TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1915-3p
miRNA Sequence: CCCCAGGGCGACGCGGCGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51383 ------
NM_000029chr12170 46 ------
NM_000044chrX1411 --197 --
NM_000046chr562330 2124 1146 1078 301 91 11065 --2731 255
NM_000052chrX33372 2349 1254 --13323 --
NM_000053chr1391848 1684 1601 1288 678 646 257 163 119 1584 ----
NM_000068chr191260 11545 ----
NM_000084chrX85876 5054 4910 4485 4436 2049 1522 162 11155 11368 14427
NM_000088chr1721140 544 --2535 385 --
NM_000089chr71736 ------
NM_000092chr264479 3924 2826 1840 344 151 11097 23054 3018 --
NM_000094chr33305 79 36 ------
NM_000103chr1541197 430 377 26 ------
NM_000109chrX12322 ------
NM_000129chr621282 28 ------
NM_000138chr1531006 990 925 1763 11960 --
NM_000168chr742997 2323 2242 2129 ------
NM_000176chr512982 11577 13055 --
NM_000189chr24618 595 355 96 1435 ----
NM_000191chr12509 141 --126 --
NM_000202chrX23686 2639 13606 ----
NM_000208chr1994557 4423 4376 3188 3023 1607 1035 69 54 23371 1181 13742 --
NM_000210chr221812 426 ------
NM_000217chr1264206 3692 2053 1857 1823 794 14689 34678 4586 646 14638
NM_000232chr432534 2185 1169 12419 ----
NM_000238chr7167 --1277 1143
NM_000248chr332456 1955 358 ------
NM_000259chr15105803 4260 4240 4145 3988 2407 2260 1703 1317 1293 24099 1249 23910 910 14441
NM_000262chr2271668 1214 560 537 478 221 60 21561 453 11148 --
NM_000264chr962890 2057 2050 1005 566 236 13026 ----
NM_000266chrX4968 754 258 210 1404 --1178
NM_000268chr2283745 3564 2550 2342 1245 1239 840 588 53103 2486 2286 1508 348 23610 1092 --
NM_000271chr18--1174 ----
NM_000278chr1031544 1450 754 ----1547
NM_000288chr61134 --1264 --
NM_000304chr17------1928
NM_000314chr101550 ------
NM_000318chr852778 2720 2660 2026 2003 1869 --1342
NM_000319chr121213 --1408 --
NM_000329chr1--1848 ----
NM_000332chr666744 6638 6373 4364 2247 501 ------
NM_000337chr5116470 6112 4710 4364 4163 4149 2150 1662 1602 1340 605 11022 ----
NM_000362chr22112714 2318 2235 1435 1396 1375 1336 1294 848 178 54 1230 22772 2333 --
NM_000376chr12102938 2667 2641 2569 2541 2446 2396 515 103 27 12426 32691 2385 687 --
NM_000399chr103858 364 263 1475 ----
NM_000411chr2142911 2781 2561 444 22790 2277 12734 1186
NM_000412chr33322 311 273 ------
NM_000430chr1753309 2897 1185 234 39 22563 2292 11300 --
NM_000434chr61123 ------
NM_000435chr194881 870 737 27 1238 ----
NM_000439chr532077 1860 616 2839 344 ----
NM_000442chr172249 27 ------
NM_000448chr11----150 22613 2263
NM_000449chr11494 --1192 11271
NM_000450chr131298 89 32 ----11615
NM_000461chr373331 3254 1610 1484 1098 302 132 ------
NM_000462chr1521720 1431 ------
NM_000474chr7191 ------
NM_000478chr14621 558 253 163 ------
NM_000486chr1292867 2797 2448 2154 1008 790 684 317 125 12789 22033 368 --
NM_000494chr103827 279 26 ------
NM_000505chr5130 ------
NM_000555chrX127688 6461 5804 5752 5294 5242 3139 2278 700 616 474 448 --1181 15715
NM_000557chr206343 193 159 111 61 25 ----1429
NM_000572chr12866 66 1785 --2963 75
NM_000598chr72575 478 --11530 --
NM_000599chr283973 3816 3391 3117 2858 622 427 421 22960 1096 ----
NM_000610chr1182948 2426 2373 2263 1942 934 740 593 1522 21051 432 1384
NM_000615chr1172365 2116 2039 2005 1968 923 631 ------
NM_000618chr1245382 2385 1174 203 --34182 1372 1244 --
NM_000618chr1245382 2385 1174 203 --34182 1372 1244 --
NM_000626chr175438 151 91 39 25 1352 ----
NM_000633chr1884504 3477 3299 1574 1360 1016 872 563 --31255 1160 507 --
NM_000635chr1941643 1587 496 305 --1220 157
NM_000684chr1011279 ------
NM_000687chr20----2689 122 --
NM_000688chr31123 ------
NM_000719chr12116041 5753 5675 5333 4829 4565 4145 2366 2012 1310 147 14923 25429 518 --
NM_000723chr1781590 1233 1067 577 565 505 407 137 11455 11050 --
NM_000724chr101460 12034 ----
NM_000756chr82443 360 ------
NM_000793chr1454981 4943 3279 1457 401 14182 ----
NM_000794chr5--1342 160 --
NM_000800chr531103 244 238 ----1644
NM_000809chr499241 6861 6761 3671 3174 1578 1553 1257 246 13663 ----
NM_000813chr512004 ----15488
NM_000814chr1573897 3827 3770 3731 3597 3467 562 --12651 --
NM_000815chr14456 450 324 33 167 ----
NM_000816chr5----1650 --
NM_000826chr41131 --12017 --
NM_000827chr552461 2261 861 838 578 --125 --
NM_000831chr1295913 5901 5672 5602 5547 4959 4444 4433 4305 4157 3932 3916 3880 2179 1702 1584 1353 1307 1263 1158 1009 995 956 911 573 502 183 95 31 34702 4245 1650 76075 5955 5785 5773 4727 2051 528 --
NM_000836chr194880 227 147 31 1908 ----
NM_000838chr6--190 --1242
NM_000842chr111546 ------
NM_000845chr7181 --1431 --
NM_000859chr521136 1093 1454 ----
NM_000868chrX31621 886 432 ------
NM_000872chr10--177 ----
NM_000875chr15146954 6485 5968 5455 5381 5224 5096 4924 4831 4802 4574 4420 4378 1780 26688 2256 36671 2181 1527 --
NM_000876chr611286 ------
NM_000883chr72560 537 1665 2505 494 1217
NM_000883chr72560 537 1665 2505 494 1217
NM_000891chr1773550 3059 2920 1133 1125 1062 290 --23544 640 --
NM_000899chr1243228 704 415 266 1797 ----
NM_000901chr42641 398 ------
NM_000903chr16145 --11150 --
NM_000908chr51607 ------
NM_000924chr1271347 1285 1096 924 453 311 264 --1331 2475 360
NM_000926chr1169182 9169 8682 8143 7576 6801 37360 1240 1232 ----
NM_000933chr201178 ------
NM_000941chr78353 346 245 235 139 97 76 55 --1133 --
NM_000944chr4----1124 --
NM_000960chr195535 261 255 199 97 1528 1112 1165
NM_000966chr1241001 897 439 252 ------
NM_000983chr151249 1168 995 451 133 150 11486 --
NM_001001323chr122653 605 12319 ----
NM_001001331chr362264 2061 1080 915 270 168 --1904 --
NM_001001389chr1182948 2426 2373 2263 1942 934 740 593 1522 21051 432 1384
NM_001001390chr1182948 2426 2373 2263 1942 934 740 593 1522 21051 432 1384
NM_001001391chr1182948 2426 2373 2263 1942 934 740 593 1522 21051 432 1384
NM_001001392chr1182994 2472 2419 2309 1988 980 786 639 1568 21097 478 1430
NM_001001396chr183505 3448 3266 3202 1493 536 479 110 ----11415
NM_001001481chr831240 330 156 ------
NM_001001484chr1022361 874 ------
NM_001001520chr19----1123 --
NM_001001522chr115379 324 150 104 46 ------
NM_001001549chr752620 910 340 286 100 ------
NM_001001550chr752620 910 340 286 100 ------
NM_001001555chr752620 910 340 286 100 ------
NM_001001557chr862182 1393 701 522 235 23 11452 ----
NM_001001560chr225852 602 287 276 216 ------
NM_001001586chr14368 193 70 45 ------
NM_001001665chr262816 2410 2246 1041 833 392 42770 2738 2362 142 12194 11330
NM_001001668chr1943341 3330 2844 401 13619 ----
NM_001001890chr2133996 3065 120 14178 23113 103 --
NM_001001936chr102418 45 ------
NM_001002032chr173717 225 78 ------
NM_001002762chr10112911 2512 2387 2069 2020 1791 635 409 264 82 67 ------
NM_001002811chr151458 1159 983 605 566 1135 148 --
NM_001002812chr151458 1159 983 605 566 1135 148 --
NM_001002812chr151458 1159 983 605 566 1135 148 --
NM_001002814chr893134 2826 2779 2743 2513 1304 1266 933 548 22986 1217 12637 13118
NM_001002837chr222243 225 1208 ----
NM_001002838chrX2676 84 ------
NM_001002840chr75718 514 501 130 115 ------
NM_001002860chr1484215 4176 3795 1503 1089 1007 914 805 23229 1040 ----
NM_001002906chrY1533 ------
NM_001002909chr1732101 1817 379 --159 --
NM_001002919chr2148 ------
NM_001003406chr22173153 3093 3082 3010 2812 2672 2519 2047 2011 1323 1164 1059 786 743 510 458 154 22164 98 21171 986 1383
NM_001003652chr18148333 8308 8023 7405 7387 6891 6862 5839 5298 2712 2030 1541 1374 575 37371 5512 836 25712 3036 15613
NM_001003676chr115931 646 366 121 70 ------
NM_001003681chr2251491 670 320 300 90 1246 1689 --
NM_001003682chr141221 1170 1157 549 1490 --1450
NM_001003688chr42174 24 ------
NM_001003694chr32109 68 ------
NM_001003698chr661958 1674 1546 1432 752 584 --21640 442 --
NM_001003699chr661958 1674 1546 1432 752 584 --21640 442 --
NM_001003760chr663518 3161 2380 2244 897 160 ----1846
NM_001003794chr3112918 2516 2446 2262 1905 1152 1092 1086 445 334 33 --12043 11121
NM_001003800chr9123739 3350 2847 2617 2527 2445 2370 1404 1063 830 796 339 12990 ----
NM_001003891chr223841 201 96 --2821 134 --
NM_001003940chr15133729 3650 3425 3371 3225 3157 3121 2963 1431 1209 1012 1003 601 22783 779 13722 33745 3621 341
NM_001003942chr15133729 3650 3425 3371 3225 3157 3121 2963 1431 1209 1012 1003 601 22783 779 13722 33745 3621 341
NM_001003943chr15133733 3654 3429 3375 3229 3161 3125 2967 1435 1213 1016 1007 605 22787 783 13726 33749 3625 345
NM_001004065chr953155 2808 1365 946 189 33016 2852 38 23070 341 13108
NM_001004196chr32310 35 ------
NM_001004304chr12152686 2562 2436 2423 2160 2074 1007 786 453 319 254 246 226 110 64 22817 2185 23041 2407 --
NM_001004317chr673377 3350 1449 1202 1031 912 606 2691 98 14442 --
NM_001004419chr1263795 1409 1018 851 523 492 ------
NM_001005158chr3189 --198 --
NM_001005159chr3189 --198 --
NM_001005209chr23521 513 81 --1586 --
NM_001005266chr153759 261 214 ------
NM_001005267chr153759 261 214 ------
NM_001005268chr153759 261 214 ------
NM_001005269chr153759 261 214 ------
NM_001005271chr1731105 833 237 1920 2819 104 --
NM_001005273chr1731105 833 237 1920 2819 104 --
NM_001005386chr21145 11729 ----
NM_001005404chr17113670 2882 2873 1735 687 668 646 458 405 299 216 --1736 --
NM_001005474chr3--1221 --1437
NM_001005476chr21749 ------
NM_001005505chr321269 329 --21667 489 1154
NM_001005609chrX123479 3085 2939 1490 1472 1270 1103 993 921 724 542 420 31515 901 878 3780 377 40 --
NM_001005739chr22708 247 ------
NM_001005861chr31792 ------
NM_001005920chr164802 389 276 204 --11006 --
NM_001006115chr3102640 1976 1817 1071 783 774 620 450 299 267 42615 2187 2003 1903 62360 2254 1022 966 435 374 22563 1118
NM_001006617chr931046 235 111 --11001 --
NM_001006619chr931046 235 111 --11001 --
NM_001006620chr931046 235 111 --11001 --
NM_001006621chr931046 235 111 --11001 --
NM_001006684chrX2590 126 ------
NM_001006938chrX2582 111 ----1792
NM_001006946chr271636 1462 433 388 314 126 80 ------
NM_001007023chr1454981 4943 3279 1457 401 14182 ----
NM_001007099chr11249 --1163 --
NM_001007100chr11249 --1163 --
NM_001007156chr1561603 1497 751 683 425 39 11628 ----
NM_001007226chr1731145 1111 166 ------
NM_001007227chr1731145 1111 166 ------
NM_001007228chr1731145 1111 166 ------
NM_001007229chr1731145 1111 166 ------
NM_001007230chr1731145 1111 166 ------
NM_001007237chr122595 1842 --191 --
NM_001007271chr106937 759 291 171 90 57 ----1964
NM_001007273chr10132 ----159
NM_001007466chr654464 1633 970 555 68 34405 938 188 23797 3785 --
NM_001007553chr121038 949 --11143 --
NM_001007794chr11266 1595 ----
NM_001008220chr5133841 3734 2863 2666 2608 2509 943 730 562 526 509 503 127 33161 2895 1048 23715 3207 11039
NM_001008222chrX91140 503 454 427 346 326 285 246 240 --11226 --
NM_001008225chr7----134 --
NM_001008391chr112582 285 ------
NM_001008407chr771657 1347 1141 588 533 499 291 1266 1232 --
NM_001008410chr272187 1947 1757 561 541 502 21 2781 133 22158 1866 --
NM_001008528chr1731160 531 218 ------
NM_001008529chr1751265 1063 340 225 152 1242 ----
NM_001008541chr1011456 1498 22275 2260 11430
NM_001008541chr1011456 1498 22275 2260 11430
NM_001008564chr1331563 761 129 ------
NM_001008701chr19112969 2805 2148 1232 1184 833 790 530 368 165 64 --3820 693 53 --
NM_001008703chr6121 ------
NM_001008704chr6121 ------
NM_001008707chr1421532 63 --1556 --
NM_001008738chr512153 --12763 --
NM_001008925chr443117 1202 657 241 ------
NM_001009552chr8--1469 ----
NM_001009554chr434033 2962 1744 ----11768
NM_001009554chr434033 2962 1744 ----11768
NM_001009555chr4126 ------
NM_001009812chr24103 66 39 24 --132 --
NM_001009899chr366269 5594 5251 4703 2523 2064 ----13954
NM_001009923chr201596 --1204 --
NM_001009960chr742108 1930 1763 888 11881 ----
NM_001009993chr293771 3710 3666 3280 2852 1639 1561 986 636 54013 3095 1200 887 588 13156 --
NM_001010846chr174327 3143 3059 1540 829 228 31 --2555 24 --
NM_001010852chr61149 ------
NM_001010862chrX83134 3120 2496 2423 2155 2025 753 270 22712 442 12880 --
NM_001010867chr1256652 6494 6446 6331 6319 5961 5951 5719 5376 5229 4760 4620 2670 2575 2349 2103 1676 1198 1115 887 512 318 205 115 47 44303 1780 298 128 36411 6132 6119 1880
NM_001010888chrX34311 661 637 ------
NM_001010891chr576317 5628 5552 4866 4565 2588 712 ------
NM_001010895chr941946 1390 615 123 ------
NM_001010898chr1163447 2874 1330 1181 1158 1058 1021 1006 970 855 712 701 671 639 621 497 2746 568 33654 679 413 --
NM_001010980chr1123217 2960 2369 2262 2233 1342 1293 1066 1052 893 712 75 23077 3045 1743 --
NM_001011553chr71346 ------
NM_001011645chrX1411 --197 --
NM_001011666chr746291 5104 1182 1006 1213 ----
NM_001011708chr222404 426 12355 ----
NM_001011722chr12333 122 ----1455
NM_001011722chr12333 122 ----1455
NM_001012329chr1131985 1938 1854 1814 1751 1611 1586 1483 939 352 334 62 25 1523 22130 719 11560
NM_001012393chr1153614 3596 2050 1584 85 41854 1821 1262 539 ----
NM_001012398chr16146 ------
NM_001012420chr1531038 658 203 --1754 --
NM_001012423chr1531038 658 203 --1754 --
NM_001012614chr45786 649 608 95 33 ------
NM_001012642chr1561939 1754 855 536 322 50 --32138 2026 620 --
NM_001012753chr1931249 1199 337 ------
NM_001012755chrX64366 3101 1998 1023 298 48 13353 --1352
NM_001012761chr532479 2096 1790 21800 130 ----
NM_001012977chrX31002 420 42 ------
NM_001013031chr1043359 2540 2487 647 ------
NM_001013398chr72575 478 --11530 --
NM_001013415chr431064 1040 130 ------
NM_001013622chr431131 1124 794 1943 6483 421 360 174 113 51 1988
NM_001013635chr1251185 983 834 807 258 ------
NM_001013674chr11321 ------
NM_001013690chr1292288 2199 1851 1829 1812 1013 620 539 522 --22257 1550 12145
NM_001013693chr1112737 2495 2144 1138 865 830 788 406 344 129 31 --32691 2188 309 --
NM_001013693chr1112737 2495 2144 1138 865 830 788 406 344 129 31 --32691 2188 309 --
NM_001013843chr151691 ----1794
NM_001014442chr13----156 --
NM_001014449chr162207 32 ------
NM_001014451chr162207 32 ------
NM_001014797chr1066755 5480 2960 2772 2261 1543 36869 4968 896 --17514
NM_001015045chr452446 1682 465 360 73 --187 --
NM_001015053chr1771545 1411 1052 373 333 284 276 --124 --
NM_001015055chr23304 127 66 ------
NM_001015056chr23304 127 66 ------
NM_001015056chr23304 127 66 ------
NM_001015877chrX22636 2249 1225 ----
NM_001015880chr1011371 ------
NM_001015881chrX3277 195 154 11139 1260 --
NM_001015887chr321171 733 1220 ----
NM_001017368chr1782513 1936 1774 1028 1004 295 55 46 1786 --1691
NM_001017392chr1941351 1084 337 70 --1141 --
NM_001017395chr3132976 2890 2862 2835 2749 2687 1235 1052 706 561 524 403 35 13382 --22400 243
NM_001017440chr7167495 6556 6254 6189 4992 3142 3053 2937 2801 2773 1868 1837 1071 573 501 184 27781 6375 25957 2079 27454 3181
NM_001017535chr12102938 2667 2641 2569 2541 2446 2396 515 103 27 12426 32691 2385 687 --
NM_001017924chr1021401 33 --11184 --
NM_001017969chr91188 ------
NM_001017979chr42233 169 --149 --
NM_001017990chrX1125 ----123
NM_001017995chr553779 1947 1246 1201 277 1663 31294 179 115 --
NM_001017999chr141488 583 552 495 ------
NM_001017999chr141488 583 552 495 ------
NM_001018000chr141488 583 552 495 ------
NM_001018000chr141488 583 552 495 ------
NM_001018001chr141488 583 552 495 ------
NM_001018008chr154565 514 470 23 ------
NM_001018050chr22193472 3377 3371 3238 3177 3066 2650 2618 2437 2426 2092 1386 1040 988 895 857 769 261 254 22357 1176 23027 1190 --
NM_001018052chr22193472 3377 3371 3238 3177 3066 2650 2618 2437 2426 2092 1386 1040 988 895 857 769 261 254 22357 1176 23027 1190 --
NM_001018053chr131923 1904 752 160 ----
NM_001018054chr121046 57 ------
NM_001018057chr111125 1202 ----
NM_001018065chr955061 3840 2252 1478 538 ------
NM_001018066chr955061 3840 2252 1478 538 ------
NM_001018074chr512982 11577 13055 --
NM_001018075chr512982 11577 13055 --
NM_001018076chr512982 11577 13055 --
NM_001018077chr512982 11577 13055 --
NM_001018089chr1553379 2469 1302 1033 872 ------
NM_001018108chr1582304 2078 1772 1461 816 797 764 304 --1183 --
NM_001020818chr1951824 1550 1329 487 372 11746 --1546
NM_001020819chr1951824 1550 1329 487 372 11746 --1546
NM_001020820chr1951824 1550 1329 487 372 11746 --1546
NM_001020821chr1951824 1550 1329 487 372 11746 --1546
NM_001020825chr51457 --1530 --
NM_001023567chr152661 203 11624 21723 757 --
NM_001023587chr32962 444 1341 ----
NM_001024094chr512982 11577 13055 --
NM_001024218chr141595 ------
NM_001024226chr131042 837 347 ------
NM_001024227chr131042 837 347 ------
NM_001024228chr131042 837 347 ------
NM_001024401chr16142835 2761 2749 2710 2595 2253 1834 1052 1042 997 621 411 394 372 --2534 483 --
NM_001024455chrX92534 2427 2235 1710 1034 986 786 328 281 21072 202 12411 --
NM_001024463chr151244 --2741 369 --
NM_001024660chr331334 1312 361 ------
NM_001024680chr211811 11730 ----
NM_001024736chr15101403 1396 1385 1374 1353 1279 1245 1084 550 50 ------
NM_001024808chr1292367 2131 1876 894 802 703 458 446 90 --2741 224 --
NM_001024845chr15870 696 341 128 104 --1745 --
NM_001024847chr342182 726 692 96 ------
NM_001024858chr14102916 2597 2534 2222 1914 1825 266 241 171 63 --52928 2062 1996 571 557 1608
NM_001024937chr172734 229 --190 --
NM_001024948chr141276 1158 918 616 ------
NM_001024956chr1154198 3588 1798 1708 616 31910 1348 706 14056 --
NM_001024959chr34765 652 628 65 --1231 --
NM_001024960chr34765 652 628 65 --1231 --
NM_001025076chr1045937 5049 4740 2228 1235 --25645 2306
NM_001025077chr1067295 6407 6098 4872 1229 193 11593 --17003
NM_001025079chr372924 1178 958 609 504 379 322 ------
NM_001025105chr511290 --2464 159 --
NM_001025108chr253129 2949 2808 1197 32 ------
NM_001025233chr1231016 459 427 ------
NM_001025252chr832852 2264 443 1182 ----
NM_001025253chr832852 2264 443 1182 ----
NM_001025266chr354110 3258 1670 1547 1429 43689 3565 930 551 --1806
NM_001025366chr631498 684 560 1324 ----
NM_001025366chr631498 684 560 1324 ----
NM_001025367chr631498 684 560 1324 ----
NM_001025367chr631498 684 560 1324 ----
NM_001025368chr631498 684 560 1324 ----
NM_001025368chr631498 684 560 1324 ----
NM_001025369chr631514 700 576 1340 ----
NM_001025369chr631514 700 576 1340 ----
NM_001025370chr631498 684 560 1324 ----
NM_001025370chr631498 684 560 1324 ----
NM_001025579chr1741065 164 37 31 --11133 --
NM_001025603chr11494 --1192 11271
NM_001025780chr931277 1157 374 ------
NM_001029835chr73403 312 92 ------
NM_001029861chr1971031 690 231 202 178 123 42 --1275 --
NM_001029863chr641162 1011 506 356 ------
NM_001029871chr2051694 1575 728 570 24 --2711 528 --
NM_001029883chr262969 2535 2513 1960 1934 117 --1203 --
NM_001029989chr151969 ----1747
NM_001029998chr431381 1007 954 ------
NM_001030007chr1633600 1092 575 --22645 297 153
NM_001030047chr1961043 944 706 367 225 69 ------
NM_001030055chr1433930 3363 840 24617 510 ----
NM_001031677chr54348 76 70 22 ------
NM_001031680chr172236 2121 2022 1630 1017 239 151 2989 348 2950 460 1413
NM_001031684chr211218 11313 1443 --
NM_001031690chr7113078 2807 2610 2055 1975 1015 452 274 259 212 137 42874 2443 778 199 12013 1733
NM_001031695chr2284784 4560 4070 4044 3480 1611 1140 764 --24017 1979 --
NM_001031702chr35659 597 284 156 23 1813 ----
NM_001031732chr413192 ------
NM_001031740chr151667 1498 691 474 80 21586 610 ----
NM_001031804chr1633145 805 136 --11461 --
NM_001032221chr92362 115 1536 1342 --
NM_001032279chr112428 365 ------
NM_001032280chr621480 638 --1148 --
NM_001032283chr1221071 236 ------
NM_001032284chr1221071 236 ------
NM_001032288chr2081508 1310 1211 1000 592 519 432 365 1255 ----
NM_001032289chrX4836 355 75 53 2738 212 ----
NM_001032296chr1372806 2627 2550 2522 2283 1182 414 ----22570 396
NM_001032363chr192091 2002 1880 1772 668 590 511 183 74 --11544 --
NM_001032363chr192091 2002 1880 1772 668 590 511 183 74 --11544 --
NM_001032380chr1011892 ------
NM_001033026chr192470 167 ----196
NM_001033044chr11387 1539 ----
NM_001033045chr233724 3312 1470 21421 555 23999 76 --
NM_001033049chr2121955 168 --31735 576 97 --
NM_001033056chr11387 1539 ----
NM_001033057chr332046 667 337 --1511 --
NM_001033081chr151806 1483 1371 495 228 21916 1310 41433 687 420 271 1638
NM_001033082chr151806 1483 1371 495 228 21916 1310 41433 687 420 271 1638
NM_001033087chr2072967 2074 1020 667 655 327 30 --137 --
NM_001033117chr3104577 3902 3394 3381 1937 1261 1088 99 93 63 33634 584 120 14293 14441
NM_001033507chr141749 1702 1563 1481 11617 ----
NM_001033518chr722158 2102 22733 1766 12093 22608 589
NM_001033519chr722158 2102 22733 1766 12093 22608 589
NM_001033520chr722158 2102 22733 1766 12093 22608 589
NM_001033551chr17263606 3541 3492 3464 3442 3225 3176 3101 2984 2938 2604 2556 1341 1249 1213 1107 1049 1037 1007 980 869 859 823 502 457 419 12818 43482 3386 3252 681 13564
NM_001033602chr1352629 2241 1832 1753 163 --12212 --
NM_001033723chr8132632 2611 2320 2198 2164 2048 1999 1781 1769 841 746 133 49 --22098 543 12470
NM_001033756chr631432 618 494 1258 ----
NM_001033756chr631432 618 494 1258 ----
NM_001034837chr5--1102 ----
NM_001034838chr5--1102 ----
NM_001034841chr16104480 4107 3796 3603 3503 1826 1414 1283 1253 209 --11773 --
NM_001034845chr4165 11338 ----
NM_001034954chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_001034955chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_001034956chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_001034957chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_001035235chr53246 135 45 --1203 --
NM_001035521chr2290 24 1279 ----
NM_001035534chr971363 1356 982 924 448 345 85 21148 1114 21076 72 --
NM_001037131chr241041 848 306 110 136 ----
NM_001037132chr721954 900 ------
NM_001037133chr721954 900 ------
NM_001037164chr72101 43 ------
NM_001037174chr221940 1409 ------
NM_001037334chr181707 ------
NM_001037339chr121158 552 ------
NM_001037340chr121158 552 ------
NM_001037341chr121158 552 ------
NM_001037341chr121158 552 ------
NM_001037637chr51140 ------
NM_001037954chr1152750 1314 1178 1089 46 --2722 638 --
NM_001038640chr151728 --1824 --
NM_001038707chr182156 1632 1448 336 263 192 176 150 ------
NM_001038707chr182156 1632 1448 336 263 192 176 150 ------
NM_001039091chrX21109 481 11067 ----
NM_001039199chr20124848 4474 3720 3411 3269 1662 1621 1609 1580 1512 1192 705 54425 4393 3900 3639 1070 13853 2908 641
NM_001039459chr72148 84 1887 1333 --
NM_001039479chr1482262 2192 2082 1866 847 393 49 39 --21760 1590 11739
NM_001039538chr233383 2916 2719 --12813 --
NM_001039550chr24764 264 205 123 1302 1185 --
NM_001039570chr22164255 4157 4132 4095 3953 3889 3829 3778 3747 3683 3484 3269 1607 1439 1015 518 2612 489 23634 235 24075 3178
NM_001039571chr22164255 4157 4132 4095 3953 3889 3829 3778 3747 3683 3484 3269 1607 1439 1015 518 2612 489 23634 235 24075 3178
NM_001039574chr17965 919 895 877 821 169 64 1402 1786 --
NM_001039582chrX155 --192 --
NM_001039583chr224535 421 153 109 2191 55 ----
NM_001039584chr224535 421 153 109 2191 55 ----
NM_001039585chr123059 1364 --184 --
NM_001039590chrX23209 2584 --1861 --
NM_001039591chrX23209 2584 --1861 --
NM_001039615chr832121 1598 104 11536 ----
NM_001039618chr1165651 5081 4109 3678 565 437 ------
NM_001039619chr142266 29 ------
NM_001039690chr16102024 1684 1600 1495 769 727 613 535 355 41 22171 494 22068 701 2579 89
NM_001039693chr243641 3203 3051 2884 23153 3002 --1337
NM_001039711chr14849 187 67 49 1931 ----
NM_001039712chr14849 187 67 49 1931 ----
NM_001039770chr3102150 1867 1531 1512 651 512 454 390 197 122 ------
NM_001039802chr12381 370 1395 ----
NM_001039840chrX45949 5687 4266 4151 15148 ----
NM_001039905chr1551265 568 445 151 114 ------
NM_001039916chr122103 45 --1118 --
NM_001039917chr122103 45 --1118 --
NM_001039918chr122103 45 --1118 --
NM_001039919chr122103 45 --1118 --
NM_001039920chr122103 45 --1118 --
NM_001039933chr175438 151 91 39 25 1352 ----
NM_001039937chr1323468 2768 ------
NM_001040056chr161273 --1196 --
NM_001040057chr72473 122 ----1226
NM_001040102chr1072364 2335 2298 2236 2023 1801 125 11917 12394 --
NM_001040103chr1072364 2335 2298 2236 2023 1801 125 11917 12394 --
NM_001040110chr731332 1255 1225 1190 ----
NM_001040144chr16102024 1684 1600 1495 769 727 613 535 355 41 22171 494 22068 701 2579 89
NM_001040146chr16102024 1684 1600 1495 769 727 613 535 355 41 22171 494 22068 701 2579 89
NM_001040152chr754443 3527 1459 1450 1304 1293 ----
NM_001040159chr41401 1330 ----
NM_001040167chr73431 75 37 1859 128 --
NM_001040272chr941944 922 300 31 ------
NM_001040273chr1082004 835 771 597 578 498 467 161 11814 21833 347 --
NM_001040280chr651526 1291 508 392 267 3600 451 325 ----
NM_001040284chr1655870 4524 3945 897 845 175 ----
NM_001040402chr432868 2537 1048 ------
NM_001040409chr21859 ------
NM_001040429chr1343446 2910 1161 69 ------
NM_001040446chr561935 1742 835 735 127 59 21693 553 ----
NM_001040450chr1532901 2509 2349 12820 ----
NM_001040453chr1532901 2509 2349 12820 ----
NM_001040709chr162442 647 552 432 261 159 22490 850 ----
NM_001040876chr421607 104 ------
NM_001042353chr204557 483 383 59 --1435 --
NM_001042361chr101204 1427 ----
NM_001042364chr101204 1427 ----
NM_001042365chr101204 1427 ----
NM_001042368chr92671 220 ----1548
NM_001042387chr101204 1427 ----
NM_001042388chr181356 2795 79 ----
NM_001042393chr101204 1427 ----
NM_001042396chr101204 1427 ----
NM_001042397chr101204 1427 ----
NM_001042403chr121644 --1794 --
NM_001042404chr11601 ------
NM_001042413chr972694 1004 936 287 269 212 203 11188 1515 --
NM_001042425chr621480 638 --1148 --
NM_001042428chr161185 ------
NM_001042473chr101557 11976 ----
NM_001042478chr13179 89 27 ------
NM_001042481chr1421677 153 ------
NM_001042486chr2021372 515 --21492 391 --
NM_001042494chr1542888 2764 2596 1446 ------
NM_001042495chr1542888 2764 2596 1446 ------
NM_001042496chr1542888 2764 2596 1446 ------
NM_001042497chr1542888 2764 2596 1446 ------
NM_001042498chrX3973 212 190 2875 349 1104 --
NM_001042506chrX31002 420 42 ------
NM_001042510chr81151 ------
NM_001042511chr81151 ------
NM_001042537chrX32329 499 194 ----1412
NM_001042539chr1671123 1013 963 905 422 227 174 ------
NM_001042576chr201467 --1308 --
NM_001042595chr193404 110 69 152 ----
NM_001042599chr296719 5527 5368 5269 4996 3107 2339 448 70 17723 11491 12987
NM_001042601chr333063 2509 896 --1634 --
NM_001042632chr20122418 2260 2216 1005 997 544 536 476 433 393 367 315 --1324 --
NM_001042633chr20122418 2260 2216 1005 997 544 536 476 433 393 367 315 --1324 --
NM_001042681chr141985 280 240 45 ------
NM_001042682chr141985 280 240 45 ------
NM_001042682chr141985 280 240 45 ------
NM_001042724chr193199 136 83 ----1676
NM_001042728chr1241001 897 439 252 ------
NM_001043318chr1473459 2696 1364 1303 706 533 487 13628 13171 31493 1070 633
NM_001044305chr621576 1440 ------
NM_001044385chr242790 2583 2527 1489 ----13286
NM_001045556chr861794 1359 644 450 437 188 161 --195
NM_001045557chr861794 1359 644 450 437 188 161 --195
NM_001046chr512886 ------
NM_001049chr1452129 1592 999 613 247 --11862 --
NM_001066chr1122107 2053 2019 1773 1595 1335 867 523 398 118 74 47 22034 1571 2381 336 --
NM_001077628chr12126 30 --124 --
NM_001083620chr41131 --12015 --
NM_001092chr174769 523 454 53 --21736 564 11845
NM_001095chr1251939 1501 1377 623 521 --31923 394 88 --
NM_001099678chr366239 5279 4764 4404 4260 3907 24991 123 1392 --
NM_001100108chr1147768 6519 5909 5666 5498 5195 2485 2452 2076 1797 1784 845 376 369 25950 5295 --11364
NM_001106chr3179078 7994 7393 6613 3899 3838 3807 3619 3416 2177 2144 1843 1813 1687 1676 1135 1081 33648 2080 1976 67929 3436 2807 2666 2207 873 --
NM_001113490chrX2688 659 ----12315
NM_001116chr1641014 823 410 200 --22320 219 --
NM_001117chr182940 610 1975 1561 --
NM_001121chr101711 ------
NM_001127chr227878 455 431 359 351 178 125 --1156 1211
NM_001128chr1633600 1092 575 --22645 297 153
NM_001144chr1631015 971 264 1939 ----
NM_001146chr822122 193 ------
NM_001148chr411415 21801 419 ----
NM_001160chr1262797 2493 2474 961 818 663 ----12443
NM_001163chr961008 896 880 864 282 269 --1641 --
NM_001167chrX65431 5340 4474 4392 4273 1943 46217 5382 4192 2468 ----
NM_001172chr142263 89 1640 ----
NM_001173chr1433930 3363 840 24617 510 ----
NM_001174chrX4941 380 319 272 1286 ----
NM_001177chr1242288 1992 1898 1775 ------
NM_001186chr212764 197 12888 ----
NM_001189chr46968 884 784 350 319 155 1728 1259 --
NM_001191chr2071373 1346 1139 1063 581 467 208 1543 ----
NM_001199chr8149 ------
NM_001200chr2021155 467 ------
NM_001201chr423509 3416 ------
NM_001203chr42228 158 ------
NM_001204chr246108 5080 4909 428 ------
NM_001207chr51140 ------
NM_001218chr15112597 2587 2392 2084 1871 1769 930 626 457 370 69 2746 436 --1162
NM_001219chr751949 1769 821 580 276 --11891 --
NM_001222chr1061811 1494 1411 394 341 65 21553 573 21643 302 --
NM_001231chr12500 402 ------
NM_001237chr41441 ------
NM_001237chr41441 ------
NM_001241chr211798 ------
NM_001241chr211798 ------
NM_001256chr1732507 2489 1136 12823 --12528
NM_001257chr161413 1265 ----
NM_001264chr64806 786 725 718 --2662 33 --
NM_001270chr51927 ------
NM_001271chr1553078 2574 1004 895 767 1567 ----
NM_001275chr144395 72 62 45 ------
NM_001293chr11170 1487 ----
NM_001300chr101133 --1450 --
NM_001304chr1743373 2652 2466 2372 161 --11099
NM_001310chr1242373 2061 1130 220 ------
NM_001328chr45786 649 608 95 33 ------
NM_001331chr1171885 1088 1057 981 311 302 25 --1694 --
NM_001346chr361778 916 673 623 511 437 1777 ----
NM_001356chrX4955 632 425 408 ------
NM_001357chr11275 ------
NM_001362chr142824 378 --1693 1183
NM_001364chr1173828 3735 3676 3542 3079 2954 1681 1631 11638 --
NM_001365chr175221 214 81 54 47 1637 ----
NM_001379chr191120 ------
NM_001386chr822263 984 --1155 --
NM_001387chr563097 2929 2642 2532 1045 746 --22974 1258 42317 2241 2218 2156
NM_001396chr212796 507 ------
NM_001397chr172569 2370 2171 2149 1993 1638 270 1843 31722 1697 543 22094 589
NM_001399chrX123479 3085 2939 1490 1472 1270 1103 993 921 724 542 420 31515 901 878 3780 377 40 --
NM_001406chr1771674 1625 668 509 234 67 43 --1250 --
NM_001407chr34594 522 386 279 21485 1470 11646 --
NM_001408chr161463 1247 1241 654 447 143 --1233 1431
NM_001412chrX43127 1456 612 363 ------
NM_001417chr1241349 779 762 44 11908 ----
NM_001419chr1953220 3168 3149 1716 281 1551 23686 3669 1149
NM_001420chr1992873 2815 2571 1230 1210 1179 512 431 364 --32890 2676 164 --
NM_001423chr1271958 1432 1407 651 332 294 27 159 1184 --
NM_001426chr21527 ----1538
NM_001429chr221112 --1878 --
NM_001430chr251831 1540 1437 1298 737 --21519 1451 --
NM_001431chr62901 177 ------
NM_001432chr441564 1510 1462 1412 23889 2426 1557 --
NM_001438chr112784 22615 1335 12383 --
NM_001448chrX11297 ----11431
NM_001460chr143317 3001 142 21 ------
NM_001478chr122750 166 1352 1976 --
NM_001489chr9262 43 ------
NM_001491chr652392 2133 2127 463 202 12738 ----
NM_001493chrX2542 523 1144 ----
NM_001495chr861199 304 289 241 226 159 --2419 356 --
NM_001497chr962306 1791 1711 1012 1004 575 22431 1069 1636 --
NM_001498chr64955 512 276 115 1388 ----
NM_001511chr41572 ------
NM_001521chr2290 24 1279 ----
NM_001541chr111157 ------
NM_001542chr122595 1842 --191 --
NM_001543chr5164552 4488 4379 4150 4041 3921 3899 3893 3873 3056 1666 1573 1179 588 268 252 14658 63965 3852 1493 1230 984 649 21841 713
NM_001552chr175881 304 282 211 52 --21029 194 1398
NM_001560chrX42560 1965 769 511 52385 2265 2149 720 72 11004 --
NM_001567chr115699 599 505 258 249 --1620 --
NM_001610chr11199 1617 ----
NM_001614chr172212 64 ------
NM_001614chr172212 64 ------
NM_001616chr223466 2234 ----1157
NM_001620chr111172 --155 --
NM_001635chr7------1125
NM_001642chr114851 426 122 25 ------
NM_001654chrX1311 ----1124
NM_001655chr1131641 840 443 11961 ----
NM_001658chr131042 837 347 ------
NM_001659chr12102713 2632 2516 2418 2403 2347 2320 1999 1730 915 --2288 108 --
NM_001660chr32555 529 1100 --1206
NM_001663chr143154 116 25 ------
NM_001664chr31382 ------
NM_001665chr112537 56 1206 ----
NM_001668chr132203 503 348 12212 11768 --
NM_001677chr11360 ----1235
NM_001678chr1761363 1288 670 546 465 44 --11245 --
NM_001679chr32509 96 ------
NM_001682chr122367 319 12033 ----
NM_001683chr362264 2061 1080 915 270 168 --1904 --
NM_001693chr821122 199 ------
NM_001701chr921358 623 ------
NM_001704chr6--162 ----
NM_001707chr74308 177 150 26 ------
NM_001731chr12174 ------
NM_001742chr71389 149 ----
NM_001743chr21227 ------
NM_001754chr2133996 3065 120 14178 23113 103 --
NM_001755chr1621884 751 ------
NM_001759chr1273834 3461 3379 3310 1077 877 679 12080 13213 24051 4042
NM_001760chr64859 783 712 685 --1331 --
NM_001773chr161452 1250 1105 580 567 508 1241 11063 --
NM_001777chr372924 1178 958 609 504 379 322 ------
NM_001781chr12--1130 ----
NM_001788chr71346 ------
NM_001789chr341486 1392 1220 483 2397 119 11125 --
NM_001791chr12381 370 1395 ----
NM_001792chr181460 ------
NM_001796chr161240 ------
NM_001798chr12----21017 73 1148
NM_001806chr1922901 1808 42473 1997 267 132 ----
NM_001810chr206733 718 702 596 569 129 --2238 68 --
NM_001823chr142131 53 ------
NM_001845chr1321030 440 ------
NM_001851chr65737 678 515 204 56 ------
NM_001852chr13681 457 36 1120 161 --
NM_001854chr1145 ------
NM_001859chr973937 3818 3444 2613 2572 1094 766 --23570 398 --
NM_001892chr511290 --2464 159 --
NM_001903chr5----1735 --
NM_001907chr163283 233 80 ------
NM_001927chr22715 231 ------
NM_001935chr21925 ------
NM_001937chr14907 875 149 23 --2946 884 --
NM_001939chrX102617 2344 1521 1498 1420 1160 795 519 447 42 23421 1274 32597 895 132 --
NM_001941chr1823893 712 11214 11156 --
NM_001949chr632479 1043 249 --11139 1213
NM_001954chr63743 552 185 --2691 294 --
NM_001956chr15421 387 154 107 94 ------
NM_001962chr52229 222 ------
NM_001964chr51436 ------
NM_001969chr1423436 423 33319 3227 1179 ----
NM_001970chr173220 192 82 1548 ----
NM_001978chr87960 777 733 647 247 241 210 ------
NM_001981chr112076 ------
NM_001987chr1283782 3704 3261 1297 1217 714 634 159 3977 966 225 11691 --
NM_001993chr13870 345 113 ------
NM_001999chr531325 1272 173 ------
NM_002006chr445261 1732 666 467 12083 13755 --
NM_002009chr1532233 1116 1102 11822 ----
NM_002015chr1372596 2468 2393 2336 1037 545 314 11201 ----
NM_002017chr11------11219
NM_002024chrX21673 883 11551 ----
NM_002025chrX168887 8843 8390 8049 7656 7104 6960 6954 6589 6205 6070 2440 2375 1763 1494 770 --28663 6175 --
NM_002039chr42581 309 ------
NM_002048chr92916 342 190 1175 --
NM_002061chr121954 1479 21905 1398 --11740
NM_002062chr62536 484 31474 1079 192 2316 25 --
NM_002065chr11387 1539 ----
NM_002077chr931554 221 75 ------
NM_002086chr1742012 1438 881 630 2833 801 11906 --
NM_002089chr41577 ------
NM_002103chr194883 340 236 207 --1247 --
NM_002106chr41343 ------
NM_002126chr1732784 1601 415 ------
NM_002130chr53612 449 84 1163 ----
NM_002131chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_002133chr223566 450 147 ------
NM_002135chr123489 367 94 --1163 --
NM_002136chr122489 459 ------
NM_002139chrX------1583
NM_002145chr17143 ------
NM_002146chr1731001 154 118 --161 --
NM_002147chr175924 784 648 174 53 1674 ----
NM_002148chr22700 568 ------
NM_002167chr12355 146 157 ----
NM_002168chr152244 97 ------
NM_002176chr9------126
NM_002193chr231286 705 597 2668 574 ----
NM_002198chr52759 185 2578 223 1147 --
NM_002205chr125951 871 728 634 77 ------
NM_002207chr3147 ------
NM_002213chr32246 131 1227 ----
NM_002214chr744773 4676 3486 1838 ------
NM_002222chr32832 547 --1519 --
NM_002230chr174960 259 219 156 1448 1880 --
NM_002232chr1155 2912 311 ----
NM_002235chr1231584 1180 482 11675 ----
NM_002241chr152862 2549 723 58 30 12650 ----
NM_002247chr101233 1912 1529 1669
NM_002249chr12402 64 1211 1474 --
NM_002253chr44565 340 167 29 ------
NM_002254chr272255 1481 710 673 572 243 59 2446 41 ----
NM_002264chr354063 3405 3378 1666 500 ----11872
NM_002265chr172920 456 ------
NM_002268chr321904 562 ------
NM_002270chr525153 4366 14409 ----
NM_002271chr1322416 207 12267 --11522
NM_002283chr125806 764 614 528 204 ------
NM_002285chr253129 2949 2808 1197 32 ------
NM_002298chr1341449 1436 623 431 --1568 --
NM_002309chr22102852 2769 2626 2426 2271 2122 1134 969 624 564 32395 739 654 33037 853 159 3916 523 236
NM_002336chr124634 602 526 356 --11806 --
NM_002355chr1221382 872 --11168 --
NM_002359chr17184174 3942 3895 3681 3629 3617 3533 3326 3157 2836 1618 1604 1530 1454 1430 1376 1310 538 --32763 1537 1495 13404
NM_002373chr1541034 538 437 134 21007 405 ----
NM_002374chr233383 2916 2719 --12813 --
NM_002375chr3142015 1808 1686 1624 1615 1609 1517 926 629 543 358 257 215 185 11497 ----
NM_002382chr1441189 1105 1074 401 ------
NM_002383chr166946 836 786 728 245 50 ------
NM_002387chr544400 3391 945 216 1744 1157 1565
NM_002390chr17112069 2018 1983 1945 1929 1894 1772 1736 1452 168 127 21529 1266 --1405
NM_002398chr241194 416 233 182 ------
NM_002399chr1541144 1037 544 236 ------
NM_002403chr13262 43 26 137 1131 --
NM_002427chr1111105 ------
NM_002429chr1271551 1378 1102 1076 411 347 319 ------
NM_002430chr2272157 1972 1797 1611 1015 835 503 1634 21643 957 --
NM_002442chr1271627 1158 661 619 599 586 296 ------
NM_002445chr841281 172 165 63 ------
NM_002448chr4149 --1544 --
NM_002451chr983462 2841 2827 2807 2689 2562 1402 1076 11521 ----
NM_002467chr81100 ------
NM_002469chr122481 59 ------
NM_002473chr22--195 3553 528 505 --
NM_002479chr11651 --2498 118 --
NM_002480chr122169 93 182 ----
NM_002481chr1146599 5724 5525 3097 2599 2302 2134 1841 1446 859 833 825 670 499 27764 2558 1266 --
NM_002490chr222609 140 --1448 --
NM_002499chr1592288 2085 1972 1773 1538 918 528 448 179 ------
NM_002501chr19134002 3705 2794 2621 1567 1520 1251 790 782 714 381 243 26 21356 854 33490 2990 678 21463 1152
NM_002507chr1771937 1808 1728 1709 1701 1488 443 1733 1123 --
NM_002509chr202615 176 ----1232
NM_002516chr19--1112 ----
NM_002522chr1722510 887 2772 654 23427 2849 13196
NM_002537chr154798 764 700 324 1849 --167
NM_002543chr122510 76 1418 ----
NM_002545chr1153614 3596 2050 1584 85 41854 1821 1262 539 ----
NM_002547chrX83185 2648 1579 1356 1045 552 459 24 ----1145
NM_002569chr1551371 1237 1000 991 475 21337 80 142 --
NM_002570chr152491 276 2296 262 1425 --
NM_002572chr111111 1297 ----
NM_002576chr1121142 144 1470 ----
NM_002577chr363631 2736 2576 1127 860 433 ------
NM_002581chr934865 1982 1048 11301 --2825 462
NM_002586chr62421 379 --21649 1115 --
NM_002588chr5----31415 1169 657 1137
NM_002589chr4182 ------
NM_002591chr201491 ------
NM_002595chr1221722 471 ------
NM_002599chr1161034 916 275 143 124 92 11008 11000 --
NM_002600chr121158 552 ------
NM_002601chr21367 --1333 --
NM_002605chr152209 78 1445 ----
NM_002608chr2251389 566 434 355 75 21296 283 11464 --
NM_002609chr581296 1212 740 599 583 488 324 63 --21675 161 21717 358
NM_002613chr16152141 2121 2093 1872 1716 1710 1522 1436 1406 1388 1176 1003 878 603 454 11664 31834 1789 756 --
NM_002629chr103721 609 282 ------
NM_002632chr143794 538 293 ----1226
NM_002634chr173832 736 295 ------
NM_002648chr641075 994 527 159 --11212 --
NM_002655chr844457 3288 2018 200 ----11357
NM_002657chr2073468 3420 3410 2947 2660 1096 362 ----13399
NM_002658chr104680 669 202 178 1704 ----
NM_002660chr203922 314 202 ------
NM_002698chr19112864 2517 1041 1019 844 723 340 328 255 180 54 1354 22677 818 --
NM_002705chr163777 91 68 ------
NM_002709chr243485 1005 880 829 ------
NM_002710chr121741 ------
NM_002713chr12244 123 11173 1378 --
NM_002714chr681050 941 787 342 228 201 148 141 ------
NM_002716chr1163402 2767 2628 2560 1338 278 11289 ----
NM_002729chr101113 ------
NM_002736chr721723 514 ------
NM_002737chr17176211 5853 5764 5546 5521 5011 4235 4139 2420 2377 2266 2194 1743 1671 1646 1077 672 35790 4810 2028 25897 4077 1806
NM_002739chr191164 1515 1504 1674
NM_002745chr2294372 4217 2957 2885 1696 892 534 201 76 --1582 --
NM_002746chr161104 --127 --
NM_002751chr2281187 1143 1039 979 851 233 207 43 --2363 223 --
NM_002752chr5--169 ----
NM_002753chr42549 72 --1118 --
NM_002755chr151223 ------
NM_002758chr171169 ------
NM_002764chrX3701 684 59 ------
NM_002765chrX21109 481 11067 ----
NM_002768chr1671628 1452 1046 586 503 222 197 21380 1069 41560 1497 314 243 --
NM_002779chr104575 491 365 158 ------
NM_002790chr1------130
NM_002809chr171237 --155 --
NM_002815chr17--1195 158 --
NM_002822chr1221468 435 ------
NM_002827chr2051699 1257 1113 326 298 ------
NM_002829chr93376 308 72 ------
NM_002833chr1531269 641 51 ----11120
NM_002834chr1211525 11613 --11398
NM_002835chr71654 ------
NM_002843chr1113213 33112 2504 2446 13274 --
NM_002849chr12136 ------
NM_002856chr192309 275 ------
NM_002857chr161015 972 863 473 439 392 1414 ----
NM_002859chr1221736 1569 --41497 1446 1324 192 --
NM_002863chr14------1115
NM_002867chr13735 538 491 --1155 --
NM_002868chr1282285 2216 2142 2111 1653 918 221 110 12149 2492 214 --
NM_002869chr111653 ----1770
NM_002874chr932099 563 79 21743 70 ----
NM_002883chr229949 846 781 706 379 332 101 89 25 --1613 --
NM_002886chr365176 5122 4948 3247 804 207 34853 1812 123 11686 --
NM_002890chr51248 ------
NM_002900chr102271 123 ----147
NM_002918chr193452 407 272 ------
NM_002940chr421607 104 ------
NM_002941chr321176 611 ------
NM_002955chr661958 1674 1546 1432 752 584 --21640 442 --
NM_002958chr31792 ------
NM_002973chr121201 ------
NM_002977chr243205 2835 1043 423 --12702 --
NM_002979chr11249 --1163 --
NM_002994chr441367 1238 497 145 ------
NM_002997chr271636 1462 433 388 314 126 80 ------
NM_003010chr1752218 1545 1536 939 375 ------
NM_003011chr911405 ----157
NM_003013chr42325 118 ------
NM_003016chr171791 ------
NM_003028chr993761 3743 3737 3130 2490 2440 1030 848 344 22472 1091 23783 777 32518 2405 904
NM_003034chr1297172 6779 6477 5287 3116 2608 2356 1833 107 37741 6283 2452 15971 --
NM_003043chr3104140 3295 3233 3175 3071 2978 1484 1258 911 520 33624 1211 479 43463 3450 3266 1249 --
NM_003045chr13104365 4305 4054 3798 3593 1333 987 773 603 192 2382 350 ----
NM_003051chr111820 1669 ----
NM_003060chr53974 931 138 1907 --11300
NM_003069chrX2595 116 ------
NM_003074chr381922 1734 1691 804 751 264 228 84 11764 ----
NM_003076chr1281491 1480 1133 549 541 243 92 81 --21465 586 --
NM_003077chr173658 608 30 1627 2336 56 --
NM_003088chr74928 913 467 328 --51072 1009 961 907 366 1233
NM_003108chr277218 2871 2606 1965 1949 1889 1101 24791 2465 --156
NM_003113chr22586 182 ------
NM_003130chr71423 11123 ----
NM_003131chr682099 1770 1759 917 622 604 572 461 21847 258 32125 863 825 22211 2041
NM_003133chr11281 ------
NM_003137chr63891 487 212 --11419 --
NM_003140chrY1110 ------
NM_003144chr63881 770 620 ------
NM_003145chr14440 195 132 118 ------
NM_003149chr311289 ------
NM_003150chr17102275 2047 1991 1660 919 850 676 443 373 158 ------
NM_003156chr1171332 1284 1269 1057 915 870 128 11251 3301 159 44 --
NM_003161chr1743073 1209 833 714 ------
NM_003164chr112165 116 296 49 ----
NM_003178chr332098 1585 299 1467 ----
NM_003179chrX71245 1020 496 409 403 259 30 11033 ----
NM_003185chr2011099 --1956 --
NM_003186chr115379 324 150 104 46 ------
NM_003189chr162552 2065 1137 927 345 124 11226 32410 653 160 --
NM_003199chr1831592 1496 812 11047 ----
NM_003200chr19122139 2114 2095 1915 1874 1633 962 956 595 309 201 50 22211 1908 41788 1477 910 194 22047 1662
NM_003204chr1741601 1497 1484 463 21712 1324 ----
NM_003215chr461526 1503 1445 1134 1127 426 --11480 --
NM_003216chr22162913 2891 2767 2695 2679 2454 2350 1055 922 599 509 357 332 315 295 54 21213 588 21076 834 13142
NM_003217chr1231627 1550 202 11768 ----
NM_003220chr621480 638 --1148 --
NM_003221chr653956 3520 2602 1653 1042 1551 33285 2955 1348 --
NM_003236chr253030 1338 597 179 89 2890 768 ----
NM_003239chr1431031 880 753 --2820 713 --
NM_003242chr342182 726 692 96 ------
NM_003250chr171325 ------
NM_003255chr1751946 497 298 235 83 --1250 --
NM_003274chr212954 251 ----1571
NM_003275chr921057 473 11143 ----
NM_003281chr1235210 5044 4986 4825 4183 4138 3330 3299 2187 1816 1578 1569 1116 1098 1063 1030 887 664 439 388 243 207 143 34332 1462 447 54341 4276 3711 1760 550 13484
NM_003290chr1921172 37 1318 ----
NM_003291chr132806 599 ------
NM_003292chr12657 581 ------
NM_003298chr361943 1669 1026 789 751 379 35900 5025 4271 13992 23775 2241
NM_003304chr311298 ------
NM_003309chr621649 65 ------
NM_003339chr511201 11294 ----
NM_003342chr1722082 925 12302 ----
NM_003344chr72691 446 ------
NM_003349chr2081508 1310 1211 1000 592 519 432 365 1255 ----
NM_003355chr113336 255 32 ------
NM_003356chr1131040 1019 900 ----1807
NM_003370chr192693 580 --1248 --
NM_003371chr962058 1835 1487 597 435 229 51944 1438 775 680 39 41502 1360 1345 289 --
NM_003376chr631498 684 560 1324 ----
NM_003376chr631498 684 560 1324 ----
NM_003392chr343397 3262 1596 461 1483 11511 --
NM_003394chr122462 101 1513 --1163
NM_003400chr21791 ------
NM_003404chr2021302 831 ------
NM_003405chr221536 1145 ----
NM_003406chr82570 359 11241 ----
NM_003412chr322015 1949 --1328 --
NM_003427chr61447 --2686 118 --
NM_003442chr111176 ------
NM_003455chr1141665 1321 463 160 31674 1179 84 ----
NM_003456chr161185 ------
NM_003458chr3183753 3715 3128 3054 3033 2780 2743 2567 2474 1326 1111 847 479 207 129 89 78 63 12633 63560 3306 3084 1308 588 513 --
NM_003463chr632585 2445 1168 ------
NM_003466chr282516 2239 776 715 591 537 334 177 21947 52 12459 22364 785
NM_003468chr243163 1250 1135 960 24142 3537 ----
NM_003470chr1691825 1606 1582 1294 1272 716 557 357 302 11286 1317 --
NM_003474chr101616 2827 574 ----
NM_003477chr111254 ------
NM_003478chr1122978 50 ------
NM_003481chr121511 --1187 --
NM_003482chr1262674 2199 2114 1733 1026 133 1323 1178 12207
NM_003487chr172211 92 ------
NM_003489chr21----12197 --
NM_003498chr16132492 2263 2167 2161 2131 1777 802 757 581 452 349 169 21 32283 1744 723 ----
NM_003502chr162525 41 ------
NM_003559chr17113604 3438 3391 2921 2850 2844 2811 2711 1423 825 612 --83701 3224 2872 2581 2509 1276 1046 314 --
NM_003563chr1731145 1111 166 ------
NM_003564chr13637 540 526 ----1245
NM_003566chr125701 647 558 224 184 ------
NM_003574chr1844994 4364 2311 1774 13737 1440 --
NM_003575chr72542 504 --11091 1282
NM_003576chr1372806 2627 2550 2522 2283 1182 414 ----22570 396
NM_003583chr1233649 1101 468 11053 ----
NM_003590chr211513 ------
NM_003597chr212163 1172 12111 --
NM_003607chr163793 3441 1203 1086 778 423 13063 1834 --
NM_003618chr21402 ------
NM_003620chr171145 11003 ----
NM_003624chr1931278 480 357 21143 463 21166 339 --
NM_003626chr11------1859
NM_003628chr21749 ------
NM_003629chr163121 3008 2690 2653 2245 31 22506 521 --12571
NM_003633chr532280 1884 640 ------
NM_003637chr181490 1142 1118 1100 502 251 103 33 --11033 11352
NM_003644chr17176388 5795 5597 4993 4818 4721 4421 4192 2312 1810 1765 1459 1279 944 716 335 98 45719 4692 1307 526 25731 4796 22538 2039
NM_003655chr173617 185 62 ------
NM_003656chr3145 ------
NM_003659chr21321 1387 ----
NM_003666chr11667 2618 586 ----
NM_003671chr973109 2914 2886 2808 2521 856 274 --12248 --
NM_003677chr1252306 2140 1474 474 288 22257 2225 ----
NM_003679chr163100 2948 2491 851 742 718 13176 ----
NM_003684chr15927 810 433 175 54 1304 ----
NM_003685chr191154 ------
NM_003705chr21234 ------
NM_003713chr121099 219 ------
NM_003722chr322202 2098 11805 ----
NM_003735chr5----31415 1169 657 1137
NM_003736chr5----31415 1169 657 1137
NM_003741chr3------1148
NM_003743chr21212 --11476 --
NM_003749chr131924 ------
NM_003759chr433801 3010 2927 12623 ----
NM_003768chr141473 658 596 160 ------
NM_003822chr143037 2522 1977 1141 ------
NM_003825chr1511362 ------
NM_003842chr862211 2056 1811 863 624 35 ------
NM_003861chr1432779 2333 861 ----12171
NM_003872chr222617 950 ------
NM_003873chr102839 722 ------
NM_003884chr3------11185
NM_003885chr1751764 861 769 435 345 --2161 131 --
NM_003893chr101354 --3452 182 145 --
NM_003908chr2031224 867 427 ------
NM_003913chr633413 557 433 --13022 --
NM_003927chr18----1781 --
NM_003930chr72960 680 1879 ----
NM_003934chr9------1232
NM_003936chr221129 939 1877 1453 --
NM_003939chr1083683 3560 3420 3302 3159 2925 964 120 --13870 1572
NM_003949chr1792062 1889 1819 1650 1481 1355 1336 1324 192 3603 453 433 1517 --
NM_003951chrX1324 ------
NM_003955chr1761149 587 563 542 522 246 1428 1113 --
NM_003958chr633393 2641 454 23604 3154 22798 2465 --
NM_003975chr13223 217 106 ------
NM_003983chr16103894 3658 3198 1648 1517 1433 1190 1156 458 176 --31701 917 477 --
NM_003987chr1031544 1450 754 ----1547
NM_003988chr1031621 1527 831 ----1624
NM_003989chr1031480 1386 690 ----1483
NM_003990chr1031480 1386 690 ----1483
NM_003994chr1243228 704 415 266 1797 ----
NM_004006chrX12322 ------
NM_004007chrX12322 ------
NM_004009chrX12322 ------
NM_004010chrX12322 ------
NM_004011chrX12322 ------
NM_004012chrX12322 ------
NM_004013chrX12322 ------
NM_004014chrX12322 ------
NM_004015chrX12322 ------
NM_004016chrX12236 ------
NM_004017chrX12322 ------
NM_004018chrX12236 ------
NM_004020chrX12322 ------
NM_004021chrX12236 ------
NM_004022chrX12236 ------
NM_004023chrX12236 ------
NM_004035chr1775055 3287 1968 1795 1703 1563 1319 34786 4042 1293 23413 443 24952 767
NM_004036chr22471 79 ------
NM_004050chr1442149 1009 792 74 --11812 22336 915
NM_004055chr1172054 2036 1574 1568 1470 824 748 22150 77 32072 1484 638 11893
NM_004061chr5------1134
NM_004067chr71116 --1214 --
NM_004074chr11157 --1164 --
NM_004077chr122466 235 --11312 --
NM_004079chr132589 2282 1099 32526 317 180 ----
NM_004089chrX3277 195 154 11139 1260 --
NM_004090chr1752662 2315 1101 728 146 22683 2529 31382 787 166 12173
NM_004093chr1352708 404 357 206 186 11981 ----
NM_004094chr1462759 2280 2262 1977 1903 51 1413 ----
NM_004100chr652621 2324 1698 309 76 ------
NM_004136chr151335 --12380 --
NM_004156chr8--1469 ----
NM_004161chr2--11408 ----
NM_004171chr11108658 8596 8388 6789 6588 6305 6194 3704 3594 2286 38263 1507 375 16214 --
NM_004181chr41301 ------
NM_004185chr12230 155 --196 1175
NM_004186chr33887 781 592 --1855 1955
NM_004187chrX5380 220 204 190 86 --2960 923 --
NM_004200chr1192957 2877 2661 2333 2278 1217 796 530 523 --22573 2174 22379 214
NM_004203chr16------1137
NM_004210chr10122139 1790 1771 1746 1630 1624 1572 1355 756 730 723 641 --31314 521 396 11993
NM_004227chr782709 2677 2566 2129 1942 953 803 625 22248 180 32484 2406 1239 --
NM_004228chr19148 --271 64 --
NM_004229chrX1738 1473 ----
NM_004232chr183935 551 173 ------
NM_004233chr651526 1291 508 392 267 3600 451 325 ----
NM_004242chr6--143 ----
NM_004263chr2101639 1566 1532 1421 1379 1247 374 291 277 169 --21676 410 --
NM_004272chr53640 630 618 ------
NM_004281chr101123 ------
NM_004286chr22132683 2676 2532 2466 1919 939 843 833 810 692 596 260 47 22650 547 21896 1818 --
NM_004293chr923617 185 2105 32 ----
NM_004295chr176529 426 271 252 201 177 ----1547
NM_004302chr12132721 2423 2248 2064 1883 1871 1121 982 969 766 753 120 30 1335 12581 22485 489
NM_004308chr11141896 1701 1672 1611 1527 1451 672 623 550 216 156 86 61 33 --31665 1482 655 --
NM_004309chr175868 716 373 137 124 --1929 --
NM_004311chr1052793 2567 2427 2161 1093 --12170 --
NM_004319chr182919 2794 2731 925 634 549 487 61 1779 --1480
NM_004321chr2183420 3389 3198 3191 3174 3167 2898 2511 2346 1181 856 812 733 704 625 592 522 221 43008 2783 2431 1069 23357 566 1912
NM_004326chr13966 879 245 ----1956
NM_004329chr10----1310 --
NM_004331chr821058 555 ------
NM_004350chr172236 2121 2022 1630 1017 239 151 2989 348 2950 460 1413
NM_004358chr2051125 1056 409 204 188 --2794 719 --
NM_004364chr1961257 1250 1217 1153 292 240 --127 --
NM_004370chr631682 1391 870 ------
NM_004379chr221767 619 ------
NM_004380chr1662441 2376 2321 1704 1616 531 ------
NM_004389chr22680 102 1184 ----
NM_004392chr1322412 2037 ------
NM_004393chr371971 1879 777 720 702 358 159 1932 ----
NM_004395chr55707 498 277 126 58 ----1508
NM_004397chr1131014 766 265 22611 1227 ----
NM_004411chr72708 305 ------
NM_004417chr5----1133 179
NM_004418chr22426 98 1445 174 --
NM_004419chr102904 814 2934 260 ----
NM_004423chr372459 2010 1952 1698 972 345 202 12070 1801 1270
NM_004426chr1221234 309 --1199 --
NM_004427chr13895 828 143 ----1919
NM_004429chrX81278 1129 1096 1036 558 502 303 216 --2229 158 --
NM_004432chr92923 704 ------
NM_004433chr151591 1469 672 443 348 31383 162 63 1217 --
NM_004434chr1421532 63 --1556 --
NM_004442chr151566 1207 675 447 70 2314 223 --31455 544 373
NM_004443chr32540 507 ------
NM_004447chr121215 ------
NM_004449chr21--1157 ----
NM_004451chr112511 87 --2520 209 1138
NM_004454chr321944 141 2615 251 ----
NM_004459chr1721630 672 ------
NM_004463chrX1143 ------
NM_004468chr12185 116 1394 --176
NM_004474chr12816 698 --1110 --
NM_004475chr17101158 1101 962 860 467 440 410 363 145 95 ------
NM_004485chr1124368 4320 4283 3755 3558 3532 3152 2993 1543 878 643 448 13730 ----
NM_004494chr131230 245 50 2439 312 21245 372 --
NM_004497chr195618 583 543 108 58 ------
NM_004500chr1431643 1472 683 ------
NM_004501chr153548 3434 2960 2687 1625 ----11406
NM_004503chr122563 159 --2814 271 --
NM_004505chr171358 2709 260 ----
NM_004514chr1792946 2541 2534 2126 2026 1125 855 624 461 ------
NM_004521chr10------1100
NM_004530chr163459 361 301 ------
NM_004540chr21--196 ----
NM_004549chr1161536 1436 1279 1077 1060 1008 ------
NM_004554chr1481842 1565 1436 408 193 105 94 71 11327 1581 --
NM_004555chr163220 183 99 --1191 --
NM_004560chr92717 232 ------
NM_004566chr1071931 1675 793 769 601 204 130 22496 498 2889 247 1293
NM_004573chr157674 650 628 588 523 316 123 --2507 202 153
NM_004577chr72499 214 ------
NM_004580chr1521876 587 146 ----
NM_004586chrX55397 3851 3664 1738 196 45332 3553 1689 922 ----
NM_004587chr201467 --1308 --
NM_004588chr11103353 2785 1538 1376 1027 954 860 603 437 121 --43469 654 262 224 1209
NM_004598chr522787 1016 --11295 --
NM_004602chr2021474 409 --1310 --
NM_004603chr7298 54 --2932 347 1790
NM_004606chrX122 --1312 --
NM_004608chr163319 168 60 1383 2459 112 --
NM_004612chr954648 4540 746 401 49 22955 1427 14722 --
NM_004626chr112249 184 1286 1707 --
NM_004630chr1161212 948 824 399 216 207 1174 11134 --
NM_004631chr121046 57 ------
NM_004634chr32109 68 ------
NM_004637chr311222 --1245 1471
NM_004643chr14----3643 311 239 --
NM_004646chr193947 195 73 1447 ----
NM_004647chr191223 --2273 27 --
NM_004656chr361069 826 474 412 338 292 --31198 492 485 1126
NM_004660chrY3628 539 423 1642 ----
NM_004670chr1011371 ------
NM_004677chrY1533 ------
NM_004687chr1761953 1346 700 278 134 79 --21967 205 --
NM_004703chr1711684 ------
NM_004719chr1242574 1898 1763 1025 ------
NM_004723chr12147 138 1131 163 1192
NM_004725chr101523 1562 ----
NM_004736chr122088 1993 ------
NM_004737chr2221077 159 ------
NM_004744chr442575 2409 1579 225 --12691 --
NM_004745chr855571 5009 422 314 72 14965 15789 14380
NM_004758chr1731174 359 97 --1893 1201
NM_004759chr1111985 1722 1714 1669 1336 780 619 604 505 466 212 11375 164 --
NM_004760chr761643 852 843 772 680 68 11545 ----
NM_004762chr17151803 1763 1716 1682 1511 1398 718 630 565 538 523 499 272 113 37 ------
NM_004772chr52991 587 ------
NM_004774chr17--12364 12826 --
NM_004776chr2082748 2528 2404 1025 898 486 389 207 ------
NM_004783chr166607 584 475 460 152 61 1207 ----
NM_004788chr1132353 2277 198 ------
NM_004796chr1431817 284 132 ------
NM_004798chr2063576 3472 3446 2934 2565 2291 12242 --1193
NM_004801chr221544 392 ------
NM_004805chr241415 1008 295 69 ------
NM_004807chr2112422 2036 1962 1901 1648 833 623 517 296 287 32 --11778 --
NM_004808chr1073160 2514 2486 2330 2306 2164 967 1887 ----
NM_004815chr154148 3853 1122 871 747 ------
NM_004821chr51263 --189 --
NM_004822chr17163355 3293 3233 2521 1525 1499 1483 1312 1301 1225 1122 1111 705 313 244 67 --62704 2515 1474 353 307 195 12865
NM_004827chr42698 315 ----1678
NM_004834chr242704 2612 1330 679 1616 ----
NM_004840chrX32188 716 188 ------
NM_004845chrX84067 4031 3380 1318 1129 1096 685 70 1149 --11575
NM_004850chr231763 1082 176 21682 385 ----
NM_004854chr271158 1140 1056 880 517 374 42 11235 ----
NM_004859chr1762910 2749 2719 2623 2604 239 ------
NM_004860chr172396 129 --1511 --
NM_004863chr14175198 4913 4356 4234 4215 3442 1875 1771 1178 982 971 859 791 483 384 357 310 14166 --15237
NM_004867chrX125 ------
NM_004879chr112355 157 ------
NM_004884chr1551728 1553 478 134 97 --1230 11676
NM_004904chr746291 5104 1182 1006 1213 ----
NM_004921chr141912 1674 1612 244 --1530 --
NM_004922chr105989 919 865 309 150 1975 1113 --
NM_004924chr193420 213 52 --21062 929 1319
NM_004926chr143714 615 235 ------
NM_004943chr1951200 1056 951 934 295 11235 ----
NM_004952chr18918 760 749 314 294 287 255 232 ------
NM_004953chr33392 169 159 --1293 --
NM_004959chr961498 399 369 349 304 55 11083 1942 --
NM_004972chr91401 ----1906
NM_004973chr61707 1523 1554 11682
NM_004976chr11145015 4884 4680 4521 4284 4209 4058 4020 3224 2041 1316 1070 451 110 24746 1512 64029 3255 1796 1630 791 184 25064 3234
NM_004978chr1101628 1582 1558 1540 1484 1106 432 388 267 107 11065 21449 403 162
NM_004979chrX81064 928 832 816 398 246 210 93 1964 1317 --
NM_004985chr1233010 1738 262 ------
NM_004992chrX188205 7662 7010 6731 6025 5807 5388 5321 3156 3140 2841 2825 2666 2229 1784 1512 821 650 16549 36472 3198 1428 15881
NM_004992chrX188205 7662 7010 6731 6025 5807 5388 5321 3156 3140 2841 2825 2666 2229 1784 1512 821 650 16549 36472 3198 1428 15881
NM_004995chr1421266 138 11386 21348 425 1572
NM_005010chr721954 900 ------
NM_005011chr731332 1255 1225 1190 ----
NM_005020chr72522 154 --1224 --
NM_005027chr1971155 1136 891 440 411 297 119 1810 2391 37 --
NM_005030chr162273 53 ------
NM_005056chr1265383 3751 3693 3635 3577 1005 15272 11334 --
NM_005063chr1083265 3248 3092 2593 1554 1508 682 446 --13397 --
NM_005065chr1465263 4774 4039 3687 858 81 ------
NM_005076chr1114198 3740 3231 3201 2967 2959 2753 1136 1035 715 693 31311 1054 1003 43713 3539 2853 1200 2480 347
NM_005078chr1551508 1370 1298 729 177 1608 31746 1251 357 134
NM_005079chr832852 2264 443 1182 ----
NM_005080chr221758 1325 ----
NM_005094chr95556 280 235 218 72 --1588 --
NM_005096chrX5864 322 289 198 155 --1302 --
NM_005099chr15863 364 290 165 28 --1403 1180
NM_005105chr152064 1540 471 354 58 11503 ----
NM_005114chr41712 1637 ----
NM_005116chr2064609 4357 3695 766 697 394 13167 ----
NM_005121chr1723251 146 ------
NM_005126chr31505 2694 607 ----
NM_005133chr112428 365 ------
NM_005134chr181356 2795 79 ----
NM_005135chr1542888 2764 2596 1446 ------
NM_005137chr22101721 1689 957 846 815 776 680 613 589 463 2402 31 52084 884 855 606 66 12226
NM_005148chr173450 96 40 ------
NM_005151chr181707 ------
NM_005155chr6158 ----1632
NM_005156chr944547 4385 3496 1908 ------
NM_005157chr971586 1401 778 671 474 374 109 --11380 --
NM_005184chr1931424 1271 1073 11384 1293 11236
NM_005188chr11167508 6923 6762 6457 6269 5933 5653 5539 2493 2398 2262 1840 1739 963 347 278 37960 7102 5390 25695 2836 17411
NM_005197chr1445840 4748 4279 1647 35695 4085 3960 14269 --
NM_005202chr191713 746 686 673 409 275 121 80 27 12241 --3782 608 436
NM_005215chr181656 ------
NM_005219chr591646 1430 1350 1233 1124 498 415 234 135 31770 1581 588 21616 95 --
NM_005224chr193638 48 32 ------
NM_005229chrX51174 1130 1048 498 32 --1425 21168 133
NM_005235chr296719 5527 5368 5269 4996 3107 2339 448 70 17723 11491 12987
NM_005238chr1131001 959 270 1427 12985 --
NM_005254chr1511335 ------
NM_005271chr101931 1378 11064 --
NM_005273chr71254 --2233 117 --
NM_005276chr1261635 1465 652 618 460 62 --11266 1267
NM_005276chr1261635 1465 652 618 460 62 --11266 1267
NM_005311chr752620 910 340 286 100 ------
NM_005312chr9132568 2349 2216 2104 1681 1011 985 957 863 751 467 441 72 --11928 11052
NM_005316chr112983 62 ------
NM_005324chr1711724 ------
NM_005327chr42259 251 ------
NM_005334chrX91613 1558 1282 1138 653 428 422 414 22 11295 1267 --
NM_005347chr92520 235 --11606 --
NM_005349chr4--196 ----
NM_005354chr191640 --199 --
NM_005359chr18106063 5975 5657 5317 4296 2425 2371 2327 2202 1120 16017 36029 5239 5153 24779 4462
NM_005368chr222426 32 ----1210
NM_005375chr6--153 ----
NM_005381chr22436 127 --149 --
NM_005386chr203836 737 278 --122 --
NM_005387chr112527 75 ------
NM_005402chr771752 1321 1225 684 639 336 269 ------
NM_005407chr1441259 507 388 276 --1412 --
NM_005415chr22486 241 ------
NM_005417chr20101935 1917 1907 1774 1394 1328 443 283 265 41 --41924 1434 1275 1253 11373
NM_005435chr71386 ----1218
NM_005436chr1063751 2690 2581 326 246 80 ------
NM_005437chr1021181 91 --1993 --
NM_005456chr115711 558 270 256 233 ------
NM_005458chr94668 575 535 86 1708 1472 1388
NM_005461chr2041345 448 349 190 --11281 --
NM_005465chr12635 60 11480 ----
NM_005474chr1771545 1411 1052 373 333 284 276 --124 --
NM_005475chr1242985 2931 2053 868 12228 ----
NM_005476chr921150 484 31169 1117 354 ----
NM_005477chr1552346 1824 1813 807 704 22173 2087 41789 898 447 435 1474
NM_005477chr1552346 1824 1813 807 704 22173 2087 41789 898 447 435 1474
NM_005487chr2251491 670 320 300 90 1246 1689 --
NM_005497chr17105722 5381 4920 4786 4476 3832 2449 458 143 93 15636 ----
NM_005504chr1255979 4868 2029 1628 1294 11937 ----
NM_005512chr1151878 1843 748 727 102 11631 21418 298 --
NM_005513chr331554 1131 340 ------
NM_005522chr741373 1063 136 126 --142 --
NM_005523chr741448 427 327 248 21462 153 ----
NM_005530chr1541508 1390 1140 1128 2957 488 ----
NM_005542chr731489 230 130 ------
NM_005547chr11315 1326 ----
NM_005562chr151508 1459 1417 663 325 137 11292 --
NM_005573chr51559 ------
NM_005587chr1521016 278 ------
NM_005596chr972284 2209 2134 2066 1107 935 501 25887 5749 --16194
NM_005603chr181461 2655 412 1144 --
NM_005604chr63948 263 55 ------
NM_005605chr81313 ------
NM_005609chr11152 ----1261
NM_005610chr1--1680 ----
NM_005613chr142117 1834 1810 48 ------
NM_005614chr71847 1877 ----
NM_005627chr62328 117 ------
NM_005643chr62552 211 ------
NM_005644chr1177 ------
NM_005647chrX112604 2570 2246 2137 1337 1297 1179 1137 623 591 133 22964 255 --1413
NM_005665chr154123 3880 3863 3647 1672 34170 815 627 --13848
NM_005668chr534124 1774 905 ----1383
NM_005682chr1651261 1217 992 521 343 21254 389 2311 188 --
NM_005686chr191360 1195 1099 1021 1006 515 372 311 194 --2341 36 --
NM_005698chr1121 ----172
NM_005707chr152973 249 11147 ----
NM_005718chr34765 652 628 65 --1231 --
NM_005722chr21145 11729 ----
NM_005730chr1263001 1245 1183 1137 1056 845 2633 544 21461 1284 13068
NM_005734chr111114 ------
NM_005736chr1041229 1004 281 208 --21202 158 1151
NM_005737chr242846 2626 717 510 1649 2605 492 --
NM_005738chr72101 43 ------
NM_005740chr226763 719 706 593 82 54 1355 ----
NM_005742chr2--141 ----
NM_005748chr1232752 2300 1239 ------
NM_005759chr223482 1042 1319 168 1350
NM_005761chr12--150 ----
NM_005768chr122677 258 ------
NM_005776chr141246 ------
NM_005779chr553452 3041 2637 931 321 12373 13328 --
NM_005785chr1291737 1626 1455 1333 1282 1236 328 284 238 --21426 151 11694
NM_005786chr182121 114 ------
NM_005789chr1761691 1678 867 781 500 58 ------
NM_005795chr221045 192 ------
NM_005797chr1121607 153 ------
NM_005802chr91250 ------
NM_005814chr191199 1173 1142 1083 943 488 306 223 59 1573 1372 --
NM_005819chr152885 2324 453 214 102 --21024 653 --
NM_005822chr662057 667 649 599 376 92 ------
NM_005828chr17184084 3922 3916 3806 3792 3671 3531 3518 3457 3210 1826 1650 1485 1178 752 688 614 151 23161 3129 34462 4073 1458 --
NM_005840chrX87623 7357 6564 5897 5528 2517 1619 157 --22657 2409 --
NM_005850chr1155 --184 --
NM_005851chr113120 97 66 ------
NM_005852chr1731105 833 237 1920 2819 104 --
NM_005853chr162606 53 ------
NM_005857chr121217 49 ------
NM_005863chr1021123 494 ------
NM_005864chr142604 326 1585 2257 61 --
NM_005868chr742521 2273 2134 2114 ------
NM_005877chr2272142 2114 1842 1641 1604 758 215 11677 ----
NM_005880chr1621545 277 ------
NM_005885chr531645 244 171 ------
NM_005895chr1273829 3712 2950 2711 1442 1302 1155 24150 4075 12659 --
NM_005898chr1123011 864 ------
NM_005900chr42174 24 ------
NM_005901chr18148333 8308 8023 7405 7387 6891 6862 5839 5298 2712 2030 1541 1374 575 37371 5512 836 25712 3036 15613
NM_005904chr182515 483 1575 --1953
NM_005906chr61678 ----166
NM_005907chr621220 251 ------
NM_005910chr1793676 3427 3093 1264 1078 1062 693 400 364 31097 1036 989 53911 3519 3246 2822 2771 13064
NM_005911chr211114 --11258 --
NM_005916chr7----124 158
NM_005920chr1123716 3709 3697 3292 2991 2976 2360 1223 1143 1060 1038 740 23477 697 33420 2914 982 13017
NM_005923chr6163 ------
NM_005933chr1142892 2234 1172 227 --11047 --
NM_005934chr1972580 2522 2132 1836 1639 1041 440 142 62295 2170 912 277 237 194 1315
NM_005937chr17183880 3741 3671 3602 3352 3123 3116 2790 1141 1116 830 678 668 625 496 150 96 50 13874 2949 398 --
NM_005938chrX31251 964 173 21186 422 ----
NM_005941chr821380 377 ------
NM_005944chr32310 35 ------
NM_005955chr173768 3724 1887 1685 1056 1002 761 --1816 23409 27
NM_005962chr1011456 1498 22275 2260 11430
NM_005962chr1011456 1498 22275 2260 11430
NM_005964chr171317 ------
NM_005969chr1141038 770 325 310 --1336 --
NM_005985chr204677 644 192 186 1699 1250 --
NM_005986chr1352351 1805 578 216 186 ------
NM_005990chr542753 1956 1057 962 11994 ----
NM_005994chr174795 769 383 274 3214 160 64 1172 --
NM_006007chr943736 3037 1066 1043 13214 ----
NM_006011chr1584029 3970 3943 3142 2942 1685 1446 343 --1911 2897 413
NM_006015chr121090 891 ----1134
NM_006016chr631883 1694 1677 ------
NM_006030chr321269 329 --21667 489 1154
NM_006032chr14----1192 --
NM_006034chr11132098 1985 1821 1753 1548 977 765 477 208 180 154 77 36 1790 1269 1842
NM_006035chr1441213 1188 1065 361 ------
NM_006037chr274378 3354 3105 1831 693 276 195 --13142 11969
NM_006038chr2031392 555 504 11537 1849 1344
NM_006039chr178997 932 851 817 811 759 226 151 1878 156 1115
NM_006047chr2033494 2448 2376 ------
NM_006048chr13502 391 323 --2924 898 --
NM_006051chr52248 200 --2216 35 --
NM_006061chr631121 395 322 --1990 --
NM_006062chr291154 1082 1030 888 852 843 804 187 157 ------
NM_006073chr631532 811 346 ------
NM_006077chr10143 ----2546 331
NM_006090chr11266 1595 ----
NM_006106chr1132112 1249 875 1835 11181 --
NM_006108chr1142393 1757 512 270 1773 ----
NM_006109chr142266 29 ------
NM_006133chr11142285 2080 2069 2052 1776 1629 1002 991 897 755 718 561 444 251 21957 1692 41574 929 842 484 1937
NM_006139chr252424 2396 2368 1073 64 1306 ----
NM_006141chr1661883 1090 999 935 260 215 22773 400 1223 --
NM_006148chr1792958 2436 2045 908 699 532 226 186 56 22037 446 21146 252 --
NM_006153chr31207 ------
NM_006154chr1521906 1854 ------
NM_006156chr144268 260 238 98 ----171
NM_006164chr21421 ------
NM_006166chr1242595 2554 2287 2208 12238 ----
NM_006191chr124921 847 696 182 1190 ----
NM_006201chrX31074 1029 768 --11114 1788
NM_006203chr534330 2134 331 14866 ----
NM_006212chr1123995 3775 3663 3350 2092 1952 1733 1287 859 509 342 57 13314 35205 1011 298 21727 794
NM_006216chr21654 1161 ----
NM_006224chr1732316 2068 1663 1435 1407 --
NM_006237chr1372292 2118 1798 876 656 398 321 ------
NM_006241chr332179 1771 1724 ------
NM_006245chr64883 251 92 57 --2733 704 146
NM_006246chr141473 ----11033
NM_006251chr533087 1038 421 ------
NM_006256chr11889 ------
NM_006257chr102334 71 1823 --146
NM_006266chr92671 220 ----1548
NM_006268chr1181111 1093 938 877 870 374 295 178 --2283 116 --
NM_006277chr2175 ------
NM_006279chr14630 574 229 126 ------
NM_006283chr8114468 4099 4032 3373 3060 1867 742 694 604 484 171 13817 ----
NM_006293chr156971 956 936 242 217 41 ------
NM_006301chr121614 1421 ----
NM_006306chrX105034 4796 4028 3720 3688 1257 1227 740 94 60 --3875 815 299 --
NM_006309chr3122 --136 --
NM_006313chr1221573 579 ------
NM_006320chr411107 ------
NM_006321chr361977 1931 1824 901 686 239 --21920 489 --
NM_006328chr113656 99 83 ------
NM_006336chr9131496 1456 1338 1200 1182 1093 1062 1053 570 545 425 276 33 --11489 11362
NM_006345chr431387 36 24 ------
NM_006352chr121763 96 1628 ----
NM_006356chr17125 ------
NM_006359chrX32329 499 194 ----1412
NM_006371chr3145039 4168 3712 3635 3338 2112 1671 1665 1492 1335 1258 648 459 302 21089 343 --12062
NM_006373chr1751243 1214 893 470 207 --21456 492 --
NM_006382chr172254 83 ------
NM_006386chr2221847 767 22298 1994 11946 --
NM_006393chr1011603 24141 280 1164 13258
NM_006412chr92176 28 1390 1498 1451
NM_006430chr22108 68 1418 ----
NM_006434chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_006449chr231761 1736 1549 ------
NM_006454chr4122741 2594 1010 875 745 721 642 528 481 381 246 22 12877 1786 --
NM_006459chr1021810 133 1441 21539 742 --
NM_006460chr1731493 634 127 --11441 --
NM_006464chr2114247 4046 3351 3039 2905 1482 771 763 358 191 21 11304 1388 11171
NM_006465chr1572124 1787 1509 1428 696 538 233 11827 1174 --
NM_006469chr111377 ------
NM_006472chr13333 161 58 ------
NM_006480chr52462 99 ------
NM_006482chr1233649 1101 468 11053 ----
NM_006494chr192289 75 --2784 233 --
NM_006517chrX71895 1566 694 484 314 252 138 2241 231 1289 --
NM_006521chrX2447 114 21069 384 3924 487 269 124
NM_006532chr193550 245 150 129 3593 460 301 11699
NM_006534chr2032641 1144 786 ------
NM_006538chr264080 3066 3034 1268 1131 80 ------
NM_006540chr841090 445 407 139 ------
NM_006544chr1435352 4030 672 15403 25453 4389 11212
NM_006546chr17116241 5891 5454 5296 5249 4047 2135 1475 1103 432 105 16389 25430 5038 --
NM_006549chr1252778 2526 1927 770 126 --21193 46 --
NM_006561chr1045937 5049 4740 2228 1235 --25645 2306
NM_006565chr161974 1396 136 --
NM_006575chr141992 ------
NM_006587chr41292 ------
NM_006595chr1111644 ------
NM_006599chr1646984 6799 6289 5617 16229 38155 1877 674 --
NM_006612chr17--1426 ----
NM_006618chr121311 530 ----1340
NM_006621chr121264 280 11961 ----
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006625chr1195 ------
NM_006628chr1544479 3524 1869 556 ------
NM_006633chr51778 ------
NM_006634chr2167 ------
NM_006636chr21859 ------
NM_006646chr133884 748 147 ----1841
NM_006650chr5133841 3734 2863 2666 2608 2509 943 730 562 526 509 503 127 33161 2895 1048 23715 3207 11039
NM_006690chr2092294 2083 1996 1974 533 427 353 229 77 ----41814 1691 1582 1531
NM_006696chr52113 62 ------
NM_006698chr2051258 329 305 295 247 ------
NM_006699chr12851 749 --1658 --
NM_006700chr122578 305 ------
NM_006703chr63343 337 71 ------
NM_006708chr62877 374 ------
NM_006711chr162293 107 1319 ----
NM_006717chr943129 2368 1154 768 --11278 11072
NM_006722chr332456 1955 358 ------
NM_006729chrX35586 4852 1345 --13777 --
NM_006732chr1962129 1966 1711 1547 810 118 --31880 566 309 --
NM_006736chr2101774 1524 1429 1274 1215 677 467 442 318 200 31496 1312 164 21515 1195 --
NM_006738chr15133909 3670 3575 3099 2883 1404 1245 1182 920 794 141 124 41 ----13551
NM_006748chr861794 1359 644 450 437 188 161 --195
NM_006750chr16137809 7586 7339 7162 7083 6832 5990 5712 2196 1433 1135 571 181 ------
NM_006751chr21413 ------
NM_006763chr151629 1304 539 455 76 --2393 22 --
NM_006766chr842604 2255 1934 189 ------
NM_006769chr12265 211 ------
NM_006772chr651548 1478 1428 1192 532 --1358 1123
NM_006775chr623096 2519 ------
NM_006777chrX62422 2341 1794 778 622 497 --1694 --
NM_006788chr1861957 1842 862 768 548 438 12084 --1431
NM_006805chr531320 368 276 123 2150 119 --
NM_006814chr2042123 2093 702 45 ------
NM_006815chr122503 55 --11236 --
NM_006823chr831344 1113 401 ------
NM_006827chr1432574 367 302 11226 ----
NM_006838chr1231668 400 378 ----11245
NM_006841chr34655 622 487 206 --1184 --
NM_006852chr1722109 1858 1995 1186 --
NM_006854chr721873 1790 ------
NM_006856chr1241106 785 331 89 ------
NM_006861chr1241852 1750 1715 333 41604 1549 1341 603 --11706
NM_006868chr1853061 2393 2291 2184 129 ----1189
NM_006874chr431141 857 816 ------
NM_006885chr1623333 667 1279 ----
NM_006889chr351137 1060 1006 452 61 --11408 --
NM_006893chr1----150 --
NM_006896chr741115 835 289 224 ------
NM_006897chr121401 --1543 --
NM_006899chr20----1136 --
NM_006901chr153546 207 155 ------
NM_006918chr1154198 3588 1798 1708 616 31910 1348 706 14056 --
NM_006922chr222492 2310 --12031 --
NM_006924chr1762911 1733 1443 642 321 273 --12969 --
NM_006931chr1252146 1951 1673 487 195 11870 21497 297 --
NM_006943chr2083130 2960 2592 1027 952 882 554 122 2992 636 32073 462 400 --
NM_006950chrX5379 362 318 290 172 --247 32 1585
NM_006981chr922795 353 ------
NM_006999chr5--21361 416 ----
NM_007006chr1632861 568 400 ------
NM_007011chr15126478 5636 4798 4596 4223 2306 1644 953 935 924 686 40 41101 675 470 168 26173 907 --
NM_007017chr53802 315 159 ------
NM_007039chr1411474 1196 1531 --
NM_007047chr672392 2370 2082 1902 633 576 253 1429 1649 --
NM_007050chr20187651 5804 5421 5370 5303 5025 2592 2324 2152 2025 1468 1104 1014 797 627 494 448 279 11636 26353 785 25321 1043
NM_007064chr331334 1312 361 ------
NM_007067chr1731247 1163 140 ----1967
NM_007073chr673798 3767 3757 3259 1163 815 656 ----11133
NM_007078chr1052780 2730 1890 659 401 32701 620 589 11046 --
NM_007107chr351744 1582 778 313 23 11668 ----
NM_007112chr1163 --152 --
NM_007114chr3--12791 ----
NM_007122chr13579 544 404 --1230 --
NM_007144chr1731101 872 60 --1107 11283
NM_007150chrX21736 410 11432 ----
NM_007153chr1944476 2999 1734 741 33208 3176 1752 ----
NM_007158chr121038 949 --11143 --
NM_007170chr13373 135 88 --128 --
NM_007174chr123885 755 111 --1214 1958
NM_007175chr842769 1406 975 508 1366 --11234
NM_007176chr1431483 588 44 11173 ----
NM_007185chr13782 200 109 1760 191 --
NM_007189chr741357 460 368 328 21085 39 2575 85 11307
NM_007200chr15133909 3670 3575 3099 2883 1404 1245 1182 920 794 141 124 41 ----13551
NM_007203chr953155 2808 1365 946 189 33016 2852 38 23070 341 13108
NM_007216chr113759 388 152 ------
NM_007232chr204794 344 168 53 1644 2843 778 --
NM_007236chr1572094 1893 1633 1564 798 742 467 ----1617
NM_007238chr20144634 4524 4273 4261 3929 3893 3801 3729 3673 1740 1241 769 620 533 24110 1691 24291 1101 --
NM_007242chr162207 32 ------
NM_007245chr163822 294 112 ------
NM_007249chr1388792 6012 2797 2735 2317 1293 741 729 1212 ----
NM_007256chr1151339 1065 547 282 266 --2574 309 --
NM_007260chr14774 248 232 172 --2508 135 --
NM_007275chr321138 342 --1972 --
NM_007283chr3112918 2516 2446 2262 1905 1152 1092 1086 445 334 33 --12043 11121
NM_007286chr5112096 1898 1402 1361 834 697 576 481 438 405 61 --31734 200 128 --
NM_007292chr1775055 3287 1968 1795 1703 1563 1319 34786 4042 1293 23413 443 24952 767
NM_007294chr1751073 1036 834 199 110 1462 1498 175
NM_007295chr1751073 1036 834 199 110 1462 1498 175
NM_007296chr1751073 1036 834 199 110 1462 1498 175
NM_007297chr1751073 1036 834 199 110 1462 1498 175
NM_007298chr1751073 1036 834 199 110 1462 1498 175
NM_007299chr1751073 1036 834 199 110 1462 1498 175
NM_007300chr1751073 1036 834 199 110 1462 1498 175
NM_007302chr1751073 1036 834 199 110 1462 1498 175
NM_007303chr1751073 1036 834 199 110 1462 1498 175
NM_007304chr1751073 1036 834 199 110 1462 1498 175
NM_007305chr1751073 1036 834 199 110 1462 1498 175
NM_007313chr971586 1401 778 671 474 374 109 --11380 --
NM_007350chr1233343 1429 1391 23277 3201 14281 --
NM_007353chr782887 2292 1948 1853 982 207 115 64 ------
NM_007359chr1731209 1175 517 1328 ----
NM_007363chrX3823 258 74 1906 ----
NM_012064chr123939 808 775 ------
NM_012069chrX61080 1004 902 690 564 59 22463 794 --1628
NM_012074chr143827 760 739 --21115 23 --
NM_012083chr1011007 2267 99 1326 --
NM_012090chr121039 198 --11251 --
NM_012095chr1053252 2929 2664 2378 560 ------
NM_012097chr221940 1409 ------
NM_012098chr951449 1268 1194 572 51 ------
NM_012102chr141985 280 240 45 ------
NM_012104chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_012104chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_012111chr14----1137 --
NM_012118chr41401 ------
NM_012134chr151672 1547 1369 141 90 --11392 --
NM_012141chr1323468 2768 ------
NM_012153chr1141760 1641 1633 65 11671 ----
NM_012156chr20113164 3053 2999 2987 2519 2462 2381 1372 1284 772 415 11336 32554 2333 1096 --
NM_012164chr9125679 4873 4733 2455 2296 2059 1928 1456 1330 1309 774 719 11776 21526 794 --
NM_012175chr111633 --1131 --
NM_012180chr41750 --1170 --
NM_012192chr114258 181 137 31 --168 22315 705
NM_012193chr11125243 5197 4637 4405 4376 4016 3685 3514 3284 2176 2027 1593 ------
NM_012199chr1134483 4417 4305 4146 3530 3361 3311 3256 3153 2857 1641 1531 1048 11837 14084 --
NM_012200chr111101 ------
NM_012207chr101437 ------
NM_012210chr911053 ------
NM_012214chr295805 4196 4026 2182 2161 2154 2005 1513 1345 11432 ----
NM_012215chr1031885 1837 378 ------
NM_012218chr19102802 2731 2082 935 800 711 644 554 475 239 1613 32744 1894 720 11158
NM_012229chr1041247 1126 537 43 ------
NM_012232chr1782200 2174 2116 1973 1431 1420 557 248 11498 31683 403 307 1628
NM_012234chr321388 82 1588 ----
NM_012248chr163687 506 223 ------
NM_012249chr2--12685 11291 --
NM_012261chr202703 121 1535 ----
NM_012281chr7138 11859 ----
NM_012282chrX1155 --2852 54 1303
NM_012285chr174122 74 66 29 --2499 88 --
NM_012287chr311325 ------
NM_012296chr1183439 3366 3212 2997 2919 2783 807 792 33542 3516 1200 11229 21023 164
NM_012300chr532212 894 554 12182 11698 12087
NM_012301chr741858 1776 576 162 1124 11535 --
NM_012304chr542480 2164 761 633 --32368 2171 656 --
NM_012308chr1152395 1861 1736 1703 980 --11939 --
NM_012309chr11114638 4204 3883 3752 3618 1365 1343 649 201 179 123 --24738 1181 11055
NM_012316chr1185387 5366 5243 5179 4866 4522 4301 3890 3881 2150 1362 1004 624 439 173 157 120 65 44785 2179 1345 658 35491 4423 1765 --
NM_012320chr1671392 997 557 439 365 310 292 --156 --
NM_012325chr2021022 503 1484 --11061
NM_012326chr23628 184 147 ------
NM_012328chr721444 1094 --1266 --
NM_012329chr1711156 153 ----
NM_012333chr121391 337 ------
NM_012347chr632713 1889 236 1718 ----
NM_012384chr2082222 2110 1500 925 851 586 489 326 2463 235 22245 438 21759 26
NM_012396chr14549 502 222 80 ----1174
NM_012398chr1972888 2377 2351 1930 1137 685 531 11822 31125 880 424 --
NM_012399chr2211376 1600 11695 --
NM_012402chr1161393 1215 280 209 108 102 --2928 381 --
NM_012405chr153411 3083 2789 741 278 151 23665 26 --
NM_012407chr224535 421 153 109 2191 55 ----
NM_012410chr165380 348 153 105 89 ------
NM_012416chr921172 198 ------
NM_012419chr62610 81 ------
NM_012430chr32555 27 ------
NM_012458chr194869 845 443 288 1924 21082 477 21125 422
NM_012461chr142493 198 ------
NM_012465chr1053237 2895 2640 2449 2338 --1341 --
NM_012473chr223637 288 104 --1536 --
NM_012478chr175885 853 315 242 75 1254 ----
NM_013229chr1262797 2493 2474 961 818 663 ----12443
NM_013231chr1474132 3546 1692 1542 1381 703 370 --23119 2735 --
NM_013236chr222412 228 ------
NM_013245chr162698 234 --3686 578 192 --
NM_013247chr22387 136 1415 ----
NM_013253chr111125 1202 ----
NM_013255chr778677 8538 7626 6993 6478 3034 1566 47348 6857 6054 5821 18040 --
NM_013261chr442785 804 615 270 ------
NM_013262chr621130 241 11167 --1223
NM_013269chr1263722 1336 945 778 450 419 ------
NM_013279chr1181901 1832 1689 668 547 461 313 222 1862 22024 520 1617
NM_013286chr3153686 3643 3214 2991 2579 2400 2360 1525 1476 1216 985 935 809 343 103 13482 ----
NM_013305chr186652 250 204 147 97 57 --1293 --
NM_013323chr1721125 128 1264 1936 --
NM_013333chr192360 120 ----156
NM_013335chr23190 147 138 ------
NM_013336chr371762 1464 1361 720 615 364 182 ------
NM_013341chr222404 426 12355 ----
NM_013365chr225852 602 287 276 216 ------
NM_013372chr1542618 1286 345 123 ----1611
NM_013382chr1481665 1583 1501 876 781 721 231 26 --12062 32148 510 140
NM_013390chr94641 469 455 381 11234 ----
NM_013399chr16101726 1720 1710 1153 687 669 570 505 493 93 11390 31624 1254 522 21453 358
NM_013400chr771030 924 700 439 345 302 264 ------
NM_013411chr142545 1980 1855 306 ------
NM_013433chr1981675 1579 1434 1409 294 281 184 90 1695 1260 1665
NM_013434chr261943 1840 1725 1307 444 171 11956 41847 1277 590 277 --
NM_013434chr261943 1840 1725 1307 444 171 11956 41847 1277 590 277 --
NM_013436chr2145 ------
NM_013438chr921405 1144 ------
NM_013443chr941048 1035 316 161 21008 365 ----
NM_013444chrX1836 ------
NM_013446chr721350 1321 11212 ----
NM_013449chr1272009 1995 1188 813 502 368 136 1858 189 --
NM_013951chr282516 2239 776 715 591 537 334 177 21947 52 12459 22364 785
NM_013952chr282593 2316 853 792 668 614 411 254 22024 129 12536 22441 862
NM_013953chr282593 2316 853 792 668 614 411 254 22024 129 12536 22441 862
NM_013989chr1454981 4943 3279 1457 401 14182 ----
NM_013992chr282593 2316 853 792 668 614 411 254 22024 129 12536 22441 862
NM_013993chr63743 552 185 --2691 294 --
NM_013994chr63743 552 185 --2691 294 --
NM_014002chr13688 614 121 1662 --1173
NM_014007chr92197 65 ------
NM_014010chr94382 79 71 64 ------
NM_014011chr2----1288 --
NM_014021chr143040 2754 1068 658 12210 --12778
NM_014023chr1051975 1946 1920 375 104 --22200 225 --
NM_014028chr643350 2782 2753 2329 22721 2248 ----
NM_014030chr1741053 933 146 130 21082 1063 11143 --
NM_014039chr112894 193 ------
NM_014060chrX123 ------
NM_014079chr32786 354 1130 1202 1764
NM_014089chr1331563 761 129 ------
NM_014109chr811158 ------
NM_014110chr12244 123 11173 1378 --
NM_014112chr814909 ------
NM_014141chr774237 4212 1691 1093 999 595 587 11544 ----
NM_014145chr201596 --1204 --
NM_014155chr1156778 5679 4870 1841 1337 11718 1148 --
NM_014157chr16143479 3248 3150 2976 2870 2799 1546 1221 974 871 838 445 183 139 33772 1468 287 11427 11461
NM_014181chr222792 2331 --12485 --
NM_014182chr123687 626 171 1708 ----
NM_014183chr201292 ------
NM_014191chr122848 224 ------
NM_014203chr19150 1125 ----
NM_014231chr1231830 502 479 1355 11705 11999
NM_014232chr1731174 392 99 --11122 --
NM_014232chr1731174 392 99 --11122 --
NM_014233chr1781744 1698 1675 1668 1606 515 399 101 1682 1211 --
NM_014238chr1771434 1426 1212 1081 530 283 261 11145 ----
NM_014240chr363928 3486 2942 2700 1372 807 23879 2681 175 1313
NM_014250chr2251491 670 320 300 90 1246 1689 --
NM_014251chr72696 156 166 ----
NM_014268chr1841358 1339 344 198 ------
NM_014275chr59934 876 857 618 308 292 138 128 54 1715 ----
NM_014292chr2271816 1769 1470 1213 604 187 29 11243 11404 11303
NM_014293chr22133765 3421 3375 3233 3128 2861 1358 1143 975 894 859 806 114 23547 2566 33883 1153 1035 --
NM_014299chr1981455 1433 1384 879 764 557 303 267 21633 410 4819 286 276 133 --
NM_014309chr2284774 4550 4060 4034 3470 1601 1130 754 --24007 1969 --
NM_014323chr222308 37 1361 ----
NM_014325chr1211450 21519 54 ----
NM_014333chr111968 1137 ----
NM_014342chr112964 429 21511 116 11331 --
NM_014344chr112346 31 1188 1581 --
NM_014351chr22197 ------
NM_014368chr931778 1772 402 11987 1760 11561
NM_014374chr771030 924 700 439 345 302 264 ------
NM_014396chr741612 1406 914 456 1552 ----
NM_014409chr13733 233 119 ------
NM_014415chr31113 ----11224
NM_014417chr194210 202 174 69 1834 ----
NM_014418chr1471892 1729 694 684 654 476 205 --11329 --
NM_014423chr544692 4133 3940 3865 11266 12173 1431
NM_014445chr331697 640 75 --11512 --
NM_014452chr62989 983 1218 ----
NM_014458chr1258 43 ------
NM_014470chr121313 --146 --
NM_014480chr192882 145 1635 ----
NM_014491chr7------1958
NM_014494chr16----12310 1870
NM_014507chr2261188 1113 1080 896 291 122 ------
NM_014515chr123970 104 41 ------
NM_014517chr33640 270 234 183 ----
NM_014547chr152250 81 ------
NM_014547chr152250 81 ------
NM_014554chr1272208 1947 1827 663 131 119 72 --11452 --
NM_014564chr91731 1897 2158 49 --
NM_014577chr222703 172 1670 ----
NM_014587chr1631476 1112 1058 --11419 --
NM_014591chr1061040 929 488 158 135 30 1913 1110 --
NM_014592chr5--1102 ----
NM_014604chr173199 172 166 1328 --1182
NM_014613chr531936 890 801 --3986 635 445 12468
NM_014614chr221400 1262 --1475 --
NM_014615chr1622667 592 --13506 --
NM_014634chr2283283 2876 2291 1205 1167 610 504 164 --52535 1235 1187 402 364 --
NM_014636chr964126 3757 1505 1436 232 76 140 23830 264 --
NM_014646chr1842089 490 219 192 2844 234 --1907
NM_014647chr1622084 561 11897 ----
NM_014649chr19175 ------
NM_014659chr151244 --2741 369 --
NM_014661chr10123938 3735 3697 3479 3338 3239 3055 1199 454 389 361 157 1531 43268 1213 608 58 12624
NM_014663chr13991 314 193 --152 --
NM_014667chr342402 2231 2218 2184 22203 2113 --12152
NM_014670chr231108 627 70 --1325 --
NM_014674chr31445 ----23814 3529
NM_014677chr8176 11237 1503 --
NM_014680chr172569 41 1505 ----
NM_014683chr1712039 ------
NM_014686chr1962194 1694 643 634 333 206 --1139 1680
NM_014690chr7113078 2807 2610 2055 1975 1015 452 274 259 212 137 42874 2443 778 199 12013 1733
NM_014700chr1621488 48 --11286 --
NM_014702chr623248 526 ------
NM_014705chr711953 1530 ----
NM_014706chr1221064 41 ------
NM_014711chr16161 1725 11571 --
NM_014712chr164510 442 160 44 --2418 393 --
NM_014717chr191711 ------
NM_014718chr125782 217 202 157 42 183 ----
NM_014726chr177431 347 341 248 221 179 157 1191 11169 --
NM_014729chr831568 322 152 ------
NM_014730chr12185196 4828 4811 4771 4531 3766 3448 1979 1963 1957 1830 1749 1737 1595 1477 1395 930 630 44436 3390 3338 458 34201 3794 2057 13562
NM_014730chr12185196 4828 4811 4771 4531 3766 3448 1979 1963 1957 1830 1749 1737 1595 1477 1395 930 630 44436 3390 3338 458 34201 3794 2057 13562
NM_014731chr2071632 1580 1537 1229 1147 463 354 1712 1505 --
NM_014735chrX31710 786 441 ------
NM_014736chr152994 45 ----1772
NM_014737chr2062737 1550 1395 574 180 24 --33381 1604 1093 11312
NM_014739chr643773 3243 864 390 12849 --12746
NM_014741chr11101781 1613 1491 1481 1447 775 649 345 225 163 11953 ----
NM_014742chr204682 136 129 115 ------
NM_014743chr452723 2287 1118 1007 491 ------
NM_014746chr284283 3098 2710 1766 1551 915 340 311 --11004 --
NM_014747chr1194874 4702 4620 4560 4470 3786 1785 1700 1684 1662 946 854 762 639 433 395 389 240 225 35302 4738 1129 64852 4654 4322 3694 1524 652 25098 553
NM_014751chr821870 781 --21970 830 --
NM_014752chr1151588 1328 145 55 31 1248 11360 --
NM_014755chr243494 3370 874 229 ------
NM_014757chr562333 1948 1882 816 760 101 --1148 --
NM_014759chr861549 1454 562 338 271 139 --2495 363 11428
NM_014761chr163991 287 237 --1141 --
NM_014762chr172219 1804 835 737 681 648 148 1782 1252 1559
NM_014765chr122510 602 --173 11866
NM_014766chr763800 2934 1257 604 586 539 11520 ----
NM_014767chr10213598 3230 2864 2845 2833 2748 2458 2294 1133 1044 995 982 933 885 515 461 449 439 427 264 114 22986 2357 33199 2380 957 --
NM_014770chr1241300 932 472 413 --21170 253 --
NM_014771chr164782 759 146 23 --141 --
NM_014772chr18123528 3342 2610 1322 1316 1003 390 361 259 250 91 46 11208 22199 1395 12904
NM_014776chr1252969 2750 2452 2232 450 22192 548 ----
NM_014783chr1521193 323 ------
NM_014786chr1171081 920 874 808 454 269 202 --1509 1522
NM_014798chr17131870 1675 1664 1440 1291 752 745 638 587 340 279 247 187 --31731 1405 1183 --
NM_014800chr72148 84 1887 1333 --
NM_014810chr131485 742 45 11364 12787 13443
NM_014811chr93683 170 28 --1677 --
NM_014812chr11601 ------
NM_014819chr532071 1772 779 ------
NM_014820chr311920 ------
NM_014822chr4------1495
NM_014824chr1111331 ------
NM_014826chr163793 3441 1203 1086 778 423 13063 1834 --
NM_014827chr11151 11369 1161 --
NM_014828chr1452395 1789 1707 1674 253 --12168 --
NM_014830chr1273409 3095 2810 1417 1405 1393 103 13531 --22723 1385
NM_014835chr2032248 2042 1823 1216 ----
NM_014836chr1011892 ------
NM_014839chr111740 ------
NM_014840chr1262732 1313 1039 752 375 60 --1389 1650
NM_014849chr151096 915 524 413 370 2830 804 ----
NM_014850chr3104577 3902 3394 3381 1937 1261 1088 99 93 63 33634 584 120 14293 14441
NM_014858chr151051 897 413 70 32 ------
NM_014859chr1761381 1341 1057 536 509 397 ------
NM_014868chr122818 581 --1118 --
NM_014869chr351315 926 463 178 162 11425 --11244
NM_014872chr912173 1190 1227 11838
NM_014873chr134156 3963 872 13639 --14229
NM_014876chr2271953 1917 1550 818 661 391 186 --11880 --
NM_014877chr1797682 7024 6953 6831 6600 5944 5764 5489 1113 ------
NM_014881chr10139 ------
NM_014883chr452446 1682 465 360 73 --187 --
NM_014884chr19177 --160 --
NM_014891chr761492 492 419 129 82 35 31410 450 300 1465 --
NM_014897chr1743267 2503 2314 2162 ------
NM_014901chr571898 1629 1420 669 380 348 45 ------
NM_014902chr2021372 515 --21492 391 --
NM_014909chr14153839 3266 2976 2834 2780 2527 1095 1071 1020 911 905 788 481 367 38 --43520 2807 852 697 33274 2470 380
NM_014912chr1012885 13279 12854 --
NM_014914chr241041 848 306 110 136 ----
NM_014921chr19112969 2805 2148 1232 1184 833 790 530 368 165 64 --3820 693 53 --
NM_014924chr1472112 1952 1070 900 864 811 682 --1313 --
NM_014925chr123812 349 210 1803 ----
NM_014926chr311140 ----1810
NM_014932chr3166 ------
NM_014934chr1363377 3136 3068 2942 2709 697 23075 556 --11275
NM_014935chr1203425 3262 3170 3139 3058 2796 2790 2754 2722 2516 2449 1169 1069 992 446 325 248 219 103 90 43119 2703 1231 1022 42898 2838 2712 1122 --
NM_014948chr2092369 2349 2322 2121 1958 1632 1623 738 513 12341 12279 1420
NM_014949chr111015 --179 --
NM_014952chr1571977 1741 1724 1279 577 159 128 41663 1581 753 460 31366 1332 249 --
NM_014961chr42720 604 ------
NM_014969chr11324 ------
NM_014977chr14189 2357 190 ----
NM_014982chr1435214 4937 3917 1931 ----
NM_014988chr431067 646 56 --12704 --
NM_014990chr142930 153 ------
NM_014991chr422505 2378 ------
NM_014994chr15101988 1785 1579 1456 798 754 737 681 247 201 1309 22086 392 --
NM_014996chr321050 77 ------
NM_015001chr11409 1656 ----
NM_015008chr3132976 2890 2862 2835 2749 2687 1235 1052 706 561 524 403 35 13382 --22400 243
NM_015009chr31589 --1146 --
NM_015020chr1643511 1070 641 485 --1196 --
NM_015023chr1101738 1297 689 662 631 618 558 416 289 279 --51781 1613 1193 183 54 --
NM_015024chr841381 272 203 94 1913 ----
NM_015033chr973256 2501 1046 714 339 311 37 1602 12893 12608
NM_015035chr20146540 6206 6138 5738 5521 5011 4977 4807 4583 4293 2561 2419 1535 1124 2121 39 36457 6432 450 --
NM_015042chr15173927 3918 3839 3721 3683 3611 3308 3196 3168 1691 1515 1253 980 971 870 351 148 34005 3934 3247 13896 33906 1028 509
NM_015046chr942471 1755 540 151 2999 947 ----
NM_015050chr641309 1075 867 62 2215 202 ----
NM_015051chr921168 1132 32169 726 447 11126 --
NM_015052chr731236 913 31 155 ----
NM_015054chr12136 ------
NM_015061chr92710 37 --170 --
NM_015063chr1951114 350 326 143 74 1112 31228 449 272 --
NM_015064chr1253649 3437 2851 1310 351 33600 976 196 ----
NM_015068chr773295 1441 1083 980 311 302 156 11462 ----
NM_015071chr575646 4890 4658 4209 4012 1555 150 --21958 1153 --
NM_015074chr154096 3542 1326 1111 487 64047 4015 3231 1884 1245 737 ----
NM_015075chrX72174 2141 1382 888 705 249 101 11706 31855 880 495 --
NM_015076chr643610 3317 987 306 ------
NM_015077chr17214535 4506 4159 4145 3996 3768 3699 3600 3220 3066 3028 1294 1026 799 774 729 723 436 410 206 101 24200 1000 23380 86 --
NM_015082chr532169 565 284 --21996 23 --
NM_015086chr1231381 580 484 21339 430 145 --
NM_015087chr1322556 2001 1867 ----
NM_015090chr1146129 5321 5079 4322 2369 2090 1765 1359 904 775 716 600 436 311 14282 1553 35585 5520 4557
NM_015092chr1643492 2909 1769 1599 --13567 --
NM_015094chr22193905 3792 3402 3257 3240 3140 3134 3058 3027 2960 2898 1602 1351 963 818 749 692 444 126 --43171 2931 573 96 --
NM_015097chr311940 ------
NM_015099chr175497 468 209 183 70 --130 --
NM_015100chr131708 831 794 ------
NM_015107chrX61524 913 852 90 74 64 1127 11566 --
NM_015115chr432868 2537 1048 ------
NM_015120chr2128 ------
NM_015124chr2292276 2186 1809 1657 929 565 450 303 123 --22227 2005 --
NM_015125chr191476 ------
NM_015132chr751775 1729 1439 1420 65 ------
NM_015138chr1582093 1961 1809 1013 876 404 240 230 --1359 --
NM_015144chr1623116 1165 1540 1419 1481
NM_015149chr122109 730 2455 371 ----
NM_015155chr1062304 2213 862 634 596 452 ------
NM_015156chr1432963 356 99 ----1273
NM_015161chr1621128 1102 ------
NM_015171chr164395 183 103 90 ------
NM_015172chr121264 601 ------
NM_015176chr1----11420 --
NM_015193chr871413 1395 1195 1151 589 321 100 ------
NM_015194chr1761802 812 685 220 147 48 --31842 446 241 21538 634
NM_015197chr14123369 3248 2974 2940 2720 2508 2282 2260 897 444 331 269 11059 43018 2954 1261 611 --
NM_015208chr1834060 3889 2685 34011 3514 2720 ----
NM_015209chr141488 583 552 495 ------
NM_015215chr122937 880 ------
NM_015216chr511079 ------
NM_015229chr1751036 983 887 868 318 1146 1905 --
NM_015233chr1352629 2241 1832 1753 163 --12212 --
NM_015239chr91123 ------
NM_015245chr692713 2335 1943 1008 769 670 438 187 147 --21964 805 12046
NM_015250chr962041 1652 829 747 672 256 11292 ----
NM_015254chr8202935 2665 2602 2472 2434 2317 1955 1257 895 851 591 578 561 536 484 450 319 236 161 29 21946 988 4572 512 277 154 --
NM_015260chr1981539 1431 1358 1305 1133 1127 311 60 --2443 218 1640
NM_015263chr151986 ------
NM_015265chr232053 1940 232 ------
NM_015270chr1272187 2050 1915 1692 503 362 228 21442 409 42226 2138 1931 567 --
NM_015271chr432764 621 576 --12864 --
NM_015272chr1641684 1612 132 84 ----11888
NM_015284chr171959 1877 585 458 287 265 92 --41813 776 527 255 --
NM_015288chr583723 3306 3003 2496 1550 1283 284 34 --13282 1686
NM_015296chr132832 493 1452 ----
NM_015299chr14173886 3829 3818 3732 3717 3681 3597 3274 2994 1482 1301 988 971 575 456 389 377 1430 23672 1523 12838
NM_015305chr14111751 1677 1447 1398 1312 1199 697 667 537 468 406 ----31390 675 241
NM_015310chr877821 7446 7205 6608 3208 2887 963 26292 2996 13348 12792
NM_015313chr1123902 70 34548 3910 127 ----
NM_015315chr5143142 3069 2992 2948 2157 1246 1067 1037 1010 999 872 524 479 375 22793 586 42852 2714 492 176 --
NM_015317chr252748 2468 2088 1117 668 --12142 --
NM_015326chr192701 2558 2307 1935 636 544 525 166 81 --12281 --
NM_015327chr151284 539 428 247 57 21276 1032 ----
NM_015328chr762531 2350 2296 2029 639 368 ------
NM_015332chr7123559 3451 3356 3202 2777 2428 2389 2204 1411 1311 1039 655 1921 43539 3484 2967 1206 1496
NM_015335chr1222222 25 22415 449 ----
NM_015336chr1212448 1197 ----
NM_015343chr17199 ----2135 60
NM_015344chr821918 108 ------
NM_015345chr6102319 2278 1848 913 862 648 549 485 248 219 1124 2743 111 --
NM_015346chr1441613 1404 625 102 ------
NM_015347chr1232183 819 764 ------
NM_015349chr672151 1139 1097 605 350 223 78 --12076 --
NM_015355chr1721571 380 ------
NM_015356chr8282 28 ------
NM_015374chr2251369 1272 1253 1097 388 3338 244 36 21000 414 1437
NM_015375chr1144686 4526 4371 4124 4088 3440 3433 3134 1989 1494 946 627 619 158 53096 1908 1538 897 447 14936 --
NM_015378chr162854 2658 2440 2388 1160 939 1650 42721 2341 2138 1205 --
NM_015385chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_015393chr463731 3244 2358 1342 601 151 --11177 --
NM_015396chr321415 101 ------
NM_015397chr92689 301 --11518 --
NM_015401chr127934 898 791 355 274 81 62 --1173 3747 678 39
NM_015436chr442936 1021 476 60 ------
NM_015443chr174481 467 413 264 ------
NM_015444chr31202 ------
NM_015455chr511133 23870 3036 ----
NM_015457chr1151041 841 282 243 162 1437 2989 804 --
NM_015461chr182614 258 ------
NM_015477chr153631 247 27 ----1118
NM_015481chr121271 ----1406
NM_015483chr721016 409 ------
NM_015493chr1962047 2001 1493 896 799 82 1883 1151 --
NM_015508chr331245 1013 337 ------
NM_015511chr2051137 943 395 229 55 185 ----
NM_015520chr352744 1035 555 444 432 ------
NM_015523chr111220 ------
NM_015526chr1951400 1342 1283 1137 357 ------
NM_015528chr172178 25 ------
NM_015537chr93918 846 58 --3881 735 201 --
NM_015541chr341059 1052 461 76 --1918 --
NM_015545chr73719 299 87 --1292 --
NM_015553chr664125 3731 3538 1987 1952 805 13712 ----
NM_015554chr1522248 823 22118 522 ----
NM_015557chr193325 2830 2212 1374 1078 980 767 643 447 11457 33470 1441 1046 21000 126
NM_015559chr1841069 824 802 26 1173 ----
NM_015564chr532957 2587 568 ------
NM_015565chr211122 ------
NM_015567chr131115 ------
NM_015575chr252776 1375 1365 713 227 21042 757 23367 2501 12264
NM_015576chr312842 --22336 684 --
NM_015577chr521753 1363 ------
NM_015605chr101204 1427 ----
NM_015609chr172762 2713 2105 808 762 324 48 1606 42839 2789 2165 958 --
NM_015610chr722158 2102 22733 1766 12093 22608 589
NM_015645chr115343 316 300 266 90 ------
NM_015652chr10----1227 --
NM_015670chr171457 ------
NM_015675chr19--1485 ----
NM_015686chrX62117 2068 1961 1677 956 356 31587 1543 522 2972 826 --
NM_015691chrX42096 726 632 451 ------
NM_015695chr64784 315 276 180 11794 ----
NM_015713chr82792 301 13048 ----
NM_015716chr172734 229 --190 --
NM_015726chr161830 1487 1396 347 198 53 21612 532 ----
NM_015833chr2121955 168 --31735 576 97 --
NM_015850chr852296 1691 1535 730 400 --2967 597 12361
NM_015872chr181666 1611 1395 1366 473 453 280 93 1359 2665 392 --
NM_015874chr4--196 ----
NM_015878chr821849 1676 ------
NM_015879chr18128374 7846 7169 6622 5690 2747 2468 2095 2078 1396 617 371 16080 16509 27569 978
NM_015881chr111125 1202 ----
NM_015886chr834345 1290 601 139 ----
NM_015889chr223841 201 96 --2821 134 --
NM_015897chr193156 141 27 ------
NM_015898chr1961927 1773 741 654 359 241 --32319 379 339 --
NM_015902chr83793 220 107 ------
NM_015906chr164764 3725 3353 3274 1861 1401 ------
NM_015912chr852229 2030 1800 1740 1707 21840 286 ----
NM_015964chr164314 222 89 58 ------
NM_015980chr551194 667 647 614 198 196 ----
NM_015995chr15235431 5382 5244 5131 5023 5000 4758 3527 3509 2070 2045 1730 1714 1384 1352 1246 911 862 742 608 521 327 49 12123 65046 4972 3462 2171 1404 631 11685
NM_016003chr722158 2102 22733 1766 12093 22608 589
NM_016018chr842189 585 535 144 ------
NM_016019chr7------1303
NM_016022chr14778 422 242 187 --3792 715 416 --
NM_016025chr1631325 642 53 --197 --
NM_016032chrX91140 503 454 427 346 326 285 246 240 --11226 --
NM_016037chr12463 304 ------
NM_016045chr2031795 658 265 ------
NM_016057chr1221090 867 2817 201 ----
NM_016061chr22380 306 ------
NM_016073chr151989 ------
NM_016076chr132324 1245 36 --22520 574 --
NM_016083chr643155 3050 995 80 ------
NM_016089chr321831 1549 --21784 393 --
NM_016096chr81151 ------
NM_016107chr511254 ------
NM_016131chr222328 747 12274 ----
NM_016132chr1532683 1253 1046 ------
NM_016140chr164314 222 89 58 ------
NM_016162chr123578 173 50 1771 1673 --
NM_016169chr10133183 3055 2609 2419 2365 2142 1190 966 697 456 429 310 303 33202 2903 912 21012 647 --
NM_016173chr3194054 3919 3864 3820 3782 3751 1786 1755 1729 1513 1477 1003 829 762 628 523 451 435 429 --84222 3479 3267 3055 2926 1119 736 500 --
NM_016179chr13----156 --
NM_016201chr33912 784 458 1516 ----
NM_016206chr398345 7746 7633 7149 2974 2745 2656 2620 1749 48892 2689 1948 1074 18075 --
NM_016219chr92486 454 --1126 --
NM_016223chr116314 302 250 100 61 39 1136 ----
NM_016224chr631400 678 49 21876 890 2586 490 --
NM_016231chr1731329 1126 514 157 ----
NM_016235chr1621065 53 --1326 --
NM_016240chr841556 1317 1103 523 --2661 623 --
NM_016246chr19121 ------
NM_016250chr144706 692 619 186 160 1738 --
NM_016252chr22886 805 ------
NM_016255chr622268 431 23004 2616 169 --
NM_016257chr183542 2805 2503 577 309 111 69 26 32536 660 340 13445 --
NM_016260chr265449 2682 2103 1321 736 388 1837 ----
NM_016264chr191370 ------
NM_016272chr2272100 1844 1786 902 743 625 442 ----11914
NM_016277chr621598 175 11319 ----
NM_016287chr141385 805 398 226 11920 ----
NM_016319chr124689 659 563 88 1579 2571 24 --
NM_016320chr1141147 1013 725 374 --194 --
NM_016322chr933253 2573 857 ------
NM_016329chr3189 --198 --
NM_016333chr165212 197 121 111 38 ------
NM_016339chr17101646 1607 1353 1231 1207 1131 607 410 287 144 --21672 37 --
NM_016352chr781294 1217 1170 477 393 294 164 149 --1105 --
NM_016364chr10132 ----159
NM_016374chr121306 545 1219 ----
NM_016374chr121306 545 1219 ----
NM_016396chr1532726 1946 1190 ------
NM_016422chr111696 23161 1197 --12242
NM_016433chr1231451 233 95 --1364 --
NM_016436chr2052057 421 410 125 37 32354 2322 225 ----
NM_016441chr222089 1532 ------
NM_016453chr34559 508 238 198 1187 ----
NM_016488chr1231925 1358 1273 --11456 --
NM_016507chr1732508 723 199 22153 910 ----
NM_016516chr22708 247 ------
NM_016522chr1121588 1202 11559 ----
NM_016525chr93860 300 215 ----146
NM_016526chr11122415 1973 1944 1859 1823 1620 848 820 699 680 610 579 1538 21710 780 --
NM_016531chr454244 3964 2974 758 239 ------
NM_016575chr1294772 4134 3373 1499 983 692 622 579 263 25093 282 25104 3356 --
NM_016577chr3104216 3545 3476 3453 3400 3289 1543 976 913 499 ----24194 3510
NM_016578chr111233 ------
NM_016580chr53336 285 21 --1365 --
NM_016596chr127934 898 791 355 274 81 62 --1173 3747 678 39
NM_016598chr361396 1357 1037 524 258 251 11023 ----
NM_016605chr592194 2053 1923 1901 1868 1756 1728 601 21 193 ----
NM_016621chr11154058 3972 3774 3566 3552 3348 3293 3046 3005 1838 1790 1736 1237 600 350 --34143 3795 3463 --
NM_016654chr1511335 ------
NM_016734chr9111997 1834 1745 1736 1680 1674 1535 1465 1353 699 527 41646 1418 782 349 3574 518 159 1723
NM_016824chr101711 ------
NM_016829chr35701 523 312 256 43 --1553 --
NM_016830chr121192 --167 1361
NM_016834chr1793676 3427 3093 1264 1078 1062 693 400 364 31097 1036 989 53911 3519 3246 2822 2771 13064
NM_016835chr1793676 3427 3093 1264 1078 1062 693 400 364 31097 1036 989 53911 3519 3246 2822 2771 13064
NM_016841chr1793676 3427 3093 1264 1078 1062 693 400 364 31097 1036 989 53911 3519 3246 2822 2771 13064
NM_016929chr6134323 3731 1654 1569 1406 1275 956 842 667 553 508 250 180 13248 ----
NM_016938chr113361 161 100 --2441 382 --
NM_016946chr1143586 3196 3172 2566 2339 1442 1430 1314 1279 1165 952 393 271 61 12963 1505 --
NM_016950chr41401 1330 ----
NM_017412chr821375 964 ------
NM_017413chrX62465 568 242 231 174 75 --12170 --
NM_017415chr561315 1166 553 293 202 72 41576 781 515 96 ----
NM_017420chr1422766 526 ------
NM_017432chr191141 1295 3364 148 96 --
NM_017433chr101563 1191 177 --
NM_017443chr931454 1178 27 11220 ----
NM_017447chr2134216 1427 1421 14381 ----
NM_017449chr151566 1207 675 447 70 2314 223 --31455 544 373
NM_017450chr174955 545 99 55 11209 21084 927 11141
NM_017452chr2021474 409 --1310 --
NM_017453chr2021474 409 --1310 --
NM_017454chr2021474 409 --1310 --
NM_017456chr17151803 1763 1716 1682 1511 1398 718 630 565 538 523 499 272 113 37 ------
NM_017457chr19148 --271 64 --
NM_017459chr13262 43 26 137 1131 --
NM_017519chr611288 ------
NM_017522chr121046 57 ------
NM_017548chr341716 749 593 481 ------
NM_017551chr1092502 2231 2165 2019 581 563 554 449 318 --1968 --
NM_017558chr16----1360 --
NM_017582chr141744 677 653 111 31436 1423 522 --11315
NM_017589chr11150 ------
NM_017590chr2292262 2253 1659 893 397 354 251 219 31 12425 2526 427 22247 1018
NM_017592chr19101876 1812 966 869 803 651 560 290 277 70 11763 1551 --
NM_017594chr953154 3103 1270 1091 182 --12743 21314 240
NM_017596chr1174205 4174 4005 3982 3802 3787 3732 3438 3391 3163 1800 1458 1310 1261 1102 846 719 33717 3188 3130 63958 3472 1144 775 673 315 13695
NM_017599chr1241931 1331 774 134 ------
NM_017602chrX5938 878 807 602 144 ------
NM_017612chr121204 ------
NM_017622chr175516 452 200 76 28 ------
NM_017626chr1061749 1350 1225 629 417 46 ------
NM_017633chr61132 --13785 --
NM_017634chr821927 704 ------
NM_017635chr1121366 482 21453 26 ----
NM_017637chr9128621 8605 8552 7872 7356 6670 6053 6037 3769 3077 2701 88 28803 7075 27840 7829 --
NM_017643chr1742129 2063 989 642 --22817 2454 --
NM_017650chr754468 4274 4060 935 349 --1704 --
NM_017655chr12164 101 ------
NM_017658chr1423773 3709 ------
NM_017664chr132680 42 ------
NM_017666chrX62237 2054 1904 1391 592 477 11433 ----
NM_017668chr165680 649 641 615 218 ------
NM_017670chr112731 603 --1832 --
NM_017672chr1511160 ------
NM_017679chr173613 468 69 ------
NM_017704chr112669 332 ------
NM_017709chr174199 3916 3572 3532 3064 2950 1532 1413 ----
NM_017719chr321891 417 --12044 --
NM_017724chr32316 22 --136 --
NM_017737chr11794 1767 ----
NM_017741chr442322 1923 426 112 22273 2241 ----
NM_017742chr1831691 194 186 ------
NM_017744chr161667 1601 912 763 177 26 ------
NM_017747chr5150 ------
NM_017752chrX4819 730 685 422 ------
NM_017758chr1781354 1181 978 574 465 216 142 30 123 ----
NM_017763chr17--21133 80 2906 451 1838
NM_017772chr671498 1222 1121 545 444 424 168 21479 227 ----
NM_017778chr831004 996 603 ------
NM_017786chr82491 111 ------
NM_017787chr1042836 2239 658 450 12090 ----
NM_017789chr21552 1107 ----
NM_017790chr9150 ------
NM_017799chr1421543 425 ------
NM_017801chr331969 697 62 12318 ----
NM_017812chr71692 ------
NM_017813chr835629 5393 4330 ------
NM_017824chr1022129 258 ----1776
NM_017848chrX73808 3698 3673 1689 1683 1302 522 23167 167 11820 1285
NM_017849chr292768 2526 2365 1276 938 677 553 395 324 13027 2971 444 --
NM_017873chr972901 2587 2488 2114 2069 399 183 198 2833 573 --
NM_017893chr1031436 576 541 ------
NM_017902chr10135607 5328 4895 4743 4608 3972 1785 1664 1606 1578 1209 481 381 11416 44201 3794 2160 907 21514 703
NM_017907chr112204 62 --1464 --
NM_017919chr965661 4171 3834 967 775 266 --21048 201 13684
NM_017921chr17112230 2201 2104 2004 1639 924 525 426 174 132 107 22256 1455 --12038
NM_017938chrX2845 354 ------
NM_017944chr1113026 22736 1902 127 --
NM_017964chr2141 ------
NM_017966chr112206 137 --1406 --
NM_017983chr171179 1452 ----
NM_017994chr762859 2526 2448 297 241 70 --1211 --
NM_018003chr1531788 241 79 11739 ----
NM_018010chr311599 11368 ----
NM_018017chr1022550 1086 ------
NM_018026chr1161383 1043 375 283 102 31 ------
NM_018027chr1052772 2507 356 308 28 ------
NM_018028chr19--1942 138 --
NM_018030chr18176 ------
NM_018045chr192831 2801 2756 2667 2615 2280 2164 444 387 12248 22774 887 12230
NM_018067chr12464 104 --3482 412 112 --
NM_018071chr145570 323 280 238 119 1704 187 --
NM_018111chr19171 ------
NM_018117chr102535 274 ------
NM_018121chr1023063 2083 ------
NM_018125chr12333 122 ----1455
NM_018128chr1721471 440 21342 1066 ----
NM_018133chr321482 29 ------
NM_018145chr153540 508 113 ------
NM_018151chr21787 ------
NM_018156chr162854 2658 2440 2388 1160 939 1650 42721 2341 2138 1205 --
NM_018159chrX1176 1138 ----
NM_018164chr121246 ------
NM_018171chr121867 1154 ----
NM_018172chr1171433 1000 586 534 482 430 378 --1986 --
NM_018184chr341632 1582 764 335 ------
NM_018191chr132449 349 1128 137 --
NM_018201chr9122396 2250 2142 2062 1995 1881 1725 872 826 354 257 55 22075 791 11756 --
NM_018202chr1165 ----2908 698
NM_018203chr14841 625 563 30 --2675 136 --
NM_018207chr151691 1546 1525 1432 1284 21302 32 11641 --
NM_018208chr191138 1132 1121 1034 884 445 439 170 68 1324 1774 2368 157
NM_018214chr621320 372 ------
NM_018223chr124944 794 731 212 --1136 --
NM_018227chr422587 285 ------
NM_018234chr272187 1947 1757 561 541 502 21 2781 133 22158 1866 --
NM_018240chr15863 739 622 566 196 ------
NM_018241chr4--175 ----
NM_018245chr102343 160 ------
NM_018287chr101416 ------
NM_018293chr311099 --1777 --
NM_018299chr831240 330 156 ------
NM_018315chr431064 1040 130 ------
NM_018320chr114351 130 111 83 --11044 --
NM_018325chr92628 82 ----1580
NM_018358chr32216 103 --2230 55 --
NM_018362chr1112760 ------
NM_018364chr171314 1278 997 786 674 552 292 ------
NM_018373chr1476102 4308 1538 1253 1227 807 445 11489 22454 1014 1403
NM_018381chr194637 374 236 136 --195 --
NM_018383chr241447 724 116 33 ------
NM_018388chrX--11013 ----
NM_018403chr373951 3463 3146 3003 2524 1554 681 12656 ----
NM_018409chr442854 2745 2025 109 ------
NM_018424chr961881 1844 1825 1727 1717 1579 1343 ----
NM_018425chr1082418 2092 2036 2001 1872 880 635 54 1244 --21740 988
NM_018433chr21504 ------
NM_018440chr8107398 7348 7157 7000 6395 5556 2797 2093 648 604 26346 3403 25597 22 --
NM_018462chr31161 2811 292 ----
NM_018482chr81234 --167 --
NM_018486chrX1163 ----1436
NM_018489chr131671 153 103 133 172 --
NM_018509chr1761629 1320 657 535 256 35 ----1394
NM_018527chr13198 --183 --
NM_018553chr1751830 1810 1361 380 210 ------
NM_018557chr221161 120 --11179 --
NM_018584chr1----1196 --
NM_018650chr112234 ------
NM_018660chr8102847 2608 2268 1233 1198 1161 1009 802 613 30 22543 2398 ----
NM_018667chr1682224 1995 1094 999 806 771 511 90 11781 41022 780 167 56 --
NM_018679chr6359 30 22 ------
NM_018689chr1591810 1741 1031 948 556 453 316 255 161 1110 31902 533 206 --
NM_018710chr8162 ------
NM_018711chr1251337 611 554 504 46 11475 1654 --
NM_018717chr432641 2396 745 1719 2993 513 --
NM_018718chr731740 736 669 ------
NM_018836chr131209 948 27 ------
NM_018840chr203307 119 94 ------
NM_018841chr163487 3386 3349 1589 1239 268 --33409 1310 1261 1823
NM_018896chr172195 64 ------
NM_018898chr51217 1391 --1734
NM_018899chr51217 1391 --1734
NM_018900chr51217 1391 --1734
NM_018901chr51217 1391 --1734
NM_018902chr51217 1391 --1734
NM_018903chr51217 1391 --1734
NM_018904chr51217 1391 --1734
NM_018905chr51217 1391 --1734
NM_018906chr51217 1391 --1734
NM_018907chr51217 1391 --1734
NM_018908chr51217 1391 --1734
NM_018909chr51217 1391 --1734
NM_018910chr51217 1391 --1734
NM_018911chr51217 1391 --1734
NM_018912chr5----31415 1169 657 1137
NM_018913chr5----31415 1169 657 1137
NM_018914chr5----31415 1169 657 1137
NM_018915chr5----31415 1169 657 1137
NM_018916chr5----31415 1169 657 1137
NM_018917chr5----31415 1169 657 1137
NM_018918chr5----31415 1169 657 1137
NM_018919chr5----31415 1169 657 1137
NM_018920chr5----31415 1169 657 1137
NM_018921chr5----31415 1169 657 1137
NM_018922chr5----31415 1169 657 1137
NM_018923chr5----31415 1169 657 1137
NM_018924chr5----31415 1169 657 1137
NM_018925chr5----31415 1169 657 1137
NM_018926chr5----31415 1169 657 1137
NM_018927chr5----31415 1169 657 1137
NM_018928chr5----31415 1169 657 1137
NM_018929chr5----31415 1169 657 1137
NM_018951chr74363 304 216 130 --1503 --
NM_018952chr173567 266 147 ------
NM_018953chr124703 314 308 150 --1816 --
NM_018959chr192739 486 --1102 1525
NM_018970chr722094 553 1750 ----
NM_018976chr1242767 2440 2117 1943 12175 1962 --
NM_018977chrX3869 352 318 1407 1888 --
NM_018979chr122911 30 11901 12560 --
NM_018991chr75718 514 501 130 115 ------
NM_018992chr1671673 1471 1132 426 368 236 123 11446 11485 --
NM_018993chr2011389 ------
NM_018999chr1044743 4328 894 670 --14532 --
NM_019004chr722169 1573 ------
NM_019022chr1842787 2746 705 311 ------
NM_019042chr721131 51 1868 ----
NM_019046chr104826 783 733 613 --1234 --
NM_019053chr1021091 899 ------
NM_019058chr101725 1589 ----
NM_019064chr172866 833 ----1246
NM_019071chr73589 235 203 ------
NM_019072chr532598 1415 856 13691 ----
NM_019074chr155832 826 783 647 77 --1654 --
NM_019084chr103599 340 243 1170 --1769
NM_019106chr2252161 956 510 335 235 1533 ----
NM_019114chr932314 1949 595 --12412 --
NM_019116chr1673201 2834 2398 889 707 638 76 ------
NM_019593chr2042633 2616 2082 48 12118 ----
NM_019595chr2175 ------
NM_019596chr2152879 2857 1899 724 684 2628 175 ----
NM_019610chr132149 2072 1859 ----1592
NM_019613chr174927 326 117 83 21075 885 ----
NM_019845chr2----1338 1758
NM_019850chr25628 560 491 317 119 ----176
NM_019857chrX51702 696 636 527 494 21648 1511 ----
NM_019859chr10--21006 108 ----
NM_019885chr2112550 2307 1011 979 893 857 791 655 487 462 138 12021 42182 665 613 399 1245
NM_019903chr101711 ------
NM_020039chr1251939 1501 1377 623 521 --31923 394 88 --
NM_020117chr52170 28 2952 920 ----
NM_020122chr285900 5588 5114 5025 4950 1946 586 72 23696 2027 ----
NM_020123chr102513 398 11216 ----
NM_020137chrX--1108 161 --
NM_020141chr142024 1864 638 233 --12256 --
NM_020142chr123564 444 205 ------
NM_020144chr712084 ----11982
NM_020150chr102578 39 1228 ----
NM_020159chr421732 1363 ------
NM_020168chr1521266 284 21035 886 ----
NM_020179chr111133 1170 1358 --
NM_020180chr18------11362
NM_020182chr2053418 2930 2728 1315 760 12234 ----
NM_020184chr2102363 2093 2069 1961 1672 1634 944 735 631 200 12078 ----
NM_020198chr171108 ------
NM_020205chr12361 283 13013 --1885
NM_020208chr352924 2663 2136 1022 940 42852 2728 2355 564 22889 804 1162
NM_020211chr1531178 991 89 --1501 --
NM_020239chr182156 1632 1448 336 263 192 176 150 ------
NM_020246chr73151 144 61 --1292 1109
NM_020248chr1131985 1938 1854 1814 1751 1611 1586 1483 939 352 334 62 25 1523 22130 719 11560
NM_020310chr1771755 1716 1710 1134 806 730 592 12274 32416 2186 865 11857
NM_020337chr432898 942 679 ------
NM_020338chr10132632 2395 1441 1387 1305 1282 840 792 704 487 415 241 235 175 12369 22520 564
NM_020341chr2021516 1373 ----1774
NM_020344chr91125 --261 54 --
NM_020346chr111603 ------
NM_020348chr1052812 1838 1082 760 636 1266 11772 1312
NM_020362chr14721 645 607 238 ------
NM_020381chr62621 524 ------
NM_020383chr10139 ------
NM_020390chr314412 ------
NM_020405chr17104467 4298 4121 4017 3960 1214 958 862 539 80 23562 1165 43361 1553 1370 101 1414
NM_020429chr752153 667 642 512 94 12606 ----
NM_020431chr1492681 2605 2169 2122 2058 2028 1751 963 762 2308 218 12642 --
NM_020432chr71270 ------
NM_020438chr981429 986 962 528 324 291 256 213 --2513 197 --
NM_020443chr1186949 6332 6226 6176 5625 5269 4984 4815 4576 4263 2618 1629 940 669 415 322 312 273 44607 2710 2393 1795 ----
NM_020444chr531451 358 63 1277 ----
NM_020456chr1311583 12326 ----
NM_020474chr18----1686 --
NM_020526chr191779 1691 1685 1632 1179 681 649 254 203 1179 ----
NM_020530chr224927 859 846 820 ------
NM_020640chr332033 539 205 11469 ----
NM_020647chr841697 1606 699 597 1609 --2226 197
NM_020651chr22486 95 1170 ----
NM_020655chr1651348 1245 1239 347 173 ------
NM_020672chr12567 23 --2480 168 --
NM_020673chr2087411 6629 6303 5126 1948 1447 623 400 15303 17521 --
NM_020676chr33840 305 140 ------
NM_020699chr1175071 5026 4992 4379 4306 3862 3829 3669 1945 1874 1811 1566 1430 845 747 720 296 12088 ----
NM_020708chr2061988 1899 834 770 414 113 11557 2326 224 --
NM_020713chr20153104 2852 2596 2284 2264 1001 804 710 567 459 412 395 369 275 198 --42440 2189 897 788 --
NM_020717chrX124936 4769 4250 4223 4024 4008 3770 3519 1782 1566 656 124 --21820 180 --
NM_020724chr472520 2209 2040 1953 794 208 104 --1940 --
NM_020732chr611288 ------
NM_020734chr1223211 2995 ------
NM_020742chrX12034 --12650 --
NM_020748chr1731949 1428 1404 ------
NM_020752chr102702 217 1709 ----
NM_020766chrX33380 1577 388 ------
NM_020769chrX3792 378 63 --1754 --
NM_020771chr611057 ------
NM_020772chr1748316 7306 2372 368 --21530 620 --
NM_020783chr181733 186 ----
NM_020791chr17188 ------
NM_020792chr32487 358 12819 21894 746 --
NM_020794chr131132 1050 217 ------
NM_020795chr17121847 1702 1548 1485 604 489 458 449 349 198 191 39 1519 11542 --
NM_020796chr522166 982 ----1145
NM_020801chr511786 ------
NM_020804chr6102418 2050 2011 1879 1734 952 860 472 384 205 12089 12043 1549
NM_020805chr181116 ------
NM_020806chr141595 ------
NM_020807chr1651398 1178 616 511 185 --1711 --
NM_020808chr14300 294 245 221 ------
NM_020809chr1111594 193 ----
NM_020813chr1922771 1140 2701 304 42034 871 469 445 21168 919
NM_020814chr231231 512 434 --21252 129 --
NM_020818chr14134 ------
NM_020820chr2041311 593 577 36 11359 2615 202 --
NM_020825chr16133693 3545 3375 2885 2774 2697 1465 1389 1140 843 509 363 250 12626 23514 593 --
NM_020831chr2241003 802 216 166 --1981 1137
NM_020845chr1252334 925 833 313 76 21758 101 32425 1939 1014 --
NM_020850chr1693093 2672 2662 1186 1154 829 520 343 23 --12740 --
NM_020854chr181985 11358 ----
NM_020856chr191984 --1126 --
NM_020858chr1531913 1795 1558 ------
NM_020860chr41420 ------
NM_020870chr432039 1497 608 ------
NM_020871chrX11700 ------
NM_020886chr1131037 902 35 11082 --184
NM_020888chr141685 1453 1330 220 21698 507 11865 --
NM_020895chr191247 --1272 --
NM_020896chr1141037 360 273 24 ------
NM_020899chr1762213 847 631 129 120 71 2509 182 1275 22380 89
NM_020918chr1043177 957 208 127 12662 ----
NM_020920chr146389 335 319 62 55 28 ------
NM_020922chrX2676 84 ------
NM_020933chr1951924 1884 1662 665 351 1118 ----
NM_020939chr641173 1166 1106 360 2118 36 ----
NM_020940chr1022893 926 ----1380
NM_020946chr9131771 1650 1522 1502 1475 1437 1420 1338 1320 643 626 510 487 2617 202 21565 177 --
NM_020948chr122953 632 ------
NM_020962chr1541552 811 655 555 1597 12192 --
NM_020967chr204804 478 263 41 ------
NM_020977chr411415 21801 419 ----
NM_020981chr21172 1312 ----
NM_020983chr1272187 2050 1915 1692 503 362 228 21442 409 42226 2138 1931 567 --
NM_020993chr1292367 2131 1876 894 802 703 458 446 90 --2741 224 --
NM_021003chr141680 ------
NM_021012chr1783040 2291 2185 1247 1057 423 383 241 --42530 2106 611 101 2950 630
NM_021020chr8163215 3149 2980 2784 2771 1282 1098 1022 940 730 482 445 409 390 224 27 12988 53287 2858 2617 794 679 1112
NM_021033chr1321176 22 ------
NM_021038chr323310 2118 ------
NM_021072chr521700 1020 ------
NM_021079chr17102935 2198 2113 2062 1281 1056 898 757 206 102 33224 2371 873 32528 996 651 --
NM_021090chr22194725 4326 3707 3494 3464 1805 1599 1565 1504 1476 1381 1127 1035 890 877 774 742 238 65 11087 44950 3975 3242 520 --
NM_021096chr22173153 3093 3082 3010 2812 2672 2519 2047 2011 1323 1164 1059 786 743 510 458 154 22164 98 21171 986 1383
NM_021097chr242907 2140 769 515 1961 ----
NM_021106chr94637 255 238 116 --1683 1533
NM_021116chr7278697 8289 7810 7291 7236 6498 6184 5865 3166 3129 3078 2821 2801 2600 2534 2312 2107 1962 1873 1683 1596 1528 1310 1259 607 549 243 13347 68109 3383 3240 2073 488 23 28420 532
NM_021120chrX63100 2235 1224 807 413 357 --12256 --
NM_021132chr1031267 235 146 ----1169
NM_021133chr14583 134 72 53 ------
NM_021136chr141707 ------
NM_021137chr1792306 1997 1647 906 729 550 380 149 91 11958 1264 --
NM_021140chrX2364 314 ------
NM_021155chr1952869 2555 1078 180 149 --22743 305 169
NM_021159chr421642 1212 1439 ----
NM_021163chr713412 11270 ----
NM_021174chr85651 499 482 278 266 199 ----
NM_021183chrX2109 90 ------
NM_021189chr151008 925 804 685 351 --2866 312 --
NM_021190chr11150 ------
NM_021215chr205950 791 446 396 85 21820 914 ----
NM_021222chr121432 977 --11052 --
NM_021224chr9168 ------
NM_021239chr1441210 1160 194 170 ------
NM_021242chrX2299 84 2381 227 ----
NM_021248chr203620 574 116 --1258 --
NM_021249chr1431273 673 463 ------
NM_021253chr63905 129 95 ------
NM_021255chr143936 834 544 --1284 --
NM_021259chr167982 960 916 452 364 253 83 --2967 246 1735
NM_021260chr1471359 1318 1289 528 512 481 462 ------
NM_021267chr1961146 1014 879 321 251 68 1264 --1126
NM_021602chr175438 151 91 39 25 1352 ----
NM_021619chr931044 164 38 1836 --2505 250
NM_021637chrX198 --1210 --
NM_021638chr4105014 4964 4226 4200 3589 3446 3165 3035 930 335 14004 53382 1515 1241 880 814 --
NM_021639chr1----1351 --
NM_021643chr261864 1817 611 520 362 271 21252 250 ----
NM_021644chr101437 ------
NM_021647chr434033 2962 1744 ----11768
NM_021649chr511852 --1683 --
NM_021728chr143984 794 387 ------
NM_021729chr112303 64 ------
NM_021783chrX5714 511 218 53 27 12135 1603 --
NM_021784chr20133 ------
NM_021813chr621755 1492 15126 32224 1844 1762 14670
NM_021818chr14179 ------
NM_021872chr2051125 1056 409 204 188 --2794 719 --
NM_021873chr2051125 1056 409 204 188 --2794 719 --
NM_021905chr672264 236 228 142 130 123 116 --2920 55 --
NM_021911chr512004 ----15488
NM_021912chr1573897 3827 3770 3731 3597 3467 562 --12651 --
NM_021914chr1431878 877 454 ------
NM_021940chr621576 1440 ------
NM_021942chr41871 ------
NM_021943chr661948 1836 1778 764 491 142 ------
NM_021945chr692811 2719 2428 1392 1360 1078 396 45 35 12437 2375 311 1335
NM_021946chrX101429 1292 1238 1205 1197 591 353 343 337 300 --11246 21107 1087
NM_021954chr1373666 3436 2988 2972 1249 1235 363 --3430 405 306 --
NM_021959chr63757 240 173 1288 --1766
NM_021960chr132676 2409 1781 1985 ----
NM_021961chr1166997 2903 2803 2458 2402 120 12280 25903 2911 --
NM_021962chr174769 523 454 53 --21736 564 11845
NM_021964chr346478 6421 2562 1596 35269 4946 2258 ----
NM_021965chr9--11106 1408 11197
NM_021988chr2081508 1310 1211 1000 592 519 432 365 1255 ----
NM_021991chr174663 318 228 181 1151 1583 --
NM_022003chr112934 28 2515 508 --21138 840
NM_022039chr104475 420 388 109 1163 126 --
NM_022048chr1596346 5875 4844 2085 1927 1228 1219 473 350 11845 2568 32 --
NM_022054chr142785 85 1102 ----
NM_022060chr1451342 1246 1003 957 496 --31373 914 345 --
NM_022062chr1171659 1311 1242 1224 737 678 209 --31506 1497 773 --
NM_022091chr632761 2505 2429 ------
NM_022130chr521041 538 ------
NM_022138chr631174 583 228 1481 ----
NM_022143chr7--21062 223 ----
NM_022152chr28970 912 785 470 154 135 79 31 ------
NM_022153chr10203394 2886 2591 2494 2310 2283 2258 1433 1378 1330 1106 1027 947 702 602 440 166 98 86 40 33604 3051 777 63473 3328 3115 1209 505 119 2884 342
NM_022166chr16175337 4887 4746 4525 4389 4299 4158 4122 2353 1715 1395 1376 1285 805 612 406 121 14661 52369 1856 702 454 91 --
NM_022169chr11111365 1165 1117 989 556 511 455 166 124 100 87 1333 31322 1300 387 1174
NM_022170chr751419 1371 1155 620 178 11328 ----
NM_022336chr232050 2014 58 1809 ----
NM_022343chr971262 1018 981 869 848 333 134 ------
NM_022405chr352924 2663 2136 1022 940 42852 2728 2355 564 22889 804 1162
NM_022442chr2081508 1310 1211 1000 592 519 432 365 1255 ----
NM_022455chr52297 242 ------
NM_022459chr1346157 4403 2081 1427 15047 11661 --
NM_022462chr19213800 3680 3354 3230 3139 3077 2866 2736 2672 2551 2491 1483 1385 1327 1310 1244 491 376 262 229 179 --63372 2612 974 638 555 190 1217
NM_022465chr1252463 2221 2107 1170 851 --12058 1534
NM_022469chr172690 2320 891 741 472 464 368 11093 ----
NM_022470chr341256 1174 1088 154 ------
NM_022473chr1554299 3829 3139 769 145 --1955 21651 238
NM_022474chr1422381 1732 ----11106
NM_022476chr16146 ------
NM_022477chr20--21637 1592 11185 --
NM_022479chr741308 981 209 77 1338 11138 1235
NM_022491chr1283563 3481 2615 2393 1063 848 487 117 13066 ----
NM_022494chr10191 ------
NM_022497chr392646 1431 1217 1051 808 392 108 99 87 --2476 381 --
NM_022552chr21995 11027 ----
NM_022574chr772062 2034 1632 787 759 701 645 --31457 837 25 --
NM_022648chr2184564 4545 4193 3864 3839 3727 3689 3490 3399 1841 1835 1459 1402 1333 1091 1038 885 775 23954 2968 53417 1740 1214 805 235 1351
NM_022650chr51248 ------
NM_022658chr1241328 379 303 155 ------
NM_022659chr8--1204 1123 --
NM_022716chr122084 1263 12687 --1207
NM_022719chr22143748 3621 3293 3106 3023 2515 2485 1338 1105 741 550 516 265 98 --42905 576 487 315 --
NM_022726chr621199 92 ------
NM_022730chr26965 926 851 840 726 36 ------
NM_022733chr121171 237 --1855 --
NM_022735chr111607 11761 1220 --
NM_022745chr152277 2223 2059 743 570 1954 ----
NM_022748chr751861 1093 922 336 47 --12600 --
NM_022749chr841078 940 561 244 191 1223 --
NM_022755chr941613 989 845 175 --12238 1256
NM_022758chr662369 2251 2133 2065 107 78 12724 23100 2623 1914
NM_022763chr332742 2291 1200 ------
NM_022781chr921273 262 --12612 --
NM_022810chrX1324 ------
NM_022824chr53786 680 616 ------
NM_022831chr12584 302 ----1199
NM_022833chr971363 1356 982 924 448 345 85 21148 1114 21076 72 --
NM_022836chr1--11230 --1576
NM_022842chr3133163 2992 2747 2706 2671 2382 2325 2199 1226 959 542 311 126 ------
NM_022845chr1621838 705 ------
NM_022893chr242094 1058 967 732 ------
NM_022898chr1423004 1826 13488 1905 1839
NM_022913chr51218 ------
NM_022918chr1121470 1428 ------
NM_023018chr181359 1306 1262 1111 1103 463 260 137 1596 21395 55 --
NM_023034chr81222 ------
NM_023035chr192199 135 1812 ----
NM_023067chr331056 245 120 --1109 11153
NM_023075chr181708 1351 ----
NM_023076chr1632498 2188 38 32288 2200 1157 12514 --
NM_023079chr1781743 1544 1450 1243 441 407 204 188 ------
NM_023105chr852296 1691 1535 730 400 --2967 597 12361
NM_023106chr852296 1691 1535 730 400 --2967 597 12361
NM_023110chr852296 1691 1535 730 400 --2967 597 12361
NM_023111chr852296 1691 1535 730 400 --2967 597 12361
NM_023927chr531359 1167 254 ------
NM_023929chr812769 ------
NM_024015chr17196 2966 860 21122 89 --
NM_024016chr173578 223 93 ------
NM_024017chr1711647 41369 1165 314 87 ----
NM_024019chr41101 ----1284
NM_024046chr321261 399 11094 1838 --
NM_024052chr1742033 971 696 368 --1652 --
NM_024085chr25841 812 741 241 99 ------
NM_024086chr17113758 3696 3446 3112 2864 1242 831 566 434 338 296 22817 524 ----
NM_024106chr192351 82 1270 ----
NM_024107chr174812 742 293 62 ------
NM_024117chr931046 235 111 --11001 --
NM_024294chr662369 2251 2133 2065 107 78 12724 23100 2623 1914
NM_024306chr166742 467 239 221 181 41 ------
NM_024312chr1211447 ------
NM_024328chr144516 223 167 57 --136 --
NM_024332chrX41457 1302 734 447 ----11222
NM_024345chr922063 113 --15127 --
NM_024408chr163423 716 605 445 405 97 --1252 --
NM_024423chr1824107 926 11428 11370 --
NM_024494chr12230 155 --196 1175
NM_024509chr192172 31 ------
NM_024511chr463381 2813 2182 851 816 218 13467 ----
NM_024519chr163266 228 23 ------
NM_024522chr151914 1653 451 286 88 --41435 1294 417 37 --
NM_024523chr751005 330 206 63 22 --1456 --
NM_024524chr323052 643 22391 1161 ----
NM_024529chr11415 ------
NM_024536chr22161 138 --3311 304 155 --
NM_024539chrX2978 389 ------
NM_024541chr1091851 1831 1457 1399 1321 1172 645 448 153 21632 1303 11267 11692
NM_024551chr1261592 1028 953 690 285 240 31968 1573 253 12075 --
NM_024551chr1261592 1028 953 690 285 240 31968 1573 253 12075 --
NM_024554chr151240 1130 1094 545 135 31343 397 115 ----
NM_024595chr171230 1180 1061 895 835 800 412 31149 924 863 ----
NM_024611chr1553379 2469 1302 1033 872 ------
NM_024626chr161591 1584 1080 582 419 334 199 ----
NM_024631chr112676 161 ------
NM_024639chr642394 2291 1115 572 32783 2749 915 1440 --
NM_024640chr13356 187 160 ------
NM_024645chr81992 ------
NM_024665chr324550 3803 ------
NM_024674chr172517 2333 2178 622 591 218 121 --1637 13226
NM_024676chr131230 1020 888 ------
NM_024698chr11101329 1258 1160 952 880 507 483 384 326 270 21299 887 21033 305 --
NM_024705chr133911 90 61 --179 1233
NM_024721chr832395 2333 2099 ------
NM_024722chr171387 ----1224
NM_024740chr1173567 2539 1571 590 387 349 127 23699 2766 23891 136 --
NM_024742chr1671936 1872 1587 1507 1418 485 415 11463 11333 21708 732
NM_024744chr23826 312 33 11055 ----
NM_024755chr151691 ----1794
NM_024761chr985341 5041 3993 1903 1678 451 79 46 --13878 --
NM_024766chr21438 ------
NM_024779chr1241030 483 396 55 --11298 --
NM_024785chr251452 1074 586 259 192 183 2508 103 --
NM_024792chr17--1470 179 1287
NM_024798chr1592910 2054 2016 1996 1790 1182 1171 952 832 12407 12157 --
NM_024811chr1141470 1251 775 277 ----11588
NM_024816chr161205 --176 2390 32
NM_024817chr15135933 5250 3829 2251 1881 1749 1190 1141 768 401 369 239 96 ------
NM_024828chr911294 ------
NM_024830chr562222 2122 2086 2077 418 310 12182 2735 78 --
NM_024834chr101657 --11691 --
NM_024855chr203614 191 135 --143 --
NM_024874chr131293 1268 1236 --1423 1137
NM_024884chr1484192 4065 3582 799 718 630 417 296 --13204 --
NM_024885chrX2305 32 ------
NM_024887chr161790 1615 1601 779 529 429 31879 543 175 ----
NM_024896chr951669 863 853 765 130 12072 ----
NM_024899chr181210 ----1513
NM_024909chr651326 1297 580 214 110 1159 --21535 572
NM_024911chr11227 --1332 --
NM_024928chr10--1141 ----
NM_024930chr52790 438 11925 ----
NM_024933chr24629 590 561 74 ------
NM_024947chr398467 8164 7549 6652 3834 3378 2914 1487 737 17921 ----
NM_024949chr434251 4018 3049 34032 3153 697 ----
NM_024953chr1221920 209 21986 451 ----
NM_024954chr102575 427 1464 ----
NM_024963chr7245745 5738 5520 5461 5100 4847 4679 4555 4494 3908 2227 2075 1985 1860 1828 1564 1516 1377 1300 783 381 209 133 74 85395 4798 3602 2355 2308 1122 550 58 85269 3742 2390 1709 1458 596 314 273 1763
NM_024969chr2167 --1735 --
NM_024989chr266306 6263 5543 3189 1560 772 11116 ----
NM_024991chr1082207 1990 1089 962 787 750 438 283 2878 246 --12674
NM_025054chr832920 976 718 ------
NM_025058chr17663 628 191 83 46 39 29 --1610 --
NM_025061chr197775 319 270 172 158 141 51 --11075 --
NM_025077chr1--1226 ----
NM_025080chr1141070 774 706 262 ------
NM_025083chr1571876 1740 1402 1258 818 367 331 ------
NM_025099chr175990 354 261 168 62 --1384 --
NM_025104chr1741783 1181 520 179 ------
NM_025138chr133427 391 120 --1410 --
NM_025160chr123902 2877 164 ----
NM_025179chr1164493 4014 4006 3927 3835 3778 3639 3116 3034 1987 1639 1592 1304 1134 745 126 34119 3403 25 21861 1021 --
NM_025181chr2161 1329 ----
NM_025182chr93960 378 314 --1215 --
NM_025187chr1651303 1167 557 335 262 --1858 --
NM_025191chr133475 1045 314 ------
NM_025222chr362507 2043 802 545 416 400 12426 ----
NM_025230chr14111719 1408 522 491 427 286 253 222 209 150 126 11663 --1613
NM_025248chr1793272 1303 1265 1197 1147 1138 732 539 469 22043 1042 1714 1835
NM_025250chr793031 2794 2775 2618 2504 1925 1917 307 73 11093 42571 2375 1865 186 1984
NM_025251chr881125 418 366 360 299 210 133 105 --1324 --
NM_025263chr651252 731 490 372 260 ------
NM_030576chr1762549 2461 2078 2043 2003 987 1573 11914 1277
NM_030627chr5------12769
NM_030629chr1661750 763 132 103 95 82 1578 --1448
NM_030630chr173739 599 47 --3747 556 223 --
NM_030634chr122351 335 12028 11702 --
NM_030645chr171419 1163 1079 898 481 164 21 --182 21173 126
NM_030647chr7105776 4898 4765 4381 2484 2126 1966 1835 1474 899 14271 13977 --
NM_030648chr495493 5203 4979 4727 4332 3862 2162 1953 649 --11663 --
NM_030650chr244262 4072 2844 1554 23506 1484 ----
NM_030661chr741555 1388 1099 645 ------
NM_030664chr1022361 874 ------
NM_030674chr1253647 792 708 662 593 12026 24643 2227 --
NM_030758chr2251467 484 246 189 167 1155 ----
NM_030761chr1112622 2315 2098 2021 1924 1788 1765 745 475 428 199 ----1686
NM_030763chrX1878 ------
NM_030766chr122804 277 1355 --11012
NM_030786chr141913 1846 1671 677 1336 ----
NM_030796chr792088 2071 2023 1801 1605 1511 859 653 48 11536 --11556
NM_030802chr17145 --2297 145 --
NM_030806chr1208881 8534 8339 8235 8029 7992 7438 7226 6571 6314 6276 5923 5791 3313 3189 2274 1421 1174 819 596 49021 8523 2206 1655 49179 8871 7952 7263 --
NM_030808chr172979 78 --11047 --
NM_030816chr133153 3133 375 ------
NM_030881chr2221847 767 22298 1994 11946 --
NM_030884chr3142015 1808 1686 1624 1615 1609 1517 926 629 543 358 257 215 185 11497 ----
NM_030914chr95944 756 735 621 21 --2974 64 --
NM_030918chr1134701 4256 2053 1914 1738 1665 1608 1102 987 495 484 256 58 --24379 4005 24197 472
NM_030920chr1135 1835 11689 --
NM_030925chr1351969 1593 1491 747 129 21822 86 1278 --
NM_030937chr141188 235 217 162 --142 --
NM_030938chr1721025 887 11152 --1873
NM_030945chr541884 1845 1009 248 ------
NM_030962chr1131368 498 318 ------
NM_030963chr61192 ------
NM_030964chr5122983 2925 2859 2849 2546 2380 2319 1028 906 794 544 479 32899 589 433 12690 12970
NM_030978chr91422 ------
NM_030979chr13------1296
NM_030981chr1181179 1141 980 856 408 123 90 55 1461 41112 1099 901 475 --
NM_031157chr122489 459 ------
NM_031212chr104300 246 69 49 ------
NM_031226chr1541197 430 377 26 ------
NM_031231chr203111 104 51 --1550 --
NM_031232chr203111 104 51 --1550 --
NM_031268chr16152141 2121 2093 1872 1716 1710 1522 1436 1406 1388 1176 1003 878 603 454 11664 31834 1789 756 --
NM_031272chr17249 29 ------
NM_031306chr13862 777 102 ------
NM_031309chr861885 1849 1686 845 603 360 --1896 --
NM_031314chr1431643 1472 683 ------
NM_031371chr121306 545 1219 ----
NM_031371chr121306 545 1219 ----
NM_031372chr431422 1255 651 --11154 --
NM_031411chr51217 1391 --1734
NM_031412chr1261180 997 769 454 276 40 ------
NM_031417chr1962522 2330 1756 668 489 225 --32794 623 430 --
NM_031418chr112709 474 ----1149
NM_031419chr3--1221 --1437
NM_031424chr204557 483 383 59 --1435 --
NM_031427chr1485862 4594 4388 2097 1979 1778 1665 1409 --15532 --
NM_031442chrX43108 3085 2010 706 ----1601
NM_031443chr73403 312 92 ------
NM_031444chr2272177 1878 1679 625 471 85 73 --11761 1742
NM_031445chr273173 2854 2439 578 421 412 82 --12796 --
NM_031461chr81763 --12013 1614
NM_031468chr7167495 6556 6254 6189 4992 3142 3053 2937 2801 2773 1868 1837 1071 573 501 184 27781 6375 25957 2079 27454 3181
NM_031483chr2073000 2257 1400 950 828 549 450 22354 315 --1778
NM_031492chr111406 ------
NM_031844chr153548 3434 2960 2687 1625 ----11406
NM_031845chr233383 2916 2719 --12813 --
NM_031847chr233383 2916 2719 --12813 --
NM_031849chr51217 1391 --1734
NM_031857chr51217 1391 --1734
NM_031860chr51217 1391 --1734
NM_031886chr1952634 2123 1954 1710 153 32074 973 366 --1998
NM_031890chr22102800 2470 2204 2197 1162 1046 1015 764 542 331 --22211 148 1637
NM_031891chr184355 349 156 140 ------
NM_031935chr11143 ------
NM_031936chr14695 224 183 139 1596 ----
NM_031992chr751419 1371 1155 620 178 11328 ----
NM_032012chr964732 3656 1684 395 280 129 --15131 1604
NM_032013chr20--21637 1592 11185 --
NM_032042chr532432 980 33 ------
NM_032050chr222308 37 1361 ----
NM_032052chr223422 252 240 --1231 --
NM_032088chr5----31415 1169 657 1137
NM_032092chr5----31415 1169 657 1137
NM_032102chr113681 84 41 ------
NM_032108chr195957 807 799 618 24 ------
NM_032109chr531160 350 309 ------
NM_032121chrX1866 11119 ----
NM_032124chr1821119 1089 ------
NM_032147chr121644 --1794 --
NM_032182chr1031434 1272 78 11045 ----
NM_032195chr212207 104 --1151 --
NM_032199chr1023426 344 11198 ----
NM_032205chr8----134 --
NM_032208chr253644 1042 514 426 411 1567 122 --
NM_032221chr2021354 619 --11328 --
NM_032229chr1311139 1779 ----
NM_032233chr144856 847 774 299 ------
NM_032239chr421326 425 1453 ----
NM_032242chr3193049 2947 2651 2637 2631 2193 2166 2121 2088 1111 1085 1056 1008 981 887 849 710 538 376 22880 2624 --1767
NM_032268chr1673234 2717 2312 2278 1998 1166 665 32637 949 96 178 --
NM_032271chr1691377 1345 1332 1241 1055 991 338 123 43 --21506 207 11179
NM_032281chr1992873 2815 2571 1230 1210 1179 512 431 364 --32890 2676 164 --
NM_032283chr1101620 1594 1509 1311 1225 670 479 413 357 250 --41752 1338 1155 202 21775 1719
NM_032291chr1--1108 ----
NM_032294chr1781712 1683 1276 710 595 322 246 200 1621 21552 465 11183
NM_032307chr91726 1316 ----
NM_032316chr3102417 2147 2129 2079 1547 1537 941 630 184 123 2862 417 12251 --
NM_032320chr111527 ------
NM_032325chr1151749 1644 158 55 45 --1360 --
NM_032329chr273937 3178 2769 1639 1468 1252 564 --43672 3267 3064 1525 1739
NM_032353chr173427 176 140 ------
NM_032403chr5----31415 1169 657 1137
NM_032413chr151139 ------
NM_032420chr55717 656 609 563 103 --2816 730 --
NM_032432chr451017 446 330 95 56 1496 ----
NM_032433chr1931214 529 328 ------
NM_032434chr231591 1176 324 ----1507
NM_032452chr1451431 1232 984 406 84 ----11252
NM_032458chrX22966 2579 1555 ----
NM_032466chr811559 ------
NM_032468chr811559 ------
NM_032482chr1941951 815 565 97 12394 32724 2701 2218 --
NM_032499chr1521640 81 ------
NM_032501chr2051280 1237 924 256 48 126 11383 1325
NM_032505chr31227 ------
NM_032509chr832418 1865 728 32305 529 272 ----
NM_032511chr6----147 131
NM_032538chr692807 2643 2055 1962 1737 836 667 575 345 1548 31977 1862 759 12166
NM_032539chrX----1771 --
NM_032550chr102418 45 ------
NM_032552chr951554 1461 1413 310 85 --1367 1559
NM_032560chr1421055 303 ------
NM_032562chr102306 22 ------
NM_032569chr1631639 1293 679 21264 77 2549 506 --
NM_032580chr172567 181 ------
NM_032581chr741578 612 489 216 --175 --
NM_032582chr171369 2732 272 ----
NM_032595chr1781464 1393 615 518 418 347 193 97 1570 1429 --
NM_032631chr19----1123 --
NM_032638chr361301 1079 1071 594 487 127 --1443 --
NM_032682chr333489 2408 1159 1257 22964 1200 --
NM_032701chr193562 129 80 ----190
NM_032711chr17184174 3942 3895 3681 3629 3617 3533 3326 3157 2836 1618 1604 1530 1454 1430 1376 1310 538 --32763 1537 1495 13404
NM_032727chr1021504 195 ------
NM_032737chr19112513 2332 1835 1814 1740 863 800 709 579 293 155 12152 22294 1992 --
NM_032786chr123495 468 24 ----1503
NM_032788chr231434 1091 643 11604 ----
NM_032800chr152515 2032 1692 750 531 22502 2422 22524 2242 --
NM_032801chr1142188 2148 2126 1990 12366 ----
NM_032804chr1042534 2102 208 81 ----1131
NM_032808chr156828 767 745 728 317 206 --1886 --
NM_032829chr1261039 1031 1022 903 326 235 2894 336 ----
NM_032832chr6--11443 123 --
NM_032833chr132226 1684 829 ------
NM_032840chr1271078 1016 486 452 290 215 103 --2799 202 --
NM_032846chr1431437 1284 33 --11241 --
NM_032859chr132625 535 1181 ----
NM_032866chr1573182 2213 2162 996 674 607 582 ------
NM_032873chr1154468 1668 603 407 203 12775 1290 --
NM_032875chr17122 ------
NM_032876chr145880 745 475 386 362 12074 1118 --
NM_032885chr192138 80 --1309 --
NM_032900chr10103702 3691 3625 3011 2652 2559 2515 961 859 638 --11530 12970
NM_032932chr17205966 5897 5809 5593 5485 4804 3999 3985 2379 2360 2302 2148 2040 1964 1842 1461 1453 985 577 112 --45141 4970 1711 354 2418 40
NM_032947chr54930 91 70 61 11177 ----
NM_032951chr72164 106 --5228 123 80 54 38 1524
NM_032953chr72164 106 --5228 123 80 54 38 1524
NM_032995chr261374 1054 577 192 123 85 11153 21041 465 1418
NM_032998chr14849 187 67 49 1931 ----
NM_033016chr2251389 566 434 355 75 21296 283 11464 --
NM_033018chrX31074 1029 768 --11114 1788
NM_033020chr164764 3725 3353 3274 1861 1401 ------
NM_033025chr196365 329 214 207 110 67 ------
NM_033027chr34913 299 149 130 --11105 --
NM_033030chr211632 ------
NM_033044chr121039 198 --11251 --
NM_033046chr23304 127 66 ------
NM_033055chr11445 ------
NM_033058chr83719 280 91 ------
NM_033103chr191409 ----1926
NM_033117chr9------1237
NM_033129chr2061688 1674 1620 1451 568 533 ------
NM_033132chr1321625 48 ------
NM_033133chr17133503 3089 2838 2795 2788 2470 1340 1192 1100 1025 961 903 596 43309 3167 2376 1061 2972 483 --
NM_033136chr541284 425 419 197 ------
NM_033137chr541284 425 419 197 ------
NM_033141chr1442218 870 805 228 12169 11658 --
NM_033161chr991807 1665 1465 1275 1257 733 474 184 114 --21814 716 1671
NM_033181chr643155 3050 995 80 ------
NM_033207chr1072364 2335 2298 2236 2023 1801 125 11917 12394 --
NM_033211chr531406 180 122 --11543 --
NM_033224chr777658 6584 5329 1382 402 314 48 25248 573 --15127
NM_033225chr852314 2015 1994 355 96 ------
NM_033226chr163202 190 98 ------
NM_033228chr5------1435
NM_033246chr155347 340 294 156 114 ------
NM_033259chr31782 ----1805
NM_033267chr52770 40 ------
NM_033274chr5122935 2865 2408 2301 1301 974 781 737 692 381 177 40 23456 1184 ----
NM_033285chr823955 1151 --11702 --
NM_033290chrX52854 2754 1386 506 30 11456 ----
NM_033300chr121046 57 ------
NM_033309chr163902 866 145 ------
NM_033315chr1781982 1955 1885 1568 1431 1391 506 331 1212 21705 778 --
NM_033316chr32512 23 ------
NM_033326chr1122501 1698 --11659 --
NM_033331chr973109 2914 2886 2808 2521 856 274 --12248 --
NM_033334chr9262 43 ------
NM_033360chr1233131 1859 383 ------
NM_033375chr1771471 1440 1344 560 479 449 434 ----31377 1268 1222
NM_033386chr224761 445 49 37 --3357 171 130 31114 1077 974
NM_033389chr1764764 4691 4228 3723 3245 1141 ----14702
NM_033394chr221220 51 ------
NM_033396chr111139 --2285 65 --
NM_033401chr161140 ------
NM_033420chr1961006 897 360 289 243 197 --2466 181 --
NM_033421chr2091762 1604 1560 758 576 550 524 349 341 ------
NM_033425chr1152750 1314 1178 1089 46 --2722 638 --
NM_033426chr1432104 541 174 1892 1524 --
NM_033429chr1572457 2225 2219 2104 964 286 274 2997 83 31219 825 29 12858
NM_033430chr442549 1136 786 322 ------
NM_033437chr442549 1136 786 322 ------
NM_033449chr581906 1834 1682 1396 789 496 352 329 11584 31482 1448 270 1400
NM_033480chr632713 1889 236 1718 ----
NM_033481chr632713 1889 236 1718 ----
NM_033495chrX1104 ------
NM_033503chr15133729 3650 3425 3371 3225 3157 3121 2963 1431 1209 1012 1003 601 22783 779 13722 33745 3621 341
NM_033542chr2051607 1561 213 103 35 11508 21653 52 1385
NM_033549chr53863 177 41 --1897 1293
NM_033551chr5143142 3069 2992 2948 2157 1246 1067 1037 1010 999 872 524 479 375 22793 586 42852 2714 492 176 --
NM_033626chrX91768 1622 1474 1371 683 594 577 171 155 --1625 --
NM_033631chr1123866 3707 3366 3276 2781 2398 2376 626 610 514 343 109 --33822 2669 1407 1836
NM_033632chr431064 1040 130 ------
NM_033637chr1083683 3560 3420 3302 3159 2925 964 120 --13870 1572
NM_033644chr532212 894 554 12182 11698 12087
NM_033645chr532212 894 554 12182 11698 12087
NM_052818chr1341946 1870 1732 1670 --11906 --
NM_052827chr12----21017 73 1148
NM_052828chr671574 1423 618 594 578 496 34 21053 252 --11220
NM_052837chr1121 ----172
NM_052840chr1531415 1401 139 11129 ----
NM_052845chr12102969 2860 2825 2651 2124 1280 611 222 80 73 12181 --1943
NM_052855chr171105 --153 --
NM_052860chr54935 874 675 80 --1664 --
NM_052868chr13239 185 65 ------
NM_052875chr1191707 797 627 608 334 327 237 174 155 22024 1862 4671 654 403 254 2377 198
NM_052896chr141910 1822 886 186 1752 22534 1856 11839
NM_052897chr121239 --1645 3818 605 61
NM_052898chr831877 1342 270 11600 ----
NM_052905chr231294 1274 502 --11401 --
NM_052906chr22184679 4344 4283 3860 3676 3605 3345 3294 3187 3143 2026 1682 1490 1207 980 785 360 351 63739 3687 3422 3391 906 707 84868 4543 3323 1863 1588 1424 1181 691 --
NM_052907chr1263330 2926 908 625 515 401 --11681 1600
NM_052918chr1043558 2739 2686 846 ------
NM_052925chr1941029 740 353 84 ------
NM_052934chr18775 578 524 489 313 256 119 71 21673 48 ----
NM_052954chr2132172 534 334 ------
NM_052958chr82245 187 ------
NM_052978chr1441689 477 252 173 ------
NM_052996chr1631760 1485 1113 ------
NM_053002chr31957 ------
NM_053016chr987272 6845 6267 6162 5225 1700 401 28 36764 5877 3196 26334 6192 --
NM_053023chr1131300 484 351 12779 21288 583 --
NM_053025chr34650 397 370 306 ------
NM_053026chr34650 397 370 306 ------
NM_053027chr34650 397 370 306 ------
NM_053028chr34650 397 370 306 ------
NM_053031chr34650 397 370 306 ------
NM_053032chr34650 397 370 306 ------
NM_053279chr8132720 2544 2225 1150 895 859 713 677 594 558 316 270 44 1774 32261 407 175 1115
NM_054013chr59934 876 857 618 308 292 138 128 54 1715 ----
NM_054016chr121802 741 1692 ----
NM_054016chr121802 741 1692 ----
NM_054016chr121802 741 1692 ----
NM_054027chr552264 1971 1771 1725 310 12215 ----
NM_054035chr172777 618 --154 --
NM_054111chr63196 175 31 ------
NM_057161chr63459 217 90 --1196 --
NM_057169chr1252969 2750 2452 2232 450 22192 548 ----
NM_057170chr1252969 2750 2452 2232 450 22192 548 ----
NM_057178chr1782513 1936 1774 1028 1004 295 55 46 1786 --1691
NM_058170chr1--11164 ----
NM_058172chr421622 1148 ------
NM_058175chr213815 253 183 --1705 --
NM_058240chr1451388 1380 1219 149 96 1691 ----
NM_058241chr211698 ------
NM_058241chr211698 ------
NM_078471chr1731250 913 52 11120 ----
NM_078476chr661611 1533 587 497 221 21 21419 1352 1139 --
NM_078485chr65737 678 515 204 56 ------
NM_079834chr19121702 1396 1217 1067 665 629 614 604 457 222 88 64 ------
NM_080415chr172840 96 --2605 333 --
NM_080476chr20198 ------
NM_080491chr1183439 3366 3212 2997 2919 2783 807 792 33542 3516 1200 11229 21023 164
NM_080544chr331321 1189 1166 --11128 --
NM_080546chr921655 922 11775 ----
NM_080552chr202226 120 197 ----
NM_080594chr162293 107 1319 ----
NM_080597chr18176 ------
NM_080604chr63618 548 61 --1493 --
NM_080607chr206968 910 862 836 806 417 --1230 --
NM_080616chr202626 251 ------
NM_080625chr202984 90 ----139
NM_080629chr1145 ------
NM_080630chr1145 ------
NM_080645chr631682 1391 870 ------
NM_080654chr11155 11202 ----
NM_080664chr1441491 385 183 123 ------
NM_080669chr17194737 3968 3945 3752 3678 3605 3481 3141 1870 1677 1584 1578 1494 1255 1102 955 579 556 512 --53620 1952 1438 1022 644 1474
NM_080670chr53823 678 155 --2780 672 --
NM_080676chr2072967 2074 1020 667 655 327 30 --137 --
NM_080720chrX1125 ----123
NM_080732chr192490 343 --157 --
NM_080737chrX4937 410 382 32 11456 --1426
NM_080743chr652504 1874 1018 471 460 12521 12050 --
NM_080744chr72481 153 2119 36 2663 454 --
NM_080759chr1322412 2037 ------
NM_080760chr1322412 2037 ------
NM_080792chr2092317 1727 1659 616 578 535 279 179 161 21878 259 31778 691 671 21667 119
NM_080829chr2011019 --178 --
NM_080865chr33701 162 82 ------
NM_080881chr55707 498 277 126 58 ----1508
NM_130386chr18--1176 ----
NM_130434chr153951 482 25 ------
NM_130436chr212796 507 ------
NM_130438chr2121084 356 --1159 --
NM_130439chr1011456 1498 22275 2260 11430
NM_130439chr1011456 1498 22275 2260 11430
NM_130442chr72148 84 1887 1333 --
NM_130468chr154227 116 99 85 --192 --
NM_130469chr143661 334 256 --2878 323 --
NM_130781chr54348 76 70 22 ------
NM_130787chr19150 1125 ----
NM_130795chr94637 255 238 116 --1683 1533
NM_130798chr1511362 ------
NM_130830chr383962 3244 2585 1282 1273 1062 882 654 21110 51 3258 235 79 13717
NM_130838chr1521720 1431 ------
NM_130839chr1521720 1431 ------
NM_130846chr12136 ------
NM_130848chr56845 821 651 162 114 97 --11369 --
NM_133170chr20187651 5804 5421 5370 5303 5025 2592 2324 2152 2025 1468 1104 1014 797 627 494 448 279 11636 26353 785 25321 1043
NM_133171chr2021021 978 1236 11180 --
NM_133172chr52248 200 --2216 35 --
NM_133173chr52248 200 --2216 35 --
NM_133174chr52248 200 --2216 35 --
NM_133264chr17103740 3158 2623 1438 1306 1001 916 884 295 175 13100 13595 1747
NM_133265chrX2688 659 ----12315
NM_133328chr192822 331 157 ----
NM_133329chr21447 --11573 --
NM_133370chr413192 ------
NM_133372chr512153 --12763 --
NM_133444chr1991761 1675 1590 1463 1320 1151 408 290 122 --2464 61 --
NM_133446chr102220 31 ------
NM_133452chr193989 351 199 --41139 1090 1048 775 --
NM_133457chr741195 250 203 31 11226 31357 1278 1164 11365
NM_133468chr742344 2223 1654 437 1498 ----
NM_133476chr122103 45 --1118 --
NM_133477chr431023 623 509 ------
NM_133496chr122798 199 ------
NM_133499chrX3388 360 242 --2117 102 1655
NM_133631chr321176 611 ------
NM_133639chr153354 314 58 ------
NM_133642chr2221077 159 ------
NM_133647chr1542888 2764 2596 1446 ------
NM_134268chr1791100 1040 971 917 852 785 161 85 27 ------
NM_134325chr15484 310 113 59 24 11208 ----
NM_134427chr94637 255 238 116 --1683 1533
NM_134442chr221767 619 ------
NM_138288chr1421914 1849 --133 --
NM_138300chr151415 1389 1213 1106 616 1134 21621 1459 1490
NM_138319chr152491 276 2296 262 1425 --
NM_138323chr151669 ------
NM_138335chr42671 175 ------
NM_138338chr22193472 3377 3371 3238 3177 3066 2650 2618 2437 2426 2092 1386 1040 988 895 857 769 261 254 22357 1176 23027 1190 --
NM_138357chr102666 25 ------
NM_138370chr22641 512 199 --1314
NM_138373chr1951824 1550 1329 487 372 11746 --1546
NM_138385chr461070 923 545 450 308 210 11248 31197 555 365 --
NM_138415chr227663 584 553 323 289 282 62 --1534 --
NM_138426chr721597 703 ------
NM_138444chr1331422 479 91 24644 3152 1189 --
NM_138473chr1284810 4782 4194 3586 3546 1962 1385 508 ----13642
NM_138477chr153744 233 44 --125 --
NM_138479chr14708 287 232 149 21770 1560 11632 --
NM_138494chr742108 1930 1763 888 11881 ----
NM_138558chr12244 123 11173 1378 --
NM_138576chr1423004 1826 13488 1905 1839
NM_138578chr2071373 1346 1139 1063 581 467 208 1543 ----
NM_138621chr264080 3066 3034 1268 1131 80 ------
NM_138638chr1431878 877 454 ------
NM_138694chr641089 1083 535 344 12318 ----
NM_138713chr1646984 6799 6289 5617 16229 38155 1877 674 --
NM_138714chr1646984 6799 6289 5617 16229 38155 1877 674 --
NM_138717chr6158 ----1632
NM_138727chr161667 1601 912 763 177 26 ------
NM_138728chr161667 1601 912 763 177 26 ------
NM_138730chr6--168 ----
NM_138731chr14123 11665 11602 --
NM_138735chr221526 392 ------
NM_138771chr711167 ------
NM_138795chr171576 1458 1318 604 546 490 291 1446 3642 272 126 --
NM_138799chr222084 1278 22035 2003 ----
NM_138923chrX122 --1312 --
NM_138927chr2131078 1051 713 ------
NM_138967chr15132388 2357 2324 2166 2044 1951 1852 1789 1542 877 831 375 360 21931 475 --22223 2180
NM_138969chr861212 1163 1017 561 468 440 --1363 11119
NM_138970chr1431817 284 132 ------
NM_138971chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138971chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138972chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138972chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138973chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138973chr1193542 3085 2859 1488 1037 1001 406 383 35 ------
NM_138981chr42549 72 --1118 --
NM_138994chr161140 ------
NM_139014chr612181 ------
NM_139035chrX2595 116 ------
NM_139068chr5--1200 ----
NM_139069chr5--1200 ----
NM_139070chr5--169 ----
NM_139071chr1281491 1480 1133 549 541 243 92 81 --21465 586 --
NM_139131chr112527 75 ------
NM_139132chr1141147 1013 725 374 --194 --
NM_139135chr121090 891 ----1134
NM_139168chr511878 ------
NM_139201chr122539 149 ------
NM_139215chr172211 92 ------
NM_139276chr17102275 2047 1991 1660 919 850 676 443 373 158 ------
NM_139279chr292691 2638 1391 1277 1112 1032 988 605 22 22949 2411 32714 2381 513 --
NM_139280chr1761244 577 511 291 125 94 --1200 --
NM_139283chr1212136 --1562 --
NM_139286chr91179 ------
NM_139316chr7------1125
NM_139321chr2093936 3654 3209 3131 3091 2994 2802 1607 1166 43288 1600 1159 331 12851 13404
NM_139323chr2021302 831 ------
NM_144488chr94637 255 238 116 --1683 1533
NM_144489chr94637 255 238 116 --1683 1533
NM_144498chr2032248 2042 1823 1216 ----
NM_144567chr131809 1074 660 --1468 --
NM_144571chr486601 5935 5590 4934 4924 2604 2171 1296 ------
NM_144578chr14105357 4960 4492 3797 3719 3401 1874 1371 944 609 ------
NM_144579chr2132769 2633 2605 2581 2493 2384 2198 2059 1064 886 714 231 113 22776 2140 1509 1124
NM_144580chr14321 269 234 61 ------
NM_144582chr2162493 2328 2299 2213 2196 1946 1685 1653 1601 1040 998 972 583 543 128 107 --42516 360 152 53 1833
NM_144586chr23873 103 86 --1949 --
NM_144588chr1061254 1132 991 971 230 74 51273 1184 468 376 264 21450 1026 140
NM_144590chr101403 1302 --12469
NM_144633chr331072 601 77 ------
NM_144635chr331075 971 827 1119 1242 --
NM_144660chr101289 ------
NM_144671chr12171926 1858 1821 1780 1738 1612 1565 1512 1439 1324 1307 716 699 640 634 473 66 11868 21665 1524 151
NM_144685chr192275 219 ------
NM_144691chr196484 261 155 122 110 94 ------
NM_144703chr2061120 1051 819 794 760 431 ------
NM_144718chr322491 884 2540 473 ----
NM_144726chr5136 --1838 --
NM_144767chr15133909 3670 3575 3099 2883 1404 1245 1182 920 794 141 124 41 ----13551
NM_144775chr17174305 3918 1846 1732 1574 1391 1295 1257 1120 878 598 536 509 313 263 245 228 34259 1042 659 31455 789 575 33386 1161 687
NM_144949chr2----1288 --
NM_144967chrX21058 888 2682 57 ----
NM_144998chr173433 189 43 ----1138
NM_145008chr112768 176 1755 198 1556
NM_145012chr104321 252 181 70 ------
NM_145013chr11122751 2660 2338 2075 1942 1187 1146 999 854 419 299 158 --1795 --
NM_145025chr62319 155 --1304 --
NM_145071chr36343 310 119 102 72 43 1402 ----
NM_145074chr22387 136 1415 ----
NM_145112chr1441189 1105 1074 401 ------
NM_145113chr1431461 1377 1346 ------
NM_145117chr1142846 2401 2083 155 ------
NM_145165chr1422368 2296 12096 ----
NM_145176chr643130 2872 2211 519 1738 ----
NM_145185chr1941875 1570 489 325 198 31811 518 289 --
NM_145201chr83294 113 95 ------
NM_145203chr13--1771 1158 --
NM_145206chr1082850 2704 2264 2255 2153 1078 747 309 ----12123
NM_145239chr1671120 841 403 390 353 295 93 --270 53 --
NM_145245chr1971148 1085 1075 903 364 250 171 1381 21013 451 --
NM_145274chr171759 --1924 --
NM_145284chrX11585 11791 1941 --
NM_145296chr197824 671 598 206 140 36 30 2352 97 ----
NM_145307chr1014309 1553 --13662
NM_145313chr1071324 1318 1281 1245 1208 505 483 --21298 1063 --
NM_145332chr61701 ----1158
NM_145333chr61701 ----1158
NM_145349chr1782121 1642 1578 1545 334 315 210 151 --2381 131 --
NM_145638chr1141037 360 273 24 ------
NM_145649chr652392 2133 2127 463 202 12738 ----
NM_145655chr652392 2133 2127 463 202 12738 ----
NM_145686chr242704 2612 1330 679 1616 ----
NM_145687chr242704 2612 1330 679 1616 ----
NM_145690chr82570 359 11241 ----
NM_145698chr101557 11976 ----
NM_145714chr161287 ------
NM_145727chr62386 44 ----1541
NM_145730chr227878 455 431 359 351 178 125 --1156 1211
NM_145798chr174308 297 124 28 ------
NM_145808chr72920 494 ------
NM_145899chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145901chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145902chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145903chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145904chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145905chr6111301 1288 969 492 469 435 401 331 273 220 118 2423 49 1354 --
NM_145912chr22143215 3146 3065 1797 1640 1600 1570 1018 850 677 556 295 252 203 33895 3880 3016 33624 3592 34 34421 3257 1878
NM_145913chr125851 743 668 363 184 --1800 --
NM_146388chr1951112 964 947 338 176 11123 ----
NM_147147chr673798 3767 3757 3259 1163 815 656 ----11133
NM_147150chr953155 2808 1365 946 189 33016 2852 38 23070 341 13108
NM_147156chr10--1369 ----
NM_147161chr131058 946 411 --2202 152 --
NM_147202chr962730 2401 2240 1852 1076 257 22515 1867 --1643
NM_147223chr221524 395 --11659 --
NM_147233chr21212 --11476 --
NM_148174chr821849 1676 ------
NM_148414chr162370 72 ------
NM_148415chr161310 ------
NM_148416chr161287 ------
NM_148571chr1742071 1725 1383 225 21637 322 --11453
NM_148894chr4164 ------
NM_148898chr7------1958
NM_148899chr7------1958
NM_152233chr1431273 673 463 ------
NM_152237chr22121488 1342 1315 1277 1224 1199 1191 1168 552 325 226 55 21306 238 1294 21620 102
NM_152240chr341256 1174 1088 154 ------
NM_152244chr1721125 128 1264 1936 --
NM_152253chr22213755 3681 3157 3130 3108 2904 2868 2848 2771 2745 1559 1530 1508 1497 1348 1330 994 551 509 460 289 ----13097
NM_152263chr1145649 4919 4777 4263 4095 3871 3813 3734 2225 1866 1669 1215 907 76 44182 1539 1433 1166 1255 --
NM_152264chr112950 788 ------
NM_152265chr131388 542 252 --11145 --
NM_152267chr22132164 1839 1774 1492 713 697 689 419 224 97 80 65 37 12157 1640 12050
NM_152271chr81361 1911 ----
NM_152272chr831313 1133 1096 ------
NM_152277chr5----12038 --
NM_152284chr81777 1353 ----
NM_152287chr1672538 2367 2014 861 532 415 113 22422 378 1436 1165
NM_152296chr193316 121 86 --1271 --
NM_152330chr1421677 153 ------
NM_152335chr153618 423 64 158 ----
NM_152344chr1721321 1101 ------
NM_152352chr1812742 12566 1915 --
NM_152371chr161562 1276 792 515 292 34 --41589 1396 668 302 --
NM_152388chr242790 2583 2527 1489 ----13286
NM_152424chrX104739 4581 3160 3013 2881 1898 1319 777 545 145 11734 13118 --
NM_152437chr1222233 936 1250 1830 --
NM_152440chr1221020 830 ------
NM_152470chr1883443 3258 2602 1338 1331 1264 814 721 33972 3117 998 32654 1368 1200 --
NM_152482chr1991702 1633 1602 1565 1547 1153 705 483 24 11110 2531 62 21584 318
NM_152520chr21425 ------
NM_152529chr233724 3312 1470 21421 555 23999 76 --
NM_152538chr321171 733 1220 ----
NM_152546chr541458 1291 259 129 11409 ----
NM_152563chr1171433 1000 586 534 482 430 378 --1986 --
NM_152586chr102146 23 --1771 --
NM_152594chr1512219 22162 423 ----
NM_152608chr132014 1714 176 ------
NM_152609chr11947 1468 ----
NM_152624chr597466 6273 5295 4847 2304 1922 1715 982 532 25492 1254 ----
NM_152629chr972694 1004 936 287 269 212 203 11188 1515 --
NM_152636chr1122178 737 12505 ----
NM_152660chr11748 ------
NM_152678chr342749 2087 1030 1017 42519 2179 981 949 ----
NM_152686chr532129 918 185 ------
NM_152699chr373577 3437 3308 2595 2564 2346 669 --23415 436 --
NM_152733chr6276304 6238 6108 6045 5964 5728 5643 5632 5400 5394 5283 4988 4959 4905 4889 4837 4610 4570 4446 4421 2420 2196 1971 672 664 585 451 45168 1683 1236 798 35476 1283 1159 12000
NM_152734chr6115324 4647 4584 3738 1794 1425 1317 870 767 358 93 --35178 4946 889 --
NM_152749chr73449 150 77 ------
NM_152758chr862355 1926 980 845 475 51 ------
NM_152774chr712491 12344 ----
NM_152787chrX43643 3317 3050 426 ------
NM_152789chr72473 122 ----1226
NM_152793chr7115217 4041 4032 3691 3397 3150 1322 1259 1241 607 69 ------
NM_152838chr2033494 2448 2376 ------
NM_152860chr1261487 492 273 150 144 134 ----11351
NM_152902chr131717 1357 48 ------
NM_152910chr13195 ------
NM_152924chr15126478 5636 4798 4596 4223 2306 1644 953 935 924 686 40 41101 675 470 168 26173 907 --
NM_153029chr1684021 3910 2786 2760 1369 1185 838 154 --12984 --
NM_153035chr153248 2739 2285 557 437 23199 2190 124 --
NM_153050chr22194725 4326 3707 3494 3464 1805 1599 1565 1504 1476 1381 1127 1035 890 877 774 742 238 65 11087 44950 3975 3242 520 --
NM_153051chr22194725 4326 3707 3494 3464 1805 1599 1565 1504 1476 1381 1127 1035 890 877 774 742 238 65 11087 44950 3975 3242 520 --
NM_153184chr321438 288 ------
NM_153188chr525153 4366 14409 ----
NM_153207chr1223024 1484 ------
NM_153234chr522172 2125 --12438 --
NM_153260chr151590 11091 11173 --
NM_153261chr16--21170 1055 ----
NM_153273chr3102640 1976 1817 1071 783 774 620 450 299 267 42615 2187 2003 1903 62360 2254 1022 966 435 374 22563 1118
NM_153321chr17------1928
NM_153322chr17------1928
NM_153333chrX2590 126 ------
NM_153335chr1761339 1246 980 111 102 80 1486 --1988
NM_153350chr1641438 1186 338 45 11289 1359 --
NM_153365chr452519 1106 966 318 37 22288 213 ----
NM_153367chr1083947 3091 1385 1042 684 600 243 221 11015 43721 917 783 296 13918
NM_153371chr1322043 556 ------
NM_153450chr11--3145 76 69 --1679
NM_153464chr192589 188 ------
NM_153487chr6154442 4385 4212 4011 3859 3737 3396 3305 1181 1003 870 735 729 477 184 34573 3528 671 33551 3074 1175 43386 3246 1148 490
NM_153499chr1262876 2624 2025 1882 868 224 --1144 --
NM_153500chr1262876 2624 2025 1882 868 224 --1144 --
NM_153616chr1531913 1795 1558 ------
NM_153617chr1531913 1795 1558 ------
NM_153618chr1531913 1795 1558 ------
NM_153619chr1563151 3033 2796 2218 891 871 ------
NM_153620chr751764 1454 527 517 63 --1433 --
NM_153631chr741555 1388 1099 645 ------
NM_153632chr741555 1388 1099 645 ------
NM_153634chr1221222 666 ------
NM_153675chr20133 ------
NM_153685chr1241130 853 827 109 ------
NM_153693chr122563 159 --2814 271 --
NM_153695chr9----166 --
NM_153702chr4--1254 ----
NM_153705chr1131730 595 249 22662 1681 ----
NM_153715chr74363 304 216 130 --1503 --
NM_153756chr141360 1276 161 142 --11381 --
NM_153759chr21995 11027 ----
NM_153810chr1094510 4301 4159 3646 3394 1637 768 653 202 25018 1935 14574 --
NM_153812chr162164 2084 1982 1945 571 95 ------
NM_153819chr11273 40 ------
NM_153827chr172734 229 --190 --
NM_153832chr11491 ----184
NM_153836chr221843 23 ------
NM_170606chr711356 1130 ----
NM_170607chr1741527 1220 387 280 11378 1636 1264
NM_170662chr3--1132 ----
NM_170663chr172734 229 --190 --
NM_170674chr1541144 1037 544 236 ------
NM_170675chr153820 713 220 ------
NM_170676chr153820 713 220 ------
NM_170677chr1541144 1037 544 236 ------
NM_170711chr192915 662 --1278 1701
NM_170719chr133427 391 120 --1410 --
NM_170774chr2062737 1550 1395 574 180 24 --33381 1604 1093 11312
NM_170782chr12402 64 1211 1474 --
NM_171998chrX62152 930 775 760 345 288 ------
NM_172016chr63905 129 95 ------
NM_172020chr791778 1768 1529 587 492 481 117 75 53 --1150 --
NM_172057chr7167 --1277 1143
NM_172069chr22925 688 12252 ----
NM_172071chr147320 5469 5004 295 36526 6166 1722 17181 --
NM_172103chr652621 2324 1698 309 76 ------
NM_172105chr652621 2324 1698 309 76 ------
NM_172127chr42514 503 --1104 --
NM_172128chr42470 459 --160 --
NM_172169chr1061811 1494 1411 394 341 65 21553 573 21643 302 --
NM_172170chr1061811 1494 1411 394 341 65 21553 573 21643 302 --
NM_172171chr1061811 1494 1411 394 341 65 21553 573 21643 302 --
NM_172173chr1061811 1494 1411 394 341 65 21553 573 21643 302 --
NM_172206chr1781712 1683 1276 710 595 322 246 200 1621 21552 465 11183
NM_172216chr1252778 2526 1927 770 126 --21193 46 --
NM_172226chr1262876 2624 2025 1882 868 224 --1144 --
NM_172315chr1541144 1037 544 236 ------
NM_172316chr1541144 1037 544 236 ------
NM_172337chr143984 794 387 ------
NM_172344chr21447 --11573 --
NM_172349chr52297 242 ------
NM_172373chr1311095 --11016 --
NM_173075chr421732 336 ------
NM_173156chr162175 2057 1615 1362 674 659 11444 ----
NM_173157chr123489 367 94 --1163 --
NM_173163chr163214 177 93 --1185 --
NM_173165chr16295 58 --2155 66 --
NM_173172chr241361 545 291 39 ------
NM_173191chr1061040 929 488 158 135 30 1913 1110 --
NM_173192chr1061040 929 488 158 135 30 1913 1110 --
NM_173193chr1061040 929 488 158 135 30 1913 1110 --
NM_173194chr1061040 929 488 158 135 30 1913 1110 --
NM_173195chr1061040 929 488 158 135 30 1913 1110 --
NM_173198chr922795 353 ------
NM_173199chr92398 182 ------
NM_173200chr922795 353 ------
NM_173214chr1646984 6799 6289 5617 16229 38155 1877 674 --
NM_173354chr2141755 1532 841 232 --1310 --
NM_173355chr23933 897 249 1959 --1878
NM_173454chr152209 78 1445 ----
NM_173465chr551016 858 822 372 227 --1221 1383
NM_173468chr435611 3819 388 14484 ----
NM_173472chr32193 51 ------
NM_173478chr1721055 340 ------
NM_173491chr53437 145 105 ----1178
NM_173495chrX1573 ----22507 273
NM_173500chr1531090 929 563 ------
NM_173510chr221661 ------
NM_173511chr222847 1366 131 12677 --
NM_173519chr821716 563 ------
NM_173535chr2------1437
NM_173547chr1771682 1255 343 290 253 76 24 21400 260 21306 1198 --
NM_173576chr1012091 ------
NM_173587chr116407 246 189 169 100 67 ------
NM_173595chr12145250 4682 4366 4336 4119 3702 3362 1802 1410 1364 822 664 640 213 34511 3884 186 85148 4606 4228 4153 3918 491 339 133 --
NM_173602chr1282877 2860 2626 1478 1320 1199 940 61 --13228 13052
NM_173609chr153759 261 214 ------
NM_173642chr1119008 8595 6536 6298 6281 6217 5641 3696 2939 2889 117 48676 8097 3307 2858 18119 11196
NM_173653chr321229 152 --11363 --
NM_173662chr4146 ------
NM_173681chr792016 1756 1585 1357 771 622 570 455 290 --21608 1518 --
NM_173683chr851796 1565 1526 1342 527 ------
NM_173808chr114191 ------
NM_173822chr211464 --1270 --
NM_173829chr5104753 4477 3836 3762 3754 2456 2399 775 150 66 14875 12450 --
NM_173832chr8113633 3401 2856 2838 2664 2331 2302 1086 754 600 376 23655 732 63282 2447 2320 806 485 125 1513
NM_173833chr841475 1442 1430 666 --41360 1209 1180 58 1201
NM_173847chr17--163 ----
NM_173851chr843583 3448 2466 1591 ------
NM_174856chr20----1136 --
NM_174911chr892890 538 407 390 310 300 235 118 99 1111 12486 --
NM_174921chr4--2870 438 ----
NM_174924chr162149 45 ------
NM_174934chr11153625 3406 2892 2825 2364 873 821 785 740 670 654 477 465 405 285 12239 51148 1100 1043 899 699 33510 3482 831
NM_174936chr121205 28 --1192 --
NM_174963chr14630 574 229 126 ------
NM_174964chr14630 574 229 126 ------
NM_174965chr14649 593 248 145 ------
NM_174966chr14630 574 229 126 ------
NM_174967chr14649 593 248 145 ------
NM_174968chr14630 574 229 126 ------
NM_174969chr14630 574 229 126 ------
NM_174970chr14649 593 248 145 ------
NM_174971chr14630 574 229 126 ------
NM_175624chr1276553 6492 6405 6110 5484 4904 2405 45403 2994 2355 2282 23076 1158 --
NM_175625chr1276553 6492 6405 6110 5484 4904 2405 45403 2994 2355 2282 23076 1158 --
NM_175629chr21995 11027 ----
NM_175709chr22102768 2685 2550 2128 1950 766 753 522 435 45 32910 2311 315 12382 1216
NM_175733chr1171913 1898 1394 576 400 357 331 ----11990
NM_175736chr12167517 7000 6501 5709 4806 2544 2275 1838 1409 1403 1333 1210 946 777 395 181 32658 2377 2003 22597 1016 1428
NM_175747chr63979 886 864 ------
NM_175748chr1441447 860 764 547 --1463 --
NM_175854chr1312664 12017 ----
NM_175856chr53627 334 124 ------
NM_175859chrX51702 696 636 527 494 21648 1511 ----
NM_175862chr351137 1060 1006 452 61 --11408 --
NM_175863chr611288 ------
NM_175866chr1148 ------
NM_175884chr71929 ----143
NM_175907chr1822067 1091 12482 1172 --
NM_176863chr1761691 1678 867 781 500 58 ------
NM_176871chr8143255 3154 3138 3082 3046 2765 2645 2367 2357 930 850 804 634 196 32664 255 93 22112 334 --
NM_177398chr141749 1702 1563 1481 11617 ----
NM_177399chr141749 1702 1563 1481 11617 ----
NM_177414chr121099 219 ------
NM_177441chr174812 742 293 62 ------
NM_177551chr124834 194 107 48 ------
NM_177952chr141680 ------
NM_177977chr1792062 1889 1819 1650 1481 1355 1336 1324 192 3603 453 433 1517 --
NM_177985chr221940 1409 ------
NM_177990chr2021516 1373 ----1774
NM_177996chr20113164 3053 2999 2987 2519 2462 2381 1372 1284 772 415 11336 32554 2333 1096 --
NM_177999chr993464 3150 3051 2677 2632 962 746 288 141 1661 21396 1136 --
NM_178009chr13158 ------
NM_178014chr64789 711 232 122 ----1208
NM_178037chr1253649 3437 2851 1310 351 33600 976 196 ----
NM_178038chr1253649 3437 2851 1310 351 33600 976 196 ----
NM_178126chr1721843 686 ----12151
NM_178138chr91731 1897 2158 49 --
NM_178140chr532173 1005 371 --11938 --
NM_178151chrX127688 6461 5804 5752 5294 5242 3139 2278 700 616 474 448 --1181 15715
NM_178152chrX127688 6461 5804 5752 5294 5242 3139 2278 700 616 474 448 --1181 15715
NM_178153chrX127688 6461 5804 5752 5294 5242 3139 2278 700 616 474 448 --1181 15715
NM_178191chr121143 29 --21097 96 --
NM_178313chr232050 1482 114 --2596 46 --
NM_178314chr123803 748 145 ------
NM_178426chr132303 603 448 12312 11868 --
NM_178427chr132203 503 348 12212 11768 --
NM_178441chr1471359 1318 1289 528 512 481 462 ------
NM_178496chr331464 1214 133 1468 ----
NM_178500chr175847 616 290 270 149 ----1118
NM_178505chr1053088 646 583 84 43 12449 11405 --
NM_178507chr116696 546 283 136 127 113 --133 --
NM_178508chr6121 ------
NM_178539chr1241557 478 407 395 11625 11835 --
NM_178557chr491674 1652 1299 1261 1137 698 675 603 240 --11210 --
NM_178565chr851368 1138 1107 1072 505 11725 ----
NM_178568chr1761554 1110 586 455 389 259 ------
NM_178578chr2042123 2093 702 45 ------
NM_178582chr2061276 457 443 422 363 44 11395 1115 --
NM_178585chr422505 2378 ------
NM_178812chr82384 270 1219 ----
NM_178818chr1662239 1729 1658 1584 1578 120 1717 12225 --
NM_178830chr195258 246 96 68 51 1175 2708 673 --
NM_178841chr168954 946 872 866 739 719 258 31 ------
NM_178860chr174972 373 308 207 --1642 --
NM_178863chr161444 ----137
NM_180976chr64883 251 92 57 --2733 704 146
NM_180977chr64883 251 92 57 --2733 704 146
NM_181050chr162525 41 ------
NM_181332chrX12034 --12650 --
NM_181349chr752153 667 642 512 94 12606 ----
NM_181351chr1172365 2116 2039 2005 1968 923 631 ------
NM_181357chr14111719 1408 522 491 427 286 253 222 209 150 126 11663 --1613
NM_181358chr133271 1541 44 --33395 3205 156 --
NM_181425chr941191 972 908 27 ------
NM_181491chr9132865 2596 2372 2320 1129 1108 948 871 852 325 134 114 41 --42406 1245 969 185 12751
NM_181504chr541529 416 383 53 ------
NM_181507chr113759 388 152 ------
NM_181508chr113759 388 152 ------
NM_181523chr541529 416 383 53 ------
NM_181524chr541529 416 383 53 ------
NM_181645chr11159 ------
NM_181659chr2032641 1144 786 ------
NM_181659chr2032641 1144 786 ------
NM_181672chrX51889 1868 1272 268 52 ------
NM_181673chrX51889 1868 1272 268 52 ------
NM_181689chr203836 737 278 --122 --
NM_181698chr102181 70 ------
NM_181701chr961743 749 427 217 150 39 11900 2874 736 1945
NM_181712chr152072 1982 1642 483 47 42022 1956 1561 1334 11279 --
NM_181784chr221056 129 --11953 --
NM_181803chr20123 ------
NM_181807chr11--1370 ----
NM_181809chr1103653 3589 2896 2674 1615 1498 1381 939 611 419 2903 463 31352 880 178 --
NM_181833chr2283745 3564 2550 2342 1245 1239 840 588 53103 2486 2286 1508 348 23610 1092 --
NM_181838chr511201 11294 ----
NM_181839chr831344 1113 401 ------
NM_181844chr17112002 1965 1810 1456 1223 698 499 480 276 168 82 --11710 1658
NM_181861chr1262797 2493 2474 961 818 663 ----12443
NM_181868chr1262797 2493 2474 961 818 663 ----12443
NM_181869chr1262882 2578 2559 1046 903 748 ----12528
NM_182488chr132901 47 --1332 --
NM_182498chr191268 --2278 256 --
NM_182503chr665336 4701 4572 3976 1593 1107 --11040 --
NM_182507chr1272180 1814 1554 1490 933 923 596 1501 --1765
NM_182509chr1461536 1295 1116 447 365 221 --11661 11356
NM_182526chr14152805 2779 2583 2575 2268 2218 2003 1255 1201 867 605 596 556 326 25 --42861 2236 1988 639 12883
NM_182527chr22102250 1873 536 500 472 415 391 242 125 82 1288 41676 549 348 95 --
NM_182528chr25394 357 196 151 67 ------
NM_182553chr112187 70 --192 --
NM_182557chr1191941 1912 1671 1585 1424 713 355 342 88 --21788 766 --
NM_182562chr1542240 408 45 22 2875 82 198 --
NM_182577chr193477 375 51 --1167 --
NM_182580chr172554 2514 2474 2320 2243 1639 634 11017 --12066
NM_182616chr157761 749 419 413 328 133 77 11125 1725 --
NM_182641chr1721630 672 ------
NM_182663chr191768 1580 660 654 648 642 374 94 25 ------
NM_182664chr1111898 1710 790 784 778 772 504 224 155 127 26 ------
NM_182665chr191768 1580 660 654 648 642 374 94 25 ------
NM_182697chr72691 446 ------
NM_182700chr741920 481 215 55 --1572 --
NM_182706chr8282 28 ------
NM_182763chr132665 2398 1770 1974 ----
NM_182764chr2021021 978 1236 11180 --
NM_182767chr1221697 327 ------
NM_182776chr7----124 158
NM_182797chr201198 ------
NM_182811chr203922 314 202 ------
NM_182830chr1432284 697 288 ------
NM_182898chr746291 5104 1182 1006 1213 ----
NM_182899chr746291 5104 1182 1006 1213 ----
NM_182915chr272187 1947 1757 561 541 502 21 2781 133 22158 1866 --
NM_182917chr33392 169 159 --1293 --
NM_182918chr21--1157 ----
NM_182925chr571532 1111 1062 656 561 100 31 1382 1590 11488
NM_182936chr1451388 1380 1219 149 96 1691 ----
NM_182964chr1142846 2401 2083 155 ---