885 6665 4884 2817 57 47672 5890 561 297
NM_002487chr151709 ------
NM_002499chr15158 1697 ----
NM_002500chr21929 --1863 --
NM_002501chr19284054 3923 3899 3887 3725 3685 3260 3217 3204 3126 3095 3056 2983 2899 1593 1572 1516 1496 1405 992 872 865 712 675 569 554 187 180 33876 1413 1000 53004 1545 1335 797 452 1542
NM_002505chr631226 570 391 --1422 --
NM_002507chr17161909 1846 1827 1814 1532 1483 1281 488 312 283 250 227 184 119 85 62 41695 575 482 187 1791 --
NM_002508chr161604 1572 662 259 226 200 1146 1358 1539
NM_002509chr203625 293 216 ------
NM_002515chr1451736 1604 1430 1320 706 11375 21272 36 --
NM_002516chr198237 204 106 77 56 46 36 26 --2264 226 --
NM_002518chr22131 95 ------
NM_002519chr112353 47 --1569 --
NM_002520chr51196 ------
NM_002522chr17122758 2733 2712 2614 2590 2582 2498 885 871 737 171 116 22625 844 52533 1236 1166 1126 973 --
NM_002524chr12282 226 1196 ----
NM_002526chr61580 ------
NM_002530chr15265 41 ------
NM_002544chr17----137 --
NM_002545chr1174165 4023 3789 944 891 732 606 1297 23209 274 11359
NM_002546chr81171 ------
NM_002553chr71400 ------
NM_002556chr1171982 1780 1724 1592 1335 341 304 2832 733 1661 --
NM_002558chr17--1109 ----
NM_002569chr1591402 1345 1327 1279 986 583 362 352 36 21270 23 31304 435 219 --
NM_002570chr151949 2920 202 ----
NM_002576chr1131140 863 74 ----1128
NM_002577chr3112820 2710 1623 1528 1497 1490 1007 986 898 796 336 2911 813 1193 --
NM_002578chrX3397 369 326 2157 33 ----
NM_002579chr1991439 1396 1367 1332 1306 1071 591 578 60 11046 ----
NM_002581chr974580 3770 1445 976 759 95 51 31239 1042 962 22267 789 --
NM_002586chr691112 1097 1008 529 398 324 306 237 129 31574 1439 1089 21484 297 --
NM_002588chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_002594chr2032338 2065 34 2808 313 ----
NM_002595chr121646 1414 ----
NM_002599chr114971 914 383 262 1929 ----
NM_002601chr23365 327 103 1113 ----
NM_002607chr721118 131 ------
NM_002608chr22111514 1491 1398 1387 1272 1151 1131 432 424 188 96 --51340 621 529 171 151 1404
NM_002609chr551503 1261 554 440 117 11482 21671 351 1419
NM_002610chr222286 850 --22823 524 --
NM_002612chr74656 239 118 81 11461 ----
NM_002622chr55905 220 200 85 34 ------
NM_002628chr32459 173 ------
NM_002634chr173857 721 607 2840 745 ----
NM_002636chr62489 63 --1417 --
NM_002641chrX3568 264 123 ------
NM_002646chr162164 1855 864 846 596 224 --2840 78 --
NM_002648chr661208 985 931 425 157 26 11093 1219 --
NM_002655chr844418 3602 1616 1060 ------
NM_002657chr20153770 3658 3630 3466 3416 3240 3209 2905 2861 2648 2482 2426 1290 371 291 32522 1134 971 13608 --
NM_002687chr142334 253 ------
NM_002697chr1199 ------
NM_002698chr19222964 2809 2712 2602 2460 2454 2342 2322 2298 2279 2114 2035 1905 1144 1134 1066 1010 316 253 216 186 99 32381 1199 193 12260 --
NM_002699chr1101369 1080 947 580 532 441 424 301 285 157 --11252 --
NM_002705chr16280 45 ----1294
NM_002707chr21156 ------
NM_002709chr253203 3140 3099 1035 98 12714 ----
NM_002710chr122697 120 ------
NM_002714chr64916 353 310 33 1124 2360 295 --
NM_002715chr52825 442 --1814 --
NM_002717chr84515 507 467 100 1495 1652 --
NM_002721chr9----1356 --
NM_002726chr61347 ------
NM_002730chr1951127 999 934 238 222 51256 977 267 207 198 11162 --
NM_002734chr1741981 1521 915 31 ------
NM_002742chr141663 ------
NM_002744chr1142 ------
NM_002745chr2263378 1460 1312 323 117 74 24173 471 14227 --
NM_002746chr165583 492 464 191 54 1398 1144 --
NM_002753chr44831 115 49 21 ------
NM_002755chr15--1574 ----
NM_002761chr16131 ------
NM_002763chr1147 1143 ----
NM_002773chr163480 381 99 ------
NM_002791chr141102 --1111 --
NM_002821chr65312 246 159 104 80 --1555 --
NM_002824chr128458 393 372 356 323 310 159 35 1384 ----
NM_002829chr93852 295 119 --169 --
NM_002830chr21291 ------
NM_002833chr1541416 625 362 313 ------
NM_002834chr1263678 2970 1151 1141 374 52 ----11053
NM_002837chr1254535 3916 2894 2885 2876 1992 33434 2919 2831 13526
NM_002839chr933465 1301 426 141 ----
NM_002840chr15595 373 225 184 61 1605 ----
NM_002841chr33635 591 183 ------
NM_002846chr24482 118 99 42 --1517 179
NM_002850chr1971109 1053 944 798 393 156 53 --1352 --
NM_002855chr11213669 3554 3463 3430 3374 3279 3197 2760 2702 1360 1295 901 813 723 701 454 207 194 135 46 36 22263 1447 21435 326 --
NM_002859chr12141638 1609 1442 1351 1333 637 601 577 540 464 199 177 114 28 --1549 --
NM_002866chr197495 409 209 125 100 76 25 ------
NM_002868chr12152411 2253 2236 2174 2109 1985 1929 956 915 415 368 360 313 85 64 1748 11494 172
NM_002869chr1121773 1755 31715 102 53 --1400
NM_002874chr92888 821 1894 1651 --
NM_002880chr33693 225 172 2873 644 ----
NM_002881chr241402 1075 242 234 1461 --11013
NM_002883chr222928 22 ------
NM_002886chr374596 4150 3278 1996 1874 1301 1031 14915 ----
NM_002890chr51239 --1858 --
NM_002895chr20----1834 --
NM_002896chr111301 1116 166 --
NM_002897chr21189 ------
NM_002903chr17126 --1253 --
NM_002912chr61330 ------
NM_002918chr1971057 783 756 353 283 269 144 157 140 --
NM_002924chr11585 ------
NM_002938chr431472 1285 462 1685 31994 1413 146 --
NM_002941chr33517 217 187 11587 ----
NM_002942chr31273 ----1477
NM_002955chr691990 1955 1740 1698 1651 1599 1430 439 327 21553 1494 1243 --
NM_002956chr121301 21275 1022 ----
NM_002957chr973694 2992 1369 1114 803 618 92 32711 1413 1004 --13522
NM_002959chr1124115 4030 3418 3411 3327 3102 3069 1588 965 637 422 50 1548 21265 1122 --
NM_002962chr1392 58 34 --1111 --
NM_002966chr12213 24 ------
NM_002967chr191185 ------
NM_002971chr31367 1419 ----
NM_002973chr12136 ------
NM_002997chr251647 1423 297 122 22 ------
NM_002998chr832067 420 399 12037 ----
NM_003001chr16857 830 823 722 226 190 ------
NM_003010chr1742379 1753 937 149 11688 ----
NM_003011chr94345 312 238 99 --1212 --
NM_003012chr822066 157 --12994 --
NM_003013chr4195 ------
NM_003016chr1731851 280 100 1775 ----
NM_003025chr1991115 1051 949 898 880 264 239 81 26 --1479 --
NM_003026chr92424 28 1468 ----
NM_003028chr9173798 3777 3758 3734 3349 3320 3234 3126 3004 2923 2537 2481 1028 989 773 387 233 22541 2390 33595 2624 1468 --
NM_003029chr161379 557 488 372 273 194 1240 2398 344 --
NM_003030chr321410 1345 --2133 86 --
NM_003034chr12157055 7024 6777 6660 6578 6262 6009 5270 5226 5090 4990 1613 939 597 515 27373 2736 36251 5445 2603 --
NM_003036chr151080 995 846 812 87 1874 ----
NM_003037chr1----1117 --
NM_003042chr34694 417 379 162 ------
NM_003043chr3103939 3747 3441 3356 3263 3093 2916 1601 1390 1218 11491 13586 1659
NM_003045chr13104946 4141 3655 3429 3415 3340 1371 1152 1044 600 1254 24190 3693 --
NM_003046chr854912 4780 3971 1512 830 1155 --12133
NM_003047chr1111345 1247 1240 1081 964 305 254 159 106 82 75 2328 33 1505 --
NM_003051chr121935 158 --21293 649 --
NM_003060chr531230 410 363 1893 1396 --
NM_003062chr5----128 --
NM_003068chr8----1838 --
NM_003074chr311392 --2157 145 --
NM_003075chr123319 133 65 128 ----
NM_003076chr12101434 1418 1315 1130 1074 1039 666 617 481 259 41605 1335 509 365 11371 11098
NM_003077chr172646 224 ------
NM_003081chr2041156 271 235 23 ------
NM_003088chr712996 939 874 411 397 288 251 204 181 159 107 25 --167 --
NM_003091chr20--1193 ----
NM_003096chr2136 ------
NM_003099chr15176496 6059 6050 5923 5529 5331 5078 4346 4178 1818 1705 1250 531 461 342 77 60 11141 1113 11471
NM_003106chr31943 ------
NM_003107chr6101908 1853 684 676 666 533 450 370 364 345 --1525 --
NM_003108chr2157216 6851 6679 6502 6371 6311 5995 5576 5500 5315 4497 2206 1854 497 273 12085 ----
NM_003110chr179863 841 399 339 285 197 177 113 62 2853 203 ----
NM_003112chr7125 ------
NM_003113chr2167 ------
NM_003118chr552067 1370 746 515 46 11988 ----
NM_003128chr262876 2511 1937 1909 760 27 ----11052
NM_003131chr6192110 2097 1963 1873 1700 1575 1436 1427 860 818 800 671 658 650 602 523 371 265 203 4531 473 193 146 ----
NM_003137chr621678 50 157 ----
NM_003139chr117862 816 762 717 236 218 48 2618 257 ----
NM_003144chr62684 106 11839 --11647
NM_003145chr13354 45 23 1375 ----
NM_003146chr11--181 ----
NM_003150chr1752198 1678 1580 967 441 --11598 166
NM_003155chr862439 2320 2298 2079 1136 353 32452 228 125 ----
NM_003156chr1151021 375 298 244 65 2280 151 11155 --
NM_003161chr1722884 2443 ------
NM_003164chr113492 429 142 1474 1157 --
NM_003165chr981690 1604 1565 1515 1393 770 682 116 11451 11942 1606
NM_003168chr177956 803 778 731 654 425 354 ------
NM_003173chrX41379 1266 389 184 ----11393
NM_003178chr372171 1488 1481 743 450 270 155 --32235 1663 404 --
NM_003179chrX181462 1446 1417 1380 1374 1365 1353 1274 1221 1204 905 385 375 264 256 227 74 65 1193 41393 1195 1121 393 197
NM_003180chr194346 322 89 42 ------
NM_003184chr821097 108 11055 ----
NM_003185chr2071346 1224 988 513 492 471 93 ------
NM_003189chr152837 1258 399 326 251 32427 2157 259 1831 11189
NM_003194chr63451 141 35 --1487 --
NM_003199chr1845626 3657 1766 1382 ------
NM_003200chr19102105 2076 2016 1891 1841 1785 1758 1560 1520 931 21751 937 ----
NM_003202chr51447 ----11723
NM_003203chr24874 541 137 79 ------
NM_003204chr1731589 1335 622 --1240 --
NM_003211chr1241567 1152 530 366 11143 ----
NM_003214chr681189 1102 991 497 467 346 67 45 ----11088
NM_003216chr22153164 2693 2346 2337 2258 2166 2079 2042 1331 976 778 717 531 293 47 31240 343 201 42865 896 652 309 173
NM_003220chr671193 1178 325 245 200 177 23 11524 21060 92 --
NM_003221chr6164091 4066 3398 3377 3120 3086 3032 2887 2658 2648 1486 1089 596 523 503 307 12855 12843 --
NM_003223chr166602 549 543 284 131 22 ------
NM_003234chr342318 2145 1544 690 ------
NM_003236chr263323 3010 1411 929 595 263 21386 1304 33239 2290 676 --
NM_003239chr145850 751 719 697 61 1725 1731 --
NM_003242chr352112 1978 120 79 43 31992 751 47 ----
NM_003246chr1541418 1279 679 139 ------
NM_003253chr2131650 766 413 191 1466 --
NM_003255chr17111944 1859 1816 1689 836 644 495 282 213 145 77 11020 11792 --
NM_003257chr1541244 1093 1071 157 ------
NM_003269chr61501 ----187
NM_003270chrX2794 29 --2481 295 --
NM_003272chr13736 490 171 ------
NM_003274chr211259 1491 2558 518 --
NM_003281chr1215341 4871 4338 4231 3414 3378 2112 2071 1780 1420 1126 963 938 902 683 656 556 327 140 121 94 25082 956 55358 5118 1639 105 72 1795
NM_003285chr12540 207 1467 1345 --
NM_003286chr202819 435 ------
NM_003289chr92190 41 ------
NM_003291chr131186 ------
NM_003300chr14----141 --
NM_003302chr7----1137 --
NM_003304chr321408 1296 ------
NM_003317chr142540 50 1715 ----
NM_003319chr2--1698 ----
NM_003322chr65338 278 152 134 76 ----1125
NM_003323chr19140 ------
NM_003325chr22--177 1212 --
NM_003336chrX2160 72 --1150 --
NM_003337chr51605 ----155
NM_003338chr1031516 1341 173 ------
NM_003339chr521502 25 --1634 --
NM_003342chr1772693 2538 854 777 713 561 494 --22188 962 --
NM_003344chr71153 1645 ----
NM_003348chr1241272 410 247 57 21401 598 21425 1318 --
NM_003349chr205626 577 546 517 26 1385 21056 616 --
NM_003352chr22367 216 2204 31 ----
NM_003367chr195453 429 181 91 55 ------
NM_003369chr1182494 890 702 687 525 362 304 72 22621 2585 --11950
NM_003370chr197778 742 592 572 259 245 233 --1691 --
NM_003371chr981587 862 746 671 631 433 324 76 ------
NM_003373chr1061867 1241 706 609 355 35 ------
NM_003374chr51232 1804 1158 --
NM_003376chr641245 697 604 245 128 ----
NM_003376chr641245 697 604 245 128 ----
NM_003378chr78385 375 356 161 124 111 81 61 --1409 1439
NM_003383chr92231 97 ------
NM_003387chr2102801 2508 2321 2104 2056 1856 943 817 401 72 ------
NM_003392chr331105 1039 514 1629 22933 1724 --
NM_003403chr14174 --121 --
NM_003404chr202699 58 --21753 1624 --
NM_003405chr222134 26 ------
NM_003406chr811749 21889 1624 ----
NM_003409chr181284 --1245 --
NM_003410chrX32903 2154 249 11942 ----
NM_003413chrX2788 251 --1288 --
NM_003439chr7103105 2195 1068 890 756 737 726 673 197 33 ------
NM_003442chr113556 274 174 ------
NM_003453chr13192 1657 ----
NM_003458chr3204000 3822 3815 3451 3240 3004 2741 2621 2565 2555 1500 1029 1017 980 974 941 832 448 331 127 --53534 3206 2540 1486 551 22968 2445
NM_003463chr632747 2458 161 12778 1993 --
NM_003466chr2132486 2454 2432 2360 2305 957 854 781 713 651 586 439 206 3621 506 478 ----
NM_003468chr2123491 1382 1166 1129 1088 1082 1075 1068 957 887 705 109 ----12897
NM_003470chr1651721 1500 610 542 528 2506 50 ----
NM_003471chr32123 113 ------
NM_003472chr611206 ------
NM_003477chr111252 ------
NM_003478chr1142528 2451 1323 350 1186 ----
NM_003481chr126409 398 392 362 100 85 ------
NM_003482chr12152666 2650 2644 2514 2476 1062 1024 979 902 753 726 531 505 131 48 12494 21728 390 --
NM_003483chr1222528 1055 1210 12235 --
NM_003485chr1451099 1046 886 106 83 11225 1871 --
NM_003487chr172209 182 ------
NM_003489chr21----1746 --
NM_003498chr1662129 1775 1054 1026 347 179 11991 22489 637 --
NM_003502chr162163 124 ----1220
NM_003559chr17133698 3537 3179 3095 3036 2869 2842 2828 2749 1007 842 823 234 21491 445 22984 2731 --
NM_003562chr173387 292 97 1397 182 --
NM_003563chr1751422 1348 1342 1023 533 ------
NM_003564chr14196 169 146 22 1578 ----
NM_003566chr1242616 909 667 222 ------
NM_003574chr18105171 5137 4125 3820 1925 1691 1570 516 374 346 ----15018
NM_003575chr741316 502 338 269 11203 21473 514 --
NM_003576chr13102847 2744 2170 1028 725 677 659 463 391 55 12498 ----
NM_003581chr22677 76 --1297 --
NM_003590chr23960 901 203 --11368 --
NM_003593chr172599 511 2218 185 ----
NM_003595chr223380 368 72 1443 ----
NM_003603chr431652 1625 199 ------
NM_003607chr1104190 3458 2821 1562 1376 1102 1008 1001 273 73 156 124 14331
NM_003609chr16127 --159 --
NM_003616chr141392 ------
NM_003620chr173985 772 719 ------
NM_003624chr1961260 929 557 433 355 241 --1380 --
NM_003629chr142865 2651 1105 624 11095 1805 --
NM_003631chr102180 25 ------
NM_003632chr176734 357 218 210 88 58 --1677 --
NM_003633chr532438 2379 1021 1301 1407 --
NM_003635chr103388 103 96 --2376 358 --
NM_003636chr1131814 1722 1716 1700 1520 1503 1219 679 582 473 405 263 40 21727 1690 21435 1187 --
NM_003642chr21241 ------
NM_003644chr17216503 6150 6024 5335 4898 4687 4500 4173 4079 4008 2519 2469 2183 2035 1277 1258 1231 785 763 713 92 55570 4295 2159 2136 2128 26190 5419 16338
NM_003654chr114642 526 149 142 1505 187 --
NM_003655chr177589 579 543 236 227 196 83 ------
NM_003656chr3162 ----1126
NM_003660chr193634 534 62 ------
NM_003663chr332281 2125 497 ------
NM_003670chr33924 477 321 ------
NM_003671chr932759 2730 854 32775 2421 2302 12796 --
NM_003673chr17150 ------
NM_003680chr12207 23 ------
NM_003685chr195969 807 797 621 393 ------
NM_003705chr22730 692 1859 ----
NM_003709chr21126 ------
NM_003713chr1--11177 11240 --
NM_003714chr53933 678 173 12460 12766 12496
NM_003716chr31719 ------
NM_003722chr362256 478 316 146 94 61 22273 866 130 --
NM_003735chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_003736chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_003737chr114394 388 382 338 1155 ----
NM_003741chr34347 338 144 111 --1254 --
NM_003743chr252302 1785 1631 1521 1473 --1576 --
NM_003750chr10------1291
NM_003758chr15146 --1137 --
NM_003758chr15146 --1137 --
NM_003759chr462846 1164 953 772 580 347 13224 13218 --
NM_003760chr1--1553 ----
NM_003763chr2072708 2697 2648 2426 1958 1143 473 22030 476 23049 147 --
NM_003768chr181812 1789 1511 1469 1443 729 510 52 1125 ----
NM_003779chr15442 404 348 340 185 2141 73 ----
NM_003783chr11765 ------
NM_003787chr184670 621 608 184 --11145 --
NM_003795chr6------2508 188
NM_003819chr1------138
NM_003822chr142520 2113 515 485 ----1736
NM_003825chr1531401 582 47 1267 ----
NM_003829chr931126 452 33 ------
NM_003831chr181130 ----1199
NM_003840chr842053 1895 1531 1424 133 ----
NM_003858chr143701 141 24 ------
NM_003861chr1432033 239 145 11054 ----
NM_003870chr1552009 1993 1984 806 177 11815 1149 --
NM_003873chr106977 890 660 454 310 294 1746 1286 --
NM_003877chr123895 784 209 ----1364
NM_003883chr54401 373 172 45 ------
NM_003885chr1772651 2022 1762 1693 651 266 146 11993 ----
NM_003888chr1551738 1320 1151 397 46 21176 345 21252 412 --
NM_003893chr101457 --1343 150
NM_003895chr21--1359 2719 182 --
NM_003901chr1082718 2698 2288 2161 1870 1854 1738 711 11715 ----
NM_003908chr2021191 1096 ------
NM_003916chrX11362 163 ----
NM_003922chr15127 136 ----
NM_003924chr451378 631 617 197 189 ------
NM_003927chr18------1809
NM_003930chr722295 1939 11572 21950 92 --
NM_003931chr62555 120 ------
NM_003932chr2251647 1368 1350 133 89 --1140 --
NM_003936chr211998 986 772 751 423 409 392 378 314 293 40 2300 138 1484 --
NM_003938chr193779 394 226 179 1958 --
NM_003947chr32447 201 --189 --
NM_003948chr442521 2341 741 611 --12676 --
NM_003949chr17101887 1878 1852 1787 1765 1353 574 293 285 105 31983 1615 116 21621 1344 11997
NM_003955chr1781483 1140 603 535 299 151 137 50 ------
NM_003958chr673198 3106 3074 2937 739 518 424 --1883 --
NM_003969chr193338 147 131 --1331 --
NM_003971chr17160 ------
NM_003975chr1168 ------
NM_003980chr63588 414 89 ------
NM_003983chr16104331 4303 4140 3990 3612 2763 1602 1236 1043 253 14052 23512 1218 --
NM_003987chr10142224 1789 1710 1645 1619 1612 1603 908 865 822 750 543 251 170 11892 11541 1157
NM_003988chr10142301 1866 1787 1722 1696 1689 1680 942 899 827 620 328 247 44 11969 11618 1234
NM_003989chr10142160 1725 1646 1581 1555 1548 1539 844 801 758 686 479 187 106 11828 11477 193
NM_003990chr10142160 1725 1646 1581 1555 1548 1539 844 801 758 686 479 187 106 11828 11477 193
NM_003993chr11101 1237 ----
NM_003994chr1234345 3145 1308 --13090 --
NM_003996chr62161 45 --158 --
NM_003998chr41584 ------
NM_004006chrX31807 446 102 ------
NM_004007chrX31807 446 102 ------
NM_004009chrX31807 446 102 ------
NM_004010chrX31807 446 102 ------
NM_004011chrX31807 446 102 ------
NM_004012chrX31807 446 102 ------
NM_004013chrX31807 446 102 ------
NM_004014chrX31807 446 102 ------
NM_004015chrX31807 446 102 ------
NM_004016chrX21721 360 ------
NM_004017chrX31807 446 102 ------
NM_004018chrX21721 360 ------
NM_004019chrX1333 --151 --
NM_004020chrX31807 446 102 ------
NM_004021chrX21721 360 ------
NM_004022chrX21721 360 ------
NM_004023chrX21721 360 ------
NM_004024chr14520 458 321 132 ------
NM_004028chr1842986 2559 491 34 1619 1878 --
NM_004036chr23509 271 256 2518 123 ----
NM_004040chr271217 1197 1174 423 311 45 26 1401 ----
NM_004050chr1492255 2057 1877 920 869 758 592 554 393 --1605 --
NM_004061chr5--1527 ----
NM_004063chr83658 356 113 ------
NM_004064chr1211213 --1854 --
NM_004067chr731411 614 574 3584 514 207 11429 --
NM_004068chr35302 179 91 66 42 1342 ----
NM_004074chr112196 137 ------
NM_004077chr12111309 1243 1213 1047 997 955 473 463 415 194 174 1284 ----
NM_004078chr151011 990 455 262 34 --1977 --
NM_004081chrY11379 197 ----
NM_004082chr23299 226 26 --1319 --
NM_004083chr12--176 ----
NM_004087chr3--21594 1402 ----
NM_004090chr1792913 2902 2721 2552 2349 1119 741 387 367 42241 1016 517 355 12439 --
NM_004093chr1352985 1296 947 594 268 --22375 129 --
NM_004094chr1421135 612 12945 1309 --
NM_004096chr1062132 1651 1542 573 454 206 21764 1736 21340 791 --
NM_004100chr622543 1723 --32619 2322 1001 --
NM_004102chr11451 --148 --
NM_004113chr331983 35 25 11723 ----
NM_004114chrX--1989 ----
NM_004117chr63826 612 42 41583 1408 630 47 11686 1714
NM_004124chr1423494 2726 ------
NM_004133chr831781 706 249 ------
NM_004156chr8--1505 ----
NM_004157chr33904 803 339 ------
NM_004161chr211160 ------
NM_004171chr11109223 9034 8593 8243 7272 6570 6299 5942 3525 2883 21172 479 29027 2029 --
NM_004176chr173394 210 28 ------
NM_004178chr122110 32 ------
NM_004187chrX131401 1355 1051 454 447 419 404 354 215 202 133 116 42 31097 1040 1010 ----
NM_004193chr102391 197 ------
NM_004199chr52152 23 ------
NM_004200chr11102744 2063 1052 964 919 806 794 781 385 236 1836 52073 1205 1103 1088 310 --
NM_004205chr11228 21 ------
NM_004210chr1092098 1713 1416 814 728 550 264 115 83 41662 1608 1546 473 22001 1348 --
NM_004215chr81501 ------
NM_004225chr821289 1142 ------
NM_004227chr772652 2513 2202 932 623 323 66 22477 837 --12029
NM_004228chr192113 61 1122 ----
NM_004229chrX--1593 ----
NM_004232chr18--1279 ----
NM_004236chr151411 ------
NM_004247chr17150 ------
NM_004253chr9--2680 277 1926 --
NM_004263chr271673 1612 1564 1481 720 275 259 21581 1341 ----
NM_004272chr51345 1767 1120 --
NM_004274chr1472982 2793 2487 2212 329 298 286 13060 ----
NM_004277chr6291 21 1660 1178 --
NM_004283chr194877 802 129 100 1636 130 --
NM_004295chr1761242 423 404 247 182 130 ------
NM_004296chr14123951 3813 3302 3159 3001 2685 1089 1008 900 822 366 235 1843 33344 2744 1126 1505
NM_004302chr12172861 2719 2623 2578 2540 2384 2254 2117 2029 1964 1881 1787 860 779 761 479 446 2794 450 22457 85 --
NM_004305chr2145 ------
NM_004308chr1191445 738 652 608 517 386 213 132 26 --31460 670 295 --
NM_004311chr10133052 2790 2737 2725 2547 2483 2324 2267 2027 1198 1190 684 426 22556 343 22316 2050 --
NM_004313chr175396 326 180 102 93 2137 108 ----
NM_004316chr123830 434 389 2902 427 ----
NM_004321chr242552 1286 1113 85 32860 2488 50 ----
NM_004326chr121156 836 1784 11009 --
NM_004331chr81193 ------
NM_004349chr821019 287 ----1905
NM_004350chr1102011 1957 1865 1015 823 746 635 472 448 428 21920 546 12111 --
NM_004369chr23560 293 28 ------
NM_004370chr621775 1485 4814 806 594 521 ----
NM_004376chr1061556 1406 1306 1225 422 319 11451 ----
NM_004379chr2--2264 203 ----
NM_004380chr1622101 1847 ------
NM_004384chr532318 2092 2023 ------
NM_004386chr1971809 935 917 809 620 154 44 12047 1697 --
NM_004391chr391883 1753 1705 1585 1503 1410 1369 577 129 1232 31433 100 69 --
NM_004395chr57692 681 580 525 515 231 27 --2537 268 --
NM_004397chr1163473 3113 3037 2977 1358 72 ------
NM_004405chr24406 288 175 76 --2913 106 --
NM_004408chr92494 175 1103 1417 --
NM_004411chr71303 ------
NM_004414chr211160 1493 ----
NM_004416chr1251086 762 693 38 25 1262 ----
NM_004417chr51420 ------
NM_004418chr23547 254 70 2117 91 ----
NM_004420chr11252414 2380 2371 2272 2219 2209 2199 2131 2109 2099 2089 2021 1898 1884 1878 1870 1823 1635 1618 1528 837 768 450 421 283 12362 11587 --
NM_004422chr173342 318 165 1171 ----
NM_004423chr3132717 2590 2455 1010 716 676 590 510 458 381 303 234 57 3906 627 364 32700 420 258 1295
NM_004425chr1184 ------
NM_004427chr13292 152 40 1466 1793 --
NM_004429chrX91331 455 327 313 247 213 184 141 76 --155 --
NM_004430chr8122171 965 957 950 812 404 393 210 139 128 110 33 1783 1792 --
NM_004431chr12323 258 ------
NM_004432chr91398 22166 1843 ----
NM_004433chr151485 604 538 197 87 1273 1548 --
NM_004437chr182791 2413 752 636 566 451 308 34 12274 31077 741 294 --
NM_004438chr262824 2110 1015 855 648 344 23207 902 12443 --
NM_004440chr621793 155 --11784 --
NM_004441chr32481 443 --1428 --
NM_004442chr191681 1561 1450 1403 1154 468 368 46 25 --1539 --
NM_004443chr32187 162 1241 1228 --
NM_004444chr7--2300 233 ----
NM_004446chr1121 --132 --
NM_004450chr14----1321 --
NM_004451chr117517 509 477 224 166 157 134 1561 ----
NM_004454chr331727 656 153 11648 22030 534 --
NM_004458chrX31772 889 57 --12036 --
NM_004459chr171536 ------
NM_004460chr2------156
NM_004463chrX3472 222 73 1412 1463 --
NM_004464chr474059 3756 3644 1152 907 442 211 140 24011 3351 --
NM_004468chr14605 249 218 72 ------
NM_004474chr12303 46 1397 --139
NM_004475chr1761194 874 461 191 180 46 1354 ----
NM_004484chrX2316 117 ------
NM_004486chr981195 777 751 118 96 89 74 65 1889 ----
NM_004487chr351148 1080 905 898 56 133 ----
NM_004493chrX239 31 ------
NM_004494chr1111235 1205 1171 1014 944 937 816 369 212 196 118 11109 2340 95 --
NM_004496chr145412 321 312 299 283 ------
NM_004497chr192604 580 ------
NM_004500chr1461923 1641 1267 752 250 85 11909 ----
NM_004501chr141253 1103 844 489 22655 1554 ----
NM_004503chr125811 779 337 204 40 1172 124 --
NM_004505chr1731380 547 50 ------
NM_004514chr1762806 2539 2024 1882 1023 150 42812 2682 2324 2288 11197 1111
NM_004521chr10188 ------
NM_004524chr172300 219 ------
NM_004525chr221259 616 ----1574
NM_004527chr174600 362 327 105 1517 11061 --
NM_004529chr921313 505 ------
NM_004535chr2061694 1310 627 593 174 51 ------
NM_004556chr63929 724 274 --139 --
NM_004571chr2193279 2886 2370 2208 2173 1182 567 290 274 22220 521 12735 --
NM_004575chr451078 1048 573 56 30 11164 ----
NM_004583chr174630 523 264 34 --1607 --
NM_004586chrX104731 4684 4439 3897 2173 1950 1474 831 431 155 ----11212
NM_004588chr1193217 3195 2946 2629 1100 1083 677 458 40 1425 ----
NM_004598chr532923 1013 355 22399 1325 --1708
NM_004599chr223534 436 147 2162 56 231 23 --
NM_004603chr771063 1051 972 915 387 136 116 2922 738 21125 301 --
NM_004608chr162165 48 2132 70 ----
NM_004612chr944709 2962 1416 399 13558 13773 13871
NM_004615chrX4676 365 299 121 1130 ----
NM_004616chr12----139 --
NM_004630chr1171057 1021 940 863 754 397 281 1261 2370 307 --
NM_004631chr12990 481 11239 ----
NM_004634chr34569 432 146 48 ------
NM_004637chr371253 1238 1202 890 446 439 74 --1467 --
NM_004639chr6121 ------
NM_004640chr61137 ------
NM_004642chr12183 ------
NM_004643chr142634 308 ------
NM_004645chr17----1829 --
NM_004656chr351227 1140 1017 284 78 2885 863 11219 --
NM_004660chrY2237 26 ------
NM_004673chr121482 450 ------
NM_004684chr4140 ------
NM_004686chr82491 346 2639 354 ----
NM_004687chr1742000 513 469 391 ------
NM_004694chr171551 --192 --
NM_004698chr13151 79 24 2186 55 ----
NM_004717chr711523 1584 11503 --
NM_004718chr2143 ------
NM_004723chr12985 854 ------
NM_004725chr1031527 1421 336 ------
NM_004726chrX35299 2084 659 ------
NM_004730chr52610 88 1592 ----
NM_004734chr1351311 143 117 73 30 ------
NM_004736chr162086 1772 1727 747 663 72 ------
NM_004738chr2032448 1606 831 --3355 338 134 11028
NM_004739chr114554 543 499 69 ------
NM_004742chr33300 182 71 ------
NM_004745chr884376 2425 2325 1911 1591 489 88 25 36140 6094 2199 35426 4510 608 --
NM_004746chr185269 82 76 61 43 ------
NM_004748chr1522933 1329 11147 ----
NM_004755chr14--146 --1405
NM_004759chr181978 1850 1577 1508 1331 725 371 210 32026 1780 734 31742 1566 462 --
NM_004760chr73760 666 66 22065 712 ----
NM_004762chr1771571 1481 1384 1232 592 328 233 11237 ----
NM_004765chr16164 ------
NM_004768chr111189 ------
NM_004772chr52323 237 --11401 --
NM_004774chr1742855 2374 2210 606 11929 1863 --
NM_004775chr184827 497 260 198 --1163 --
NM_004781chr141657 628 319 40 ------
NM_004781chr141657 628 319 40 ------
NM_004784chr4196 ------
NM_004789chr91366 ------
NM_004796chr141547 ------
NM_004798chr2082932 2869 1148 376 337 313 296 187 33135 2314 1328 ----
NM_004807chr282418 2167 1898 1646 1052 618 481 412 2550 377 ----
NM_004808chr1052933 2592 2304 2162 296 --22649 1210 --
NM_004814chr1--199 ----
NM_004815chr154539 4445 4063 3223 312 14439 1745 --
NM_004818chr122568 245 --176 --
NM_004821chr54780 741 327 42 ------
NM_004822chr17173748 3732 3711 3683 3655 3529 3112 2645 1430 834 782 776 770 748 537 523 166 31575 1448 1046 22876 585 --
NM_004824chr621144 1014 ------
NM_004827chr41293 2364 219 11853 --
NM_004831chr191781 2302 172 ----
NM_004836chr22297 180 ------
NM_004839chr153453 170 149 ------
NM_004841chr13973 126 73 21164 1156 ----
NM_004849chr631684 186 64 ------
NM_004857chr1443594 3454 907 341 ------
NM_004859chr1732824 1906 257 --1765 --
NM_004860chr172225 185 --2368 21 --
NM_004863chr14125233 5059 4968 4200 3927 3738 908 857 747 529 417 334 136 ----
NM_004866chr533967 1077 198 ----14968
NM_004869chr181180 ------
NM_004871chr17103862 3021 1307 1286 1272 1072 957 478 461 432 13884 13518 --
NM_004872chr1------153
NM_004873chr1443227 3146 2498 2038 ------
NM_004879chr113659 353 127 --1323 --
NM_004884chr1581666 1631 1569 1440 565 550 535 243 1510 11171 --
NM_004887chr521033 1019 1889 ----
NM_004890chr17296 28 ------
NM_004893chr5--2432 72 197 --
NM_004896chr104394 371 46 37 ------
NM_004898chr432535 2279 460 12538 22080 472 1876
NM_004902chr201616 ------
NM_004904chr7116002 5233 4961 4729 4698 4512 4445 2469 1844 1004 317 --35954 4781 572 1102
NM_004915chr212195 117 ------
NM_004922chr102982 199 1208 --1997
NM_004924chr194900 886 307 158 1365 ----
NM_004926chr14111613 1463 694 612 606 549 490 411 230 157 39 2519 166 2572 126 --
NM_004929chr8--11415 ----
NM_004930chr13176 90 78 ------
NM_004947chr3122585 2186 2129 2084 1962 1719 995 868 721 547 423 380 ------
NM_004952chr18841 765 667 323 312 292 151 70 1705 3719 159 100 --
NM_004954chr112243 187 ------
NM_004956chr7--13466 ----
NM_004959chr9101426 1401 1354 1128 939 599 393 385 280 145 ------
NM_004960chr161135 ------
NM_004961chrX61309 988 601 240 165 58 --41349 567 517 32 --
NM_004964chr1--139 --160
NM_004965chr21142 ------
NM_004973chr631602 1331 1112 --11674 --
NM_004976chr11205060 4882 4842 4827 4766 4723 4629 4433 4289 4175 3915 3779 3603 3299 3171 1990 1976 1734 1101 181 44868 4338 4292 413 44642 4422 4206 1501 13718
NM_004977chr195536 453 382 157 73 ------
NM_004978chr191615 1577 1567 1551 1271 1259 659 623 441 --11531 --
NM_004979chrX101059 1011 813 786 445 391 309 298 244 49 --2794 101 --
NM_004981chr22170 --1150 --
NM_004985chr1244514 697 509 355 ------
NM_004991chr3------1401
NM_004992chrX338514 8063 7971 7794 7463 7313 6974 6684 6443 6355 6132 5922 5877 5380 5275 3190 3089 3073 3008 2664 2519 2512 2505 1995 1818 1811 1797 1504 1301 1284 1271 1225 325 22978 1064 27884 1566 --
NM_004992chrX338514 8063 7971 7794 7463 7313 6974 6684 6443 6355 6132 5922 5877 5380 5275 3190 3089 3073 3008 2664 2519 2512 2505 1995 1818 1811 1797 1504 1301 1284 1271 1225 325 22978 1064 27884 1566 --
NM_004993chr14--1509 --11354
NM_004994chr201135 ------
NM_004995chr1451310 399 168 105 26 2472 253 --11281
NM_005010chr732140 1694 398 22229 72 ----
NM_005011chr731453 1253 697 21313 560 ----
NM_005016chr12127 ------
NM_005020chr71152 1164 ----
NM_005022chr17--123 2178 49 --
NM_005027chr1991113 1027 388 353 286 216 185 163 34 --2959 910 --
NM_005028chr1041631 1561 858 332 --1742 --
NM_005032chrX2339 258 1726 1183 --
NM_005045chr71127 ------
NM_005053chr194466 213 170 40 ------
NM_005055chr114159 78 39 30 ------
NM_005056chr1275267 4970 4638 4140 1792 1611 1331 1375 15577 1863
NM_005060chr1276 26 --11230 --
NM_005063chr1083360 3088 3001 2989 1439 1200 1133 211 21442 996 22591 604 --
NM_005065chr1474196 4037 3513 3309 2035 1854 732 --1635 11461
NM_005066chr1--1241 ----
NM_005070chr21234 294 22 ----
NM_005078chr1581771 1708 1174 1151 498 465 222 175 31238 1180 350 ----
NM_005079chr862850 2369 2105 381 191 172 ----12683
NM_005080chr223745 300 31 2834 110 --1102
NM_005087chr31320 ------
NM_005095chr131837 1582 802 22216 593 ----
NM_005096chrX41212 883 799 437 21193 61 1281 --
NM_005099chr151140 995 378 243 128 ----1387
NM_005103chr111222 ------
NM_005105chr141804 1529 744 692 11767 1768 --
NM_005114chr42710 516 ------
NM_005116chr20113964 3858 3538 3026 1687 976 763 444 392 319 208 33917 1763 1433 24189 1486 --
NM_005119chr13930 428 153 11211 21306 1166 --
NM_005121chr1721526 492 23609 2392 23328 1504 13477
NM_005124chr62321 177 ------
NM_005126chr31602 11772 ----
NM_005134chr181110 ------
NM_005135chr1543521 2886 2587 1253 1210 ----
NM_005137chr22112368 2338 2285 2110 1687 987 881 733 587 433 84 1762 ----
NM_005146chr112245 55 ------
NM_005156chr964959 3712 3494 1524 620 468 14563 34705 1926 1688 --
NM_005161chr11132086 2015 1668 1505 857 793 463 445 423 370 331 142 87 22184 1964 11393 --
NM_005166chr192116 43 3309 220 22 ----
NM_005168chr211119 11421 ----
NM_005169chr114494 230 70 51 --2417 132 1483
NM_005178chr193311 274 159 --167 --
NM_005180chr102166 37 ------
NM_005182chr166614 569 513 426 414 162 ----1181
NM_005184chr1951283 1160 330 310 290 21351 205 ----
NM_005186chr116563 499 191 140 35 21 ------
NM_005187chr16121645 1616 1495 1433 1308 806 594 528 381 363 345 161 11353 61653 1401 1371 1341 1316 335 11553
NM_005197chr14115499 4980 4275 3827 2494 2148 1706 1139 425 184 165 --35275 4942 509 --
NM_005202chr1111796 1597 1440 898 810 778 715 421 347 263 34 1399 ----
NM_005203chr102406 160 ------
NM_005206chr1711057 --1929 --
NM_005207chr2253440 3325 2311 1107 795 --11250 --
NM_005215chr181654 ------
NM_005219chr561658 1626 1384 729 492 287 21388 30 21118 461 --
NM_005220chr1791440 1252 1137 1093 487 196 128 118 23 --1224 --
NM_005222chr74628 360 165 149 ----1371
NM_005225chr2051137 1015 926 794 306 --1116 --
NM_005229chrX41128 1035 990 169 --127 --
NM_005230chr121575 ------
NM_005233chr332345 1002 884 ----12196
NM_005235chr287591 7432 7137 7060 6539 5251 446 59 17624 ----
NM_005238chr1162867 2798 2546 2496 957 864 11210 --11104
NM_005240chr13740 684 550 1712 ----
NM_005241chr32560 483 --1879 --
NM_005243chr22----1245 --
NM_005250chr1641468 1411 1242 1205 --11936 --
NM_005252chr141195 ------
NM_005254chr1531320 432 416 --21283 1222 --
NM_005256chr111892 1636 ----
NM_005261chr81867 ------
NM_005264chr101719 1956 ----
NM_005271chr1031002 978 88 ----11187
NM_005273chr7195 --1251 --
NM_005274chr1137 --1157 --
NM_005276chr1271536 1521 636 629 616 504 233 --2576 493 --
NM_005276chr1271536 1521 636 629 616 504 233 --2576 493 --
NM_005277chr4--1666 ----
NM_005311chr772019 1932 1014 972 601 405 207 ------
NM_005312chr9141860 1696 1678 1067 1048 1005 966 945 901 736 543 384 324 301 32035 1833 709 ----
NM_005313chr1511100 1879 1318 198
NM_005316chr111917 ------
NM_005324chr17----12055 --
NM_005327chr41249 198 ----
NM_005334chrX91717 1651 1518 1164 583 568 485 458 386 --2127 74 --
NM_005336chr2132203 1923 1915 1794 1456 873 863 651 475 419 170 118 25 ------
NM_005337chr122337 49 ------
NM_005338chr7144083 4035 3886 3859 3405 1512 1270 1138 887 761 697 581 175 160 ------
NM_005339chr431718 706 155 24313 608 ----
NM_005342chrX42682 2124 1929 436 1269 ----
NM_005359chr1895973 4842 4814 4307 4292 3980 2301 2160 667 24619 1448 ----
NM_005370chr193965 822 520 167 ----
NM_005374chr17102265 2108 2079 1978 1781 1582 1517 389 223 63 22376 661 2425 369 1435
NM_005382chr8--1163 ----
NM_005386chr206854 709 585 268 194 108 2717 594 1206 --
NM_005387chr112228 73 ----1608
NM_005392chr91486 2181 150 ----
NM_005397chr743233 888 879 120 1295 2690 608 13790
NM_005398chr1031434 1129 261 1275 ----
NM_005399chr163267 3209 2963 2793 1629 553 23456 563 1614 --
NM_005400chr292867 2664 451 444 421 169 163 98 58 --1405 1292
NM_005401chr11192 ------
NM_005402chr711748 ------
NM_005406chr18--11312 ----
NM_005407chr1481582 1392 1298 1264 1246 636 296 264 21509 208 2408 287 --
NM_005412chr122489 143 1426 --1111
NM_005413chr2797 85 73 55 48 35 24 ------
NM_005415chr22766 231 ------
NM_005417chr20111915 1261 755 469 441 364 261 248 135 100 55 21615 600 21806 633 --
NM_005418chr112133 94 1572 1691 --
NM_005429chr4186 ------
NM_005430chr1281043 923 844 389 378 309 237 37 2855 669 4800 652 370 258 1168
NM_005433chr1822536 1944 11123 ----
NM_005436chr10104085 3824 3093 2886 2786 2688 1633 1449 866 743 33583 2509 419 ----
NM_005438chr113479 209 50 --1123 --
NM_005439chr126464 385 350 167 75 23 --2506 130 1359
NM_005440chr17113232 2929 2788 2557 2525 1287 883 432 394 321 175 22667 400 12570 --
NM_005458chr952425 2143 2133 1797 461 1121 1904 1449
NM_005461chr2051337 1268 1229 739 347 11525 ----
NM_005465chr111666 1359 1137 --
NM_005474chr17111529 1451 1237 1116 522 515 416 235 189 128 118 11481 1553 --
NM_005475chr1282750 2273 2200 2152 1300 1130 974 810 --22691 148 --
NM_005477chr1582395 1950 1904 1003 895 863 792 44 12289 12282 1837
NM_005477chr1582395 1950 1904 1003 895 863 792 44 12289 12282 1837
NM_005493chr61205 ------
NM_005497chr1785235 4918 2447 1641 1551 1455 1425 880 31875 853 504 ----
NM_005499chr191207 ------
NM_005502chr953017 2896 2340 2235 642 22973 2143 ----
NM_005505chr123879 330 64 2792 780 ----
NM_005506chr442931 2721 2059 252 ------
NM_005507chr115442 330 184 177 73 1128 1420 --
NM_005512chr1141557 1479 739 165 --11920 11604
NM_005522chr72474 382 11437 1247 --
NM_005523chr74384 353 313 246 --1602 --
NM_005527chr61110 2159 56 ----
NM_005534chr212492 387 1437 ----
NM_005542chr721334 128 11562 ----
NM_005552chr14185 --1147 --
NM_005562chr121216 183 ------
NM_005569chr223502 258 50 ----1993
NM_005576chr15135 --1115 --
NM_005578chr364808 4784 4765 4082 4036 291 13863 ----
NM_005581chr196419 407 128 107 100 93 1397 ----
NM_005584chr13----137 --
NM_005587chr153833 204 119 ------
NM_005595chr12976 271 ------
NM_005598chr1131586 1526 1519 1477 1384 1187 1167 1055 559 416 348 42 32 ------
NM_005603chr181140 ----11536
NM_005604chr63702 81 40 1747 ----
NM_005607chr81785 --1865 --
NM_005610chr1136 --1102 --
NM_005611chr162917 155 ------
NM_005614chr73910 689 136 1142 ----
NM_005618chr61145 ------
NM_005619chr193406 91 60 ------
NM_005626chr11378 1154 ----
NM_005627chr6--2945 179 ----
NM_005629chrX7836 513 298 222 216 49 30 --5829 502 325 290 72 1364
NM_005637chr1821841 627 ------
NM_005639chr1231553 1330 171 ------
NM_005643chr62550 207 ------
NM_005644chr11356 ------
NM_005649chr5------1473
NM_005650chr222898 401 --11084 --
NM_005652chr1641210 1165 1025 56 ------
NM_005653chr12145 ------
NM_005656chr2121477 1152 1539 2459 203 1346
NM_005665chr164784 4007 3657 3072 1888 719 ------
NM_005667chr21373 ------
NM_005669chr5131 --12288 12322
NM_005687chr23332 73 49 1297 ----
NM_005688chr311193 21064 68 ----
NM_005697chr151187 124 ----
NM_005698chr12232 104 ----1209
NM_005700chr11--1359 1148 --
NM_005716chr194565 531 470 176 --1453 --
NM_005718chr35872 845 797 778 650 134 ----
NM_005722chr22443 99 12165 ----
NM_005725chr122225 2047 --1169 --
NM_005730chr1283404 3244 3097 2999 2607 2301 1043 344 63464 3208 3137 2788 2513 1269 ----
NM_005731chr21380 ------
NM_005735chr25810 646 159 118 64 1570 ----
NM_005736chr1061559 1537 1449 1299 1198 1074 1269 125 --
NM_005737chr242740 1000 577 390 --22081 523 --
NM_005742chr22526 341 ------
NM_005746chr742527 2515 2316 605 --12402 --
NM_005748chr12--13362 --13441
NM_005756chrX1263 --11350 --
NM_005759chr294482 3774 3393 3026 1884 875 441 359 346 33298 3053 613 14138 --
NM_005764chr12115 75 1370 ----
NM_005768chr122510 68 ------
NM_005776chr144557 540 244 130 ------
NM_005777chr3136 ------
NM_005778chr32370 145 2316 168 ----
NM_005779chr553633 3420 3325 1387 770 --13293 --
NM_005782chr17146 ------
NM_005786chr183921 394 111 ------
NM_005789chr17132149 2098 1657 1570 1514 1491 795 718 706 679 315 307 172 11578 21508 115 --
NM_005796chr16137 --168 --
NM_005801chr173792 148 61 3758 320 198 ----
NM_005802chr91837 ------
NM_005807chr11224 ------
NM_005808chr352389 906 342 320 44 --11157 --
NM_005814chr161094 938 591 285 98 68 11123 1219 --
NM_005819chr153062 2322 2315 212 159 33440 2485 1351 22630 388 --
NM_005822chr652197 1643 429 135 35 ------
NM_005828chr17165016 4804 4752 4635 4124 3905 3872 3758 3734 1927 1853 1795 1787 1541 612 562 54226 4160 739 586 205 24570 1313 --
NM_005832chr311439 ------
NM_005833chr91178 ------
NM_005835chr61205 ------
NM_005840chrX176880 6823 6470 6411 6285 6233 2889 2579 2301 2154 1831 1322 1302 594 495 478 114 21753 535 45495 459 342 201 14841
NM_005843chr2--194 1135 --
NM_005852chr1771122 1103 1075 1056 991 149 135 41059 859 719 23 2128 101 --
NM_005853chr16----1110 --
NM_005862chr321035 137 ------
NM_005868chr72467 204 --12131 1551
NM_005870chr131189 ------
NM_005871chr10--1209 ----
NM_005876chr23759 746 680 --1787 1566
NM_005877chr2242496 2136 169 42 --1408 --
NM_005880chr1611383 ------
NM_005881chr161306 ------
NM_005884chr196784 673 625 590 582 538 --188 --
NM_005885chr521246 32 11266 ----
NM_005898chr1142087 1975 1013 258 ----23121 2973
NM_005899chr1721361 526 ------
NM_005900chr41114 ------
NM_005901chr18118305 5566 3414 2865 2814 2450 2113 2080 1857 1539 1015 ------
NM_005902chr15174612 4589 4557 4252 4092 3705 3462 3273 2902 2895 1862 1078 682 596 542 299 213 34582 604 118 1364 --
NM_005904chr1851218 976 589 583 480 1600 ----
NM_005906chr61303 ------
NM_005909chr564254 4029 3592 3529 3325 3251 22704 1154 24088 1597 --
NM_005910chr17143706 3688 3573 3457 3074 1527 1423 1146 909 871 630 398 319 106 43781 3214 2952 1351 23203 1247 23719 1204
NM_005911chr2--21073 487 1944 --
NM_005920chr1233695 3590 3506 3495 3483 3273 3264 3144 3086 2803 2719 2415 1486 1465 1269 1212 1148 827 737 598 225 82 65 63232 3058 2439 1502 1132 23 12520 23517 880
NM_005927chr521014 177 ------
NM_005933chr11102703 2418 2243 2127 1953 1084 1044 710 698 234 22708 1857 ----
NM_005934chr19132520 2129 2076 1778 1768 1050 946 938 925 717 503 300 72 1246 11704 --
NM_005935chr483928 2119 1642 1550 1465 821 805 233 24611 1813 23564 3264 --
NM_005937chr17143924 3905 3846 3404 3275 3036 2580 1193 1046 943 826 621 198 184 43343 1274 1078 615 33959 516 494 --
NM_005938chrX91324 1314 1287 1085 1077 1057 534 353 71 2443 255 ----
NM_005941chr834193 1675 1014 --33322 839 821 --
NM_005943chr641455 1408 1390 645 1276 31510 514 157 --
NM_005944chr321011 331 ----1204
NM_005955chr184661 3987 3405 2176 1053 1037 471 23 23896 1381 ----
NM_005957chr1164476 4458 3209 3143 3118 1803 1520 1489 1364 1148 1037 866 700 670 53 36 1645 34891 3562 462 --
NM_005962chr1041680 1497 1454 94 --32254 707 387 --
NM_005962chr1041680 1497 1454 94 --32254 707 387 --
NM_005964chr1761395 1050 1030 629 292 181 --11229 1433
NM_005966chr211658 ------
NM_005967chr124636 605 220 112 2594 280 ----
NM_005968chr19136 ------
NM_005977chr131239 ------
NM_005982chr141194 ------
NM_005996chr1251540 1127 167 141 101 1347 ----
NM_005998chr1149 ------
NM_006007chr9--13491 1949 --
NM_006015chr151007 914 889 176 161 1227 1927 --
NM_006020chr1421323 1306 1457 2495 378 --
NM_006022chr132415 311 1400 --1330
NM_006030chr351165 1124 514 377 325 21660 103 1241 --
NM_006032chr14185 3178 37 29 --1162
NM_006036chr251963 1578 845 486 294 1431 ----
NM_006037chr254677 4195 3332 3183 1921 13772 ----
NM_006038chr2081863 1390 1361 731 709 514 501 485 21364 403 2569 365 --
NM_006040chr1681243 1091 571 558 511 491 439 113 ------
NM_006047chr2033369 2746 1199 --12512 --
NM_006048chr151214 921 494 432 424 1336 ----
NM_006051chr54236 208 114 90 ----1308
NM_006077chr104743 144 105 51 --2154 26 --
NM_006079chr61285 1293 ----
NM_006091chr15101715 1606 1291 715 666 567 489 221 158 55 31673 497 255 2626 472 --
NM_006094chr851938 809 682 622 590 ------
NM_006095chr431784 1694 1612 --136 --
NM_006096chr861262 499 269 176 65 52 1279 ----
NM_006099chr11188 --2360 85 --
NM_006106chr111189 ----12515
NM_006113chr161942 1866 1816 624 137 127 11446 ----
NM_006133chr11132159 2103 1962 1937 1698 1543 977 957 869 702 670 492 156 52202 1733 1611 967 690 1895 --
NM_006134chr2121270 1188 1603 11465 --
NM_006135chr12496 385 ------
NM_006141chr163933 213 196 ------
NM_006142chr1133 1475 186 --
NM_006145chr191856 --2406 334 --
NM_006148chr17152869 2611 2434 2385 2257 1946 973 925 810 775 609 305 248 200 180 82656 2603 2127 936 892 557 343 321 2501 125 --
NM_006154chr151333 22558 2500 11903 --
NM_006156chr143218 92 21 161 ----
NM_006158chr811522 11656 ----
NM_006159chr121557 ------
NM_006160chr1781304 1258 1233 460 336 330 229 21 1401 2294 267 --
NM_006162chr184609 381 371 45 11427 125 --
NM_006166chr1242592 2227 786 263 ------
NM_006176chr118705 627 592 540 296 233 95 55 1149 ----
NM_006178chr1751288 1172 337 269 158 21502 997 1318 --
NM_006185chr111120 178 ----
NM_006186chr22147 140 ------
NM_006187chr1263211 1998 1297 412 394 329 --32999 873 343 --
NM_006191chr127919 845 790 687 284 153 45 ------
NM_006194chr14156 --2105 88 1300
NM_006195chr931257 920 484 1994 ----
NM_006196chr2----129 --
NM_006201chrX31094 881 220 ----153
NM_006203chr584502 4155 3627 3608 1583 1274 862 550 ------
NM_006206chr442900 715 450 43 ------
NM_006211chr8144 ------
NM_006216chr24651 592 458 59 ------
NM_006224chr1762230 2135 1965 863 797 224 42233 2144 1633 162 ----
NM_006237chr1342148 699 128 82 ------
NM_006244chr115490 200 95 55 48 --2589 458 --
NM_006245chr64377 333 171 109 2347 277 ----
NM_006246chr141470 ------
NM_006247chr196448 406 324 140 109 36 1309 ----
NM_006251chr532212 800 717 23188 3175 1493 --
NM_006255chr141766 ------
NM_006256chr12846 45 1180 --164
NM_006265chr82987 80 ------
NM_006267chr21234 ------
NM_006268chr11111109 973 856 470 371 293 218 176 89 80 49 ------
NM_006275chr2032378 675 189 ------
NM_006277chr2------1107
NM_006281chr81751 1393 ----
NM_006281chr81751 1393 ----
NM_006283chr8114421 4029 3557 3258 1865 1555 893 847 780 492 90 24797 4017 1347 1759
NM_006288chr116975 955 779 200 189 80 2999 832 1477 2127 94
NM_006293chr153868 657 369 --2836 752 --
NM_006295chr6------124
NM_006306chrX174975 4946 4934 4575 4055 3699 2283 1531 1517 1046 989 728 460 295 262 47 35 34401 972 273 24697 4479 11019
NM_006313chr121258 ------
NM_006317chr55608 117 103 90 47 --1359 --
NM_006320chr42767 412 1392 ----
NM_006321chr332047 141 119 --11845 --
NM_006322chr132201 108 ------
NM_006328chr112471 235 ------
NM_006329chr141699 133 --1736
NM_006330chr8--1154 ----
NM_006333chr21153 ------
NM_006334chr91208 ------
NM_006336chr971422 1346 1125 458 322 255 83 1961 ----
NM_006337chr125266 226 211 62 30 ------
NM_006340chr173381 135 26 183 ----
NM_006348chr71146 ------
NM_006352chr121278 388 ------
NM_006357chr21477 ------
NM_006359chrX42028 1602 1568 577 --11678 --
NM_006361chr1791929 1742 1386 1295 675 575 427 397 105 --31842 1693 121 1442
NM_006364chr141821 ------
NM_006367chr12965 684 134 ----
NM_006369chr13398 294 284 1316 ----
NM_006373chr1771262 1086 342 266 172 154 112 21342 463 ----
NM_006377chr92977 324 --31019 305 111 1314
NM_006379chr72331 119 ----1309
NM_006380chr1753405 3007 2941 320 144 1969 ----
NM_006383chr154638 484 471 232 --1189 --
NM_006389chr11111289 1009 878 854 537 506 401 214 186 121 38 1899 --11273
NM_006390chr1251497 740 662 549 159 ----11392
NM_006393chr1073977 3394 3231 3152 3068 2832 161 13587 1275 --
NM_006400chr12378 41 35 ------
NM_006401chr91178 ------
NM_006407chr311396 ------
NM_006411chr66878 179 171 123 105 22 2931 273 1356 --
NM_006421chr81796 --137 --
NM_006422chr12386 61 25 ------
NM_006424chr471859 1685 1491 427 194 79 59 ------
NM_006427chr141158 ------
NM_006430chr2----1397 --
NM_006434chr1052651 2296 1248 1188 267 ----1540
NM_006439chr42525 509 ------
NM_006440chr222104 50 ------
NM_006449chr231575 1479 543 ------
NM_006458chr113332 268 137 ------
NM_006459chr1021740 1302 11908 1118 --
NM_006460chr1741549 1531 1176 298 ------
NM_006461chr17131 ------
NM_006464chr264200 4044 1614 1470 296 168 24403 1628 11477 --
NM_006465chr15102349 2343 2178 1995 1784 1424 596 507 480 358 1553 ----
NM_006478chr22283 34 --164 --
NM_006489chr1451736 1604 1430 1320 706 11375 21272 36 --
NM_006494chr193760 124 113 --2671 636 --
NM_006496chr121457 335 ------
NM_006497chr174753 650 301 269 --2561 134 --
NM_006500chr115357 213 127 111 24 ------
NM_006516chr151484 1474 1423 1052 519 --11333 11016
NM_006517chrX122018 1956 1756 1538 1499 1463 727 629 584 576 250 218 21469 45 1267 --
NM_006521chrX71285 1216 921 505 293 287 146 11156 --11300
NM_006527chr42267 36 ------
NM_006529chr411679 ----11523
NM_006532chr1971688 1445 584 425 290 240 132 --1571 --
NM_006534chr2062590 1126 854 475 202 21 --22604 2283 --
NM_006538chr2103736 3295 2955 2917 2622 1204 981 549 528 431 1316 13442 --
NM_006540chr811158 ------
NM_006544chr1465676 5570 5254 5124 4386 1671 1214 15297 --
NM_006546chr17265998 5988 5962 5955 5889 5575 5510 5317 5219 5159 4864 4560 4216 4124 2497 2345 2266 2142 1866 1551 1516 1416 960 785 215 21 35539 4156 1924 25139 4346 14360
NM_006547chr731561 1416 152 ------
NM_006548chr33366 310 45 ------
NM_006549chr1252844 2753 2542 2512 2464 --11825 --
NM_006557chr921313 489 ------
NM_006558chr82494 84 ------
NM_006559chr11130 ------
NM_006560chr112536 110 ------
NM_006561chr10155237 5120 5045 5030 4903 4736 4340 4268 4156 2253 1967 1908 1439 1408 1186 35929 5217 4283 ----
NM_006562chr102113 94 ------
NM_006565chr16175 --1297 --
NM_006574chr3166 ------
NM_006584chr17----125 --
NM_006589chr14564 440 144 136 1426 ----
NM_006593chr22289 283 3756 654 54 189 --
NM_006595chr1151492 1467 1354 1301 441 12042 11903 11897
NM_006599chr16107748 7549 7493 7394 5565 3159 2587 1760 1082 875 --11774 --
NM_006603chrX1387 ------
NM_006609chr251947 1059 1001 542 341 ------
NM_006618chr111595 --21053 333 --
NM_006620chr664641 3158 1867 530 166 51 ------
NM_006621chr151825 1639 1629 598 88 ----11445
NM_006622chr5----133 --
NM_006624chr1041721 1601 853 170 ------
NM_006625chr11221 1152 ----
NM_006625chr11221 1152 ----
NM_006625chr11221 1152 ----
NM_006626chr941047 793 256 236 ------
NM_006628chr15114026 4012 3855 3657 3515 3261 3224 3096 1604 1390 1178 34239 3196 1742 14647 1748
NM_006633chr5--1722 --1689
NM_006646chr1342538 2051 2018 593 1959 11237 --
NM_006650chr5123909 3782 3659 3571 3530 3257 2532 1034 698 621 589 118 63864 639 258 170 158 147 33315 2627 880 --
NM_006651chr4171493 1475 1372 1324 1223 1199 961 951 559 526 518 429 319 244 203 68 39 21288 150 ----
NM_006653chr6161 ------
NM_006654chr12114151 4141 4134 3545 3532 3039 3033 2983 534 172 91 24777 1177 ----
NM_006662chr164301 258 129 45 ------
NM_006667chrX3869 449 399 ------
NM_006668chr145404 385 370 195 56 --280 29 2160 111
NM_006675chr12163259 3163 3017 3004 2847 2531 2479 1142 1022 987 851 464 318 311 214 98 33109 2669 2590 22819 1113 --
NM_006681chr41112 ------
NM_006690chr20101983 1968 1570 1482 938 503 434 351 302 49 12287 11924 22013 563
NM_006698chr2041263 454 422 361 --2371 268 1415
NM_006699chr142299 2164 556 97 ------
NM_006704chr131121 ------
NM_006706chr53858 769 559 ------
NM_006709chr62118 56 ------
NM_006711chr164335 205 99 25 --1138 --
NM_006717chr953422 3408 1274 1209 1152 1310 21139 196 --
NM_006720chr1075081 5037 4869 3983 3886 3594 1095 11445 ----
NM_006722chr332386 2359 451 22038 778 1508 --
NM_006729chrX115405 5344 5335 4926 4919 4899 4872 4170 3774 3739 422 --1169 15455
NM_006732chr19122120 1799 1785 1756 1736 1540 1487 1338 682 474 414 124 1587 ----
NM_006734chr621320 1292 ------
NM_006735chr72230 42 --1110 --
NM_006736chr261758 1381 602 529 131 117 1708 1741 --
NM_006738chr15134628 4398 3194 3158 3076 1865 1792 1453 1243 1163 950 863 582 24643 107 155 1566
NM_006742chr16132009 1565 1490 1376 781 713 630 541 436 418 391 156 78 11321 2663 257 --
NM_006750chr16128002 7522 7235 7160 6673 5930 5633 5456 4998 2712 580 428 ----16643
NM_006751chr23918 335 265 1751 ----
NM_006756chr821400 143 ------
NM_006761chr174759 709 58 41 1729 1735 --
NM_006763chr171973 1623 1605 1433 561 461 453 11561 ----
NM_006766chr872655 2622 2520 891 643 619 441 1374 1654 1628
NM_006769chr11150 ------
NM_006772chr6181694 1649 1579 1568 1555 1426 1395 1201 1186 1073 671 588 556 467 434 244 224 196 31684 1313 1241 41531 1285 511 279 --
NM_006775chr631996 1040 327 11214 ----
NM_006777chrX3548 357 193 --11084 --
NM_006778chr63371 73 25 11250 ----
NM_006788chr1861873 1840 560 487 288 148 ----11807
NM_006801chr192108 26 ------
NM_006802chr14942 368 284 94 11163 ----
NM_006805chr551071 669 192 147 72 188 1179 --
NM_006809chr204696 609 127 27 1121 ----
NM_006813chr62636 48 ------
NM_006814chr2072134 922 834 570 261 240 34 ----1150
NM_006823chr82530 188 21147 331 11341 --
NM_006825chr125998 957 381 226 105 ------
NM_006826chr21409 ------
NM_006827chr14123293 3033 2872 2707 2264 2250 2241 779 745 477 459 21 ------
NM_006836chr122469 180 ------
NM_006838chr1231710 539 221 ------
NM_006843chr124436 429 345 47 ------
NM_006852chr1752538 2365 693 591 554 21997 726 ----
NM_006854chr741712 1559 680 386 11544 --1422
NM_006856chr1261067 873 363 329 288 76 ------
NM_006857chr22742 360 137 ----
NM_006861chr1281314 567 540 384 216 199 164 40 ------
NM_006873chr253367 3032 2622 878 445 23002 2219 ----
NM_006875chrX4876 798 769 189 ------
NM_006884chr321410 1345 --2133 86 --
NM_006885chr1694212 3101 2938 2868 2821 1565 1516 1045 342 22829 971 21355 328 --
NM_006887chr22737 651 --3459 181 62 --
NM_006888chr1493252 2696 2577 2386 1022 999 260 65 31 13375 33456 3175 2192 13011
NM_006889chr371537 1520 1135 556 293 134 43 1445 1577 1352
NM_006896chr72232 22 11075 ----
NM_006899chr201240 ----151
NM_006901chr15121 1360 1503 --
NM_006906chr112147 119 2397 107 ----
NM_006908chr7----1979 11397
NM_006917chr1299 39 ------
NM_006920chr241956 706 491 79 --1158 --
NM_006922chr232490 2422 661 --1156 --
NM_006924chr1793759 3723 2908 2804 1379 992 696 163 139 13782 ----
NM_006930chr531954 1782 1699 11235 ----
NM_006931chr1271664 1622 1609 1583 1550 783 24 12059 147 --
NM_006937chr171138 1565 ----
NM_006939chr141422 ------
NM_006940chr1211918 --11451 --
NM_006941chr22111133 1113 1036 891 829 803 779 384 375 326 37 --1990 --
NM_006943chr20253126 2827 2816 2621 2034 1053 1033 986 964 757 670 529 509 450 375 353 326 312 286 265 236 219 158 118 72 33043 1004 141 52838 799 480 305 200 --
NM_006946chr114489 227 177 30 ----2424 404
NM_006950chrX7880 631 591 356 288 87 29 --3610 168 41 2904 127
NM_006956chr73118 57 32 12098 11657 --
NM_006958chr8143 --152 --
NM_006981chr972920 2793 981 807 751 716 32 ----12051
NM_006987chr175523 481 251 206 64 41035 906 493 430 21123 170 --
NM_006988chr212341 219 ------
NM_006990chr1111878 1782 874 772 748 711 671 660 613 239 185 12493 1446 --
NM_007005chr941006 391 135 33 --1383 --
NM_007006chr1642442 495 380 116 ------
NM_007011chr15135401 4540 4482 4363 4239 2717 2314 1979 1432 1241 988 643 37 85070 5033 4993 4876 2002 1961 86 56 45489 4174 1086 436 34411 4394 2174
NM_007013chr8--11012 --1115
NM_007014chr1641753 1380 470 261 1664 ----
NM_007017chr52720 191 ------
NM_007024chr34468 424 46 33 158 ----
NM_007026chr173517 477 66 1107 ----
NM_007027chr31437 --1137 1230
NM_007039chr1442061 2055 1666 1550 ------
NM_007040chr199992 975 921 349 167 147 128 67 32 2892 383 ----
NM_007047chr6122493 2390 2079 2041 2031 1976 1770 1606 646 630 493 160 32456 798 726 ----
NM_007050chr20157777 5590 5368 5245 5048 2791 2731 2318 1425 1157 979 820 752 418 56 13129 46864 5733 5344 615 15153
NM_007052chrX1388 1109 ----
NM_007054chr542721 2440 1485 1162 13609 ----
NM_007064chr341421 1309 1043 128 ------
NM_007067chr17101438 1334 1294 1209 1106 1081 1038 553 426 318 2309 128 31531 1278 1118 11572
NM_007084chr131445 21240 422 ----
NM_007106chr131918 12169 12431 --
NM_007107chr332313 1580 807 ------
NM_007112chr1142 193 --1163
NM_007115chr2160 ----1178
NM_007123chr13827 782 58 ------
NM_007125chrY21252 409 ------
NM_007126chr91379 ------
NM_007129chr134654 375 206 22 --2852 365 --
NM_007144chr176959 398 77 45 38 21 1401 11062 --
NM_007146chr1762790 2670 2640 2240 1059 929 11062 ----
NM_007150chrX62058 1886 408 138 103 90 196 ----
NM_007158chr131118 947 79 --189 --
NM_007159chr331590 96 34 ------
NM_007162chr64236 137 121 69 1379 --2589 79
NM_007166chr111272 ----1257
NM_007170chr12787 260 ------
NM_007172chr2272982 2974 2271 2243 1113 802 190 22996 58 ----
NM_007174chr1251843 1676 883 696 150 ----127
NM_007185chr14682 173 155 74 ------
NM_007189chr75586 256 248 128 96 1140 11376 --
NM_007192chr1441005 894 371 47 ------
NM_007200chr15134628 4398 3194 3158 3076 1865 1792 1453 1243 1163 950 863 582 24643 107 155 1566
NM_007202chr172738 650 1776 ----
NM_007207chr11280 ------
NM_007214chr61908 11103 ----
NM_007217chr3197 ------
NM_007218chr81168 ------
NM_007222chr8--11732 ----
NM_007224chr1210638 623 590 577 571 539 499 206 105 64 ------
NM_007232chr206976 840 719 406 125 35 2188 23 1303 --
NM_007236chr1592398 1921 1697 1555 834 724 505 376 95 187 ----
NM_007247chr171831 ------
NM_007249chr13157706 7674 7514 6213 5753 3256 3198 2675 2198 2081 1868 1356 1201 856 409 22599 78 1418 --
NM_007260chr1191 1557 1104 --
NM_007271chr631736 1571 638 21634 64 11170 --
NM_007275chr361151 969 913 462 402 255 --2936 824 --
NM_007278chr174336 151 73 60 ------
NM_007282chr31765 176 ----
NM_007286chr592024 1868 1818 1312 694 614 472 436 289 --22035 211 --
NM_007320chr191241 ------
NM_007327chr981147 913 889 795 757 476 30 21 --1296 1288
NM_007349chr7132 ------
NM_007359chr1731173 513 156 11579 ----
NM_007361chr141500 ------
NM_007363chrX3847 47 32 --1727 --
NM_007371chr92640 486 --163 --
NM_007373chr10--1384 ----
NM_007375chr122589 307 1496 21090 378 --
NM_012062chr123733 621 85 ------
NM_012064chr123336 210 66 11152 1231 21031 459
NM_012069chrX32044 681 232 12705 ----
NM_012072chr20124483 4270 4149 4121 3587 3131 2883 1579 601 258 147 134 12889 ----
NM_012074chr1481112 968 957 767 729 150 110 41 1133 2170 158 --
NM_012081chr553730 3280 2594 2449 819 12276 ----
NM_012092chr22426 274 31358 1319 202 ----
NM_012095chr1053304 2938 2775 2285 2191 --22794 317 --
NM_012098chr92570 188 1218 31387 1266 24 185
NM_012101chr1181105 925 715 363 304 198 162 34 ------
NM_012102chr152427 2155 2062 873 685 ----1345
NM_012104chr1182759 2481 1446 1240 1229 1145 1081 895 23467 2453 12459 --
NM_012104chr1182759 2481 1446 1240 1229 1145 1081 895 23467 2453 12459 --
NM_012117chr12----180 --
NM_012137chr161907 994 587 437 171 68 32651 1095 626 ----
NM_012141chr1333702 1365 331 1290 ----
NM_012153chr1161770 1723 854 695 270 63 1409 11783 --
NM_012154chr8182 1590 ----
NM_012164chr9126691 6678 6231 6214 5694 2429 1934 1668 1547 910 790 65 15285 15477 --
NM_012166chr961504 1315 427 98 92 85 21023 449 1456 --
NM_012181chr194372 305 104 25 1283 ----
NM_012193chr11145080 4635 4451 4372 4232 4148 4007 3576 3319 3281 1999 1515 686 399 13694 15419 --
NM_012199chr193253 1548 1478 1046 693 672 638 629 600 --14450 1223
NM_012200chr115373 126 118 99 28 --1349 --
NM_012207chr1041007 941 354 255 ------
NM_012214chr286132 5469 5214 4053 3914 2518 2372 96 --15006 --
NM_012215chr10--1401 ----
NM_012218chr1942900 2664 2413 2080 --22822 274 --
NM_012229chr1011309 ------
NM_012232chr1792056 1844 1798 1429 459 400 332 241 113 1325 12076 12184
NM_012234chr34962 598 108 80 --11503 12690
NM_012244chr14141662 1633 1601 1475 1378 1290 694 624 517 498 360 346 290 40 3577 363 192 31566 1198 97 --
NM_012248chr162592 247 ------
NM_012249chr213099 --11107 13326
NM_012250chr1111371 162 ----
NM_012259chr62983 66 ------
NM_012262chr144395 3904 1934 420 44883 4254 1535 667 11269 --
NM_012272chr12------1151
NM_012281chr732151 1526 630 --21667 980 --
NM_012282chrX6769 221 207 198 87 51 137 ----
NM_012287chr374577 3499 3430 1456 1317 1127 199 13450 ----
NM_012288chr6205044 4893 4724 4665 4643 4262 3880 3706 3637 3524 2304 2112 2021 1970 1824 1259 1236 254 81 70 33939 1243 231 34904 3587 1912 --
NM_012290chr211370 ------
NM_012296chr11133493 3404 3371 3363 3248 3192 2846 1528 398 192 99 64 52 1859 42915 2714 418 156 --
NM_012298chr32214 100 --1286 --
NM_012300chr542076 1656 1578 173 1250 1920 --
NM_012301chr721549 574 ------
NM_012302chr121185 968 179 ----
NM_012304chr5112235 1851 1836 1789 1000 924 787 444 388 330 299 1935 --11744
NM_012307chr18179 ------
NM_012308chr11142599 2479 1674 1637 969 806 588 578 457 345 191 136 109 67 --12086 --
NM_012309chr11104618 3880 3550 1410 1390 1362 1050 607 489 177 2916 462 23975 3797 --
NM_012311chr102587 560 ------
NM_012316chr1175488 5385 4575 3682 3649 2052 1991 1679 1566 1317 1069 923 905 726 697 151 110 1748 13870 13640
NM_012321chr196514 504 341 150 114 32 ------
NM_012325chr2041350 1020 158 125 11262 ----
NM_012326chr24789 706 213 48 1866 ----
NM_012329chr1731542 684 607 ------
NM_012330chr103684 379 260 --11662 --
NM_012334chr544528 3968 2891 363 ------
NM_012342chr101121 ------
NM_012343chr521046 39 1314 --1178
NM_012382chr554246 4227 4051 3188 387 23773 3345 ----
NM_012384chr20102204 2185 1898 876 818 810 557 487 224 22 21906 986 ----
NM_012395chr762357 2315 1378 764 518 312 22958 2195 12305 --
NM_012396chr14627 547 220 77 ------
NM_012399chr2241800 1521 1464 1445 --11547 --
NM_012402chr1131148 418 407 ------
NM_012407chr224429 220 208 130 ------
NM_012410chr164454 367 100 37 147 ----
NM_012414chr12628 178 ------
NM_012416chr921270 437 ------
NM_012420chr1021964 84 21428 40 --12302
NM_012423chr19143 1453 ----
NM_012426chr162431 326 2177 145 ----
NM_012428chr153144 91 75 ------
NM_012446chr52437 148 147 ----
NM_012456chr11----141 --
NM_012461chr144556 476 253 191 2661 54 ----
NM_012463chr1231752 1610 146 11833 ----
NM_012465chr1073072 2893 2788 2335 929 884 665 ------
NM_012473chr227673 556 504 219 89 75 61 --1239 --
NM_012478chr176851 780 643 325 300 103 4837 681 346 233 149 1688
NM_012479chr7--31848 1769 943 12207 --
NM_013233chr23312 70 50 298 60 ----
NM_013236chr221308 1353 1470 --
NM_013238chr1331434 474 365 --21805 738 --
NM_013245chr166726 683 486 266 228 120 ------
NM_013246chr112712 161 2334 32 ----
NM_013247chr22134 113 ------
NM_013251chr12386 43 21 ------
NM_013252chr742501 2129 737 441 2870 479 1605 --
NM_013253chr115958 557 355 244 122 ------
NM_013255chr7108463 7952 7475 5837 2837 2719 2517 494 434 317 48667 2152 2122 184 23521 3511 --
NM_013257chr832029 843 302 ------
NM_013259chr33290 226 94 ------
NM_013261chr411366 13017 ----
NM_013269chr1264292 3974 3618 1552 943 367 13968 ----
NM_013279chr1172160 1623 1535 1446 394 373 272 3733 505 184 12043 1929
NM_013281chr2011375 1983 ----
NM_013293chr73633 516 99 ------
NM_013302chr1694631 4372 4222 4078 3294 1078 1071 899 512 13951 ----
NM_013305chr184913 118 53 39 1921 ----
NM_013309chr1542032 1818 93 23 --12145 --
NM_013316chr731036 801 83 160 ----
NM_013341chr242793 2022 1158 1060 12658 ----
NM_013346chrX168 ------
NM_013353chr1188 ------
NM_013354chr82378 107 --177 --
NM_013357chr83713 702 119 ------
NM_013368chr192445 57 ------
NM_013372chr153892 474 392 2949 481 1935 --
NM_013381chr121215 12116 ----
NM_013385chr2271823 1716 1452 1249 699 493 238 11228 21370 463 --
NM_013396chr21154 11292 ----
NM_013403chr197886 813 763 742 611 548 208 --2844 162 --
NM_013410chr121077 176 ------
NM_013411chr182768 2586 2242 1728 1064 881 603 56 12459 --22594 656
NM_013417chr92358 34 ------
NM_013433chr1941924 1373 511 257 21936 1320 21718 1430 --
NM_013437chr821150 454 ------
NM_013446chr731218 1097 509 1101 --1156
NM_013449chr12122944 2720 2603 2376 2279 2114 630 530 339 326 179 169 3749 661 196 --1866
NM_013450chr211049 1360 ----
NM_013943chr13229 171 70 12500 12181 13166
NM_013951chr2132486 2454 2432 2360 2305 957 854 781 713 651 586 439 206 3621 506 478 ----
NM_013952chr2132563 2531 2509 2437 2382 1034 931 858 790 728 663 516 283 3698 583 555 ----
NM_013953chr2132563 2531 2509 2437 2382 1034 931 858 790 728 663 516 283 3698 583 555 ----
NM_013986chr22----1245 --
NM_013992chr2132563 2531 2509 2437 2382 1034 931 858 790 728 663 516 283 3698 583 555 ----
NM_013993chr612527 290 279 269 231 205 180 171 115 91 84 21 127 ----
NM_013994chr612527 290 279 269 231 205 180 171 115 91 84 21 127 ----
NM_013999chr174399 364 142 23 1554 11098 --
NM_014000chr1061867 1241 706 609 355 35 ------
NM_014002chr14620 289 209 117 1634 ----
NM_014010chr93441 419 380 ------
NM_014021chr142752 2206 1283 451 13352 ----
NM_014030chr1713999 987 869 860 826 744 467 417 290 250 228 168 157 --1811 --
NM_014038chr7----1291 --
NM_014048chr1635127 3334 1424 --14515 --
NM_014079chr33713 330 84 ------
NM_014089chr1321561 853 ------
NM_014109chr82474 452 ------
NM_014112chr833348 667 132 41224 1107 906 516 ----
NM_014117chr1662244 2040 1967 1945 1897 1044 12324 11053 --
NM_014141chr784347 4194 4055 3902 1866 1273 1015 212 25056 3508 ----
NM_014154chr331585 1085 506 ------
NM_014155chr1165659 2545 1492 1473 1335 38 22286 116 26874 82 --
NM_014166chr131879 1813 ----
NM_014178chr141243 ------
NM_014181chr232327 1118 698 ------
NM_014182chr123685 473 243 2730 502 ----
NM_014186chr1152062 623 577 519 455 --22109 538 12340
NM_014190chr4101722 1654 1361 1333 1291 743 699 549 350 160 3559 480 223 ----
NM_014212chr122945 715 --1899 --
NM_014217chr151498 738 555 543 271 --1504 --
NM_014231chr12112094 1950 1894 1843 1711 1701 1682 1615 1487 543 234 1167 ----
NM_014232chr17101629 1341 1253 1212 1184 1030 622 437 341 39 51379 416 363 314 254 2260 238 170
NM_014232chr17101629 1341 1253 1212 1184 1030 622 437 341 39 51379 416 363 314 254 2260 238 170
NM_014233chr1781824 1726 1631 1530 525 442 221 49 ------
NM_014240chr3123484 3076 2903 2672 1660 1497 1475 447 406 370 308 72 21599 1144 1667 --
NM_014243chr421902 1828 11542 151 11752
NM_014245chr32927 232 ------
NM_014246chr2252310 2272 2046 1658 935 12122 1428 --
NM_014251chr73689 312 87 1812 160 --
NM_014252chr132163 129 ------
NM_014253chrX32514 2121 536 --1714 --
NM_014263chr1011312 21252 88 ----
NM_014268chr1851333 1142 933 567 455 --1332 --
NM_014271chrX3834 614 293 ------
NM_014275chr54928 828 661 616 1793 1873 --
NM_014279chr93764 262 52 ------
NM_014284chr171038 1028 892 739 425 408 92 1192 1905 1164
NM_014286chr9143576 3522 3227 2903 2831 2754 2679 2437 2238 1231 907 459 214 154 12995 33507 2514 936 --
NM_014289chrX71243 1211 1183 937 496 125 41 11123 1958 11067
NM_014292chr22111793 1760 1676 1614 1490 1231 685 499 281 90 75 31496 688 623 11669 --
NM_014293chr22274001 3993 3880 3794 3763 3741 3720 3701 3523 3307 3279 3231 2793 2677 1365 1318 1031 857 769 582 572 563 486 389 112 99 24 3425 136 73 43978 3824 3159 722 --
NM_014299chr1951760 861 502 434 227 --22041 399 --
NM_014305chr131215 ------
NM_014309chr22115255 5189 5074 4982 4953 3898 3598 3462 1717 600 590 11868 14912 13290
NM_014316chr1661933 1784 774 668 477 467 1122 42096 705 362 21 21613 217
NM_014319chr12----11878 --
NM_014323chr223412 383 142 ------
NM_014329chr161288 ------
NM_014333chr1152035 1995 362 339 199 --21985 849 --
NM_014335chr152999 990 ------
NM_014345chr61946 1182 1393 --
NM_014368chr931615 212 165 21902 51 ----
NM_014372chr13761 693 382 ------
NM_014393chr81785 22060 1716 12297 --
NM_014400chr192477 105 128 156 --
NM_014405chr17172294 2282 2264 2024 1961 1943 1683 902 826 814 634 539 522 385 338 217 33 ------
NM_014408chr12560 67 ------
NM_014409chr11103 2855 147 ----
NM_014411chr782001 1715 1483 1464 1262 681 597 462 31832 600 430 ----
NM_014415chr321383 558 11164 ----
NM_014418chr1441456 1326 1299 473 --21917 1886 --
NM_014423chr5104689 4620 4221 3756 2213 1654 1403 1162 933 117 11007 14526 --
NM_014426chr202664 224 ------
NM_014431chr1061364 462 436 388 364 195 --11582 --
NM_014450chr91203 1336 ----
NM_014456chr102318 222 ------
NM_014462chr81218 ------
NM_014470chr121636 ------
NM_014488chr113621 196 110 ------
NM_014491chr71954 ------
NM_014494chr1632006 1857 336 12057 ----
NM_014501chr19149 --139 --
NM_014515chr1211077 ------
NM_014517chr311587 1166 ----
NM_014550chr225679 589 529 201 97 2541 135 ----
NM_014554chr1262297 2144 1825 549 230 111 11611 ----
NM_014564chr97866 846 667 256 182 152 46 2712 698 ----
NM_014571chr1102677 2482 2295 2063 930 866 647 586 534 141 32889 1080 672 21975 290 --
NM_014574chr1411262 ------
NM_014591chr1051279 355 301 264 232 31124 1072 391 173 11202
NM_014592chr52742 290 1264 ----
NM_014593chr181209 ----122
NM_014604chr175815 164 154 38 24 ------
NM_014612chr941387 1180 1147 994 --1138 --
NM_014613chr562643 2464 2370 2070 1994 23 22313 708 1252 --
NM_014614chr211439 ------
NM_014616chr362947 2445 2385 273 184 172 22588 512 ----
NM_014620chr123700 217 193 3611 130 49 ----
NM_014622chr112956 859 ------
NM_014630chr15113907 3459 3294 3067 1471 929 842 640 627 527 473 43205 2910 558 385 2849 705 11250
NM_014632chr11378 62 27 170 ----
NM_014634chr22113289 3198 2780 2689 2560 2449 2411 1232 1111 449 28 33093 1445 56 ----
NM_014636chr9174152 3457 3385 3274 3134 2871 1403 1367 1359 1218 1017 884 872 841 779 667 260 --22710 978 --
NM_014637chr8295 27 ----11340
NM_014640chr2--1115 197 --
NM_014641chr62628 23 ------
NM_014646chr18102863 2830 2801 2574 2493 2361 2219 2116 562 39 1650 2861 240 --
NM_014657chr201324 1284 135 --
NM_014659chr151848 1335 1126 --
NM_014660chr72368 49 ------
NM_014661chr1093838 2448 1272 1187 1008 822 752 605 427 52384 1553 1256 1206 205 13537 --
NM_014663chr131059 728 384 1973 ----
NM_014665chr8133527 3294 2943 2679 2561 2310 1218 1161 660 586 365 350 73 22374 2287 ----
NM_014666chr52822 88 ------
NM_014667chr352279 2109 1740 1675 275 ------
NM_014676chr131410 1381 129 31385 451 25 ----
NM_014677chr841110 1037 1029 499 ------
NM_014683chr1741897 1886 693 205 ----21483 419
NM_014686chr1932177 811 413 1100 ----
NM_014689chr22150 27 ------
NM_014690chr7112756 2744 2097 1135 1122 954 840 723 473 133 68 32118 1067 945 12738 --
NM_014701chr1553121 2267 2215 1210 374 13247 ----
NM_014702chr623292 2284 13109 ----
NM_014705chr72641 256 ------
NM_014707chr742263 2210 482 471 ------
NM_014709chr2--135 ----
NM_014715chr113177 157 102 ----1883
NM_014726chr1751379 1151 905 284 39 --41248 976 392 273 --
NM_014729chr811691 ------
NM_014730chr12155058 4607 4538 3845 3741 3679 3649 3535 3444 3325 1484 1304 984 925 211 1819 35221 4961 4761 --
NM_014730chr12155058 4607 4538 3845 3741 3679 3649 3535 3444 3325 1484 1304 984 925 211 1819 35221 4961 4761 --
NM_014731chr20101533 1500 1442 1429 572 499 482 290 147 66 11238 1476 11609
NM_014732chr16245250 5034 4684 4523 4260 4161 3845 2312 2072 1920 1639 1455 1362 1348 1339 1320 1127 1069 1043 892 838 785 173 120 75516 4202 2343 1978 1093 492 166 35044 1847 1764 --
NM_014733chr52869 319 ------
NM_014735chrX62124 2039 1537 1451 1416 456 11811 --1576
NM_014740chr17150 ------
NM_014741chr1182087 2029 1779 620 529 504 366 31 11991 12105 21366 86
NM_014742chr20121448 1376 1280 1264 1253 1118 586 569 471 258 113 91 11454 1561 --
NM_014746chr274363 3335 3096 1668 890 818 28 23049 79 13976 12873
NM_014747chr1145506 5144 5124 5028 4931 4440 3967 3770 3684 3647 2184 2106 719 238 65387 4864 4121 1469 932 777 65541 5416 4609 1592 1216 98 13990
NM_014751chr812149 11428 12090 --
NM_014754chr83948 937 711 ------
NM_014755chr273491 3440 3402 2681 1528 1003 86 --23450 496 --
NM_014759chr8101063 1009 612 521 473 358 263 136 130 105 ------
NM_014761chr1641029 305 158 137 --1434 --
NM_014766chr773781 3524 2969 2747 1382 174 22 1401 1575 11276
NM_014767chr10183196 2843 2711 2698 2252 1360 1184 1175 1165 1069 1054 1042 1027 492 486 475 447 289 53574 3068 2536 1334 1084 1425 --
NM_014770chr1251097 989 947 222 180 11152 41039 962 496 91 --
NM_014772chr1893579 2736 2672 2634 2617 823 286 269 169 23357 608 1350 --
NM_014774chr193025 2881 2824 2521 2316 2201 2175 1314 66 22800 729 22867 1033 1594
NM_014776chr12103049 2716 2618 2426 2151 2145 1216 1060 314 23 1771 12640 1927
NM_014783chr1511101 ------
NM_014784chr15807 738 433 392 204 --294 38 --
NM_014786chr1151115 989 941 261 59 2992 854 1971 --
NM_014787chr122418 2049 --1732 --
NM_014798chr1731640 726 110 21797 617 31399 1287 204 --
NM_014800chr77467 404 322 293 163 140 25 1129 ----
NM_014802chr121833 ----1217
NM_014803chr105873 796 395 355 183 ------
NM_014806chr93379 121 67 1167 ----
NM_014807chr114782 627 601 54 1611 3617 338 65 --
NM_014810chr1102816 2585 1415 1269 751 689 638 451 301 262 --1740 --
NM_014812chr151754 1326 364 282 117 1290 ----
NM_014819chr52757 478 ------
NM_014820chr351908 1834 595 514 47 ----11579
NM_014824chr111500 --31902 1396 153 --
NM_014826chr1104190 3458 2821 1562 1376 1102 1008 1001 273 73 156 124 14331
NM_014827chr141472 1428 316 129 --1251 --
NM_014830chr12113750 3426 3262 2802 2594 2578 1415 658 312 300 75 31003 737 500 13666 --
NM_014838chr2252666 2426 854 715 700 12471 1163 --
NM_014839chr142160 1937 1769 1694 ------
NM_014840chr1292739 2617 2291 2117 1311 869 832 411 80 ------
NM_014841chr61195 ------
NM_014847chr11551 ------
NM_014848chr1542810 2430 206 131 --11838 --
NM_014849chr161143 1105 912 356 65 54 41264 991 894 475 11185 --
NM_014850chr3154467 4436 4301 4163 3480 1865 1614 1568 1479 1444 1344 1321 877 812 319 34045 1333 708 1197 1769
NM_014859chr1731470 1290 466 1470 1298 --
NM_014868chr123869 680 319 1792 ----
NM_014870chr1154616 4176 4031 3371 3270 3168 2990 1836 855 804 561 519 497 232 80 --21314 638 --
NM_014871chr12130 ------
NM_014872chr972079 2041 1976 1934 1795 385 206 ------
NM_014873chr163553 3050 1424 1128 1075 141 --31606 593 370 --
NM_014874chr151892 1752 1681 732 574 --11321 --
NM_014876chr224525 237 35 21 2120 38 11935 --
NM_014877chr1767005 6915 5597 2787 1129 903 --35582 2174 1606 11167
NM_014883chr41115 1576 ----
NM_014888chr71501 11502 ----
NM_014890chr3----170 --
NM_014891chr761554 615 537 462 137 54 21113 103 1529 --
NM_014897chr1732685 2294 99 1341 --13154
NM_014901chr5101573 1407 748 713 495 284 263 199 171 101 1325 11582 11619
NM_014902chr20101557 1530 1509 1369 1150 1132 574 528 408 170 1472 ----
NM_014905chr232031 684 195 1672 ----
NM_014906chr1752875 2731 1415 292 254 3491 453 307 ----
NM_014909chr1463897 3357 3219 2974 694 365 33831 3198 3089 33226 2768 2673 --
NM_014912chr1022851 424 --12442 1537
NM_014914chr25501 407 299 124 99 --11165 1176
NM_014917chr111005 ------
NM_014918chr1531302 283 129 1532 ----
NM_014920chr642690 2538 1495 692 155 13735 --
NM_014921chr19172959 2935 2842 2752 2741 2283 2017 1997 1228 875 868 702 686 657 619 434 320 2148 124 1331 11246
NM_014923chr1342273 1590 692 242 1475 ----
NM_014924chr1432624 2086 309 23116 2163 ----
NM_014925chr123222 199 172 ------
NM_014926chr32745 70 1181 --1767
NM_014934chr1343639 3373 2940 2551 23321 3231 1630 --
NM_014938chr1282309 1850 800 719 401 252 108 83 1501 42014 1944 208 45 --
NM_014939chr1831224 372 112 1614 ----
NM_014944chr151415 1067 959 316 223 --21114 118 --
NM_014945chr591897 1485 1287 1239 719 689 617 347 80 1600 21279 642 --
NM_014946chr212019 11026 ----
NM_014948chr20112457 2347 1644 1621 986 907 735 542 291 118 76 22233 1981 ----
NM_014949chr12671 136 ------
NM_014950chr1441779 1467 1218 598 ------
NM_014961chr41754 1733 31369 824 496 --
NM_014966chr3168 ------
NM_014969chr121204 737 1122 ----
NM_014974chr1031413 1368 1310 ------
NM_014977chr143425 407 119 2212 175 ----
NM_014978chr1031391 245 117 21394 120 --1342
NM_014982chr1451926 1413 1138 660 172 2161 39 31447 1107 149 --
NM_014988chr442067 1135 1065 964 ------
NM_014989chr621358 565 ------
NM_014990chr144427 236 107 95 ------
NM_014991chr422083 816 --143 1536
NM_014994chr15122211 1952 1526 1472 773 633 453 324 223 208 146 58 42284 1529 472 68 32118 1962 886 1672
NM_014996chr321003 910 ----1272
NM_014997chr751938 1856 597 246 52 ------
NM_014999chr12--11578 ----
NM_015000chr1252379 1911 338 261 92 22264 2124 ----
NM_015008chr352779 1320 1049 962 703 22765 591 1416 --
NM_015009chr32262 189 ------
NM_015017chr12444 342 ------
NM_015020chr1633094 603 354 --22366 1160 --
NM_015023chr1151693 1638 1449 1429 1250 1231 1211 1190 1138 1130 660 612 508 101 27 31274 1244 1153 31461 307 241 --
NM_015024chr841378 1130 297 265 ------
NM_015025chr242047 1009 915 775 ------
NM_015026chr1234470 3638 394 ------
NM_015027chr1651504 1364 778 672 298 ------
NM_015032chr132556 546 ------
NM_015033chr9122091 1325 1290 1179 893 860 580 507 348 295 252 117 --22423 102 --
NM_015037chr101263 159 ----
NM_015039chr1113308 3102 1525 1497 1386 1297 591 393 88 71 34 24115 3702 ----
NM_015042chr15194124 4047 3893 3848 3773 3445 3280 3257 3241 3110 2838 2671 1743 1493 1024 854 839 193 146 33664 3100 2831 21481 868 1453
NM_015044chr1683202 2860 2281 2236 2008 771 682 135 --12736 123
NM_015045chr1021525 290 ------
NM_015050chr66957 950 437 143 89 23 ----11121
NM_015051chr942980 2811 961 785 ------
NM_015052chr751050 924 493 200 65 --149 11381
NM_015053chr1102236 2147 2003 1988 1936 1863 709 153 79 49 --2310 64 --
NM_015056chr2172396 2124 674 657 638 286 158 1937 ----
NM_015063chr19111233 1224 497 386 295 269 196 188 137 126 104 1878 11342 --
NM_015064chr1263274 3019 2731 2700 2318 52 1701 23120 2251 11408
NM_015068chr7143897 3873 3857 3845 3762 3604 3190 1429 1316 1170 665 569 558 123 11105 23904 1524 1901
NM_015069chr161411 --125 --
NM_015071chr5146506 5546 5057 4628 4100 3997 2289 1954 1552 1140 1106 957 794 657 14324 1675 1472
NM_015074chr193716 3208 3127 1676 1453 590 563 389 123 34590 3422 862 11925 158
NM_015075chrX112093 2047 1986 1621 1573 1446 594 384 353 180 139 32074 1730 822 3841 805 792 191
NM_015076chr644320 4060 3083 1245 11383 21813 211 13207
NM_015077chr17164592 3697 3689 3543 3338 3131 3114 2886 2874 1685 1613 1455 652 498 327 127 1829 34379 3060 3048 --
NM_015079chr15112776 2609 2547 2471 2436 2402 2349 2312 883 614 233 --22266 726 --
NM_015080chr115402 171 96 70 35 2623 226 ----
NM_015082chr572106 1991 1920 1659 486 437 329 12608 11799 --
NM_015085chr17184070 3816 3792 3765 3638 3188 2998 1487 1394 1378 1341 1220 1121 1078 1018 648 214 41 23798 1106 13630 --
NM_015087chr1322247 433 ------
NM_015090chr1225926 5754 5741 5710 5663 5652 5185 5092 4720 4256 4217 2467 2083 1741 1644 1127 742 612 550 388 260 174 45178 964 751 191 16016 --
NM_015092chr1684433 4321 3284 2907 2894 2840 992 680 --1656 --
NM_015094chr22194504 4469 4332 4323 4297 4150 4095 3476 3255 3168 2997 1511 1373 1165 1119 798 730 676 122 11641 62884 1870 1633 779 551 481 --
NM_015097chr362213 1938 1520 1477 698 688 ------
NM_015099chr176463 291 276 179 135 85 --1167 --
NM_015100chr161644 1351 799 750 631 365 --1828 --
NM_015107chrX72158 1885 1658 529 174 161 72 --31825 150 29 123
NM_015113chr1791830 1598 911 626 583 495 457 333 83 ----11686
NM_015115chr452899 2567 2372 2341 716 1868 ----
NM_015116chr1341684 661 297 96 1200 ----
NM_015125chr199519 459 225 213 168 152 136 106 81 2452 41 ----
NM_015133chr1671352 1176 1140 409 356 140 96 11429 --1110
NM_015134chr171577 ----1472
NM_015138chr1562595 502 479 389 356 200 22785 2585 12110 --
NM_015144chr1642543 660 416 407 --2870 552 --
NM_015150chr31107 --2288 126 --
NM_015155chr1053229 979 913 800 160 ------
NM_015156chr1463302 3050 2698 639 629 283 ------
NM_015157chr1141002 773 322 179 11074 1338 --
NM_015161chr1621342 1125 1112 ----
NM_015163chr1411460 --2507 179 --
NM_015171chr162146 100 ------
NM_015172chr131292 1087 593 ------
NM_015176chr111211 ------
NM_015178chr872664 1891 1867 977 723 608 409 2819 716 2949 57 --
NM_015185chrX92895 2746 2389 2326 2189 559 517 313 118 32472 2315 2179 12210 --
NM_015191chr1142730 2144 242 99 --22356 667 --
NM_015192chr2022713 106 1456 ----
NM_015194chr1772075 1671 1544 1472 238 129 109 21849 559 1421 --
NM_015199chr332195 2070 2048 --21829 943 --
NM_015200chr452371 2293 1791 797 239 21864 713 ----
NM_015205chr13134124 4082 3974 3893 1283 1275 1251 1222 1193 1143 1087 661 38 21260 1165 ----
NM_015206chr1533883 3254 2776 33091 2655 873 ----
NM_015209chr192130 1746 1485 540 493 475 379 372 200 --1180 --
NM_015215chr11782 --22932 139 --
NM_015227chr2173103 1313 1072 881 171 130 62 23082 2690 12738 --
NM_015236chr421275 93 2986 234 ----
NM_015245chr682331 2255 2114 2041 1006 764 328 129 ----11843
NM_015250chr931688 1494 51 --1248 --
NM_015251chr1652272 749 625 546 513 12203 ----
NM_015252chr25596 325 157 147 127 ------
NM_015254chr862767 2493 2470 848 94 43 3924 725 216 2932 633 --
NM_015263chr151399 ------
NM_015264chr22144558 4372 4308 4300 4215 4156 3590 3329 3154 1943 1505 1499 1485 193 --14332 --
NM_015265chr231938 1852 155 ------
NM_015267chr123597 327 223 166 21342 239 --
NM_015270chr12102219 2048 1878 1866 1642 658 533 396 387 244 11871 31668 1481 348 --
NM_015271chr423383 2948 11012 1664 --
NM_015272chr1631793 401 187 --21984 1725 2210 34
NM_015282chr253049 2697 2352 452 140 3936 75 52 11962 --
NM_015288chr593693 2802 2751 2352 1281 1164 658 640 252 23395 2840 43869 1098 991 706 --
NM_015292chr122269 213 1114 --1283
NM_015293chr61129 ------
NM_015296chr13--146 ----
NM_015299chr14143783 3715 3593 3289 3270 3209 2828 1594 1520 1387 969 820 372 76 33919 3402 3245 13960 --
NM_015305chr1471408 1330 1290 292 265 122 111 ------
NM_015310chr896755 6297 6224 5472 3345 2487 1718 1447 270 26259 1946 37153 2728 1760 --
NM_015313chr1144094 2977 1439 706 33348 233 219 ----
NM_015315chr5223166 2942 2877 2849 2711 2680 2361 2347 2165 1244 1119 865 664 651 639 571 512 489 386 204 197 173 33174 1334 405 12664 11234
NM_015326chr162203 2093 2074 781 540 177 22690 334 --22537 1130
NM_015327chr171252 1123 963 865 517 369 245 21130 487 1478 --
NM_015328chr7122750 2696 2686 2529 2484 2331 2294 2287 1219 813 615 418 --12187 --
NM_015332chr7113425 3351 3095 2964 2947 999 518 510 503 107 63 1557 ----
NM_015335chr1231970 722 184 11004 ----
NM_015336chr1232155 1748 1632 ------
NM_015338chr2061854 1545 1513 1264 477 401 --1169 --
NM_015339chr201302 ------
NM_015344chr81129 ------
NM_015346chr1451629 1431 464 439 74 ----11325
NM_015347chr1232138 2065 761 1554 1932 --
NM_015349chr662513 2463 2149 1955 1137 1010 1551 22249 997 --
NM_015355chr1721878 1835 ------
NM_015356chr8160 ------
NM_015359chr872615 2467 2063 894 820 740 309 1224 ----
NM_015361chr2299 45 ------
NM_015365chrX114026 3848 3668 3604 2964 2701 706 596 394 44 33 13261 14094 13155
NM_015381chr2272078 1931 1401 1361 1274 780 417 ------
NM_015385chr1052651 2296 1248 1188 267 ----1540
NM_015393chr453428 678 663 169 143 13502 13254 13536
NM_015397chr951509 781 334 264 197 ------
NM_015401chr126743 435 340 259 170 60 --1753 1716
NM_015429chr32897 742 ------
NM_015436chr462832 2618 2583 2537 2494 1081 ----12167
NM_015443chr1761309 1257 969 516 479 427 21021 326 11027 --
NM_015447chr91618 --1176 --
NM_015455chr533334 2591 402 ------
NM_015457chr1181052 973 838 798 241 231 208 88 175 --11001
NM_015460chr341584 1542 1509 1439 22086 570 ----
NM_015461chr18----1186 --
NM_015464chr72378 361 ------
NM_015470chr281052 971 935 780 428 122 114 57 31123 1096 420 1950 1255
NM_015472chr31123 ------
NM_015472chr31123 ------
NM_015477chr152987 113 ------
NM_015481chr12101086 1077 1014 879 810 312 285 269 227 77 --1928 1970
NM_015488chr2151686 1614 1596 1588 1569 1515 1371 1332 1310 1202 1181 551 404 308 292 41558 1350 685 440 11153 --
NM_015493chr1942067 2044 139 61 ----1485
NM_015503chr162538 464 128 ----
NM_015508chr331487 1152 978 ------
NM_015511chr2051101 984 749 61 33 ------
NM_015520chr31442 --11714 --
NM_015526chr1981468 1435 1135 933 908 568 311 117 31438 485 393 --3582 536 254
NM_015527chr169697 618 596 309 262 251 152 135 35 2200 44 1705 --
NM_015534chr11887 ------
NM_015535chr263900 3647 3518 1463 1099 123 ------
NM_015537chr951043 916 716 466 42 --1296 --
NM_015548chr63333 305 26 ------
NM_015550chr773563 3079 2729 2636 2438 1009 844 13604 33550 1135 376 --
NM_015553chr6114241 4115 3606 3584 3408 3283 3148 1985 816 726 23 24631 175 15020 --
NM_015554chr1532765 954 749 ------
NM_015557chr193323 3070 3033 2858 1302 1043 658 552 269 12630 23428 1182 13296
NM_015565chr2131496 295 26 ----12239
NM_015567chr1361214 520 506 418 395 385 --1407 --
NM_015570chr7176 --1116 1599
NM_015571chr652342 1824 1786 1029 415 ------
NM_015575chr2103364 3147 3133 2698 2498 2421 2323 1373 1281 854 --128 1626
NM_015576chr332308 681 620 ------
NM_015578chr1922097 2086 ----11845
NM_015589chr141125 ------
NM_015605chr1021001 455 286 53 ----
NM_015607chr11191 ------
NM_015609chr1162879 2835 2786 2647 2457 2444 2416 2102 1884 955 869 829 735 194 185 136 ----1882
NM_015626chr173961 910 282 ------
NM_015634chr101400 ------
NM_015635chr91880 --21829 373 --
NM_015642chr31226 --1309 --
NM_015645chr112333 35 ------
NM_015649chr196374 286 119 98 73 36 ------
NM_015652chr104625 593 486 457 1631 ----
NM_015657chr21665 ------
NM_015660chr7--1222 ----
NM_015670chr17284 57 ------
NM_015678chr131545 ------
NM_015680chr25617 575 463 270 170 ------
NM_015686chrX142503 2421 2377 2242 2115 2084 2066 1997 1874 1809 458 444 309 78 12094 22231 243 --
NM_015687chr61519 ------
NM_015695chr671803 1726 802 703 620 487 72 3664 222 105 ----
NM_015711chr194686 655 292 31 --2668 611 --
NM_015713chr831367 855 299 13207 ----
NM_015716chr1712708 651 606 583 513 284 276 249 150 143 84 74 1719 1692 --
NM_015719chr192576 248 1204 1281 --
NM_015723chr72646 237 ------
NM_015726chr171697 1422 1364 743 548 247 61 --11136 --
NM_015831chr77936 915 595 364 354 102 35 1109 1166 --
NM_015844chr181209 ------
NM_015846chr181209 ------
NM_015847chr181209 ------
NM_015850chr871611 474 390 245 184 95 61 21822 877 2269 171 11961
NM_015855chr113822 200 141 ------
NM_015864chr6--148 --139
NM_015866chr141413 975 516 271 ------
NM_015872chr1181772 1761 1705 1502 1459 1415 1409 1390 1331 1157 732 718 662 588 428 388 380 128 --21354 445 --
NM_015878chr81531 ----1237
NM_015879chr18158271 7427 7016 6610 5946 5511 5219 3291 2722 1628 1394 1216 745 504 498 38549 6251 301 --26057 2494
NM_015881chr115958 557 355 244 122 ------
NM_015886chr845698 5253 1239 209 25162 1187 ----
NM_015895chr61245 ------
NM_015897chr192154 126 ------
NM_015898chr19182510 2310 2287 2252 2144 1925 1841 1743 1661 1596 1585 896 882 579 445 249 217 195 12270 22441 1863 1806
NM_015902chr81698 ------
NM_015904chr21282 --2249 233 --
NM_015906chr154805 4507 4199 3721 3661 44567 4513 3647 436 ----
NM_015911chr11188 1103 1607 1657
NM_015912chr852226 2187 1970 945 303 1532 ----
NM_015933chr3134 --159 --
NM_015949chr751004 287 279 211 79 ------
NM_015974chr131369 --128 --
NM_015981chr5172985 2795 2502 2374 2364 2350 2315 2086 1278 1192 1037 691 619 462 407 277 223 32972 2202 610 2582 420 1210
NM_015982chr173361 299 95 ------
NM_015986chr171519 --1287 --
NM_015993chr165646 544 221 127 23 1236 1323 --
NM_015995chr15145021 4565 4389 3890 3594 2220 2067 1495 1234 699 579 492 245 37 24430 986 45212 1440 1253 290 --
NM_015999chr12296 110 2253 230 ----
NM_016006chr31265 ------
NM_016009chr174534 4263 4246 3310 1582 1166 454 11741 ----
NM_016019chr73982 770 401 ------
NM_016021chr632324 1896 1863 11908 12386 2452 108
NM_016022chr14732 413 317 251 1745 1872 --
NM_016025chr16194 --1747 --
NM_016032chrX81138 1105 1001 425 302 293 283 213 1929 ----
NM_016037chr12302 165 ------
NM_016038chr7123 ------
NM_016041chr171257 ------
NM_016045chr2021793 262 ------
NM_016063chr63769 564 26 ------
NM_016072chr1232111 1878 1638 12329 --12429
NM_016073chr152422 151 ------
NM_016076chr152538 2517 1231 598 318 ------
NM_016083chr623047 2954 --11276 --
NM_016096chr851935 1775 1343 426 146 --1577 --
NM_016098chr61347 ------
NM_016099chr83932 174 79 140 ----
NM_016107chr5----1453 --
NM_016120chrX--11223 ----
NM_016129chr42323 105 ------
NM_016131chr242254 1880 1703 797 1953 ----
NM_016132chr1523075 516 21274 576 ----
NM_016141chr31760 ------
NM_016147chr1161103 1073 848 316 238 84 124 ----
NM_016151chr166361 347 320 147 139 89 1165 ----
NM_016152chr31308 ----1162
NM_016169chr10153266 3258 2958 2540 2502 2479 2469 2391 2210 1291 1196 1164 1067 453 320 11214 33094 2598 1172 --
NM_016201chr372277 2168 2005 1509 718 327 41 1775 ----
NM_016206chr378560 7506 7279 3362 3348 2592 1129 ------
NM_016221chr532324 2292 196 2493 226 1830 --
NM_016224chr651348 676 636 583 476 11989 ----
NM_016231chr1711222 ------
NM_016252chr2----1883 --
NM_016255chr633063 596 66 12911 ----
NM_016257chr182803 2243 801 465 445 147 139 106 12682 166 --
NM_016258chr1----1216 --
NM_016260chr2106593 6257 5640 5556 2947 2026 1477 1033 524 26 35614 1496 1172 25668 1370 --
NM_016269chr43960 482 64 1326 1204 --
NM_016271chr1832120 1468 254 ------
NM_016272chr22112429 1954 1942 1852 1737 886 784 715 677 374 354 21863 774 22452 2034 1195
NM_016277chr631524 203 173 11565 11412 --
NM_016279chr51404 ------
NM_016281chr124981 905 884 181 ------
NM_016287chr151925 1859 1715 1608 599 ------
NM_016289chr242235 1561 400 134 ------
NM_016293chr121100 --122 --
NM_016308chr11270 --2325 69 --
NM_016319chr122558 86 ----1120
NM_016320chr114395 367 317 119 --1853 --
NM_016322chr972800 2313 2291 1228 795 245 41 124 1855 --
NM_016329chr32363 338 ------
NM_016337chr141176 ------
NM_016338chr521168 29 1228 1852 --
NM_016339chr17151755 1719 1605 1591 1565 1548 1444 1264 1159 655 605 590 229 179 142 --31633 1247 339 --
NM_016340chr51128 ------
NM_016357chr122932 901 ------
NM_016364chr103149 30 23 ------
NM_016373chr165767 616 347 90 76 152 ----
NM_016374chr1--1642 ----
NM_016374chr1--1642 ----
NM_016376chr1774217 4196 3963 3715 3635 866 326 1402 44404 3012 558 277 14206
NM_016396chr1552615 2528 2060 1025 49 12618 ----
NM_016399chr121337 1147 ----
NM_016410chr9--1560 ----
NM_016418chr22133685 3622 3535 3235 2669 2400 1296 1178 1123 1041 791 344 213 ------
NM_016422chr1152196 1214 1054 510 147 ------
NM_016423chr141414 --1356 --
NM_016424chr1721309 722 ------
NM_016448chr151849 1698 1301 1264 438 ------
NM_016451chr111242 ------
NM_016456chr13766 677 85 1647 ----
NM_016463chr5128 ------
NM_016485chr621825 285 22249 458 1782 --
NM_016486chr12409 35 ------
NM_016489chr7----2178 26 1193
NM_016492chr17----1124 --
NM_016506chr113128 42 34 ------
NM_016507chr1742287 2272 681 556 12342 ----
NM_016513chr642690 2538 1495 692 155 13735 --
NM_016519chr42441 165 --192 --
NM_016522chr1141672 1543 334 301 ------
NM_016526chr11152385 2274 2146 2136 1795 1770 1568 777 697 658 523 408 400 264 140 ----11926
NM_016531chr464094 3849 516 463 414 184 11592 1258 --
NM_016532chr1731058 838 297 --1129 --
NM_016542chrX3686 634 268 ------
NM_016544chr2113786 2777 1492 1442 1252 1220 1170 1162 1033 429 352 23804 2856 --11104
NM_016548chr921339 632 ------
NM_016559chr331125 329 31 ------
NM_016569chr1251540 1127 167 141 101 1347 ----
NM_016571chr6122 ------
NM_016574chr1191127 1051 935 921 756 708 262 108 67 1155 ----
NM_016577chr3154393 4229 4213 4146 4072 3741 3164 2963 2771 2763 1772 1496 428 395 35 24384 4373 1697 --
NM_016582chr112128 23 ------
NM_016588chr61730 ------
NM_016592chr2031237 1210 336 21326 1246 ----
NM_016596chr126743 435 340 259 170 60 --1753 1716
NM_016603chr51221 1176 ----
NM_016604chr54838 461 235 24 197 1984 --
NM_016605chr5122537 2495 2349 1880 1744 1682 949 927 911 720 332 260 32579 936 396 1231 --
NM_016607chrX41601 485 388 297 ------
NM_016621chr11224289 4275 4233 4159 4116 4056 4042 4035 3839 3757 3746 3620 3459 3384 3139 3131 3003 1684 888 767 695 598 34649 3038 1541 34348 4319 1531 --
NM_016623chr81133 ------
NM_016626chr181689 ------
NM_016628chr102626 184 ------
NM_016639chr162137 100 ------
NM_016641chr1661559 1549 1474 1324 245 70 ----11332
NM_016651chr1421037 817 ------
NM_016654chr1531320 432 416 --21283 1222 --
NM_016733chr223502 258 50 ----1993
NM_016818chr212195 117 ------
NM_016823chr171927 ------
NM_016824chr1021851 1367 1655 ----
NM_016830chr125456 205 73 63 44 ------
NM_016834chr17143706 3688 3573 3457 3074 1527 1423 1146 909 871 630 398 319 106 43781 3214 2952 1351 23203 1247 23719 1204
NM_016835chr17143706 3688 3573 3457 3074 1527 1423 1146 909 871 630 398 319 106 43781 3214 2952 1351 23203 1247 23719 1204
NM_016836chr21189 ------
NM_016839chr21189 ------
NM_016841chr17143706 3688 3573 3457 3074 1527 1423 1146 909 871 630 398 319 106 43781 3214 2952 1351 23203 1247 23719 1204
NM_016929chr693995 3275 1652 1567 1516 1450 383 369 178 23974 188 176 --
NM_016936chr1641817 1607 1514 575 ------
NM_016946chr1103469 3328 2724 2322 2315 1308 975 292 187 66 --2946 552 --
NM_016952chr11103752 3603 3504 2907 2793 2707 1584 1397 650 215 1315 13637 14090
NM_017409chr124515 49 40 25 --1596 --
NM_017410chr1261111 1097 785 488 478 281 21068 897 1288 1955
NM_017412chr811049 11405 ----
NM_017413chrX132292 2045 1818 1679 970 834 677 415 394 296 280 236 52 ----1441
NM_017415chr584251 4220 4069 3623 1704 1252 1063 128 24226 3956 1439 13153
NM_017420chr1462840 2789 2764 2440 497 22 ------
NM_017439chr7161 ------
NM_017444chr861409 1368 1350 1264 713 219 ------
NM_017447chr2163948 1115 791 640 378 322 13984 ----
NM_017449chr191681 1561 1450 1403 1154 468 368 46 25 --1539 --
NM_017455chr153144 91 75 ------
NM_017456chr1771571 1481 1384 1232 592 328 233 11237 ----
NM_017457chr192113 61 1122 ----
NM_017488chr281480 1273 378 369 359 349 292 194 31433 1307 263 21069 489 --
NM_017490chr112243 187 ------
NM_017514chrX3890 841 749 2597 162 2694 299 --
NM_017519chr61115 ----1450
NM_017522chr12990 481 11239 ----
NM_017540chr572382 2052 1289 300 245 173 79 11237 ----
NM_017544chrX1866 1230 ----
NM_017548chr321533 547 --123 --
NM_017549chr741213 1143 554 457 --1936 --
NM_017551chr1022500 360 1473 ----
NM_017553chr151302 ----1275
NM_017558chr162393 369 ------
NM_017559chr171239 1273 --126
NM_017563chr3106088 5395 4968 1966 1422 1378 1008 726 160 47 --25174 1178 --
NM_017575chr1771522 1190 640 593 443 305 177 1167 1628 --
NM_017582chr151507 675 630 241 26 2643 101 11518 --
NM_017590chr2282347 2243 959 634 542 419 409 228 1832 1281 --
NM_017594chr963317 2790 2773 2313 523 236 ------
NM_017596chr1224589 4453 4350 4219 3690 3213 1742 1456 1364 1092 889 842 829 707 694 339 170 130 112 56 42 26 31301 763 745 44422 959 751 496 --
NM_017599chr1221353 375 ------
NM_017602chrX7252 157 141 126 117 85 45 2381 133 ----
NM_017607chr191472 --2353 59 --
NM_017610chr15--133 ----
NM_017612chr122415 96 ------
NM_017626chr1071214 1146 1139 265 229 163 44 1371 --1397
NM_017628chr474554 3301 3259 1494 1336 1310 155 33615 1233 1009 11249 11271
NM_017633chr643725 3147 1483 206 --23734 3312 --
NM_017634chr821713 502 ------
NM_017635chr111480 1108 ----
NM_017637chr9169428 9027 8709 8243 8209 6373 6362 6302 6289 6273 6144 6015 5749 1989 1506 1323 78717 8319 8272 8189 7512 6610 2599 26719 270 18869
NM_017643chr1732656 2333 851 ----1493
NM_017644chr364886 4838 4586 3875 1098 665 1138 14900 --
NM_017650chr764259 4058 3736 931 70 52 ----11766
NM_017657chr22878 48 1360 ----
NM_017658chr1424511 3870 ------
NM_017661chr151806 ------
NM_017668chr167721 702 255 210 101 91 50 ------
NM_017672chr15168 ------
NM_017679chr173711 604 36 --1166 181
NM_017684chr153633 490 236 ------
NM_017686chr11854 --21140 120 --
NM_017694chr22830 376 145 ----
NM_017709chr153388 3277 2935 1583 1480 12881 --13291
NM_017714chr20----1933 1282
NM_017715chr71188 ----143
NM_017719chr342416 2080 2041 278 12503 --12221
NM_017724chr32834 664 --182 --
NM_017730chr31163 ----1198
NM_017737chr12349 196 ------
NM_017739chr12491 60 1516 ----
NM_017741chr42334 133 --1612 --
NM_017744chr182387 2028 1679 761 571 559 175 77 1990 11536 --
NM_017753chr92949 383 ------
NM_017758chr1781396 1377 1086 955 600 537 426 53 21381 434 ----
NM_017766chr14428 362 116 35 1487 ----
NM_017768chr1123 ------
NM_017772chr6131796 1614 1411 1364 1323 1186 1084 463 437 429 422 263 101 11669 ----
NM_017778chr841493 549 529 504 1516 ----
NM_017779chr122464 1855 ------
NM_017780chr81205 ------
NM_017787chr1062773 2036 1102 961 905 136 32443 2306 1802 ----
NM_017789chr21220 ------
NM_017790chr9143 ------
NM_017797chr194946 892 351 29 1991 --1248
NM_017811chr953082 2711 2503 2465 2147 32037 142 84 22898 232 --
NM_017824chr1032511 2309 878 ------
NM_017845chr41536 ------
NM_017848chrX134399 4179 4015 3183 1814 1531 957 541 520 502 491 280 149 1712 23074 3034 --
NM_017849chr2132873 2500 2356 2047 1256 943 933 898 607 217 167 55 34 61039 952 725 541 239 40 1465 --
NM_017873chr9123176 2870 2385 2076 1161 932 830 791 552 441 435 207 12674 1707 --
NM_017893chr1091475 1447 1243 1145 999 928 561 448 344 51309 241 223 174 90 21320 112 --
NM_017902chr10155245 5065 4771 4719 4616 4527 4450 4358 4198 1675 1412 1314 783 201 178 55114 4553 4181 1982 1545 45626 5389 4601 1423 24215 3554
NM_017907chr116363 355 333 322 60 31 ------
NM_017919chr9115147 4185 4115 3680 1818 1356 1115 863 850 741 624 --12049 --
NM_017921chr17102237 2055 1775 1636 1593 731 576 539 436 46 32122 582 247 1294 --
NM_017922chr141547 ------
NM_017933chr241485 504 484 279 ------
NM_017938chrX42216 549 419 285 ------
NM_017955chr1431113 843 255 --11044 11174
NM_017957chr1751591 1409 1348 1224 1089 --11152 --
NM_017964chr22676 38 ------
NM_017983chr17------1158
NM_017984chr7234 21 ------
NM_017988chr121245 --1218 --
NM_017994chr742920 2220 1992 799 21209 229 12872 --
NM_018010chr321612 371 --11142 --
NM_018026chr11151347 1338 1233 1093 1075 1025 975 570 411 228 221 199 188 166 27 51258 1135 1111 942 121 196 --
NM_018027chr10112789 2731 2248 2006 848 836 383 367 251 245 39 1165 ----
NM_018032chr163827 299 44 ------
NM_018036chr1444087 3726 3338 3056 --13258 --
NM_018046chr52113 26 --21731 1547 --
NM_018047chr51854 1254 ----
NM_018054chr16167 1529 ----
NM_018061chr1------196
NM_018064chr6--1310 192 --
NM_018067chr15426 223 125 109 42 1189 1359 --
NM_018070chr13527 435 131 1123 ----
NM_018071chr145783 718 658 340 109 2605 41 2666 258 --
NM_018072chr11181 ------
NM_018077chr7264 55 ------
NM_018084chr2----12027 23006 2459
NM_018085chr1147786 7371 6810 6656 5132 2548 2377 2109 1495 816 773 574 268 113 46734 5937 823 630 37763 2598 624 --
NM_018086chr241816 1584 1320 78 --11311 --
NM_018095chr113128 42 34 ------
NM_018099chr12146 ----137
NM_018105chr82236 52 ------
NM_018107chr147977 907 887 863 421 412 144 --1366 --
NM_018110chr1641191 941 874 127 1279 ----
NM_018111chr19156 ------
NM_018112chr91159 ------
NM_018114chr31199 1205 ----
NM_018116chr11465 ------
NM_018117chr101646 ------
NM_018121chr1032239 2033 450 22716 654 22427 301 --
NM_018128chr1721290 520 1990 ----
NM_018131chr10--1741 ----
NM_018133chr3127 1580 1677 --
NM_018137chr141273 488 361 117 31276 209 125 ----
NM_018150chr12651 572 ------
NM_018155chr343218 3009 1029 807 23045 2935 1237 --
NM_018172chr116584 532 480 428 376 199 21425 1263 11243 11283
NM_018181chr1821285 28 ------
NM_018182chr17112121 2065 1968 787 743 695 417 398 385 178 167 1802 21839 1781 --
NM_018184chr321906 157 ------
NM_018195chr1151779 1581 1433 173 55 21963 557 ----
NM_018199chr144977 909 267 63 1221 2825 788 --
NM_018200chr1552267 1829 495 380 112 11948 ----
NM_018201chr9152312 2205 2138 2037 2005 1723 1675 1577 1003 824 758 724 702 620 299 --22050 641 --
NM_018202chr12747 345 ------
NM_018206chr16271 25 ------
NM_018221chr2130 ------
NM_018222chr1161614 1327 447 271 246 62 --2529 194 --
NM_018225chr9145354 4809 4639 3406 1658 1345 1266 1204 1053 935 826 612 324 164 35360 4958 3610 21840 291 --
NM_018234chr291945 1932 1464 901 853 803 533 500 394 ------
NM_018237chr101204 ------
NM_018240chr14839 705 207 95 --1338 --
NM_018241chr42835 742 ------
NM_018244chr2091030 955 893 493 426 280 226 204 105 1964 ----
NM_018246chr822340 346 --22155 1773 --
NM_018247chr612036 --23087 2885 --
NM_018254chr152304 962 674 548 399 ------
NM_018263chr272476 2281 1801 1789 772 707 388 ----12116
NM_018275chr74410 359 62 23 1469 ----
NM_018287chr10----1534 --
NM_018293chr322672 467 ------
NM_018299chr852820 2615 2428 685 393 13154 12230 --
NM_018307chr171758 ------
NM_018313chr322466 1976 ------
NM_018314chr112662 512 ------
NM_018315chr4299 55 ------
NM_018317chr41123 ------
NM_018322chr641336 1186 544 32 11226 1928 --
NM_018327chr203314 89 51 ------
NM_018334chr72472 350 ------
NM_018340chr16105006 4730 4678 3983 3768 3276 974 819 686 79 ----14590
NM_018351chr1294333 4238 4130 3276 2979 1841 1214 1035 599 ----1122
NM_018353chr142872 849 ------
NM_018362chr1153499 2971 2757 2480 750 --13322 --
NM_018364chr122938 935 13074 ----
NM_018374chr731853 1420 641 11529 24516 3232 --
NM_018383chr242076 1445 722 30 ------
NM_018385chr341265 1129 1119 222 ------
NM_018388chrX11254 11509 ----
NM_018398chr31284 ----1246
NM_018400chr11154603 4579 4024 3930 3765 3141 3005 1221 1118 1079 649 361 269 202 177 64268 3998 3833 1824 826 114 12892 --
NM_018401chr461746 1648 490 204 95 63 1646 1640 --
NM_018403chr333713 3233 3067 13509 ----
NM_018409chr483174 2985 2926 2908 2392 2180 711 224 1726 12077 --
NM_018412chr7263 50 ------
NM_018416chr1272293 2226 2103 2045 957 171 83 52516 2502 2300 2001 1036 11660 --
NM_018424chr921865 614 1433 11923 --
NM_018440chr8137633 7286 7152 6497 5594 5472 2091 1912 1783 703 446 400 204 37110 5995 5274 --17917
NM_018444chr832238 1513 114 ------
NM_018445chr152581 44 ------
NM_018452chr6_random33828 1382 901 ------
NM_018457chr12--125 1518 --
NM_018462chr3--2594 314 --1616
NM_018464chr10175 ------
NM_018469chr1721248 351 --1359 --
NM_018477chr1411077 ------
NM_018488chr172519 53 1723 ----
NM_018489chr161558 1502 873 611 602 420 ----1702
NM_018490chr1111743 ------
NM_018553chr1771808 1567 1165 594 406 250 98 --1487 --
NM_018557chr221439 101 ------
NM_018566chr134280 3112 1391 14184 24326 1096 --
NM_018584chr141165 1149 837 202 ------
NM_018602chr1531282 426 216 1593 ----
NM_018638chr1235271 4740 646 ------
NM_018640chr1232660 2561 2538 ----1827
NM_018644chr11142092 1677 1644 1518 862 717 709 581 569 530 518 90 76 56 128 1732 --
NM_018649chr103497 476 157 1147 ----
NM_018650chr132268 1646 1386 ------
NM_018653chr173356 136 83 ------
NM_018667chr16122358 2147 2107 2001 1814 1063 978 787 735 329 68 53 12273 41886 1016 996 446 --
NM_018684chrX71029 969 490 403 253 227 85 --1135 143
NM_018686chr121327 ------
NM_018688chr84296 226 60 26 182 1754 --
NM_018695chr511811 ------
NM_018699chr4----1295 --
NM_018704chr121887 1762 11480 ----
NM_018710chr82877 288 ------
NM_018712chr11--2957 293 ----
NM_018713chr11187 1447 ----
NM_018715chr162089 1792 1491 572 516 322 --2349 34 --
NM_018717chr492394 1847 937 852 757 743 730 376 287 ------
NM_018718chr751964 759 233 156 52 3722 654 162 ----
NM_018841chr1103468 1257 1186 886 819 699 676 516 179 22 11521 13506 --
NM_018847chr931909 1342 398 156 ----
NM_018890chr7----1979 11397
NM_018896chr172119 57 ------
NM_018898chr521818 263 ------
NM_018899chr521818 263 ------
NM_018900chr521818 263 ------
NM_018901chr521818 263 ------
NM_018902chr521818 263 ------
NM_018903chr521818 263 ------
NM_018904chr521818 263 ------
NM_018905chr521818 263 ------
NM_018906chr521818 263 ------
NM_018907chr521818 263 ------
NM_018908chr521818 263 ------
NM_018909chr521818 263 ------
NM_018910chr521818 263 ------
NM_018911chr521818 263 ------
NM_018912chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018913chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018914chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018915chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018916chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018917chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018918chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018919chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018920chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018921chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018922chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018923chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018924chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018925chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018926chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018927chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018928chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018929chr5111649 1483 1412 1404 1250 529 482 473 357 133 37 1532 2314 172 --
NM_018948chr1187 ------
NM_018952chr172446 226 ------
NM_018970chr732770 2484 1022 ------
NM_018976chr1222106 1903 ------
NM_018977chrX5371 350 316 225 37 ------
NM_018991chr75638 621 608 580 187 ------
NM_018994chr12558 498 ------
NM_018999chr1043547 3022 1853 1582 1535 21107 998 --
NM_019000chr521320 134 ------
NM_019001chr354147 3002 1795 1717 1381 ------
NM_019004chr721831 216 ------
NM_019005chr7------128
NM_019008chr2273409 2976 2965 2742 2561 1184 389 11094 11508 --
NM_019022chr1842978 2064 376 148 22283 398 --11133
NM_019027chr42781 546 11800 ----
NM_019035chr431832 1401 685 ------
NM_019050chr42605 55 ------
NM_019057chr5176 ------
NM_019063chr221472 331 2906 478 ----
NM_019064chr172775 582 163 257 46 --
NM_019071chr72608 201 ----1277
NM_019072chr552746 1573 214 137 78 ------
NM_019080chr1311517 ------
NM_019087chr531676 1486 335 ------
NM_019096chr63906 416 402 ------
NM_019102chr7--1329 ----
NM_019102chr7--1329 ----
NM_019106chr2293185 3026 3011 2317 1381 1253 786 757 261 42321 2250 766 83 32960 2394 1303 1622
NM_019114chr972548 2108 1937 1781 1652 988 592 --1879 --
NM_019116chr1693486 3323 2922 2819 1233 934 769 646 74 42870 2601 2304 1369 --32724 1449 845
NM_019117chrX43264 3040 2926 1183 32300 1399 825 ----
NM_019555chr321162 539 ------
NM_019592chr95692 244 148 70 64 --1843 --
NM_019593chr2042865 2686 2126 2092 23135 2925 22730 2183 --
NM_019595chr2------1107
NM_019606chr72361 163 ------
NM_019624chr1210917 910 761 746 729 714 317 193 186 157 ------
NM_019625chr1210917 910 761 746 729 714 317 193 186 157 ------
NM_019842chr6176 ------
NM_019845chr22310 157 168 ----
NM_019850chr24315 209 173 138 2671 261 2618 537 --
NM_019854chr123648 302 189 1212 --1661
NM_019857chrX41700 1124 619 207 --21631 111 --
NM_019859chr1011114 11354 ----
NM_019860chr1011162 11402 ----
NM_019884chr194462 441 168 99 2496 154 121 --
NM_019885chr2202441 2344 2325 1994 1909 1822 1106 1041 1009 977 821 525 420 396 357 335 241 207 189 133 2828 553 ----
NM_019895chr31975 ----2397 73
NM_019903chr1021851 1367 1655 ----
NM_020039chr12101683 1665 1515 1430 1281 1221 704 366 255 162 3590 487 75 11707 --
NM_020063chr14204 72 43 30 ------
NM_020066chr12877 113 1870 ----
NM_020122chr265982 5610 5151 4603 1589 1411 24972 3971 11495 --
NM_020123chr1021471 1161 ------
NM_020131chr1111617 1487 1481 1371 1343 1287 1254 525 448 93 27 1107 --21298 157
NM_020134chr281165 1053 1031 1022 922 869 427 307 2999 313 --1439
NM_020137chrX127 ------
NM_020141chr11134 1334 1270 --
NM_020142chr126598 585 548 203 168 159 --2504 66 --
NM_020144chr742082 1624 789 171 1138 11615 --
NM_020147chr152371 194 --1786 --
NM_020150chr1021446 515 --1375 --
NM_020155chr11----190 --
NM_020168chr1561214 1145 882 520 191 86 4478 178 146 92 2234 216 --
NM_020177chr532374 2259 2169 ------
NM_020178chr17176 ------
NM_020179chr111355 ------
NM_020180chr1841357 1348 1181 978 --185 --
NM_020182chr2082776 2357 2350 2247 1451 1414 1236 120 42686 2606 1253 1059 ----
NM_020184chr2142067 2053 1977 1950 1914 1670 1632 1541 906 863 731 466 460 167 ------
NM_020193chr114969 559 444 62 ------
NM_020205chr153360 3196 2317 1077 525 --22886 1368 --
NM_020211chr15101374 1324 1301 1237 1008 989 349 255 244 39 1284 1157 21480 1261
NM_020226chr42717 166 ------
NM_020228chr1152199 1930 1914 1799 759 11805 ----
NM_020239chr1122144 1902 1724 1532 1429 728 448 373 187 173 164 72 1562 2111 84 --
NM_020248chr1122213 2156 2127 1930 1737 1689 1552 830 703 680 105 89 11718 ----
NM_020309chr196818 694 428 304 232 89 3935 895 170 1945 --
NM_020310chr17112264 2253 2180 2029 1942 937 923 836 785 715 284 11949 22473 1964 12332
NM_020336chr2073745 3554 2589 2550 1110 1044 209 1970 ----
NM_020337chr462991 2965 2453 933 905 786 11096 ----
NM_020338chr10133590 2447 2403 1396 1360 1176 1073 1029 608 560 430 330 233 1152 31333 1043 26 --
NM_020341chr202769 568 1253 ----
NM_020342chr2--11778 12631 --
NM_020344chr92120 43 ------
NM_020346chr1111635 --11436 --
NM_020348chr10112676 2652 2639 2240 1892 1711 1693 317 164 137 122 11024 12357 --
NM_020357chr311283 --11571 --
NM_020360chr177580 516 227 155 129 84 68 ------
NM_020364chrY11379 197 ----
NM_020381chr61753 ------
NM_020382chr1241463 1115 547 39 31299 1269 994 ----
NM_020383chr103108 81 66 ------
NM_020384chrX61523 1406 1222 490 393 308 41652 1637 1476 1225 41870 1840 1726 1715 --
NM_020390chr374261 1714 1218 1143 999 900 615 --11695 --
NM_020408chr63955 853 682 --1376 --
NM_020416chr482282 1940 990 979 601 309 157 22 ----1813
NM_020420chrY11379 197 ----
NM_020429chr792681 2477 2437 2291 2063 1114 847 608 436 --1193 --
NM_020431chr14162603 2401 2159 2085 2076 2063 1854 1827 1082 1068 675 630 619 425 400 302 22556 2354 22428 1060 --
NM_020432chr711444 ----22039 525
NM_020438chr981313 1006 897 886 507 477 254 95 2972 183 11163 --
NM_020440chr193187 3141 2918 2498 2127 994 778 637 108 12870 ----
NM_020441chr115263 220 213 43 31 ------
NM_020443chr1136976 6749 6732 6527 6361 5647 4310 2226 1685 1510 310 243 63 66848 6301 5569 4472 2120 434 45459 2570 485 454 --
NM_020444chr531278 948 54 ------
NM_020452chr161865 1441 1431 363 311 179 21469 457 ----
NM_020455chr652472 942 930 667 25 ------
NM_020456chr1332234 1853 1711 11876 ----
NM_020457chr162425 84 --2231 75 --
NM_020463chr221262 339 ------
NM_020473chrX3568 264 123 ------
NM_020474chr181107 ------
NM_020475chr8132213 2130 2104 2003 1704 1604 1596 859 547 526 120 108 95 22456 2167 ----
NM_020476chr8132213 2130 2104 2003 1704 1604 1596 859 547 526 120 108 95 22456 2167 ----
NM_020477chr8132213 2130 2104 2003 1704 1604 1596 859 547 526 120 108 95 22456 2167 ----
NM_020478chr8152276 2193 2167 2066 1767 1667 1659 922 610 589 183 171 158 61 31 22519 2230 ----
NM_020480chr8132213 2130 2104 2003 1704 1604 1596 859 547 526 120 108 95 22456 2167 ----
NM_020524chr16777 708 689 673 368 66 ------
NM_020525chr122143 37 ------
NM_020526chr181792 1555 1488 1438 1277 1187 690 566 51770 1748 1214 1196 115 1392 --
NM_020530chr222167 103 1361 1158 --
NM_020630chr102719 33 ------
NM_020631chr1111436 1353 1198 1076 1050 975 523 366 328 220 127 ------
NM_020638chr1241320 719 319 138 21642 265 21846 1763 137
NM_020651chr241258 1246 559 484 --11663 --
NM_020654chr31527 ------
NM_020663chr141614 ------
NM_020672chr12462 70 ------
NM_020673chr20106581 6189 5774 5597 5259 4774 2301 2053 1802 1104 22404 1373 11465 15557
NM_020676chr32838 138 ------
NM_020689chr204523 515 217 205 --21204 337 --
NM_020693chr111371 1378 ----
NM_020695chr199770 747 667 648 632 318 300 291 27 1778 1190 --
NM_020698chr1283021 2493 2308 2215 2186 2130 888 281 --12931 1758
NM_020699chr1135174 5004 4641 3840 3802 3275 2038 1563 1295 986 271 186 45 34127 1515 949 33768 3390 3372 --
NM_020702chr981874 1767 1328 643 575 367 258 101 11144 11209 --
NM_020706chr211146 ------
NM_020708chr20122545 2270 1868 1767 1665 892 785 721 475 398 363 221 3945 204 120 ----
NM_020713chr20222594 2420 2390 2374 2315 2262 1271 1174 1037 818 802 658 639 632 586 520 393 364 254 166 149 78 32172 768 259 1606 --
NM_020714chr1983366 3321 3259 1465 1144 1005 749 587 24307 4220 ----
NM_020717chrX103767 3512 3504 3492 3300 1881 1067 703 607 29 1574 21277 143 --
NM_020718chr1675681 5253 5104 2370 1770 1523 56 26162 1020 --12132
NM_020728chr732997 1120 46 166 ----
NM_020732chr61115 ----1450
NM_020734chr1253267 2123 251 157 30 ------
NM_020739chr1522933 1329 11147 ----
NM_020742chrX41968 1924 802 176 --128 --
NM_020748chr1711402 ------
NM_020749chr841486 1388 1302 464 ------
NM_020750chr641342 1281 294 77 ------
NM_020760chr221843 347 11337 ----
NM_020764chr1671212 1068 1044 1029 919 897 131 11280 ----
NM_020765chr13120 85 65 ------
NM_020766chrX74566 4237 3464 1409 1003 565 550 ------
NM_020769chrX4790 751 690 332 2765 725 --2147 111
NM_020772chr1798307 7519 6721 5982 5387 3448 2299 2287 1568 16729 38058 3083 490 12532
NM_020773chr4112583 2481 2377 2028 1741 1655 929 909 842 283 55 1984 ----
NM_020774chr1886179 5730 5146 2384 2318 2031 1449 912 25120 3989 ----
NM_020777chr491840 787 696 669 567 472 220 143 102 32224 2129 80 11771 --
NM_020778chr15164589 4414 4328 4297 3534 3230 3155 1792 1760 1743 1342 1116 1021 697 686 587 73538 3289 1666 994 821 735 648 31841 1214 131 24182 1502
NM_020779chr21243 23036 2312 --22579 2373
NM_020783chr1831823 1598 780 ------
NM_020791chr17--182 ----
NM_020792chr362005 1912 737 401 103 32 12133 ----
NM_020795chr17191989 1977 1970 1944 1809 1741 1700 1353 1337 1277 805 602 566 551 545 487 431 417 24 31321 1263 368 ----
NM_020796chr562830 2536 2000 717 654 138 ------
NM_020800chr33983 377 288 1975 11258 11129
NM_020801chr532326 2132 582 12052 ----
NM_020802chr1143389 2415 405 392 ------
NM_020805chr181114 ------
NM_020807chr1651561 1508 546 245 183 2293 79 11393 --
NM_020808chr13900 219 41 ------
NM_020809chr1142006 1796 1590 762 --175 --
NM_020810chr1463079 2777 2745 2571 354 103 13238 ----
NM_020813chr1962530 1162 865 852 442 330 21056 768 ----
NM_020821chr153633 490 236 ------
NM_020826chr1183356 2599 1128 1001 894 398 70 24 11305 ----
NM_020830chr212589 162 ----
NM_020834chr1431550 1325 291 --2459 352 --
NM_020841chr1231118 639 302 ------
NM_020843chr15133 ------
NM_020845chr1272387 2062 1848 1715 1686 876 384 22038 1879 12329 --
NM_020850chr16132933 2791 2769 2452 2144 2137 2049 884 736 728 618 516 136 22604 203 1116 --
NM_020856chr1961564 1217 982 475 372 71 ------
NM_020858chr1511506 ------
NM_020859chr463152 2562 2482 1049 725 169 21406 333 1216 --
NM_020861chr64152 129 121 53 ------
NM_020866chr131839 ------
NM_020870chr472195 2023 1587 1456 771 653 475 ------
NM_020872chr311297 ----1608
NM_020886chr1121035 512 11064 ----
NM_020888chr162007 1852 1738 1460 807 218 11406 1545 --
NM_020897chr131238 1184 966 --1914 --
NM_020898chr125791 739 638 306 176 1652 ----
NM_020899chr17132011 1702 1690 818 697 689 650 425 260 127 95 84 22 2208 98 12033 11616
NM_020918chr1032399 1177 148 1861 1811 22944 843
NM_020919chr22492 295 ------
NM_020920chr141387 --1267 --
NM_020921chr142947 153 --12694 13332
NM_020922chrX21897 672 1104 ----
NM_020924chr91185 ------
NM_020925chr1----11442 --
NM_020935chr234350 4328 4310 ------
NM_020946chr981500 1362 423 393 369 260 248 137 --2506 123 --
NM_020948chr153583 2979 2939 2710 509 ------
NM_020952chr9174 ------
NM_020956chr19144642 4616 4598 4376 4363 1586 1405 1024 842 754 664 572 379 78 44030 3733 982 903 ----
NM_020962chr15102278 1725 1719 927 879 742 710 653 640 563 --1779 --
NM_020964chr18124291 3595 3258 3101 3091 3062 1478 848 824 786 757 408 23066 1346 --13328
NM_020967chr2031055 445 48 133 ----
NM_020971chr199881 736 685 673 604 207 187 94 39 ------
NM_020974chr113497 485 411 ------
NM_020977chr41501 ------
NM_020983chr12102219 2048 1878 1866 1642 658 533 396 387 244 11871 31668 1481 348 --
NM_020987chr10--1926 ----
NM_020988chr1661099 885 875 861 362 123 ------
NM_020993chr12102751 2381 2128 1905 823 735 700 538 477 444 11837 12414 --
NM_021003chr141708 1592 ----
NM_021005chr153915 410 219 ------
NM_021007chr222015 158 ------
NM_021012chr1783073 2527 2464 2412 2219 2021 1131 581 11200 11097 --
NM_021020chr8203312 3284 3057 3037 3015 2978 2850 2768 2352 2178 1213 1035 954 690 676 378 358 317 311 162 21124 1074 2221 90 --
NM_021032chr331983 35 25 11723 ----
NM_021061chr883922 3874 1659 1324 1162 945 861 381 13004 ----
NM_021069chr431652 1625 199 ------
NM_021072chr522446 2059 --191 --
NM_021079chr1783013 2813 2245 1098 1054 755 548 100 12221 22365 1039 --
NM_021090chr22154723 4288 4219 3820 1934 1502 1376 1125 1115 1073 1033 533 472 206 185 2621 560 14148 --
NM_021096chr22103218 3133 2857 2646 1267 1255 1245 983 453 188 32894 2330 676 ----
NM_021097chr212173 1466 11921 --
NM_021104chr121279 ------
NM_021106chr92696 479 ------
NM_021110chr83713 485 128 ------
NM_021120chrX83140 3096 3039 1993 850 113 56 49 ------
NM_021132chr101141 21259 324 ----
NM_021136chr142288 99 ------
NM_021140chrX2764 292 1351 ----
NM_021144chr93432 416 120 ------
NM_021145chr741023 995 239 59 1372 --1866
NM_021148chr721812 914 ------
NM_021149chr163899 242 210 --2323 26 --
NM_021155chr19103000 2605 2447 2396 2316 2237 1208 1074 946 650 22906 2473 31961 488 370 12379
NM_021168chr1661180 1129 1090 1002 534 57 11007 21066 428 --
NM_021174chr82610 239 ------
NM_021177chr6271 23 ------
NM_021183chrX1591 11759 ----
NM_021188chr141558 ------
NM_021189chr141003 982 828 99 31041 1027 906 1949 --
NM_021200chr11111117 1081 1065 1054 994 975 901 807 157 110 27 2928 880 150 --
NM_021202chr20172916 2866 2851 2281 1969 580 436 332 321 300 281 252 245 202 91 57 45 --41978 859 66 29 21992 191
NM_021216chr1951153 890 393 196 168 11092 1483 --
NM_021229chr123392 310 203 --1483 --
NM_021238chr1231966 703 517 21469 660 11975 --
NM_021239chr142956 49 ------
NM_021245chr102194 35 ------
NM_021249chr1411625 11585 21271 130 --
NM_021253chr631381 445 368 ----11135
NM_021259chr168978 958 881 730 457 444 243 37 1833 3210 176 159 --
NM_021260chr1471348 491 471 437 357 109 79 41336 1121 864 138 1955 1182
NM_021267chr198941 346 311 184 178 100 86 76 1139 ----
NM_021569chr981147 913 889 795 757 476 30 21 --1296 1288
NM_021619chr98999 860 808 501 490 393 327 245 41056 815 371 204 11279 --
NM_021627chr32772 21 1143 ----
NM_021637chrX----11358 --
NM_021638chr4215023 4322 4224 3961 3549 3429 3256 3190 1930 1780 1511 1393 1340 1099 1034 898 811 805 542 524 44 ------
NM_021643chr211793 --21655 261 --
NM_021644chr1041007 941 354 255 ------
NM_021647chr453995 3422 1826 1756 107 ------
NM_021648chr682112 1926 1918 1097 934 912 745 48 ------
NM_021705chr631226 570 391 --1422 --
NM_021724chr172196 33 ------
NM_021728chr141664 ------
NM_021783chrX6844 600 591 416 406 25 3751 435 347 42258 2244 2204 399 --
NM_021809chr2092280 2068 2043 1907 1604 372 286 181 117 ------
NM_021813chr6125402 5326 5165 4893 4005 3799 1827 1656 1510 1084 291 157 25088 4052 2206 35 15478
NM_021814chr631192 215 149 ------
NM_021817chr13309 114 90 --172 --
NM_021905chr682192 1975 1720 1604 1476 1432 646 627 11724 ----
NM_021907chr21102 1273 ----
NM_021911chr564196 2176 2040 1790 1167 806 142 --1363
NM_021912chr1583938 3840 2926 2885 1674 1239 959 524 --12818 --
NM_021913chr1951666 1636 1458 635 152 21693 29 --11788
NM_021914chr1431676 117 102 ------
NM_021939chr176599 523 314 212 190 93 --1503 --
NM_021940chr631574 620 348 1286 ----
NM_021943chr652100 1892 1862 1451 437 ------
NM_021945chr6123391 3304 2880 2807 2523 1238 1179 826 795 371 273 199 31063 282 119 32892 2829 2792 --
NM_021947chr1731062 339 278 ------
NM_021948chr12279 256 160 ----
NM_021949chrX72705 2294 2199 1977 1945 292 238 21149 497 ----
NM_021954chr1363483 3325 3170 2766 2569 1242 ------
NM_021956chr641472 1402 964 238 ------
NM_021960chr12770 489 11845 ----
NM_021961chr11137093 6473 6418 6375 5899 5364 2791 2488 2142 2037 1961 1749 1587 22926 1970 22080 1872 1740
NM_021962chr1771888 1725 843 618 521 229 43 2623 467 --12412
NM_021964chr345369 1765 1594 543 ------
NM_021973chr45539 197 169 155 108 ------
NM_021977chr682767 2746 2477 1392 789 614 600 255 22992 2393 ----
NM_021984chrX61309 988 601 240 165 58 --41349 567 517 32 --
NM_021987chrX61309 988 601 240 165 58 --41349 567 517 32 --
NM_021988chr205626 577 546 517 26 1385 21056 616 --
NM_021990chrX61309 988 601 240 165 58 --41349 567 517 32 --
NM_021998chrX11090 ------
NM_021999chr13156 ------
NM_022003chr1151195 957 449 380 152 11032 1851 --
NM_022036chr173356 136 83 ------
NM_022042chr451165 828 713 211 35 1267 181 --
NM_022048chr15156306 6248 6160 6121 4776 4518 4195 4063 3878 2357 1925 1584 589 375 348 22381 338 35181 2211 89 25041 1784
NM_022055chr2132 ------
NM_022060chr1461340 1198 1160 1072 425 260 31320 983 507 ----
NM_022066chr175903 873 806 300 92 --179 --
NM_022073chr1451271 1164 591 533 133 ------
NM_022075chr13680 657 131 1283 ----
NM_022085chr631175 520 253 --124 --
NM_022095chr20179 ------
NM_022107chr64596 538 482 24 --1399 --
NM_022114chr1134399 4349 3729 3692 3604 3304 3232 3130 3079 3044 1303 976 441 33154 1897 1867 --33254 898 107
NM_022117chrX3558 425 201 168 2447 29 --
NM_022124chr103610 195 51 1668 1474 --
NM_022130chr5--1306 ----
NM_022133chr8121 ------
NM_022138chr61348 150 ----
NM_022143chr721355 624 11370 ----
NM_022144chrX1134 ------
NM_022157chr1----1156 --
NM_022166chr16275599 5364 5169 5011 4930 4743 4729 4523 4232 4113 2523 2275 1911 1690 1469 1411 1393 1297 1161 1027 983 491 464 434 296 280 237 55816 4361 1769 818 687 35631 5067 4923 35037 4869 4254
NM_022169chr11141441 1423 1400 1297 1270 1115 1078 985 547 527 383 317 130 115 11456 11227 --
NM_022170chr72635 92 2419 114 ----
NM_022343chr931014 331 298 1837 ----
NM_022368chrX121 ------
NM_022369chr15282 65 1418 1434 --
NM_022442chr205626 577 546 517 26 1385 21056 616 --
NM_022456chr1297419 6350 4999 4966 4911 1086 569 435 113 --15587 --
NM_022458chr742770 2666 753 100 --1918 --
NM_022459chr1355273 4656 4166 4104 1002 11838 --11916
NM_022461chr3--1302 ----
NM_022462chr19193568 3285 3244 3205 2861 2699 1397 1324 1106 871 773 627 526 306 293 236 213 106 31 33363 2583 1260 53666 3369 1416 1203 160 13471
NM_022463chr1751120 1043 122 57 48 ----1154
NM_022465chr12182923 2915 2893 2827 2253 2217 2168 2141 1134 988 775 750 561 527 449 403 339 61 41155 1108 812 573 42884 2818 792 141 1997
NM_022469chr152589 2169 1154 470 395 2442 114 1450 12886
NM_022473chr1574297 4108 3949 3525 1682 871 131 34072 3101 1719 ----
NM_022474chr1442762 2403 2212 302 1788 ----
NM_022475chr42206 93 ------
NM_022477chr2041317 1175 251 168 --1123 --
NM_022491chr1273493 2658 2634 2608 795 316 29 11120 ----
NM_022494chr101326 1365 ----
NM_022497chr351302 547 346 199 85 1786 33020 508 460 --
NM_022552chr251150 1122 993 267 253 ------
NM_022553chr62178 102 1384 3499 88 69 --
NM_022557chr172178 155 --1165 --
NM_022566chr152394 64 --121 --
NM_022572chr2151686 1614 1596 1588 1569 1515 1371 1332 1310 1202 1181 551 404 308 292 41558 1350 685 440 11153 --
NM_022574chr7162183 2152 2130 2058 1972 1943 1927 1795 1765 1736 1627 1447 1427 1368 642 22 --2756 286 --
NM_022640chr171177 --1164 --
NM_022644chr173448 183 107 --1435 --
NM_022648chr2154601 4390 4350 4173 4140 4129 3680 3661 3414 3347 2868 1392 1274 1089 297 24356 3105 1821 11063
NM_022650chr51239 --1858 --
NM_022652chr121939 143 ----
NM_022659chr81120 ------
NM_022664chr1184 ------
NM_022716chr11198 13009 --1741
NM_022725chr112763 332 1379 ----
NM_022726chr621196 520 ------
NM_022730chr26876 397 301 262 181 77 3202 170 115 3921 836 423 --
NM_022733chr16982 840 748 233 69 51 21091 316 2176 96 --
NM_022737chr19121249 1120 1034 943 925 472 256 211 135 106 100 94 31265 1203 919 31063 910 250 1952
NM_022739chr171116 ------
NM_022745chr112863 32474 68 22 ----
NM_022748chr752355 1091 920 547 37 1463 ----
NM_022749chr891376 1202 1195 897 540 301 85 40 28 11382 ----
NM_022750chr72744 584 --1722 1118
NM_022753chr152764 1124 878 601 188 --2473 336 --
NM_022755chr941832 940 894 365 --1