TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1914-5p
miRNA Sequence: CCCUGUGCCCGGCCCACUUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51900 ----11194
NM_000037chr832109 2053 1757 192 1418 1321
NM_000038chr531530 595 237 ------
NM_000084chrX67002 6972 6773 6555 4243 1259 16457 ----
NM_000092chr274224 4126 3234 1065 1008 907 181 11246 13097 --
NM_000111chr72384 345 --1296 --
NM_000115chr1332582 1708 106 ------
NM_000125chr674028 3444 1546 1135 1104 923 611 ----11317
NM_000138chr152753 91 --1160 --
NM_000161chr1441773 1514 691 321 ----1344
NM_000168chr743188 2964 2254 570 ------
NM_000188chr102469 160 ------
NM_000216chrX32754 1234 32 ------
NM_000217chr1245295 4614 1746 760 --13874 --
NM_000234chr19----130 --
NM_000248chr321922 929 32798 2734 2271 ----
NM_000253chr43711 262 87 ------
NM_000259chr1556048 4137 3894 1723 932 1252 24647 2388 --
NM_000261chr1----121 --
NM_000264chr933168 2751 1129 ------
NM_000297chr42432 227 2734 99 ----
NM_000314chr1031092 787 164 --12762 23193 726
NM_000330chrX42125 1546 667 43 31732 1603 770 ----
NM_000332chr646779 6715 300 220 26384 158 46363 5125 4921 400 --
NM_000346chr171598 ------
NM_000361chr2031727 1552 434 ----1286
NM_000368chr92774 44 1810 23625 1708 --
NM_000428chr14150 1871 --12606
NM_000461chr384081 3706 1438 1393 838 421 400 137 1337 --1550
NM_000462chr151292 ------
NM_000478chr11269 ------
NM_000484chr211801 ------
NM_000503chr871848 719 657 630 244 120 28 ------
NM_000539chr341572 638 340 116 11491 ----
NM_000555chrX106729 6096 5913 5195 5052 2649 2483 1566 1407 689 11735 ----
NM_000597chr2----1253 --
NM_000612chr11123092 1466 1394 1160 1109 1092 1044 1000 953 934 599 199 22776 639 ----
NM_000615chr1132432 2031 398 --12053 1854
NM_000618chr1245565 5431 2585 1451 2861 43 --15045
NM_000618chr1245565 5431 2585 1451 2861 43 --15045
NM_000719chr1266509 6395 5229 4259 631 262 --21125 595 --
NM_000722chr7125 ------
NM_000734chr13926 668 356 2832 63 1933 1126
NM_000793chr1433141 1258 848 13643 ----
NM_000806chr511439 ------
NM_000807chr42106 66 ------
NM_000813chr585280 3913 3649 3589 2085 1802 605 56 ------
NM_000814chr1533042 1527 902 2287 211 --14028
NM_000826chr42420 378 154 ----
NM_000829chr1122307 2006 --11694 --
NM_000831chr1106265 5657 5502 5041 4640 4573 2382 1928 614 338 --34657 2369 2215 22266 1996
NM_000844chr31383 1312 --170
NM_000875chr15136242 6171 6139 5229 5216 5201 4791 2728 2084 1258 752 744 48 16504 ----
NM_000877chr243051 2454 2085 1084 1922 ----
NM_000891chr1733474 2795 742 11116 12416 --
NM_000901chr422437 2096 ------
NM_000912chr842913 2165 226 26 11024 ----
NM_000944chr452409 1647 1633 883 629 ------
NM_000961chr2073882 3819 3485 3352 3056 2923 84 ------
NM_000965chr311046 ------
NM_001001132chr2121207 250 --1313 --
NM_001001323chr12----12416 --
NM_001001331chr321768 490 ------
NM_001001419chr554634 3324 1304 770 69 --14649 --
NM_001001420chr554634 3324 1304 770 69 --14649 --
NM_001001481chr842864 2652 2364 673 ------
NM_001001567chr211168 ------
NM_001001568chr211168 ------
NM_001001571chr211168 ------
NM_001001572chr211168 ------
NM_001001573chr211168 ------
NM_001001574chr211168 ------
NM_001001575chr211168 ------
NM_001001576chr211168 ------
NM_001001577chr211168 ------
NM_001001579chr211168 ------
NM_001001580chr211168 ------
NM_001001581chr211168 ------
NM_001001582chr211168 ------
NM_001001584chr211168 ------
NM_001001585chr211168 ------
NM_001001706chr62240 219 ------
NM_001001787chr11465 ------
NM_001001928chr22118331 8312 8016 7461 7008 3328 3263 1947 1309 598 188 35296 5279 562 ----
NM_001001974chr1052401 1993 1460 614 566 ----12110
NM_001002762chr1062198 2192 1092 692 387 370 11046 --1784
NM_001002814chr833491 3456 1371 ----1309
NM_001002838chrX41871 1585 1271 725 ------
NM_001003407chr1024731 3329 157 1868 --
NM_001003408chr1024731 3329 157 1868 --
NM_001003652chr1867767 6975 6872 5730 2640 372 --2959 310 --
NM_001003674chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_001003675chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_001003688chr42978 273 ------
NM_001003712chr1273932 3921 3887 3266 2693 1333 832 ------
NM_001003800chr983072 2751 1024 953 866 636 492 106 --2996 457 13725
NM_001003927chr171430 ------
NM_001003940chr1543789 3659 3532 751 --11320 --
NM_001003942chr1543789 3659 3532 751 --11320 --
NM_001003943chr1543793 3663 3536 755 --11324 --
NM_001003954chr82138 27 ----1357
NM_001004065chr932669 2434 2422 1794 11373 1416
NM_001004304chr122428 267 ----1287
NM_001004317chr612731 23646 1319 ----
NM_001004419chr1233887 2993 833 ----24081 434
NM_001005408chr174443 422 170 29 --1102 1128
NM_001005473chr534160 1440 1262 45920 5613 5246 1563 ----
NM_001005781chr21438 ------
NM_001005782chr22887 241 ------
NM_001006600chr532084 175 58 21871 781 ----
NM_001006617chr91312 --1125 11189
NM_001006619chr91312 --1125 11189
NM_001006620chr91312 --1125 11189
NM_001006621chr91312 --1125 11189
NM_001006939chr101711 ------
NM_001006946chr221572 1233 ----1226
NM_001007023chr1433141 1258 848 13643 ----
NM_001007246chr2131775 1234 133 ------
NM_001008215chr221155 275 --1337 --
NM_001008220chr543974 3566 3470 2842 12885 23582 2423 --
NM_001008225chr71628 ------
NM_001008239chr1833485 882 602 12730 11272 --
NM_001008392chr321358 118 2577 393 12848 --
NM_001008408chr795377 5283 5214 5206 2258 2212 1410 150 76 15955 194 --
NM_001008540chr23480 327 92 ------
NM_001008564chr133822 648 358 --11488 --
NM_001008738chr552731 2535 2076 415 137 1963 ----
NM_001009554chr444771 4149 1623 1047 11821 ----
NM_001009554chr444771 4149 1623 1047 11821 ----
NM_001009880chr2274379 3196 1892 1647 1078 719 21 13607 11463 --
NM_001009899chr395360 2249 2114 1812 1601 1467 1296 572 68 15790 11632 --
NM_001010867chr1166139 5424 5277 4981 4372 4175 4131 2204 2120 1209 867 782 776 736 562 287 12488 46075 1108 682 23 11496
NM_001010888chrX94145 4036 2970 2869 1558 1337 686 551 453 13439 ----
NM_001010891chr555588 5220 2774 2637 2558 22479 2109 ----
NM_001010971chr13813 788 682 --1204 --
NM_001011666chr766109 4865 4243 2595 1468 1245 15897 ----
NM_001011713chr14269 36 ------
NM_001012393chr1154598 4238 1100 825 417 --23426 1885 --
NM_001012515chr183727 684 307 11467 11607 --
NM_001012614chr41265 ------
NM_001012751chr1021646 1431 ------
NM_001012755chrX64829 3825 3127 1516 1459 1322 ------
NM_001012977chrX31406 994 961 --1338 --
NM_001013031chr1073439 2801 2281 2215 1292 1191 1033 1557 1200 1428
NM_001013415chr41524 ------
NM_001013438chr31782 ------
NM_001013439chr31628 ------
NM_001013622chr48489 427 366 304 242 180 119 57 ------
NM_001013674chr12310 122 ------
NM_001014443chr11223 ------
NM_001015877chrX22213 857 ------
NM_001017368chr1721818 33 ----12674
NM_001017395chr333338 3230 646 ------
NM_001017424chr141200 1181 35 28 ------
NM_001017425chr141200 1181 35 28 ------
NM_001017440chr797865 7805 5997 5786 5529 3094 2188 2121 1847 12992 ----
NM_001017523chr1231849 1196 649 ----11203
NM_001017922chr121726 658 11612 1288 --
NM_001017995chr553644 3086 1382 1363 391 14641 ----
NM_001018005chr151153 ------
NM_001018038chr9173 ------
NM_001018054chr12925 319 11430 ----
NM_001018064chr951685 1628 1504 505 351 11419 ----
NM_001018072chr1231849 1196 649 ----11203
NM_001018111chr743760 2774 1307 749 21285 1140 1667 12688
NM_001023587chr311109 ------
NM_001024218chr144730 694 585 75 ------
NM_001024401chr1662615 2461 840 488 234 108 --1540 12585
NM_001024649chr531155 1088 1061 ------
NM_001024808chr1242786 2372 1881 680 1989 22155 667 --
NM_001024847chr322039 635 21781 206 ----
NM_001024858chr1452901 1871 952 769 40 --2832 335 --
NM_001024948chr123357 3019 2806 37 ----
NM_001025076chr1055173 4827 4255 4114 378 16195 --1755
NM_001025077chr1096531 6185 5613 5472 4769 1736 1362 826 721 17553 --12113
NM_001025079chr313747 11338 1531 --
NM_001025580chrX13535 1816 12811 --
NM_001025780chr911182 --2504 121 --
NM_001029858chr653201 1331 455 177 107 1482 ----
NM_001029863chr622948 184 11100 ----
NM_001029864chr2032263 326 300 --22357 1728 11783
NM_001030007chr1663548 3375 2902 2598 1266 98 ------
NM_001030055chr1423422 1676 23109 1661 11297 11899
NM_001031623chr62419 187 ------
NM_001031690chr763115 649 641 327 192 83 1897 1524 --
NM_001031695chr2253615 1594 1445 670 651 21348 1207 ----
NM_001031732chr453549 3173 2506 1418 1376 13470 ----
NM_001031812chr542001 1548 576 329 ------
NM_001032282chr85981 421 288 280 176 ------
NM_001032293chr171639 ------
NM_001032296chr131429 --12931 --
NM_001032999chr20124681 4331 4217 3967 3549 1939 1898 1876 1501 1110 892 490 1572 24612 3570 13394
NM_001033045chr224418 4165 1194 21429 159 --
NM_001033047chr422478 201 --11053 --
NM_001033085chr2------123
NM_001033503chr51418 ------
NM_001033507chr141893 1519 473 190 ------
NM_001033551chr1743760 3323 2612 1062 --21404 1043 12509
NM_001033561chr171694 ------
NM_001033723chr872711 2672 2158 1035 781 534 415 --12430 --
NM_001034852chr1451451 1398 1389 1363 722 12009 1380 --
NM_001035003chr4183 ------
NM_001035004chr4183 ------
NM_001037131chr231149 1065 478 1248 --1294
NM_001037132chr741794 818 669 544 --12206 --
NM_001037133chr741794 818 669 544 --12206 --
NM_001037553chr2174986 4868 4789 4624 4418 1708 1697 --1196 --
NM_001037872chr22303 205 1500 ----
NM_001039590chrX11574 ------
NM_001039591chrX11574 ------
NM_001039618chr1134786 4396 3704 ------
NM_001039619chr14161 ------
NM_001039649chr131315 ------
NM_001039690chr163879 118 96 --1319 1776
NM_001039709chr20124681 4331 4217 3967 3549 1939 1898 1876 1501 1110 892 490 1572 24612 3570 13394
NM_001039888chr15758 293 268 158 119 ------
NM_001039937chr1322951 924 11115 ----
NM_001040092chr82296 23 ------
NM_001040144chr163879 118 96 --1319 1776
NM_001040146chr163879 118 96 --1319 1776
NM_001040202chr432178 808 212 --11971 --
NM_001040214chr632206 2166 2020 ------
NM_001040272chr922379 330 1432 --11963
NM_001040402chr443174 2144 1161 119 12175 ----
NM_001040429chr1353430 3154 2458 471 88 ------
NM_001040441chr154983 4461 4227 3605 432 ----14801
NM_001040450chr1562207 1040 815 754 469 458 156 ----
NM_001040453chr1562207 1040 815 754 469 458 156 ----
NM_001040708chr81888 ------
NM_001040712chr943406 2909 73 34 ------
NM_001042404chr12415 64 21454 705 ----
NM_001042413chr973776 3426 3124 2962 734 485 402 ------
NM_001042453chrX51252 1080 618 608 343 ------
NM_001042537chrX42122 1629 603 129 --1731 --
NM_001042555chr1273654 3057 1826 1370 1361 1117 212 11685 ----
NM_001042604chr353481 1946 1846 977 764 ------
NM_001042632chr201278 11623 2919 865 --
NM_001042633chr201278 11623 2919 865 --
NM_001042681chr121909 851 1949 1888 1423
NM_001042682chr121909 851 1949 1888 1423
NM_001042682chr121909 851 1949 1888 1423
NM_001042749chrX31514 334 91 ------
NM_001042750chrX31514 334 91 ------
NM_001042751chrX31514 334 91 ------
NM_001042762chr74824 129 59 37 ------
NM_001043318chr1464011 3849 3667 3374 2887 983 13676 23142 90 13818
NM_001044722chr542001 1548 576 329 ------
NM_001044723chr542001 1548 576 329 ------
NM_001046chr523008 1940 22355 141 12280 --
NM_001083620chr42419 377 154 ----
NM_001092chr1762395 1931 1762 961 882 717 ------
NM_001096chr173210 156 66 --1133 --
NM_001122679chr51900 ----11194
NM_001128chr1663548 3375 2902 2598 1266 98 ------
NM_001173chr1423422 1676 23109 1661 11297 11899
NM_001177chr1222192 1846 --12086 --
NM_001188chr661202 1123 997 866 791 105 ------
NM_001198chr61303 --1969 --
NM_001201chr443655 3455 3284 2944 23104 642 ----
NM_001204chr226423 4770 1869 --1652
NM_001206chr953043 2938 741 589 441 ----1112
NM_001256chr1712925 ------
NM_001257chr1631034 1012 967 ------
NM_001259chr735922 4887 343 ------
NM_001298chr2130 1294 1816 11320
NM_001328chr41265 ------
NM_001329chr1041293 542 422 311 --1531 1515
NM_001343chr521261 259 ------
NM_001356chrX32488 815 433 ------
NM_001358chr41415 ------
NM_001364chr1134563 4213 1373 ----14505
NM_001380chr101752 1660 ----
NM_001408chr131705 1614 1218 ------
NM_001427chr721510 158 ------
NM_001448chrX3430 247 110 ------
NM_001482chr151866 ------
NM_001497chr942627 2329 2318 794 ----12550
NM_001508chr2------2657 305
NM_001546chr611157 --1943 --
NM_001584chr112925 918 ------
NM_001616chr242726 1358 544 183 12675 13379 --
NM_001621chr713002 ------
NM_001621chr713002 ------
NM_001626chr1953225 2952 2861 2281 1123 12655 22610 474 --
NM_001650chr1853368 3154 3033 2580 500 ------
NM_001656chr521489 576 ------
NM_001663chr1422712 2284 156 ----
NM_001668chr132082 1718 1459 --1471 --
NM_001677chr131103 348 339 ------
NM_001679chr31214 ------
NM_001682chr12----12130 --
NM_001683chr321768 490 ------
NM_001695chr883875 3148 3056 3013 1609 1543 1032 347 1509 ----
NM_001701chr931596 1396 1008 --1136 --
NM_001704chr61190 ------
NM_001746chr531155 1088 1061 ------
NM_001753chr711370 ------
NM_001755chr1651780 800 603 583 58 --12116 --
NM_001759chr1264131 3807 2067 1230 665 210 1284 ----
NM_001761chr1661797 1508 581 106 85 67 ----174
NM_001777chr313747 11338 1531 --
NM_001792chr183728 221 104 --1129 --
NM_001800chr192496 118 ------
NM_001839chr11273 ------
NM_001854chr12394 119 ------
NM_001895chr20----1932 --
NM_001918chr187175 7040 6883 6359 3237 3186 2666 2499 --12356 18795
NM_001946chr122249 218 --1295 --
NM_001949chr643184 2643 2631 195 ------
NM_001950chr163762 290 137 ------
NM_001957chr442051 1532 682 668 ------
NM_002009chr151427 ----1600
NM_002015chr1343075 2113 1164 870 --1664 1189
NM_002025chrX59159 8994 6388 2413 578 ------
NM_002040chr2122250 109 ------
NM_002053chr11408 ------
NM_002069chr72556 467 ------
NM_002074chr121191 640 ------
NM_002106chr41325 ------
NM_002126chr1733330 1585 1456 --12731 --
NM_002129chr42279 115 ------
NM_002145chr17188 ------
NM_002193chr281933 1902 1214 491 243 101 34 21 ------
NM_002202chr511107 ------
NM_002210chr233546 1329 197 11160 ----
NM_002214chr771876 1795 1436 1301 386 310 270 2681 81 ----
NM_002221chr152933 2595 2348 1928 408 --12428 --
NM_002233chr11158 ------
NM_002242chr21580 ------
NM_002313chr1024731 3329 157 1868 --
NM_002335chr111167 ------
NM_002336chr1234442 160 114 13638 ----
NM_002349chr231632 655 243 ------
NM_002356chr632753 2403 1827 1666 ----
NM_002380chr81341 1371 --1969
NM_002384chr182925 647 ------
NM_002395chr611487 1291 ----
NM_002397chr512080 ------
NM_002399chr1541187 255 215 102 ------
NM_002408chr141345 ------
NM_002428chr1621447 1200 ------
NM_002430chr2222347 2009 ------
NM_002499chr15178 ------
NM_002500chr221111 456 ------
NM_002544chr17149 ------
NM_002545chr1154598 4238 1100 825 417 --23426 1885 --
NM_002581chr975598 4205 3982 3939 3538 1716 1329 11620 34432 2024 1783 --
NM_002594chr2012147 --1102 1469
NM_002596chr131409 994 372 --11267 --
NM_002606chr211168 ------
NM_002613chr1685204 5003 4715 4238 3750 1651 1543 1330 ----11214
NM_002655chr834378 4175 3831 1721 ----
NM_002657chr2042941 2577 1479 929 22400 137 23843 1332 13308
NM_002713chr121158 985 1948 ----
NM_002725chr143722 1504 637 609 --1647 12713
NM_002745chr2254551 3628 2919 2842 1757 --24366 2963 --
NM_002760chrY75802 5492 5167 4435 3733 1853 341 --11233 --
NM_002822chr12------159
NM_002838chr131195 966 186 ------
NM_002839chr943406 2909 73 34 ------
NM_002843chr1153376 2651 2605 2175 545 12412 1470 --
NM_002844chr61279 ------
NM_002873chr51440 ------
NM_002890chr51255 ------
NM_002892chr1411537 ------
NM_002897chr2----2721 112 --
NM_002906chr1131703 596 518 ------
NM_002912chr62807 25 ------
NM_002938chr411437 --11234 1792
NM_002972chr221226 ------
NM_002994chr421307 226 ------
NM_002997chr221572 1233 ----1226
NM_003017chr651239 1109 447 276 62 ----132
NM_003026chr931234 1141 879 21343 160 ----
NM_003028chr973751 3709 3695 3659 3212 1502 530 22576 413 1394 --
NM_003030chr361456 1285 690 674 357 204 1179 ----
NM_003034chr1277534 7243 6797 6629 6495 5730 5415 48010 7389 4955 1823 ----
NM_003036chr111172 ------
NM_003043chr323436 3346 3463 233 64 13044 1893
NM_003045chr1374285 3786 3560 3348 3220 1936 1188 34350 3611 3259 ----
NM_003100chr51412 ------
NM_003106chr321084 273 ------
NM_003108chr296915 6518 6007 5372 4823 2321 1451 1187 981 ------
NM_003112chr742713 2215 883 422 11286 13144 --
NM_003113chr22270 215 ------
NM_003131chr652315 2255 1647 441 339 2133 99 21468 1407 --
NM_003143chr7136 ------
NM_003161chr1732550 2332 1357 33260 2688 135 ----
NM_003199chr1825228 1559 24027 943 1269 --
NM_003201chr101642 1302 --142
NM_003204chr1721446 565 --11477 1151
NM_003217chr1251999 1462 747 412 74 ------
NM_003221chr621068 843 ------
NM_003222chr2041155 1020 869 70 ------
NM_003242chr322039 635 21781 206 ----
NM_003253chr213721 623 440 ------
NM_003257chr1521159 495 ------
NM_003262chr354683 4547 4141 391 185 ------
NM_003274chr2132565 2479 1141 ------
NM_003298chr364080 3932 1732 1689 863 676 --14021 1543
NM_003305chr41370 ------
NM_003341chr31242 ------
NM_003342chr1742131 1312 905 898 ------
NM_003350chr81781 ------
NM_003352chr22887 241 ------
NM_003374chr52169 46 ------
NM_003392chr32926 59 14025 13856 --
NM_003404chr201413 ------
NM_003410chrX23097 2835 ------
NM_003413chrX1708 ------
NM_003455chr111525 1514 11410 --
NM_003457chr171639 ------
NM_003467chr23480 327 92 ------
NM_003468chr223266 2787 ------
NM_003469chr2----1119 --
NM_003471chr32335 58 ------
NM_003473chr101699 ------
NM_003477chr111492 ------
NM_003507chr252040 1920 1854 419 57 ------
NM_003566chr1252434 2373 2177 1001 472 ------
NM_003574chr1864493 1991 1339 1199 885 118 ------
NM_003576chr131429 --12931 --
NM_003583chr1252942 2653 2601 1533 1503 --1427 --
NM_003590chr223074 2544 ------
NM_003603chr431547 757 567 ------
NM_003633chr522262 1939 ------
NM_003642chr2------123
NM_003663chr322902 2368 ------
NM_003664chr51463 ------
NM_003670chr321369 575 --1231 --
NM_003671chr933338 2779 2193 ------
NM_003672chr11317 ------
NM_003679chr122514 442 --1891 13244
NM_003704chr41700 ------
NM_003705chr22311 268 ------
NM_003759chr451606 1213 416 289 249 11544 ----
NM_003762chr111479 ------
NM_003772chr112186 111 --1823 --
NM_003873chr10187 --21725 494 --
NM_003885chr1732266 1673 76 22280 1878 ----
NM_003888chr151175 ----1290
NM_003895chr2132150 1478 141 ------
NM_003908chr20----11201 --
NM_003913chr633395 1039 680 --11620 --
NM_003930chr72566 325 ------
NM_003934chr911045 ------
NM_003939chr1043725 3109 2767 1462 ------
NM_003958chr683438 3053 3005 2733 1171 1038 951 801 ------
NM_003966chr557765 6799 6692 6458 5494 23021 2226 1424 --
NM_003972chr1021215 937 --11173 1327
NM_003993chr11311 ------
NM_004028chr1853368 3154 3033 2580 500 ------
NM_004036chr21713 --2219 204 --
NM_004061chr51425 ------
NM_004067chr731444 1186 347 --11397 --
NM_004071chr2181 ------
NM_004080chr711274 ------
NM_004093chr1343167 1159 825 105 ------
NM_004098chr1011108 --1178 1485
NM_004114chrX11095 --11174 --
NM_004130chr31582 ------
NM_004134chr51541 ------
NM_004170chr93652 538 335 --1570 --
NM_004171chr11149372 8852 8815 8742 7985 6086 2213 2124 2080 1988 1467 1366 783 171 23386 2458 --28800 8680
NM_004268chr111200 ------
NM_004296chr1464028 1430 1080 998 247 46 ------
NM_004306chr82138 27 ----1357
NM_004311chr1022628 102 ------
NM_004321chr273216 2366 2260 1415 1020 579 306 11360 33110 2287 262 --
NM_004337chr81325 ------
NM_004338chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_004341chr21225 ------
NM_004370chr641858 1637 1418 713 ------
NM_004384chr542001 1548 576 329 ------
NM_004389chr23833 257 219 ------
NM_004392chr1362273 2042 1825 1733 808 477 ------
NM_004396chr171238 ------
NM_004397chr1133952 2935 1476 13045 ----
NM_004432chr932316 1955 1550 --1220 --
NM_004437chr133113 1298 947 12913 13439 12243
NM_004440chr621820 71 ------
NM_004447chr121415 ----1150
NM_004451chr113683 276 214 --1642 1289
NM_004458chrX2895 184 --1564 --
NM_004491chr1963757 3209 2732 806 484 333 13092 13459 --
NM_004492chr15164 ------
NM_004500chr1451999 1932 1542 1431 329 ------
NM_004501chr164109 4061 3985 2557 1533 1175 ------
NM_004514chr1752499 2177 963 508 307 1385 ----
NM_004560chr95980 788 750 224 53 ------
NM_004561chr1121178 716 --1387 1620
NM_004598chr563047 2690 1217 1041 971 664 ------
NM_004606chrX186 ------
NM_004612chr944604 4116 3146 1705 11871 ----
NM_004631chr12925 319 11430 ----
NM_004654chrY1195 ------
NM_004660chrY4921 742 572 428 ------
NM_004663chr1511036 ------
NM_004685chr1321831 1041 ------
NM_004697chr91115 ------
NM_004703chr1732410 1621 756 1597 --1161
NM_004709chrX31639 1485 1365 11541 ----
NM_004711chr2273349 3039 2959 1405 1050 454 212 1476 ----
NM_004726chrX65625 2103 1968 1881 1284 1258 14884 11266 --
NM_004734chr1342076 870 644 445 21113 948 ----
NM_004738chr2052171 1657 936 763 112 --11673 --
NM_004745chr861516 743 689 634 495 223 --22461 521 1469
NM_004753chr11308 ----1171
NM_004768chr111148 ------
NM_004801chr211068 ------
NM_004805chr241275 527 172 83 ------
NM_004822chr17103176 2943 2766 2669 2530 1454 1267 371 274 137 --12676 11209
NM_004824chr651352 1314 1257 499 243 ------
NM_004827chr41116 11553 11225 --
NM_004849chr611468 ------
NM_004857chr1474618 4475 1752 1618 243 213 133 ------
NM_004859chr1733080 2098 819 ------
NM_004863chr1444666 4481 1512 323 11461 --14847
NM_004866chr543335 1232 989 96 ------
NM_004888chr92169 67 ------
NM_004904chr766109 4865 4243 2595 1468 1245 15897 ----
NM_004906chr62594 462 ------
NM_004938chr91955 ------
NM_004947chr351919 1871 496 324 174 1751 --12268
NM_004952chr13805 650 622 --1196 --
NM_004955chr61520 ------
NM_004956chr754311 3340 3276 704 384 ------
NM_004962chr102770 99 ------
NM_004992chrX108136 6409 5968 5857 2700 2156 1625 1147 842 204 2710 617 38212 7628 5364 15604
NM_004992chrX108136 6409 5968 5857 2700 2156 1625 1147 842 204 2710 617 38212 7628 5364 15604
NM_004993chr1411261 --165 --
NM_004999chr684367 4168 2828 2758 1514 802 645 365 13534 ----
NM_005010chr741794 818 669 544 --12206 --
NM_005028chr1021852 920 ------
NM_005030chr161236 ------
NM_005036chr22118331 8312 8016 7461 7008 3328 3263 1947 1309 598 188 35296 5279 562 ----
NM_005063chr1032624 2479 125 11275 --13533
NM_005067chr33829 370 38 --1284 --
NM_005087chr31628 ------
NM_005093chr20124681 4331 4217 3967 3549 1939 1898 1876 1501 1110 892 490 1572 24612 3570 13394
NM_005095chr131874 856 431 ------
NM_005097chr101317 ------
NM_005121chr1732970 749 662 12361 ----
NM_005126chr321943 1403 1886 ----
NM_005168chr22668 87 ------
NM_005180chr1031623 1263 455 ------
NM_005188chr1168048 6506 6463 5122 2415 572 --16395 25378 1880
NM_005197chr1445025 977 596 340 1364 ----
NM_005202chr16792 770 679 591 390 238 ------
NM_005203chr101145 ------
NM_005207chr2221102 83 13533 --12969
NM_005233chr3------12306
NM_005239chr2141416 1289 692 194 ----11753
NM_005241chr32515 204 ------
NM_005254chr152471 78 ------
NM_005256chr111754 ------
NM_005257chr1831280 1162 1057 ------
NM_005316chr1121005 21 1100 2738 455 --
NM_005318chr2211152 ------
NM_005324chr1731918 1482 1413 --1313 --
NM_005339chr433870 3776 81 11091 13611 --
NM_005359chr1856153 5579 4848 2218 839 11581 ----
NM_005374chr1751693 737 635 307 158 --1862 --
NM_005378chr21790 ------
NM_005386chr201892 --1284 284 67
NM_005388chr9121 ------
NM_005397chr743760 2774 1307 749 21285 1140 1667 12688
NM_005399chr164283 4095 3879 3426 2740 1558 --1720 --
NM_005406chr183230 192 108 11212 ----
NM_005410chr51785 ------
NM_005436chr1043214 3169 1493 574 ------
NM_005439chr12----132 --
NM_005458chr952074 1862 1782 569 559 11734 ----
NM_005497chr1776082 4969 4154 2357 2109 1750 303 ------
NM_005502chr92755 180 ----1703
NM_005504chr1286614 6351 5576 4654 4166 1828 903 407 11134 ----
NM_005517chr13919 375 45 ------
NM_005522chr71372 ------
NM_005539chr1021126 355 --11310 --
NM_005540chr131289 1198 1168 1192 1307 11401
NM_005578chr364698 4390 3570 726 386 242 ------
NM_005596chr965473 4652 2410 2183 1157 642 --25805 4542 14221
NM_005607chr821029 376 ------
NM_005613chr1------11553
NM_005639chr123663 610 488 ----11635
NM_005648chr81150 ------
NM_005655chr85981 421 288 280 176 ------
NM_005665chr131719 1709 770 ----14059
NM_005668chr544469 982 930 709 13467 ----
NM_005688chr341042 880 420 119 ------
NM_005711chr51999 --11105 --
NM_005739chr1542372 2051 672 68 ------
NM_005746chr742061 678 453 55 ------
NM_005748chr1232844 2410 956 ------
NM_005749chr17----138 1505
NM_005778chr31438 ------
NM_005779chr531326 1145 508 --12258 --
NM_005786chr1811229 ------
NM_005808chr321358 118 2577 393 12848 --
NM_005840chrX55598 2126 2012 1727 415 --160 --
NM_005857chr13929 217 108 1360 ----
NM_005862chr311089 ------
NM_005871chr1011007 ------
NM_005880chr1611563 --123 --
NM_005898chr111288 --1897 --
NM_005900chr42978 273 ------
NM_005901chr1867767 6975 6872 5730 2640 372 --2959 310 --
NM_005903chr554634 3324 1304 770 69 --14649 --
NM_005906chr621643 432 ------
NM_005909chr542897 1357 1279 554 43612 1430 374 26 ----
NM_005911chr231354 1271 1131 --1234 --
NM_005917chr2----1143 --
NM_005933chr1142944 2038 1934 105 11098 --1824
NM_005935chr434978 4549 1375 ----1777
NM_005977chr132363 337 --1915 --
NM_005986chr1362870 2632 2512 2425 259 98 ------
NM_006007chr9104266 3919 3766 3015 2759 1488 1401 733 240 167 ------
NM_006011chr1564298 3815 2608 1481 560 55 22987 226 ----
NM_006015chr1----11028 --
NM_006016chr611605 --12226 --
NM_006037chr284541 4205 4113 1742 361 242 212 169 2222 142 1839 --
NM_006041chr17173 ------
NM_006047chr2011111 --13233 --
NM_006060chr743984 3596 440 87 11296 33431 1335 391 13639
NM_006079chr61635 ------
NM_006080chr742811 2291 1967 216 --1275 --
NM_006088chr91123 ------
NM_006094chr852097 1962 1846 835 450 ------
NM_006107chr171130 ------
NM_006109chr14161 ------
NM_006159chr122460 250 --1517 --
NM_006180chr951685 1628 1504 505 351 11419 ----
NM_006206chr432743 2246 850 ------
NM_006209chr82296 23 ------
NM_006218chr3------187
NM_006226chr22511 474 ------
NM_006237chr1331461 922 795 ------
NM_006238chr651649 1598 1570 1463 381 ------
NM_006245chr631030 959 22 1318 2931 214 --
NM_006251chr552511 1121 765 632 291 --1132 --
NM_006252chr167529 7217 6670 5644 1856 222 12476 --15050
NM_006256chr132011 1910 1041 ------
NM_006264chr41423 ------
NM_006267chr21459 ------
NM_006277chr22729 207 ------
NM_006282chr2064493 3307 3173 1507 944 784 1846 1430 --
NM_006283chr854882 4769 4561 564 195 ------
NM_006306chrX55365 5138 4069 3775 2063 41919 1836 950 493 ----
NM_006313chr1211112 ------
NM_006320chr41383 ------
NM_006323chr42265 117 ------
NM_006343chr21311 ------
NM_006359chrX42122 1629 603 129 --1731 --
NM_006380chr1743901 3579 3103 1577 ------
NM_006386chr2232056 1731 1584 ----12395
NM_006393chr1074382 4329 4189 3104 3089 801 137 14152 11314 --
NM_006424chr441910 1552 1218 783 ----1232
NM_006451chr51220 ------
NM_006454chr472900 2733 564 474 360 255 92 ----1856
NM_006482chr1252942 2653 2601 1533 1503 --1427 --
NM_006495chr172303 147 ------
NM_006516chr131617 1603 1251 --163 --
NM_006538chr243543 2734 851 774 11028 11125 --
NM_006544chr1465926 4647 4085 3771 1733 574 25937 412 22127 1592 189
NM_006546chr1754892 4767 4485 1304 824 14319 ----
NM_006561chr1055173 4827 4255 4114 378 16195 --1755
NM_006565chr1611276 ------
NM_006574chr3174 ------
NM_006595chr1111745 ------
NM_006599chr1657355 1252 709 480 304 12800 21829 980 --
NM_006603chrX31514 334 91 ------
NM_006614chr342795 985 421 335 ------
NM_006650chr543974 3566 3470 2842 12885 23582 2423 --
NM_006654chr1273654 3057 1826 1370 1361 1117 212 11685 ----
NM_006675chr1263446 2525 2456 2369 2118 1207 1775 12756 33293 3064 859
NM_006690chr2061855 1740 1731 1558 776 123 1498 ----
NM_006717chr93349 237 154 ----1612
NM_006720chr1024731 3329 157 1868 --
NM_006722chr321922 929 32798 2734 2271 ----
NM_006729chrX45049 4220 4084 753 1995 15209 --
NM_006731chr945749 3643 2163 2096 15185 1325 --
NM_006734chr631301 459 233 11129 11493 --
NM_006750chr1621426 101 1527 11594 17132
NM_006754chr72825 397 --11147 --
NM_006763chr112109 ------
NM_006772chr621538 272 ------
NM_006775chr612652 ------
NM_006778chr661888 1379 630 568 281 267 ----136
NM_006813chr62815 72 ------
NM_006832chr141753 ------
NM_006884chr361456 1285 690 674 357 204 1179 ----
NM_006924chr1723537 1158 11539 23591 809 --
NM_006938chr182731 378 --152 --
NM_006939chr141752 ----1878
NM_006943chr2043319 752 244 107 22441 53 ----
NM_006947chr431527 204 85 ------
NM_006951chr102786 541 ------
NM_006956chr721756 99 2567 521 ----
NM_006990chr132415 1676 952 ----11907
NM_006997chr101351 --1361 --
NM_007007chr1234377 3972 1144 ------
NM_007011chr15106395 6219 5389 5259 4853 2572 2343 2297 1941 1674 26687 2540 24946 1695 --
NM_007013chr83718 95 64 ------
NM_007017chr52599 284 ------
NM_007038chr2154448 4113 1222 700 88 1595 ----
NM_007050chr20117807 7467 7239 6840 5949 2242 2188 2177 1904 1643 147 36530 3196 1352 17125 --
NM_007067chr171101 ------
NM_007078chr1022533 176 ------
NM_007106chr1332475 1120 570 ------
NM_007114chr342858 2763 1040 260 ------
NM_007124chr6138 ------
NM_007144chr1721140 916 2217 156 ----
NM_007150chrX32078 1827 602 --1451 --
NM_007173chr1121662 239 ------
NM_007189chr731410 1264 964 ------
NM_007203chr932669 2434 2422 1794 11373 1416
NM_007249chr1386183 5926 2929 2534 2454 2129 1252 756 12569 ----
NM_007282chr31812 ------
NM_007294chr172352 22 132 ----
NM_007295chr172352 22 132 ----
NM_007296chr172352 22 132 ----
NM_007297chr172352 22 132 ----
NM_007298chr172352 22 132 ----
NM_007299chr172352 22 132 ----
NM_007300chr172352 22 132 ----
NM_007302chr172352 22 132 ----
NM_007303chr172352 22 132 ----
NM_007304chr172352 22 132 ----
NM_007305chr172352 22 132 ----
NM_007347chr1562879 2502 2365 938 515 199 ------
NM_007358chr1151 ------
NM_007373chr1011267 ------
NM_012092chr211637 --11719 --
NM_012102chr121909 851 1949 1888 1423
NM_012141chr1322951 924 11115 ----
NM_012156chr2042951 2200 546 509 2855 187 --13189
NM_012158chr1321811 100 ------
NM_012164chr997215 2786 2775 2480 1915 1830 817 708 455 --12247 --
NM_012193chr1145039 4065 3881 1615 --11991 --
NM_012223chr2----11012 1323
NM_012234chr353583 2866 2837 2596 2416 ------
NM_012238chr1011292 ----124
NM_012247chr101879 --2321 291 --
NM_012249chr223136 2907 ----1496
NM_012252chr755047 4207 3598 2051 266 1157 ----
NM_012257chr71298 ------
NM_012262chr144822 3542 1971 1331 ------
NM_012290chr221481 1291 ------
NM_012294chr763617 3337 3297 3145 937 833 23416 130 ----
NM_012297chr42941 839 --1778 --
NM_012300chr512377 ------
NM_012301chr752074 1944 424 183 99 11434 139 --
NM_012307chr1821071 953 ------
NM_012316chr155527 3828 3471 3414 1850 --1801 --
NM_012334chr564731 3574 3033 1732 1528 210 --23858 1615 --
NM_012395chr71322 42967 2634 2241 30 ----
NM_012425chr1012194 ----11721
NM_012428chr151392 ------
NM_012446chr5188 ------
NM_012475chr11223 ------
NM_013231chr1443513 3175 3020 2994 14196 22871 266 --
NM_013269chr1233814 2920 760 ----24008 361
NM_013279chr1152180 2119 1791 737 192 11561 ----
NM_013281chr2011428 --1400 --
NM_013381chr121691 ----1281
NM_013438chr931445 392 146 11453 ----
NM_013444chrX21148 865 ------
NM_013989chr1433141 1258 848 13643 ----
NM_014011chr231702 520 200 ------
NM_014016chr321237 1086 ------
NM_014021chr122858 1272 12568 ----
NM_014043chr34614 447 266 58 ------
NM_014048chr1643450 1150 814 322 21796 1305 21066 210 --
NM_014071chr20194 ------
NM_014089chr133822 648 358 --11488 --
NM_014106chr1552482 841 708 132 112 ------
NM_014110chr121158 985 1948 ----
NM_014112chr824710 920 14927 ----
NM_014155chr1166565 5424 4647 2306 2273 108 37117 980 698 ----
NM_014157chr1693419 3155 2506 1615 878 586 261 210 71 ------
NM_014171chr2166 ------
NM_014178chr141576 ------
NM_014181chr22490 347 22392 2016 ----
NM_014210chr171430 ------
NM_014217chr141200 1181 35 28 ------
NM_014233chr17----11757 --
NM_014240chr333653 3397 1274 11573 24071 1072 --
NM_014243chr441991 1760 1424 814 ------
NM_014253chrX12020 ------
NM_014267chr11279 55 ------
NM_014283chr111135 ------
NM_014296chr311053 ----11353
NM_014309chr2253605 1584 1435 660 641 21338 1197 ----
NM_014319chr1241422 770 417 407 ------
NM_014331chr425753 318 15023 25543 2111 --
NM_014333chr1122279 530 1930 22526 724 --
NM_014368chr931683 1569 361 --21996 1584 --
NM_014379chr82378 179 ------
NM_014382chr3------1554
NM_014415chr31323 --1494 --
NM_014431chr1061685 1641 395 187 44 32 ------
NM_014445chr332248 2065 334 ------
NM_014458chr1170 ------
NM_014491chr71743 ------
NM_014494chr1621586 1476 ------
NM_014500chrX193 ------
NM_014504chr731688 1475 124 ------
NM_014586chr2184853 4367 3183 1132 929 905 856 403 1793 11359 14835
NM_014587chr1651555 1269 1148 330 29 41104 1097 1050 1043 1449 --
NM_014614chr261429 1405 1388 1314 980 364 ------
NM_014615chr1643469 3058 1335 673 ----11436
NM_014616chr333463 3177 921 ------
NM_014634chr2283445 3044 2898 2579 2566 1364 539 293 --11432 --
NM_014636chr984028 3693 3613 3488 3057 986 435 334 13866 183 --
NM_014646chr1853185 2674 2177 1128 953 ------
NM_014665chr873567 3383 3175 3073 3031 2912 26 --23146 1181 12646
NM_014667chr352048 1828 953 734 667 ------
NM_014677chr831305 419 63 11346 ----
NM_014682chr832070 1586 596 ----1657
NM_014690chr763115 649 641 327 192 83 1897 1524 --
NM_014707chr722054 574 ------
NM_014717chr19----1142 --
NM_014721chr686766 5264 5081 4993 1358 1228 586 229 1798 12623 --
NM_014725chrX21261 1130 --2535 522 --
NM_014729chr832195 1650 70 ------
NM_014730chr1265118 3635 3300 3196 1098 862 ------
NM_014730chr1265118 3635 3300 3196 1098 862 ------
NM_014743chr472895 2640 2045 2019 1946 1233 1203 ------
NM_014746chr254406 3386 3251 1315 1182 33499 3059 2930 13475 --
NM_014747chr155795 5709 4827 4804 1995 22259 1883 --11502
NM_014752chr111274 ------
NM_014757chr532034 904 444 ------
NM_014765chr112471 ------
NM_014795chr221031 210 ------
NM_014803chr102804 221 1895 ----
NM_014810chr153106 2940 2847 2728 232 22833 144 12802 11125
NM_014812chr12415 64 21454 705 ----
NM_014822chr42473 222 ------
NM_014824chr112359 326 --11939 --
NM_014828chr1431925 685 267 1322 ----
NM_014839chr122506 734 ------
NM_014848chr1512492 --11856 1107
NM_014851chr122369 910 1100 31900 110 22 --
NM_014877chr1796478 6176 6042 5955 5128 4857 2696 2615 90 37258 2088 614 ----
NM_014891chr71152 ----11121
NM_014893chrY22352 897 --11476 --
NM_014897chr1732734 2601 58 12937 --12116
NM_014898chr1932070 1936 1857 1229 1537 2117 46
NM_014904chr1033545 2585 290 ------
NM_014905chr221783 361 1148 --11755
NM_014909chr1433799 2795 768 --1569 12712
NM_014914chr231149 1065 478 1248 --1294
NM_014916chr71295 ----1524
NM_014920chr643619 3190 2824 1536 ------
NM_014924chr1452918 2605 2137 1111 1034 --1870 --
NM_014926chr31781 ------
NM_014933chr41104 ------
NM_014946chr233088 1155 452 2969 101 ----
NM_014949chr11190 ------
NM_014950chr1431162 523 64 ------
NM_014953chr1374155 3790 3611 3571 3286 3035 1674 13124 ----
NM_014962chr2021906 1815 --1161 --
NM_014964chr1722093 622 --12236 11784
NM_014969chr131029 797 37 ------
NM_014975chr19131 ------
NM_014982chr1431608 682 483 ------
NM_014988chr452211 1854 1096 213 155 11788 1999 --
NM_014989chr651879 1873 1540 1510 373 1203 ----
NM_014991chr443045 2609 1063 970 ----1170
NM_015008chr333338 3230 646 ------
NM_015009chr33799 788 155 ----1709
NM_015011chr133952 799 351 1808 --1125
NM_015020chr1673340 3102 2830 2814 962 381 244 ------
NM_015026chr123517 300 162 13617 13658 --
NM_015032chr1312175 ------
NM_015033chr982948 2867 2065 1230 1095 644 389 66 12023 1267 --
NM_015044chr1632688 2317 919 --1226 --
NM_015049chr243015 1305 832 589 ------
NM_015061chr93832 558 361 --198 --
NM_015069chr161642 ------
NM_015071chr556310 5534 5110 2395 498 ----2842 631
NM_015074chr175002 3653 3597 1622 1081 963 627 14184 13297 --
NM_015076chr631729 816 440 --142 13194
NM_015077chr1734670 4457 3884 43935 3871 3499 1839 --2703 213
NM_015092chr1663915 3445 2873 1520 874 335 1166 ----
NM_015093chr63642 461 251 189 ----
NM_015100chr111290 --11537 --
NM_015110chr921713 292 ------
NM_015113chr175656 560 530 396 42 22013 1737 1186 --
NM_015115chr443174 2144 1161 119 12175 ----
NM_015143chr4164 ------
NM_015156chr1442970 2449 592 406 ----11172
NM_015161chr162318 166 1390 ----
NM_015172chr121522 574 1141 11581 --
NM_015176chr121296 184 ------
NM_015199chr332298 424 406 ------
NM_015200chr431746 580 192 1445 ----
NM_015208chr1823810 473 --22806 685 --
NM_015234chr611127 ------
NM_015238chr52496 446 ------
NM_015252chr22892 255 ------
NM_015264chr2274379 3196 1892 1647 1078 719 21 13607 11463 --
NM_015265chr211889 1300 --1180
NM_015271chr453826 3187 2931 1058 363 14278 ----
NM_015282chr252993 2603 2198 802 263 ------
NM_015310chr875398 2983 2919 2857 2384 837 157 27647 1591 ----
NM_015316chr1421231 1170 11332 11080 --
NM_015317chr242352 678 355 248 --22397 1126 --
NM_015335chr1232555 1662 670 1702 ----
NM_015347chr1232956 2045 446 --12335 --
NM_015349chr662060 828 821 632 195 134 ------
NM_015355chr1721932 1242 ------
NM_015358chr21151 ------
NM_015361chr21322 ------
NM_015365chrX13535 1816 12811 --
NM_015396chr31342 ----158
NM_015455chr553703 3307 2810 430 61 ------
NM_015483chr71292 --11075 --
NM_015520chr312220 21956 396 2494 234 2540 471
NM_015534chr14966 409 148 72 ------
NM_015541chr331381 1009 157 2424 139 ----
NM_015553chr644371 4292 4005 3599 24493 1523 ----
NM_015554chr1552795 2575 2231 2074 52 12757 174 --
NM_015555chr62419 187 ------
NM_015564chr522520 1319 13531 12735 --
NM_015567chr1321142 352 ----1122
NM_015576chr322917 2513 ------
NM_015633chr122147 111 --1119 --
NM_015635chr931971 1642 111 12161 --11874
NM_015651chr971822 1763 1752 1720 1547 390 60 ------
NM_015652chr101270 ------
NM_015686chrX3640 463 383 ----1840
NM_015713chr843471 3282 3083 943 ------
NM_015844chr182925 647 ------
NM_015846chr182925 647 ------
NM_015847chr182925 647 ------
NM_015852chr733201 3097 2352 2879 711 ----
NM_015949chr72938 384 --1256 1329
NM_015995chr1555472 5413 4354 1887 1150 23423 1111 45203 4001 3874 944 24720 3490
NM_015999chr11722 ------
NM_016019chr72224 126 ------
NM_016023chr812164 ------
NM_016045chr2011251 ------
NM_016053chr12----137 --
NM_016066chr1129 ------
NM_016076chr122692 1187 ----2840 177
NM_016081chr441853 631 503 407 ------
NM_016090chr112730 89 --1891 --
NM_016103chr51418 ------
NM_016107chr51152 ------
NM_016133chr22583 27 ------
NM_016152chr311046 ------
NM_016166chr151156 ------
NM_016200chr7141 ------
NM_016211chr41104 ------
NM_016213chr15129 ------
NM_016227chr111135 ------
NM_016230chr6----1152 --
NM_016231chr1711713 ------
NM_016240chr871634 1476 1376 1044 347 279 49 1171 1403 --
NM_016252chr21921 ----1171
NM_016257chr162953 2875 2277 588 380 369 --1259 --
NM_016260chr257521 6885 5239 905 628 ------
NM_016272chr2272764 1971 1882 647 589 405 147 ------
NM_016289chr21820 ------
NM_016297chr223475 1109 1141 ----
NM_016316chr22303 205 1500 ----
NM_016322chr953006 1162 1037 763 557 ------
NM_016333chr161501 ------
NM_016338chr521139 420 ------
NM_016339chr1731438 1425 1236 21497 119 11802 --
NM_016374chr141232 595 303 69 ----11468
NM_016374chr141232 595 303 69 ----11468
NM_016396chr1521108 980 22630 320 --1257
NM_016418chr2283354 3102 2968 1475 1214 1019 967 147 11240 21189 773 --
NM_016424chr1731635 1372 105 ------
NM_016441chr21119 ------
NM_016454chr151248 ------
NM_016472chr1451085 952 342 289 39 1324 ----
NM_016510chr21185 2253 239 154 2938 211
NM_016513chr643619 3190 2824 1536 ------
NM_016530chr1533637 3184 1450 --23450 65 --
NM_016531chr453710 2988 2923 487 197 ------
NM_016542chrX51252 1080 618 608 343 ------
NM_016564chr115885 252 141 44 27 1962 --1234
NM_016577chr354421 3817 2794 1423 1165 --1741 --
NM_016578chr111454 ------
NM_016620chr11379 ------
NM_016628chr101693 ------
NM_016654chr152471 78 ------
NM_016836chr2----2721 112 --
NM_016839chr2----2721 112 --
NM_016952chr1153499 2515 701 576 242 --21249 1193 --
NM_017415chr521385 276 21609 710 14411 14137
NM_017420chr1453150 2717 2605 1232 1024 1169 ----
NM_017455chr151392 ------
NM_017519chr621132 516 ------
NM_017522chr12925 319 11430 ----
NM_017544chrX1309 ------
NM_017563chr365700 5255 4065 3930 2331 639 --14184 --
NM_017575chr1741381 1357 1172 71 --21508 1016 --
NM_017628chr454529 1947 1505 541 291 --34288 4201 4011 --
NM_017633chr643826 3560 1004 659 42489 1256 477 352 ----
NM_017634chr831496 693 289 ------
NM_017635chr112271 140 1294 ----
NM_017637chr988171 7748 6644 3575 2719 2536 1050 768 13445 16882 --
NM_017643chr1722595 581 146 22021 75 --
NM_017644chr355144 3924 3801 1885 871 ------
NM_017658chr1431851 1683 788 ------
NM_017692chr9----1793 --
NM_017694chr241823 1714 102 58 1158 --11348
NM_017706chr571181 1132 973 838 432 353 218 ------
NM_017709chr114163 1230 --13959
NM_017714chr202765 703 ------
NM_017719chr342452 2004 877 461 11796 ----
NM_017740chr161683 --11194 --
NM_017744chr162181 2173 890 817 268 87 1862 ----
NM_017745chrX124 ------
NM_017762chr1552216 2166 1009 580 217 --12097 --
NM_017778chr82522 217 ------
NM_017787chr1082223 1790 985 669 652 204 166 100 12593 ----
NM_017813chr834826 2079 23 ------
NM_017831chr1863268 3124 3028 1800 1713 1502 14163 ----
NM_017860chr12303 88 ------
NM_017867chr4126 ------
NM_017896chr2033232 3056 1155 2471 354 12699 --
NM_017902chr1075738 4810 4228 2083 1443 1290 1034 12142 11278 11919
NM_017919chr954239 2319 1963 1858 1345 --33873 1426 473 13959
NM_017934chr6145 ------
NM_017944chr1122895 1129 1904 ----
NM_018025chr19183 ------
NM_018026chr1141283 1177 194 153 1565 ----
NM_018046chr551897 1425 1403 227 221 --21241 89 --
NM_018061chr131311 254 213 --11264 --
NM_018085chr157816 7794 7349 6107 6008 56770 5988 5510 1543 411 16445 1363
NM_018121chr1032296 540 110 1365 ----
NM_018159chrX1567 --21546 80 --
NM_018171chr123933 809 78 ------
NM_018184chr311535 --11793 --
NM_018246chr832501 2206 1748 ------
NM_018247chr62551 280 12815 ----
NM_018254chr121781 702 ----1370
NM_018287chr1041261 1239 1080 978 ------
NM_018293chr32963 808 ------
NM_018299chr842864 2652 2364 673 ------
NM_018312chr111160 ------
NM_018315chr41524 ------
NM_018328chr24373 129 49 25 ------
NM_018360chrX------1148
NM_018362chr1143307 852 579 240 11289 ----
NM_018364chr174092 3558 3444 1348 1124 577 202 --2450 421 --
NM_018374chr753422 1776 788 254 127 ------
NM_018388chrX----11304 --
NM_018403chr353088 3076 1244 814 696 --13394 --
NM_018409chr422314 121 --12650 --
NM_018424chr961752 1692 1369 1323 742 665 ------
NM_018433chr2130 ----1460
NM_018452chr6_random43576 2848 2626 656 3266 233 155 12754 --
NM_018482chr82350 72 12183 ----
NM_018509chr1711607 ------
NM_018566chr134365 1741 674 14683 ----
NM_018569chr41512 ------
NM_018584chr111214 ----1998
NM_018638chr1254975 3775 2116 2070 1596 ------
NM_018650chr12442 52 --1218 --
NM_018682chr71649 ------
NM_018695chr532084 175 58 21871 781 ----
NM_018708chr1971626 1619 1178 1107 651 590 72 1367 ----
NM_018717chr422486 838 1614 2490 477 12000
NM_018840chr201429 ----163
NM_018844chr731505 445 127 ------
NM_018898chr512259 ------
NM_018899chr512259 ------
NM_018900chr512259 ------
NM_018901chr512259 ------
NM_018902chr512259 ------
NM_018903chr512259 ------
NM_018904chr512259 ------
NM_018905chr512259 ------
NM_018906chr512259 ------
NM_018907chr512259 ------
NM_018908chr512259 ------
NM_018909chr512259 ------
NM_018910chr512259 ------
NM_018911chr512259 ------
NM_018948chr121397 1210 136 ----
NM_018963chr2121503 164 --1331 --
NM_018970chr722302 1150 ------
NM_018976chr1232533 1158 686 ------
NM_018993chr2041342 1300 291 135 ------
NM_018999chr1034944 4101 269 --13765 --
NM_019001chr353481 1946 1846 977 764 ------
NM_019004chr732020 178 34 --11563 --
NM_019022chr1822387 527 11155 ----
NM_019083chr121364 1347 ------
NM_019084chr1032499 1705 802 ------
NM_019096chr611100 ------
NM_019106chr2253064 2427 1022 377 98 1925 ----
NM_019595chr22729 207 ------
NM_019600chr15162 ------
NM_020122chr295644 5087 5040 5019 4652 4641 1327 1230 1156 ------
NM_020123chr1041393 988 62 46 11167 ----
NM_020132chr2174986 4868 4789 4624 4418 1708 1697 --1196 --
NM_020134chr251121 863 765 289 275 --1831 --
NM_020148chr1882315 2249 2131 2011 852 490 443 384 ------
NM_020205chr132471 1314 958 22134 148 ----
NM_020310chr1742002 1910 1827 1053 1544 1529 --
NM_020336chr2021517 635 1427 ----
NM_020337chr422696 127 1233 ----
NM_020338chr1063405 2983 2942 2745 2287 113 --22814 258 --
NM_020357chr311238 ------
NM_020432chr732028 1828 688 ------
NM_020449chrX1294 ------
NM_020466chr643839 3723 670 104 ------
NM_020474chr1821880 206 ------
NM_020475chr842046 1990 1694 980 129 1355 1258
NM_020476chr842046 1990 1694 980 129 1355 1258
NM_020477chr842046 1990 1694 980 129 1355 1258
NM_020478chr832109 2053 1757 192 1418 1321
NM_020480chr842046 1990 1694 980 129 1355 1258
NM_020640chr332293 730 63 ------
NM_020647chr842302 2109 1615 112 ------
NM_020706chr21163 ------
NM_020718chr1656353 4835 1600 1532 218 12575 ----
NM_020732chr621132 516 ------
NM_020734chr1231358 1273 283 1438 12086 --
NM_020742chrX42632 2425 2349 1045 --1961 --
NM_020750chr641531 1216 400 338 --1602 --
NM_020760chr251754 1744 1642 1258 518 ------
NM_020769chrX1850 ------
NM_020772chr1778341 5783 5755 3467 2218 1463 453 1122 ----
NM_020773chr482624 2462 2298 1981 1768 1027 951 250 ------
NM_020774chr181586 1232 --14441
NM_020800chr311191 ------
NM_020801chr512181 ------
NM_020806chr144730 694 585 75 ------
NM_020808chr121010 865 ------
NM_020809chr1121941 394 ------
NM_020810chr1453224 2907 2430 1135 1016 --1719 --
NM_020830chr252449 2327 2314 639 361 ------
NM_020841chr1273932 3921 3887 3266 2693 1333 832 ------
NM_020850chr1652001 1093 765 632 71 --11051 --
NM_020856chr1921489 152 ------
NM_020921chr1412926 ----12942
NM_020922chrX41871 1585 1271 725 ------
NM_020925chr121406 1158 ------
NM_020935chr244637 4131 996 385 1320 ----
NM_020948chr142681 2303 1374 760 ------
NM_020964chr1884557 4175 3644 3506 3157 1502 1216 708 ------
NM_020993chr1242786 2372 1881 680 1989 22155 667 --
NM_021003chr14151 ------
NM_021012chr1773105 2979 1991 1236 1215 487 215 11179 12783 --
NM_021033chr133520 255 239 1931 --11337
NM_021069chr431547 757 567 ------
NM_021072chr512496 --12337 --
NM_021090chr2243565 1817 816 118 --1930 --
NM_021120chrX52968 2247 1141 1064 369 12744 1270 --
NM_021132chr10----1880 --
NM_021140chrX2882 808 ------
NM_021148chr761875 1768 1670 972 745 641 ----1111
NM_021213chr1721089 847 ------
NM_021255chr143750 494 431 34099 3566 1204 1527 --
NM_021260chr141350 --1365 11008
NM_021620chr61735 ------
NM_021622chr1052401 1993 1460 614 566 ----12110
NM_021629chr335068 4240 408 ------
NM_021647chr444771 4149 1623 1047 11821 ----
NM_021724chr17139 ------
NM_021813chr643863 1518 836 272 24418 1792 ----
NM_021817chr11317 ------
NM_021871chr42179 24 ------
NM_021911chr585280 3913 3649 3589 2085 1802 605 56 ------
NM_021912chr1533042 1527 902 2287 211 --14028
NM_021934chr121253 ------
NM_021945chr653570 2834 2653 1153 1109 11049 2835 51 --
NM_021946chrX11444 --11458 --
NM_021961chr1167104 5127 2383 2349 215 108 ------
NM_021962chr1762395 1931 1762 961 882 717 ------
NM_021964chr376056 5724 4866 2213 744 384 88 ----14417
NM_021977chr653207 2453 511 395 249 ------
NM_022048chr1521870 250 15648 15193 --
NM_022116chr74824 129 59 37 ------
NM_022130chr52510 315 ----1158
NM_022137chr1451451 1398 1389 1363 722 12009 1380 --
NM_022143chr7166 2417 410 11211 --
NM_022166chr1685897 4623 3947 1975 1170 999 360 263 35683 4568 1323 ----
NM_022171chr341549 1187 1121 135 11097 ----
NM_022340chr333537 3310 118 13092 12331 --
NM_022373chr71108 ------
NM_022444chr721327 778 ------
NM_022459chr1376281 5706 5523 5015 1968 1407 331 --11433 --
NM_022462chr1953408 2892 2300 1157 395 13552 13420 181
NM_022474chr1442372 1809 952 797 ------
NM_022574chr71449 ----2549 98
NM_022650chr51255 ------
NM_022652chr122249 218 --1295 --
NM_022728chr7----1711 --
NM_022730chr21660 --11043 --
NM_022745chr131200 309 296 12395 1612 --
NM_022755chr972568 2273 959 610 542 521 495 --11708 --
NM_022757chr3----2988 309 --
NM_022802chr1041293 542 422 311 --1531 1515
NM_022841chr1562358 2347 2271 1920 489 330 11024 1723 --
NM_022842chr332929 2119 1263 11340 1294 --
NM_022843chr132180 141 ------
NM_022845chr1651734 903 754 557 537 --12070 --
NM_022898chr1434406 633 33 ------
NM_022900chr711073 ------
NM_022902chr52396 101 ------
NM_022912chr222850 2575 1824 12208 --
NM_022977chrX2895 184 --1564 --
NM_023000chr1411537 ------
NM_023001chr1411537 ------
NM_023079chr1741775 1755 532 312 1255 --11826
NM_023929chr822073 369 ----1179
NM_024007chr523065 894 ------
NM_024076chr1942124 2075 549 161 1880 1659 --
NM_024090chr441789 1636 640 486 1339 ----
NM_024117chr91312 --1125 11189
NM_024297chr171549 ------
NM_024345chr985463 5321 2439 1549 1082 816 549 174 1926 --26114 5393
NM_024524chr332943 2734 410 1922 --1301
NM_024551chr1231918 645 530 ------
NM_024551chr1231918 645 530 ------
NM_024556chr111472 ------
NM_024565chr52531 264 ----11532
NM_024612chr1711107 ------
NM_024645chr831321 1212 461 ----1543
NM_024646chr143970 3115 2665 725 133 ----
NM_024652chr153982 952 493 --1804 --
NM_024657chrX1512 ------
NM_024665chr31424 ------
NM_024674chr142358 1224 895 837 ----11161
NM_024704chr2031041 924 276 ------
NM_024721chr832220 1817 601 12405 ----
NM_024740chr1153376 3201 3065 1452 248 31535 573 332 ----
NM_024761chr953688 1875 1867 1569 301 11941 ----
NM_024770chr2106315 6277 4298 2413 1921 1696 1111 590 175 129 11082 ----
NM_024786chr56786 765 744 677 612 120 ------
NM_024795chr24570 435 348 340 ----1290
NM_024828chr921495 1345 ------
NM_024835chr172432 310 ------
NM_024881chr1943073 2994 1058 479 1161 --1491
NM_024884chr1443298 1197 1061 892 24148 3183 ----
NM_024887chr121891 1822 11404 21607 799 --
NM_024915chr812144 ----22099 580
NM_024930chr562002 1932 1807 1056 958 365 --1517 --
NM_024947chr377574 7439 7137 2114 1189 215 155 19557 --1818
NM_024949chr454332 3938 3744 3136 1708 23713 3190 ----
NM_024953chr1242783 2700 2196 600 ------
NM_024993chr22551 274 11106 ----
NM_025073chr144290 4019 3820 1478 13094 ----
NM_025106chr131878 1733 179 --11426 --
NM_025154chr721346 1327 ------
NM_025187chr1631100 1058 361 ------
NM_025221chr4183 ------
NM_025222chr342953 2695 2673 1078 ------
NM_025238chr152636 241 ------
NM_030583chr81341 1371 --1969
NM_030629chr1611353 ------
NM_030648chr465124 4704 4033 1554 970 706 15154 ----
NM_030660chr1411261 --165 --
NM_030674chr1274888 4390 4073 3594 2286 1636 979 13931 14053 1114
NM_030755chr1442803 2578 1191 192 1584 ----
NM_030806chr199113 8789 8134 7564 7531 6889 6677 2896 2187 11443 19373 16836
NM_030816chr122817 2537 11110 ----
NM_030820chr6----11062 --
NM_030821chr41718 ------
NM_030881chr2232056 1731 1584 ----12395
NM_030918chr1114463 3998 3816 3761 2188 2102 1962 1385 448 211 126 24047 3328 ----
NM_030978chr91385 ------
NM_031268chr1685204 5003 4715 4238 3750 1651 1543 1330 ----11214
NM_031309chr872128 2077 2027 1862 1637 1460 373 --1416 --
NM_031314chr1451999 1932 1542 1431 329 ------
NM_031371chr141232 595 303 69 ----11468
NM_031371chr141232 595 303 69 ----11468
NM_031411chr512259 ------
NM_031417chr1962829 2674 2378 2034 1764 444 1332 1116 --
NM_031427chr1475751 5355 5272 4826 2241 1956 673 35884 1443 1223 14625 --
NM_031431chr1321765 1581 1169 ----
NM_031449chr741897 1793 896 701 11624 ----
NM_031461chr8186 ------
NM_031468chr797865 7805 5997 5786 5529 3094 2188 2121 1847 12992 ----
NM_031492chr111504 ------
NM_031844chr164109 4061 3985 2557 1533 1175 ------
NM_031849chr512259 ------
NM_031857chr512259 ------
NM_031860chr512259 ------
NM_031953chr41332 ------
NM_032012chr964717 4350 3962 1573 999 914 --12103 --
NM_032160chr1874078 3882 3749 3120 2878 1274 136 ------
NM_032186chr11379 ------
NM_032199chr1031114 911 590 13090 ----
NM_032221chr2051735 1279 449 433 216 --11336 21347 420
NM_032229chr1341099 1067 853 108 1281 ----
NM_032357chr23822 248 33 1234 ----
NM_032364chr123716 389 246 ----157
NM_032373chr1033898 1587 68 ------
NM_032376chr17----3484 221 32 --
NM_032408chr71480 ------
NM_032410chr81459 ------
NM_032415chr71186 ------
NM_032439chr1011099 ------
NM_032440chr101138 ------
NM_032442chr174443 422 170 29 --1102 1128
NM_032445chr1522519 88 1999 ----
NM_032457chr453884 3055 1021 941 539 ------
NM_032458chrX32543 1187 157 ------
NM_032482chr1962469 2072 2034 1922 1906 932 1156 --1830
NM_032491chr1211284 ------
NM_032539chrX1679 ------
NM_032552chr951893 1514 760 205 37 1652 ----
NM_032569chr1641579 525 304 147 ------
NM_032575chr1611976 ------
NM_032626chr16----1319 --
NM_032682chr331103 447 101 --13387 --
NM_032777chr841375 1313 285 130 11188 ----
NM_032784chr61157 ------
NM_032810chr104540 259 162 21 ------
NM_032828chr19104460 4391 4270 3254 3121 1912 1773 1466 1334 406 24550 56 ----
NM_032859chr1343733 3408 2890 709 ------
NM_032869chr81361 --1701 1384
NM_032873chr1131717 1170 299 1766 13643 14190
NM_032932chr1786448 5911 5904 5628 4492 4140 4039 922 12010 15366 15435
NM_032968chrX41437 663 280 239 ------
NM_032969chrX41437 663 280 239 ------
NM_032973chrY41437 663 280 239 ------
NM_032983chr762517 2278 2143 898 728 235 2863 472 --1204
NM_033132chr1332172 1854 1576 1686 12227 --
NM_033161chr92784 125 ----1326
NM_033211chr531308 279 172 1159 ----
NM_033222chr91385 --196 --
NM_033225chr842913 1984 823 711 ------
NM_033260chr61801 ------
NM_033300chr12925 319 11430 ----
NM_033326chr1132452 1837 402 11986 ----
NM_033331chr933338 2779 2193 ------
NM_033360chr12--1955 --13658
NM_033394chr2------11209
NM_033401chr16----2134 96 --
NM_033421chr20----3583 263 209 --
NM_033496chr102469 160 ------
NM_033497chr102469 160 ------
NM_033498chr102469 160 ------
NM_033500chr102469 160 ------
NM_033503chr1543789 3659 3532 751 --11320 --
NM_033632chr41524 ------
NM_033637chr1043725 3109 2767 1462 ------
NM_033642chrX11095 --11174 --
NM_033644chr512377 ------
NM_033645chr512377 ------
NM_033656chr2135093 2258 728 --2914 196 --
NM_052855chr174499 461 202 118 ------
NM_052896chr142321 2289 617 91 ------
NM_052904chr6----1928 11186
NM_052905chr221327 28 ------
NM_052907chr1244290 4036 3277 380 ----13229
NM_052918chr1083638 3000 2480 2414 1491 1390 1232 23 1756 22337 399 1627
NM_052923chr61190 ------
NM_052932chr111129 ------
NM_052937chr822051 665 ------
NM_052978chr1431885 1214 82 11670 ----
NM_053016chr988014 7689 6918 5895 5551 5364 5171 2274 26954 5635 15689 --
NM_053023chr1132548 998 983 ------
NM_053043chr795377 5283 5214 5206 2258 2212 1410 150 76 15955 194 --
NM_057178chr1721818 33 ----12674
NM_079421chr192496 118 ------
NM_080626chr122296 272 ------
NM_080629chr12394 119 ------
NM_080630chr12394 119 ------
NM_080645chr641858 1637 1418 713 ------
NM_080669chr1773950 3651 1775 1365 389 300 214 11413 --13510
NM_080683chr41423 ------
NM_080684chr41423 ------
NM_080685chr41423 ------
NM_080743chr631792 402 310 ------
NM_080759chr1362273 2042 1825 1733 808 477 ------
NM_080760chr1362273 2042 1825 1733 808 477 ------
NM_080798chr101145 ------
NM_080799chr101145 ------
NM_080800chr101145 ------
NM_080801chr101145 ------
NM_080802chr101145 ------
NM_080803chr101145 ------
NM_080804chr101145 ------
NM_080805chr101145 ------
NM_080806chr101145 ------
NM_080807chr101145 ------
NM_080808chr101145 ------
NM_080809chr101145 ------
NM_080810chr101145 ------
NM_080811chr101145 ------
NM_080812chr101145 ------
NM_080813chr101145 ------
NM_080814chr101145 ------
NM_080815chr101145 ------
NM_080872chr834030 2644 905 23744 2591 ----
NM_080921chr131195 966 186 ------
NM_080927chr342604 2551 375 186 ----1140
NM_100264chr101693 ------
NM_100486chr101693 ------
NM_130391chr943406 2909 73 34 ------
NM_130392chr943406 2909 73 34 ------
NM_130393chr943406 2909 73 34 ------
NM_130438chr2153381 1186 1089 465 428 23049 1294 ----
NM_130768chr7--1116 --1330
NM_130838chr151292 ------
NM_130839chr151292 ------
NM_130847chr11104885 3586 2285 2073 1996 1867 1515 869 284 28 12114 --12017
NM_130848chr562124 1338 806 645 551 36 21503 1455 ----
NM_133170chr20117807 7467 7239 6840 5949 2242 2188 2177 1904 1643 147 36530 3196 1352 17125 --
NM_133264chr1752775 1355 1320 1197 1177 13319 ----
NM_133334chr465543 4913 4732 4146 1934 312 --35960 5265 1545 --
NM_133338chr51440 ------
NM_133339chr51440 ------
NM_133340chr51440 ------
NM_133341chr51440 ------
NM_133342chr51440 ------
NM_133343chr51440 ------
NM_133344chr51440 ------
NM_133370chr453549 3173 2506 1418 1376 13470 ----
NM_133372chr552731 2535 2076 415 137 1963 ----
NM_133445chr943116 1477 1421 989 ----12936
NM_133493chr633797 566 166 24459 4118 ----
NM_133496chr194148 3438 3175 3040 2961 1563 1526 947 633 --11089 --
NM_133638chr5--1550 --11406
NM_138328chr1763399 3240 2617 2604 778 50 22860 1350 ----
NM_138333chr931649 810 365 11797 ----
NM_138357chr1011697 2745 406 11674 --
NM_138423chr153852 548 346 --1331 --
NM_138459chr643244 3186 2636 2356 ------
NM_138468chr285709 5694 5142 1872 1838 1143 759 101 ------
NM_138479chr1------1271
NM_138558chr121158 985 1948 ----
NM_138576chr1434406 633 33 ------
NM_138621chr243543 2734 851 774 11028 11125 --
NM_138713chr1657355 1252 709 480 304 12800 21829 980 --
NM_138714chr1657355 1252 709 480 304 12800 21829 980 --
NM_138727chr162181 2173 890 817 268 87 1862 ----
NM_138728chr162181 2173 890 817 268 87 1862 ----
NM_138735chr211068 ------
NM_138773chr5----1164 --
NM_138782chr5----12087 --
NM_138792chr15141 ------
NM_138811chr711038 ------
NM_138923chrX186 ------
NM_138959chr156130 5612 1742 1600 803 --26617 836 22191 1521
NM_138994chr16----2134 96 --
NM_139135chr1----11028 --
NM_139136chr12143 ------
NM_139207chr1221511 280 ------
NM_139278chr8----1143 --
NM_139323chr201413 ------
NM_144567chr172455 1995 1858 1019 886 544 479 ------
NM_144571chr465815 2633 2055 1335 587 50 14700 ----
NM_144582chr242176 1885 1734 1045 ------
NM_144583chr241736 1650 1557 1339 --21615 450 --
NM_144599chr15134919 4725 4705 4553 4039 4020 3589 1676 1042 989 963 932 423 34269 1415 1033 13626 --
NM_144633chr331239 1036 418 --1214 --
NM_144710chr221505 21 ------
NM_144722chr53415 372 217 ------
NM_144949chr231702 520 200 ------
NM_144963chr822623 575 ------
NM_144979chr41228 ------
NM_145036chr171312 ------
NM_145055chr1833485 882 602 12730 11272 --
NM_145117chr1162750 2473 581 514 455 439 1991 ----
NM_145176chr663183 3053 956 713 409 70 ------
NM_145259chr246154 1686 1231 114 ------
NM_145279chr171464 1420 1247 1175 760 393 49 ------
NM_145305chrX11006 ------
NM_145735chr1352836 2760 2447 570 361 ------
NM_145808chr732639 2110 499 ------
NM_147150chr932669 2434 2422 1794 11373 1416
NM_147181chr4183 ------
NM_147182chr4183 ------
NM_147183chr4183 ------
NM_147223chr242406 2267 2072 55 12338 ----
NM_148898chr71743 ------
NM_148899chr71743 ------
NM_148921chr1722093 622 --12236 11784
NM_152253chr2254024 3114 1091 852 234 --24047 2823 1344
NM_152261chr1232273 2216 171 ------
NM_152271chr82887 195 ------
NM_152424chrX4626 590 458 30 ----14091
NM_152455chr1541799 985 698 283 ------
NM_152470chr1833788 3539 752 --11126 --
NM_152475chr1932238 2169 2048 22329 56 ----
NM_152519chr232060 748 572 11783 ----
NM_152520chr211014 --1214 --
NM_152529chr224418 4165 1194 21429 159 --
NM_152622chr563497 3049 908 461 377 70 --12764 --
NM_152629chr973776 3426 3124 2962 734 485 402 ------
NM_152678chr332352 1765 128 12324 ----
NM_152688chr61232 ------
NM_152699chr372957 2821 2371 1142 1046 625 355 ------
NM_152724chr1012194 ----11721
NM_152739chr71712 ------
NM_152745chr711061 ------
NM_152756chr523175 288 21219 683 ----
NM_152758chr832994 2291 285 ------
NM_152787chrX93279 2602 2433 1264 1014 960 872 690 111 ------
NM_152835chr122553 2014 1893 ----
NM_152838chr2011111 --13233 --
NM_152902chr141858 300 148 103 1386 ----
NM_152924chr15106395 6219 5389 5259 4853 2572 2343 2297 1941 1674 26687 2540 24946 1695 --
NM_153020chr61680 ------
NM_153029chr1654133 3985 2570 960 125 ------
NM_153050chr2243565 1817 816 118 --1930 --
NM_153051chr2243565 1817 816 118 --1930 --
NM_153207chr1232664 1066 725 --13897 --
NM_153365chr4--1181 --12341
NM_153499chr1243074 3053 2731 993 ------
NM_153500chr1243074 3053 2731 993 ------
NM_153607chr542821 2260 967 257 ------
NM_153686chr442180 2156 799 474 1530 ----
NM_153695chr92230 99 --1236 --
NM_153748chr12143 ------
NM_153810chr1075135 4871 4457 4059 913 456 74 14151 24949 1291 --
NM_153819chr111167 ------
NM_153831chr821029 376 ------
NM_153836chr22623 608 11973 ----
NM_170665chr1294586 4324 4288 4196 3426 1538 1496 267 212 1999 11020 --
NM_170674chr1541187 255 215 102 ------
NM_170675chr151863 ------
NM_170676chr151863 ------
NM_170677chr1541187 255 215 102 ------
NM_170696chr151175 ----1290
NM_170697chr151175 ----1290
NM_170751chr651352 1314 1257 499 243 ------
NM_170752chr651352 1314 1257 499 243 ------
NM_172058chr871848 719 657 630 244 120 28 ------
NM_172059chr871848 719 657 630 244 120 28 ------
NM_172060chr871848 719 657 630 244 120 28 ------
NM_172071chr146956 6206 2333 1842 1926 155 --
NM_172159chr32335 58 ------
NM_172160chr32335 58 ------
NM_172226chr1243074 3053 2731 993 ------
NM_172315chr1541187 255 215 102 ------
NM_172316chr1541187 255 215 102 ------
NM_173214chr1657355 1252 709 480 304 12800 21829 980 --
NM_173468chr475852 5577 5115 3741 2232 1944 1098 ------
NM_173469chr1521536 400 ------
NM_173476chr1662277 1911 1746 1679 586 559 21961 1603 21610 78 --
NM_173495chrX42142 1861 973 867 11845 ----
NM_173508chr1191 ------
NM_173531chr1943720 3592 3449 3196 2781 373 ----
NM_173642chr167891 5964 2456 1976 611 96 22538 365 18621 --
NM_173653chr3----182 --
NM_173797chr511222 ------
NM_173808chr154070 3528 1574 932 70 11512 13846 --
NM_173851chr863739 3348 3039 2976 2501 333 11115 13875 --
NM_174929chr741897 1793 896 701 11624 ----
NM_175069chr9----1979 --
NM_175071chr9----1793 --
NM_175607chr33598 561 457 ------
NM_175610chr1521159 495 ------
NM_175612chr33598 561 457 ------
NM_175733chr1122122 876 ------
NM_175852chr162859 2796 698 247 215 168 ------
NM_175861chr1245130 4064 3958 613 25295 28 ----
NM_175863chr621132 516 ------
NM_175866chr111075 ------
NM_175876chr12657 454 --1356 12178
NM_175907chr181830 11135 --21907 778
NM_176814chr711163 ------
NM_176871chr893326 3087 2438 2351 2083 1281 809 785 559 12681 ----
NM_177398chr141893 1519 473 190 ------
NM_177399chr141893 1519 473 190 ------
NM_177424chr121801 761 ------
NM_177538chr2127567 7433 7303 6375 5928 5772 3309 2304 1856 1209 380 192 ------
NM_177553chr111754 ------
NM_177559chr20----1932 --
NM_177560chr20----1932 --
NM_177952chr14151 ------
NM_177974chr153852 548 346 --1331 --
NM_177996chr2042951 2200 546 509 2855 187 --13189
NM_178011chr1063078 3036 1205 999 649 355 ------
NM_178140chr542064 1862 99 72 ----11808
NM_178151chrX106729 6096 5913 5195 5052 2649 2483 1566 1407 689 11735 ----
NM_178152chrX106729 6096 5913 5195 5052 2649 2483 1566 1407 689 11735 ----
NM_178153chrX106729 6096 5913 5195 5052 2649 2483 1566 1407 689 11735 ----
NM_178423chr731067 321 102 ------
NM_178425chr731067 321 102 ------
NM_178426chr132182 1818 1559 --1571 --
NM_178427chr132082 1718 1459 --1471 --
NM_178439chr21157 ------
NM_178441chr141350 --1365 11008
NM_178539chr1221322 53 ------
NM_178554chr362959 2366 2300 1226 977 825 22845 150 12552 --
NM_178557chr441699 1623 1284 344 --11355 --
NM_178565chr821143 215 ------
NM_178566chr941266 232 53 21 ----1529
NM_178584chr221505 21 ------
NM_178585chr443045 2609 1063 970 ----1170
NM_178812chr82397 87 ------
NM_178842chr1561625 1474 541 509 359 30 22215 1544 ----
NM_180976chr631030 959 22 1318 2931 214 --
NM_180977chr631030 959 22 1318 2931 214 --
NM_181332chrX42632 2425 2349 1045 --1961 --
NM_181351chr1132432 2031 398 --12053 1854
NM_181358chr143601 3403 2851 2652 --11557 --
NM_181443chr2021906 1815 --1161 --
NM_181481chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_181482chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_181483chr1855102 2085 1363 913 75 36568 1412 1190 ----
NM_181504chr521031 467 ----1963
NM_181521chr1666705 5343 4827 2718 849 520 --1267 --
NM_181523chr521031 467 ----1963
NM_181524chr521031 467 ----1963
NM_181672chrX3814 141 94 11297 1244 --
NM_181673chrX3814 141 94 11297 1244 --
NM_181689chr201892 --1284 284 67
NM_181705chr554737 3529 1845 1006 527 ------
NM_181782chr62446 391 ------
NM_181828chr2283354 3102 2968 1475 1214 1019 967 147 11240 21189 773 --
NM_181829chr2283354 3102 2968 1475 1214 1019 967 147 11240 21189 773 --
NM_181830chr2283354 3102 2968 1475 1214 1019 967 147 11240 21189 773 --
NM_181832chr2283369 3117 2983 1490 1229 1034 982 162 11255 21204 788 --
NM_181847chr1221387 1377 11353 ----
NM_182503chr685419 2230 2035 1940 1233 1031 1017 823 13436 ----
NM_182515chr1995301 5166 5079 4864 1988 1896 1853 1766 324 ----22592 639
NM_182527chr2251751 1713 685 629 519 --2448 441 1312
NM_182607chrX41635 1339 604 470 --21284 371 --
NM_182643chr852097 1962 1846 835 450 ------
NM_182663chr122085 1701 ----1416
NM_182664chr122215 1831 ----1546
NM_182665chr122085 1701 ----1416
NM_182666chr31242 ------
NM_182710chr112297 263 ------
NM_182715chr72825 397 --11147 --
NM_182758chr1522913 906 ----11095
NM_182789chr51220 ------
NM_182898chr766109 4865 4243 2595 1468 1245 15897 ----
NM_182899chr766109 4865 4243 2595 1468 1245 15897 ----
NM_182907chr61303 --1969 --
NM_182931chr71649 ------
NM_182964chr1162750 2473 581 514 455 439 1991 ----
NM_182970chr2043807 3139 1383 684 23260 1492 ----
NM_182978chr182721 662 ------
NM_183043chr132363 337 --1915 --
NM_183044chr132363 337 --1915 --
NM_183078chr693344 2959 2911 2639 1501 1077 944 857 707 ------
NM_183323chr51220 ------
NM_183376chr1522483 1724 12578 --1439
NM_183381chr31812 ------
NM_183383chr31812 ------
NM_183384chr31812 ------
NM_183397chr2065044 4463 4422 3509 1599 309 ------
NM_194247chr243145 1253 873 423 --11267 --
NM_194278chr1464011 3849 3667 3374 2887 983 13676 23142 90 13818
NM_194283chr52754 710 23829 2993 1292 --
NM_194285chr1153400 2641 2507 1312 662 ------
NM_194286chr1265689 2461 1875 1474 1113 779 35589 896 374 ----
NM_194292chr121491 1337 ------
NM_194317chr232741 2428 219 12052 ----
NM_194434chr1864493 1991 1339 1199 885 118 ------
NM_197941chr583044 2811 2415 2286 947 844 679 251 1881 12142 --
NM_197962chr1129 ------
NM_198053chr13926 668 356 2832 63 1933 1126
NM_198066chr1452940 2555 2099 1912 532 11898 12179 --
NM_198158chr321922 929 32798 2734 2271 ----
NM_198159chr321922 929 32798 2734 2271 ----
NM_198177chr321922 929 32798 2734 2271 ----
NM_198178chr321922 929 32798 2734 2271 ----
NM_198179chr41618 ------
NM_198268chr143601 3403 2851 2652 --11557 --
NM_198269chr143601 3403 2851 2652 --11557 --
NM_198270chrX1233 ------
NM_198273chr532861 2317 971 ------
NM_198390chr1611353 ------
NM_198391chr2011428 --1400 --
NM_198581chr2107001 6684 6477 5740 5412 5275 5112 4978 4808 426 ------
NM_198793chr313743 11334 1527 --
NM_198830chr173210 156 66 --1133 --
NM_198834chr1732079 823 430 1602 11694 2259 93
NM_198836chr1732079 823 430 1602 11694 2259 93
NM_198837chr1732079 823 430 1602 11694 2259 93
NM_198838chr1732079 823 430 1602 11694 2259 93
NM_198839chr1732079 823 430 1602 11694 2259 93
NM_198881chrX----1483 --
NM_198904chr512018 ------
NM_198990chr742837 662 379 275 ------
NM_199000chr71740 2719 522 --1902
NM_199044chr122187 981 1311 --12392
NM_199131chr1042693 2492 1468 732 --1553 --
NM_199160chr931624 1510 302 --21937 1525 --
NM_199229chr231768 1507 571 ------
NM_199320chr432694 2335 870 21948 1134 ----
NM_199320chr432694 2335 870 21948 1134 ----
NM_199328chr211884 1126 ----
NM_199436chr233088 1155 452 2969 101 ----
NM_201269chr11379 ------
NM_201348chr143722 1504 637 609 --1647 12713
NM_201403chr171464 1420 1247 1175 760 393 49 ------
NM_201412chr161145 ------
NM_201413chr211801 ------
NM_201414chr211801 ------
NM_201545chr141490 1183 450 326 11201 ----
NM_201613chr121848 140 ----
NM_203301chr1431589 1246 1135 ------
NM_203342chr133113 1298 947 12913 13439 12243
NM_203343chr133113 1298 947 12913 13439 12243
NM_203350chr1137 ------
NM_203390chr811280 --21746 1197 --
NM_203446chr2142960 2288 951 493 ------
NM_203459chr132602 2540 2496 ------
NM_203504chr42941 839 --1778 --
NM_203505chr42941 839 --1778 --
NM_205861chr121891 1822 11404 21607 799 --
NM_206853chr633735 3486 3416 ------
NM_206854chr644996 4747 4677 3413 ------
NM_206855chr665961 5712 5642 4378 776 350 ------
NM_206860chr101351 --1361 --
NM_206861chr101351 --1361 --
NM_206862chr101351 --1361 --
NM_206907chr552511 1121 765 632 291 --1132 --
NM_206909chr875398 2983 2919 2857 2384 837 157 27647 1591 ----
NM_207171chr111290 --11537 --
NM_207303chr1084085 3005 1518 1493 630 379 195 119 13714 ----
NM_207325chr1932023 1326 676 ------
NM_207337chr121420 ------
NM_207371chr10------163
NM_207380chr1532510 1146 1135 23148 2707 33338 3115 219 12744
NM_207406chr476308 5652 5385 4293 2592 2438 583 1485 --15342
NM_207481chr21536 ----11269
NM_207517chr1531781 1438 345 ------
NM_212502chr131409 994 372 --11267 --
NM_212503chr131409 994 372 --11267 --
NM_213589chr295536 5246 5142 4167 1960 1721 680 300 169 13779 11142 --
NM_213594chr1211284 ------