TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1915-5p
miRNA Sequence: ACCUUGCCUUGCUGCCCGGGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1272247 1991 1491 677 650 210 34 21740 1725 31860 742 691 --
NM_000053chr1331722 1412 283 12006 --21445 30
NM_000084chrX24489 1716 1806 ----
NM_000092chr241133 956 622 291 24273 4249 --13193
NM_000165chr61513 ------
NM_000314chr101791 ------
NM_000337chr545932 5133 1724 519 11431 14253 --
NM_000346chr171803 ------
NM_000461chr333529 1010 401 ----23805 2903
NM_000495chrX--11166 ----
NM_000555chrX87735 6680 5419 5369 3112 2466 761 487 ------
NM_000611chr11117013 6618 6486 6408 5464 2469 2333 2255 927 564 388 22636 187 --1537
NM_000724chr1011744 ------
NM_000793chr1444311 3879 3533 664 ----24949 53
NM_000806chr511513 ------
NM_000812chr4197 ------
NM_000813chr521518 1226 127 14016 --
NM_000814chr1514021 12936 ----
NM_000826chr411738 1311 139 --
NM_000845chr7--1131 ----
NM_000891chr1763554 2346 504 363 284 129 11340 ----
NM_000933chr201227 ------
NM_000935chr311142 ------
NM_000965chr3------1510
NM_001001396chr153041 2805 1376 1039 438 13297 ----
NM_001001484chr101795 ------
NM_001001664chr232665 1496 517 1790 ----
NM_001001791chr1071396 1152 482 236 211 188 122 --21192 139 --
NM_001002243chr21127 ------
NM_001002295chr101340 ------
NM_001002843chr151108 ------
NM_001003665chr1113333 3324 3215 3136 3060 2818 2744 2657 2243 384 291 ----13127
NM_001003674chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_001003675chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_001003712chr12--1444 ----
NM_001005609chrX42918 2881 1115 494 11369 22697 1149 13411
NM_001005739chr21830 ------
NM_001007023chr1444311 3879 3533 664 ----24949 53
NM_001007559chr1841361 1289 453 376 --1341 --
NM_001008495chr811531 ------
NM_001008701chr1952352 2106 726 552 485 --42598 2264 557 58 22371 375
NM_001008707chr1441765 1333 1219 634 ----138
NM_001008801chr193615 359 21 --2262 105 --
NM_001008925chr422178 1206 21109 334 ----
NM_001009993chr274205 3371 3362 2767 1587 1555 601 --64160 3623 1396 1269 1154 756 --
NM_001012751chr1011442 ------
NM_001013693chr172813 2400 2029 1093 472 410 142 --31897 1115 187 12522
NM_001013693chr172813 2400 2029 1093 472 410 142 --31897 1115 187 12522
NM_001013843chr151739 ------
NM_001014434chr1------1262
NM_001014797chr10107667 7015 6660 6559 6259 6169 5773 5104 2695 2265 15531 16190 17647
NM_001015045chr41723 ------
NM_001015508chr8180 ------
NM_001017440chr787306 6890 6815 6161 5340 2603 1885 926 --1916 1190
NM_001018065chr935874 555 262 13851 14161 14007
NM_001018066chr935874 555 262 13851 14161 14007
NM_001018089chr1531254 1064 89 22673 2455 --23358 237
NM_001018108chr1512126 --11632 11660
NM_001024688chr82816 282 ------
NM_001031695chr2244899 4435 3484 1172 --23758 1414 34950 4297 2169
NM_001031717chr31299 ------
NM_001032393chrX1591 ------
NM_001033057chr31373 ------
NM_001033081chr131849 1825 1465 1432 ----
NM_001033082chr131849 1825 1465 1432 ----
NM_001038702chr532341 1989 470 2720 320 ----
NM_001039465chr14188 ------
NM_001039711chr12415 308 ------
NM_001039712chr12415 308 ------
NM_001039762chr1072292 956 830 470 464 329 175 ------
NM_001039840chrX44365 3988 2382 1492 --2762 722 --
NM_001042453chrX--21332 195 ----
NM_001042473chr10----11421 --
NM_001042481chr1412662 ------
NM_001042599chr257112 6615 6597 2398 278 21362 1316 ----
NM_001042603chr1285081 3487 3429 3371 3313 2109 1586 633 ----35004 4082 724
NM_001083620chr411737 1310 139 --
NM_001100108chr167414 6465 5597 2413 2080 825 --36736 328 217 16452
NM_001106chr398900 8217 7726 7505 3332 3018 2324 1483 1069 19119 23697 1784 --
NM_001126chr11376 ------
NM_001167chrX86197 6064 5978 4405 4204 1995 1695 1545 26234 1189 1996 --
NM_001204chr226112 964 ------
NM_001206chr91684 --1360 --
NM_001289chrX11035 ------
NM_001300chr10--1409 ----
NM_001332chr51331 1138 --11401
NM_001351chr321742 1695 1256 ----
NM_001356chrX--12350 ----
NM_001390chr1812959 23281 2504 --13033
NM_001396chr2121004 994 1531 ----
NM_001399chrX42918 2881 1115 494 11369 22697 1149 13411
NM_001420chr1972837 2636 2540 1119 757 709 123 32163 1933 183 22898 2863 12546
NM_001429chr221833 ------
NM_001431chr6----1372 --
NM_001614chr171587 1694 ----
NM_001614chr171587 1694 ----
NM_001616chr253333 3041 2427 2387 705 12648 ----
NM_001663chr1412431 ------
NM_001681chr12133 ------
NM_001704chr61237 ------
NM_001789chr31594 ------
NM_001884chr5--1226 ----
NM_001918chr1117975 7955 3279 3230 2542 2506 2410 1808 1159 481 277 22787 1016 15794 18004
NM_001957chr442190 1955 1887 148 ------
NM_001981chr131760 1622 831 --1440 --
NM_002025chrX78217 3677 3604 3574 2354 965 946 26290 3232 ----
NM_002051chr101340 ------
NM_002111chr483771 3757 3127 2615 1484 1061 810 638 --32511 1494 1456 1190
NM_002139chrX--1505 ----
NM_002264chr324068 1687 ------
NM_002336chr122761 638 24903 4711 11859 --
NM_002380chr81250 ----1693
NM_002397chr51716 ------
NM_002481chr187325 7173 5794 5215 4913 2233 2196 1351 27048 1046 ----
NM_002485chr82816 282 ------
NM_002515chr141577 ------
NM_002643chr2142 ------
NM_002656chr61358 ------
NM_002709chr222774 1149 12876 ----
NM_002717chr8----1213 --
NM_002721chr91394 ------
NM_002787chr71525 ------
NM_002825chr71263 ------
NM_003028chr993729 3652 3631 3285 3197 1488 794 762 563 ----13435
NM_003034chr1248089 5245 2368 971 37298 5859 3084 11603 --
NM_003051chr121881 1720 ----11726
NM_003075chr12--1116 ----
NM_003091chr201217 ------
NM_003161chr1732619 1097 69 --22965 1015 --
NM_003188chr62598 531 ------
NM_003199chr181683 ------
NM_003221chr624026 3027 21377 1285 42737 2732 1243 676 --
NM_003298chr375032 2100 1872 1270 1156 1135 943 --1472 14216
NM_003320chr1184198 3909 1725 1475 1129 597 590 365 11094 1182 --
NM_003339chr541483 1242 427 307 ------
NM_003341chr31606 ------
NM_003458chr363400 3227 2712 1555 286 160 --11105 23168 2848
NM_003482chr1262738 2591 945 646 637 333 --31704 1093 25 1657
NM_003489chr2112604 ------
NM_003583chr1253447 3266 1134 1037 281 13234 ----
NM_003597chr2--1574 11466 --
NM_003705chr21808 ------
NM_003797chr11176 ------
NM_003941chr722232 2225 ------
NM_003966chr577447 7147 6975 6429 5692 1777 1322 ------
NM_004130chr32587 271 ------
NM_004200chr1152731 2673 2555 2399 622 11263 43280 2440 2283 643 11276
NM_004338chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_004379chr21435 11128 ----
NM_004426chr1231559 1304 554 2601 84 1369 1375
NM_004434chr1441765 1333 1219 634 ----138
NM_004437chr1--11088 1596 11286
NM_004458chrX41647 1631 453 95 1813 ----
NM_004464chr4--1770 --1816
NM_004499chr51458 ------
NM_004520chr5169 ------
NM_004569chr141202 ------
NM_004586chrX65162 4814 3541 1669 1533 1175 ----1966
NM_004596chr19180 ------
NM_004705chr11157 ------
NM_004713chr141646 ------
NM_004726chrX74869 3984 1515 1378 1325 754 258 14601 ----
NM_004745chr896210 6190 5406 5045 4744 1048 379 302 265 --11613 1185
NM_004774chr1742907 2106 963 687 ----12418
NM_004788chr1111900 ----12027
NM_004860chr17----1215 --
NM_004956chr764429 3747 3304 1624 1539 22 --13317 --
NM_004992chrX87509 3160 2845 1729 1516 1479 811 487 --28050 3165 26570 605
NM_004992chrX87509 3160 2845 1729 1516 1479 811 487 --28050 3165 26570 605
NM_004993chr141382 ------
NM_005023chr521077 1045 ------
NM_005056chr1285325 3731 3673 3615 3557 1830 877 159 ----35248 4326 968
NM_005076chr193543 3328 3053 2794 2662 1645 892 472 393 2521 192 13115 --
NM_005080chr221675 ------
NM_005113chr141182 ------
NM_005156chr931828 1814 1130 --1951 11164
NM_005164chr1242511 1968 1842 189 ------
NM_005188chr1197740 6754 6377 6062 5781 5246 2719 2518 77 27770 1119 --1446
NM_005235chr257112 6615 6597 2398 278 21362 1316 ----
NM_005238chr1142368 2341 1390 395 ------
NM_005277chr41116 ------
NM_005312chr9102534 2317 2233 1666 999 779 479 460 226 93 --12286 12526
NM_005324chr17----12062 --
NM_005329chr1682201 2086 1796 1677 1639 416 216 208 1624 141 --
NM_005338chr743629 3592 1358 542 23801 1449 33779 3489 291 --
NM_005339chr444188 4148 1608 1389 ----1939
NM_005359chr1835221 2124 1125 15020 --14405
NM_005398chr101443 ----1303
NM_005433chr1812322 ------
NM_005520chr51584 ------
NM_005637chr1841361 1289 453 376 --1341 --
NM_005639chr121477 ------
NM_005644chr11310 ------
NM_005665chr144135 4039 3004 1838 ----13502
NM_005704chr151072 999 891 808 113 --1164 2362 67
NM_005863chr102235 74 ------
NM_005880chr1611549 ------
NM_005885chr541574 1353 528 376 --11662 --
NM_005902chr1573029 1700 1624 810 428 235 29 13078 13114 --
NM_005910chr1773085 1613 1103 880 794 786 743 11020 33820 1600 552 --
NM_005937chr1783732 3207 2686 1384 1154 652 585 530 13973 11392 1854
NM_006015chr111349 ------
NM_006016chr61677 ----1727
NM_006145chr191737 ------
NM_006158chr811712 ------
NM_006251chr521224 825 --12645 --
NM_006252chr146763 5754 1289 325 ----25936 1136
NM_006306chrX75391 4677 4618 4546 4258 1159 879 1650 ----
NM_006371chr395053 4786 4554 2105 2085 1855 1652 1567 1238 11417 23266 1441 --
NM_006380chr17--22665 371 ----
NM_006416chr6----1305 --
NM_006454chr492959 2926 2837 2699 2091 2047 602 533 328 22461 213 2425 220 --
NM_006482chr1253447 3266 1134 1037 281 13234 ----
NM_006489chr141577 ------
NM_006521chrX21112 1042 ----2542 161
NM_006546chr1765049 4721 1309 846 242 72 --22597 1065 24964 2588
NM_006599chr1611470 ------
NM_006690chr2042119 2087 1681 102 --1632 31701 282 168
NM_006718chr61358 ------
NM_006775chr61317 ------
NM_006805chr5--1408 ----
NM_006811chr201996 ------
NM_006828chr61438 ------
NM_006925chr14188 ------
NM_006981chr911026 ------
NM_006982chr121236 ------
NM_007007chr1221901 788 1106 24581 1296 --
NM_007050chr20107374 6973 6266 5798 3096 2683 2510 1484 335 273 66909 5854 5820 2836 1064 737 1791 --
NM_007249chr1378872 7784 7683 2634 2344 919 64 11460 36113 2494 1243 --
NM_007366chr2137 ------
NM_012137chr122693 30 1273 145 --
NM_012160chr62410 95 1382 ----
NM_012180chr41664 ------
NM_012199chr123988 3768 185 23085 349 24090 3979
NM_012281chr71822 11621 ----
NM_012290chr2--11377 ----
NM_012302chr11776 ------
NM_012428chr151152 ------
NM_012482chr12538 477 ------
NM_013283chr5--1831 ----
NM_013372chr1542510 1328 402 127 11265 --1631
NM_013382chr1442154 1835 1560 256 11825 1859 21695 939
NM_013390chr931209 594 216 ------
NM_013958chr81405 ------
NM_013959chr81405 ------
NM_013961chr81405 ------
NM_013962chr81405 ------
NM_013989chr1444311 3879 3533 664 ----24949 53
NM_014016chr321431 1157 ------
NM_014048chr1611000 14533 33596 3272 1021 1832
NM_014106chr1532526 980 201 21997 138 ----
NM_014154chr321219 583 --11576 --
NM_014155chr1126820 750 26720 5276 --27488 900
NM_014159chr33499 234 38 1477 ----
NM_014181chr272715 2412 2341 2287 2082 290 117 ------
NM_014286chr963367 3242 3077 2933 1449 1416 ----33441 2737 2341
NM_014309chr2244889 4425 3474 1162 --23748 1404 34940 4287 2159
NM_014317chr101288 ------
NM_014445chr322098 2073 ------
NM_014612chr9------143
NM_014674chr343681 3513 2492 1381 1959 12855 13519
NM_014682chr8----1584 --
NM_014711chr16--11879 ----
NM_014730chr1254719 4410 4272 4206 3924 1370 23985 3700 34877 4742 1014
NM_014730chr1254719 4410 4272 4206 3924 1370 23985 3700 34877 4742 1014
NM_014747chr165702 5533 4565 4184 1489 858 24642 3932 34857 1899 1648 1966
NM_014766chr732938 1479 341 23253 1102 --23675 1143
NM_014803chr1032722 1905 590 12282 12169 --
NM_014824chr1111463 ------
NM_014872chr9160 ------
NM_014876chr2231496 1454 1447 --11459 1193
NM_014883chr41723 ------
NM_014897chr1721986 971 ----1432
NM_014909chr1473581 3552 3237 2628 2446 1468 513 --33669 1057 104 22852 1077
NM_014912chr10--2580 527 ----
NM_014917chr11875 ------
NM_014921chr1952352 2106 726 552 485 --42598 2264 557 58 22371 375
NM_014923chr1321634 497 ------
NM_014947chr122167 743 --12005 --
NM_014951chr1042564 2524 402 132 ----1408
NM_015000chr1211956 1619 12838 --
NM_015026chr1254177 1602 998 734 205 ------
NM_015035chr2086520 4765 4256 2480 1920 1834 1593 1036 25852 2496 34501 1656 1581 24316 497
NM_015042chr1553732 3545 3344 3006 2936 --52763 1007 713 706 422 --
NM_015045chr1022199 315 11473 --11769
NM_015049chr22450 354 --22910 2273 --
NM_015076chr674443 4399 4367 3393 3061 1444 1438 1878 13376 --
NM_015090chr1105496 4569 4102 2361 2297 2056 2036 1910 1457 1432 26118 4151 15061 1684
NM_015093chr6--11372 ----
NM_015094chr22123743 3469 3422 3407 3188 2845 1455 1269 759 263 83 67 1455 13808 14230
NM_015161chr161154 ------
NM_015176chr111516 1321 --1600
NM_015206chr1553654 3190 2432 1243 762 ----13706
NM_015216chr5------1132
NM_015271chr453553 2873 2633 1139 533 --11063 --
NM_015293chr6--1265 ----
NM_015294chr17--1225 ----
NM_015310chr847921 6879 6772 678 37196 6833 592 27273 5861 --
NM_015355chr1711526 ------
NM_015419chrX156 ------
NM_015483chr71953 ------
NM_015525chr611042 ------
NM_015530chr22939 240 ------
NM_015570chr721136 444 11662 ----
NM_015571chr61727 ------
NM_015608chr101631 ------
NM_015836chr1125 21342 298 ----
NM_015976chr1--1342 ----
NM_015987chr12------165
NM_016019chr71921 ----2709 443
NM_016061chr2--1294 ----
NM_016075chr1333030 2726 948 --11250 --
NM_016131chr211552 ------
NM_016152chr3------1510
NM_016255chr663259 2633 2277 724 654 546 ------
NM_016260chr222727 1220 ----12604
NM_016287chr112037 ------
NM_016424chr1731362 1328 38 ------
NM_016516chr21830 ------
NM_016542chrX--21332 195 ----
NM_016577chr354285 3821 3599 1644 1618 23965 1721 --11787
NM_016588chr61628 ------
NM_016621chr1194410 4248 4178 4062 3504 1322 1216 618 557 21573 363 --2816 43
NM_016623chr8--1539 ----
NM_016644chr51143 ------
NM_016834chr1773085 1613 1103 880 794 786 743 11020 33820 1600 552 --
NM_016835chr1773085 1613 1103 880 794 786 743 11020 33820 1600 552 --
NM_016841chr1773085 1613 1103 880 794 786 743 11020 33820 1600 552 --
NM_016937chrX1907 ------
NM_016953chr272286 2264 2227 2048 1368 1041 752 ----1203
NM_017412chr83522 420 260 ------
NM_017447chr2113449 --13077 13607
NM_017455chr151152 ------
NM_017599chr12----1208 --
NM_017602chrX2723 606 --3716 710 278 --
NM_017628chr445052 3221 1882 1757 1616 ----
NM_017637chr947917 7185 6870 1226 37811 7348 7232 ----
NM_017650chr725446 592 --24876 1553 --
NM_017657chr21127 ------
NM_017661chr151108 ------
NM_017752chrX--1352 ----
NM_017768chr12706 210 ------
NM_017813chr864647 4465 4371 1859 873 799 ------
NM_017848chrX33457 589 296 24308 1664 ----
NM_017902chr1065749 5072 4240 2241 489 154 24975 4250 1159 --
NM_018098chr31160 ------
NM_018120chr811151 ------
NM_018126chr4----11033 --
NM_018171chr121223 ------
NM_018182chr1711506 ----1847
NM_018206chr161192 ------
NM_018247chr632952 2782 939 ------
NM_018260chr192437 175 --1522 --
NM_018287chr101314 ------
NM_018293chr322467 928 ------
NM_018364chr133586 1322 488 ------
NM_018448chr1211123 ------
NM_018657chr31820 --158 --
NM_018686chr121316 ------
NM_018710chr8153 ------
NM_018719chr71300 ------
NM_018947chr784536 4519 4315 4181 4010 3949 3371 1250 --1450 --
NM_019084chr1021759 58 ------
NM_019597chrX1591 ------
NM_019857chrX31738 536 64 ----1379
NM_020177chr513374 12273 ----
NM_020193chr1111124 --11109 --
NM_020198chr17----11175 --
NM_020204chr1------1262
NM_020240chr532341 1989 470 2720 320 ----
NM_020337chr41163 ------
NM_020452chr141487 1385 524 443 11456 --21858 1831
NM_020457chr161690 ------
NM_020474chr181121 ------
NM_020640chr311398 ------
NM_020697chr821048 967 2442 92 ----
NM_020717chrX144868 4734 4017 3907 1927 1800 1774 1490 1150 1002 918 504 265 218 11654 13175 --
NM_020783chr1811837 ----22107 46
NM_020810chr1452723 2561 1353 1139 417 1721 --12836
NM_020825chr1663603 3379 1302 651 489 121 33421 949 409 1198 --
NM_020841chr12--1444 ----
NM_020865chr31110 ------
NM_020956chr1974742 4385 3696 3605 3156 3065 448 --63983 3926 3911 3350 3238 3224 14717
NM_021033chr1313189 1879 11145 --
NM_021116chr7128628 7295 7246 6977 5788 2840 2182 1898 1723 1676 1424 693 57335 2958 1086 341 106 58751 8432 5870 3284 1787 11807
NM_021140chrX3464 403 91 ------
NM_021144chr91213 ------
NM_021252chr101176 ------
NM_021911chr521518 1226 127 14016 --
NM_021912chr1514021 12936 ----
NM_021935chr31209 ------
NM_022048chr1532454 1941 977 14721 1440 12191
NM_022166chr1662478 1788 1530 732 427 190 14909 11535 13849
NM_022469chr11502 31312 916 359 --11007
NM_022716chr113042 --1572 12036
NM_022776chr311038 ------
NM_022977chrX41647 1631 453 95 1813 ----
NM_023009chr11561 ------
NM_023016chr211049 2348 69 ----
NM_024086chr1753126 2797 642 311 67 13616 13452 --
NM_024408chr142547 765 525 187 13145 ----
NM_024491chr31195 --1201 1430
NM_024496chr14----1595 --
NM_024551chr12----1537 --
NM_024551chr12----1537 --
NM_024556chr11142 ------
NM_024582chr411038 ------
NM_024611chr1531254 1064 89 22673 2455 --23358 237
NM_024617chr9--1653 ----
NM_024698chr116904 487 335 139 125 83 --3132 116 37 --
NM_024744chr241916 999 680 486 ------
NM_024755chr151739 ------
NM_024770chr266426 6334 6210 2100 1834 694 16520 12683 --
NM_024834chr1011928 1168 ----
NM_024887chr141977 1470 701 457 ----1475
NM_024947chr348815 5994 1203 59 11610 15970 --
NM_024953chr123844 682 528 ----1692
NM_025027chr1911083 ----1863
NM_025147chr2--11156 ----
NM_030576chr1752427 1760 1658 922 541 1326 5647 551 546 140 50 31796 1610 855
NM_030583chr81250 ----1693
NM_030594chr1541315 1006 55 46 ----1221
NM_030634chr11537 1835 --11843
NM_030650chr274193 3799 3593 3583 3347 2636 1558 ------
NM_030660chr141382 ------
NM_030664chr101795 ------
NM_030674chr1264652 3990 3626 3605 1781 666 25261 1466 24169 3973 --
NM_030913chr11692 ------
NM_030920chr121976 411 ------
NM_030938chr17----1183 --
NM_030963chr6--1185 ----
NM_031216chr1811422 ------
NM_031266chr51458 ------
NM_031468chr787306 6890 6815 6161 5340 2603 1885 926 --1916 1190
NM_032105chr187458 7306 5927 5348 5046 2366 2329 1484 27181 1179 14894 --
NM_032199chr1043854 3642 1463 359 --1405 1382
NM_032229chr1321010 908 1417 ----
NM_032281chr1972837 2636 2540 1119 757 709 123 32163 1933 183 22898 2863 12546
NM_032547chr4------11192
NM_032858chr1--1125 ----
NM_032859chr1363911 3533 2503 1000 577 395 --13182 --
NM_032975chr1812959 23281 2504 --13033
NM_032980chr1812959 23281 2504 --13033
NM_032998chr12415 308 ------
NM_033071chr6--1265 ----
NM_033143chr4--11101 --11147
NM_033224chr797874 6096 5730 5383 5260 2914 1664 345 103 16434 ----
NM_033272chr21153 ------
NM_033285chr843801 2855 1371 972 33250 2974 1694 14121 --
NM_033326chr1111602 1727 1693 --
NM_033364chr311658 11393 ----
NM_033380chrX--11166 ----
NM_033381chrX--11166 ----
NM_033389chr1784181 3753 1596 533 202 174 133 53 168 11914 --
NM_033495chrX1303 ------
NM_052906chr22104669 4327 3565 3504 3271 3201 3192 930 717 298 34021 3711 1047 64097 3226 1894 1829 1783 860 22034 428
NM_052923chr6125 ------
NM_080626chr121343 ------
NM_130436chr2121004 994 1531 ----
NM_133170chr20107374 6973 6266 5798 3096 2683 2510 1484 335 273 66909 5854 5820 2836 1064 737 1791 --
NM_133177chr151072 999 891 808 113 --1164 2362 67
NM_133178chr151072 999 891 808 113 --1164 2362 67
NM_133334chr476214 6044 4867 4420 507 302 169 24387 1118 11732 1783
NM_133445chr983236 2575 1481 1244 858 677 576 490 ------
NM_133493chr633792 3551 879 1129 13611 --
NM_133646chr265450 4752 4348 3972 657 580 187 13788 --
NM_133650chr6--1265 ----
NM_134442chr21435 11128 ----
NM_138316chr101963 ------
NM_138333chr911635 ------
NM_138473chr1234606 1334 59 ----24170 1552
NM_138713chr1611470 ------
NM_138714chr1611470 ------
NM_138959chr1106258 4819 4784 4558 2119 1919 1909 1372 958 171 14813 14824 --
NM_139067chr12--1116 ----
NM_139135chr111349 ------
NM_139136chr121381 ------
NM_139283chr1252322 2140 2070 1913 75 ------
NM_144571chr426315 556 ----14765
NM_144604chr16145 ------
NM_144967chrX1108 ----1783
NM_144982chr121100 ------
NM_144992chr2----198 --
NM_145014chr111264 ----1114
NM_145331chr62598 531 ------
NM_145332chr62746 679 ------
NM_145333chr62746 679 ------
NM_145698chr10----11421 --
NM_145912chr22123901 3608 3361 3246 2996 1351 1243 591 536 417 237 91 11513 31826 1704 525 11669
NM_148977chr101963 ------
NM_148978chr101963 ------
NM_152238chr1--1342 ----
NM_152253chr2274201 3822 3387 1523 1185 475 324 --12964 23592 106
NM_152330chr1412662 ------
NM_152733chr6106281 5863 5844 5421 4218 2503 1607 210 72 48 21722 295 75849 5564 4735 4518 4351 4116 1538 36288 5464 2575
NM_152739chr7133 ------
NM_152756chr523313 3244 --11165 14005
NM_152854chr20--1666 ----
NM_153207chr1223350 981 1423 ----
NM_153267chr92800 594 ------
NM_153347chr1152671 1830 1037 685 613 11047 11799 --
NM_153367chr1033455 2803 269 1214 23371 496 1923
NM_153449chr121343 ------
NM_153456chr1345537 5378 4499 1715 ----25716 2530
NM_153619chr1532313 1416 1305 ------
NM_153748chr121381 ------
NM_153836chr232136 2051 1999 --1721 --
NM_170665chr1253868 3078 2899 1092 164 --13393 13433
NM_173198chr911026 ------
NM_173200chr911026 ------
NM_173214chr1611470 ------
NM_173527chr142728 307 --2651 566 1237
NM_173694chrX31930 1631 846 ------
NM_173832chr843637 3357 173 97 101349 1324 1299 1274 1249 1224 1199 1174 1149 1124 42832 2543 2538 2516 12625
NM_173848chr8--1697 1290 --
NM_174934chr1193075 2984 2955 2929 2196 882 498 381 328 32261 1166 30 ----
NM_175859chrX31738 536 64 ----1379
NM_175861chr1265382 3725 1678 437 210 84 --11599 --
NM_177972chr1184198 3909 1725 1475 1129 597 590 365 11094 1182 --
NM_178151chrX87735 6680 5419 5369 3112 2466 761 487 ------
NM_178152chrX87735 6680 5419 5369 3112 2466 761 487 ------
NM_178153chrX87735 6680 5419 5369 3112 2466 761 487 ------
NM_181358chr163596 2901 2640 2621 1511 126 22615 1527 ----
NM_181481chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_181482chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_181483chr1864986 2610 1491 1457 1173 1079 35143 4320 545 22413 256 12365
NM_181706chr1112025 ------
NM_181838chr541483 1242 427 307 ------
NM_182515chr1996683 4868 4596 2011 978 846 558 109 28 ------
NM_182666chr31606 ------
NM_182796chr5--1831 ----
NM_182797chr201247 ------
NM_182830chr14----11837 --
NM_182943chr311142 ------
NM_182961chr6--1265 ----
NM_182970chr2074135 3634 3410 3303 3024 2944 1212 33572 647 479 13825 --
NM_194286chr1284886 1870 1852 1833 1537 1485 1290 1156 --34068 702 150 14907
NM_198216chr20144 ------
NM_198268chr163596 2901 2640 2621 1511 126 22615 1527 ----
NM_198269chr163596 2901 2640 2621 1511 126 22615 1527 ----
NM_198428chr71511 ------
NM_198440chr2292254 2245 2211 2147 2129 1979 1756 576 297 --11871 1911
NM_198679chr9102534 2317 2233 1666 999 779 479 460 226 93 --12286 12526
NM_198859chr384993 4883 4738 3928 2070 1215 1179 1118 14826 23177 142 --
NM_199132chr193615 359 21 --2262 105 --
NM_201263chr12474 126 21791 747 ----
NM_201567chr31594 ------
NM_201570chr1011744 ------
NM_201571chr1011744 ------
NM_201572chr1011744 ------
NM_201590chr1011744 ------
NM_201591chr41116 ------
NM_201592chr41116 ------
NM_201593chr1011744 ------
NM_201596chr1011744 ------
NM_201597chr1011744 ------
NM_203301chr14--11670 ----
NM_203329chr11117013 6618 6486 6408 5464 2469 2333 2255 927 564 388 22636 187 --1537
NM_203330chr11117013 6618 6486 6408 5464 2469 2333 2255 927 564 388 22636 187 --1537
NM_203331chr11117013 6618 6486 6408 5464 2469 2333 2255 927 564 388 22636 187 --1537
NM_203342chr1--11088 1596 11286
NM_203343chr1--11088 1596 11286
NM_203437chr21127 ------
NM_205861chr141977 1470 701 457 ----1475
NM_206876chr222774 1149 12876 ----
NM_206907chr521224 825 --12645 --
NM_206909chr847921 6879 6772 678 37196 6833 592 27273 5861 --
NM_207325chr1911703 ------
NM_207337chr121943 --11095 --
NM_207371chr10----11504 --
NM_207435chr12--11083 ----
NM_213654chr321219 583 --11576 --