TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-192-3p
miRNA Sequence: CUGCCAAUUCCAUAGGUCACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511189 ------
NM_000038chr5----1398 --
NM_000092chr243832 3657 1326 1236 1741 14539 --
NM_000125chr643974 2662 1296 444 1635 ----
NM_000158chr31140 ------
NM_000165chr631522 577 220 ------
NM_000170chr91203 ------
NM_000176chr532548 1186 367 1171 23886 1562 --
NM_000189chr241487 925 242 109 ------
NM_000216chrX1190 ----1968
NM_000217chr1245353 4222 4128 1875 ------
NM_000227chr18--1258 ----
NM_000248chr332936 1965 877 --1483 --
NM_000264chr91852 ----22861 2161
NM_000280chr111227 ------
NM_000314chr1042997 679 631 446 ----12022
NM_000317chr111342 ------
NM_000321chr1311729 ------
NM_000340chr31609 ------
NM_000345chr421031 778 ------
NM_000346chr17--1802 ----
NM_000430chr1753244 2666 2622 598 245 ------
NM_000439chr532539 1965 467 21741 847 ----
NM_000448chr1132587 2119 366 ------
NM_000452chr133138 87 76 1771 ----
NM_000523chr21214 ------
NM_000555chrX86846 5251 5124 4881 2527 2480 1755 92 16480 1409 15333
NM_000575chr21878 ------
NM_000602chr711210 ------
NM_000612chr1183400 543 493 459 428 392 356 232 --1807 1476
NM_000618chr1245496 4194 1463 211 16230 12095 --
NM_000618chr1245496 4194 1463 211 16230 12095 --
NM_000684chr1011308 ------
NM_000686chrX11050 ------
NM_000726chr221402 502 ------
NM_000793chr1455092 4750 3326 413 94 11651 1582 --
NM_000801chr201373 ------
NM_000813chr545601 3759 1350 636 13555 ----
NM_000814chr1544146 3698 3558 3540 ------
NM_000826chr421671 612 1818 ----
NM_000827chr542593 2502 2455 1786 ------
NM_000868chrX22316 600 ------
NM_000899chr1263688 3017 2777 1243 706 39 1553 1789 --
NM_000902chr322854 709 12654 ----
NM_000908chr51747 ------
NM_001001433chr2043062 1288 1064 439 ------
NM_001001481chr833118 341 332 --1662 13285
NM_001001484chr1011670 --11873 1794
NM_001001664chr221016 586 ----12889
NM_001001974chr1041990 796 724 419 ------
NM_001002233chr822027 436 --11986 --
NM_001002243chr2--1126 ----
NM_001002258chr241758 702 89 24 12027 ----
NM_001002259chr12188 ------
NM_001002264chr13129 ------
NM_001002909chr1751778 1746 1441 633 619 ------
NM_001003652chr1866971 5385 3474 1721 1585 903 25421 5413 16597 --
NM_001003681chr2241988 1438 633 229 --1625 --
NM_001003694chr31522 ------
NM_001003698chr62586 359 ------
NM_001003699chr62586 359 ------
NM_001003712chr1222745 1040 22722 1600 --21489 1469
NM_001003760chr611066 13561 --12338
NM_001003895chrY1126 ------
NM_001003927chr17161 ------
NM_001003940chr1542527 2481 1388 739 --13868 --
NM_001003942chr1542527 2481 1388 739 --13868 --
NM_001003943chr1542531 2485 1392 743 --13872 --
NM_001004329chr1221480 514 ------
NM_001004342chr155863 5674 4380 4260 432 15722 15969 14292
NM_001004431chr17--1247 ----
NM_001004720chr2----1908 --
NM_001004722chr2--1798 11077 --
NM_001005266chr152631 263 ------
NM_001005267chr152631 263 ------
NM_001005268chr152631 263 ------
NM_001005269chr152631 263 ------
NM_001005271chr1711143 ------
NM_001005273chr1711143 ------
NM_001005353chr1163 ------
NM_001005353chr1163 ------
NM_001005474chr31189 ----192
NM_001005476chr21477 ------
NM_001005609chrX3544 505 98 ----12755
NM_001005746chr221402 502 ------
NM_001005747chr221402 502 ------
NM_001006610chr161915 ------
NM_001006657chr232680 1242 1165 ------
NM_001006684chrX1128 ------
NM_001007023chr1455092 4750 3326 413 94 11651 1582 --
NM_001007024chr1764403 3482 3206 3160 2878 2759 ------
NM_001007025chr1764403 3482 3206 3160 2878 2759 ------
NM_001007156chr1521243 41 11450 1563 --
NM_001007246chr2141633 1473 539 413 11951 11434 11757
NM_001007466chr624735 2047 ------
NM_001007794chr1------1137
NM_001008239chr1843566 2786 2701 1292 12993 2469 420 11092
NM_001008495chr852036 1995 742 430 227 --11634 --
NM_001008738chr542645 940 687 27 --12754 --
NM_001008895chr1321456 961 ------
NM_001009554chr494696 4001 3906 3626 1683 1554 974 562 284 1300 ----
NM_001009554chr494696 4001 3906 3626 1683 1554 974 562 284 1300 ----
NM_001009909chr1172583 1181 755 743 666 605 251 --1507 --
NM_001009959chr252223 2109 719 538 385 12046 ----
NM_001010852chr6147 ------
NM_001010891chr576781 6049 5663 4981 1089 659 179 ------
NM_001010922chr111430 32903 1466 421 ----
NM_001010971chr12989 700 ------
NM_001010986chrX22540 534 ------
NM_001010989chr161176 ------
NM_001010990chr161176 ------
NM_001011663chr101307 ----11039
NM_001011708chr212642 ----11047
NM_001011713chr142217 161 11517 1490 --
NM_001011720chr82532 46 ------
NM_001012456chr7139 ------
NM_001012751chr1011790 ----1128
NM_001012989chrX1433 ------
NM_001013399chr6--1767 ----
NM_001013406chr71648 1596 ----
NM_001013620chr1247045 6073 3247 265 --16373 --
NM_001013699chr12161 ------
NM_001014797chr1038055 6425 2878 12677 1840 12538
NM_001014839chr111108 ------
NM_001014841chr111108 ------
NM_001015048chr1443134 3087 2400 487 ------
NM_001015049chr1443134 3087 2400 487 ------
NM_001015877chrX33038 2067 2020 1729 23086 852 --
NM_001017371chr21339 ------
NM_001017405chr4----1198 --
NM_001017415chr11113 ----155
NM_001017416chr11113 ----155
NM_001017440chr787904 7469 6783 6035 5656 3099 1976 186 16889 22399 639 --
NM_001017523chr1251580 1243 432 392 57 ----11277
NM_001017920chr2--1103 ----
NM_001017922chr131747 1274 1114 ------
NM_001017923chr14182 ------
NM_001017977chr11143 ------
NM_001018038chr91231 1580 --1118
NM_001018067chr174996 2116 1523 1061 954 817 787 --1222 --
NM_001018068chr174996 2116 1523 1061 954 817 787 --1222 --
NM_001018069chr174996 2116 1523 1061 954 817 787 --1222 --
NM_001018072chr1251580 1243 432 392 57 ----11277
NM_001018074chr532548 1186 367 1171 23886 1562 --
NM_001018075chr532548 1186 367 1171 23886 1562 --
NM_001018076chr532548 1186 367 1171 23886 1562 --
NM_001018077chr532548 1186 367 1171 23886 1562 --
NM_001018090chr1562569 2555 2409 2045 1964 243 ------
NM_001018091chr1572679 2665 2519 2155 2074 353 93 ------
NM_001018102chr1562569 2555 2409 2045 1964 243 ------
NM_001024094chr532548 1186 367 1171 23886 1562 --
NM_001024948chr111125 13420 ----
NM_001025076chr1045409 3981 974 860 --1386 --
NM_001025077chr1056767 5339 2332 2218 618 --11744 --
NM_001025108chr233378 2616 2592 --1536 --
NM_001025201chr23705 667 648 ------
NM_001025242chrX11310 ------
NM_001025243chrX11310 ------
NM_001025266chr343455 3303 1919 401 ------
NM_001025366chr621745 461 11567 ----
NM_001025366chr621745 461 11567 ----
NM_001025367chr621745 461 11567 ----
NM_001025367chr621745 461 11567 ----
NM_001025368chr621745 461 11567 ----
NM_001025368chr621745 461 11567 ----
NM_001025369chr621761 477 11583 ----
NM_001025369chr621761 477 11583 ----
NM_001025370chr621745 461 11567 ----
NM_001025370chr621745 461 11567 ----
NM_001025780chr9--159 ----
NM_001029863chr6--22894 2789 33244 3176 895 --
NM_001030006chr171316 11972 ----
NM_001030055chr1421538 1189 --11786 13230
NM_001031684chr241414 1220 1079 213 ------
NM_001032393chrX1550 ----1104
NM_001033506chr111104 ------
NM_001033557chr21455 ------
NM_001033578chr822219 538 --2729 434 --
NM_001033756chr621679 395 11501 ----
NM_001033756chr621679 395 11501 ----
NM_001033925chr1021736 1717 11571 ----
NM_001035511chr121399 351 11543 ----
NM_001035512chr121506 458 11650 ----
NM_001035513chr121506 458 11650 ----
NM_001037132chr742106 1956 1472 487 ------
NM_001037133chr742106 1956 1472 487 ------
NM_001037164chr72462 223 ------
NM_001037535chrX21295 1056 ------
NM_001037536chrX21295 1056 ------
NM_001037540chrX21295 1056 ------
NM_001037954chr1122481 389 13085 ----
NM_001039091chrX21353 1145 ------
NM_001039457chr11275 ------
NM_001039459chr7--1100 ----
NM_001039479chr1452022 1815 1561 206 24 --22358 826 --
NM_001039538chr222407 52 13294 ----
NM_001039547chr368071 6057 6027 2816 2096 1316 17359 16043 --
NM_001039573chr17--1467 ----
NM_001039574chr11271 ------
NM_001039590chrX43691 3663 996 561 ----11317
NM_001039591chrX43691 3663 996 561 ----11317
NM_001039618chr1135978 4235 1645 15334 24608 1188 --
NM_001039840chrX44570 4413 4355 419 ------
NM_001039937chr1364006 2632 2625 835 722 103 12641 ----
NM_001040110chr71195 11344 ----
NM_001040152chr744559 3866 3688 3268 ------
NM_001040284chr1651618 1359 1212 349 310 12340 ----
NM_001040402chr43541 221 148 ------
NM_001040429chr1333415 2697 1163 --127 --
NM_001040665chr724407 3287 11868 --14876
NM_001040697chr111482 ------
NM_001040712chr933537 2509 788 12555 11068 --
NM_001042403chr121261 ----1926
NM_001042453chrX31442 546 446 ------
NM_001042473chr1011884 21419 299 ----
NM_001042494chr15--1724 11143 1302
NM_001042495chr15--1724 11143 1302
NM_001042496chr15--1724 11143 1302
NM_001042497chr15--1724 11143 1302
NM_001042510chr812039 ------
NM_001042511chr812039 ------
NM_001042539chr161229 ------
NM_001042543chr411408 11298 ----
NM_001042550chr93834 664 610 ------
NM_001042555chr1223563 332 --33411 3325 1655 14072
NM_001042599chr237343 5836 1367 --24866 1441 --
NM_001042603chr1265373 4409 4228 3756 312 211 ------
NM_001042604chr344189 3538 3087 323 ------
NM_001083620chr421670 611 1817 ----
NM_001105518chr11833 1885 ----
NM_001106chr387631 6636 6265 3656 3235 1933 1668 1544 ------
NM_001122679chr511189 ------
NM_001156chr101485 ------
NM_001159chr21226 ------
NM_001160chr1222799 774 1271 1337 --
NM_001167chrX35682 4597 2057 1149 --11544
NM_001172chr141265 ------
NM_001173chr1421538 1189 --11786 13230
NM_001191chr201306 ------
NM_001204chr226544 1989 16687 --22892 963
NM_001222chr1031947 1400 688 1309 ----
NM_001257chr1621558 354 ------
NM_001282chr171316 11972 ----
NM_001289chrX21448 533 ------
NM_001293chr111359 ------
NM_001304chr17--43195 3039 2790 789 ----
NM_001310chr122332 226 --23042 1872 --
NM_001326chr111120 ------
NM_001356chrX32009 427 353 --12255 12054
NM_001357chr11266 ------
NM_001390chr18----13477 --
NM_001396chr2132187 1966 1043 ------
NM_001399chrX3544 505 98 ----12755
NM_001415chrX41794 1681 491 234 --1205 --
NM_001418chr111658 ------
NM_001418chr111658 ------
NM_001432chr42454 422 13680 13222 --
NM_001527chr644672 3102 282 104 23542 155 13649 --
NM_001530chr142853 223 ------
NM_001569chrX11310 ------
NM_001584chr11--1450 ----
NM_001604chr111227 ------
NM_001616chr213180 ----13332
NM_001650chr1823198 1317 1513 1368 1914
NM_001660chr3144 ------
NM_001663chr1442515 1753 217 139 32751 2430 325 12243 --
NM_001664chr32827 664 1306 ----
NM_001689chr241758 702 89 24 12027 ----
NM_001690chr32822 154 --1453 --
NM_001742chr73711 588 163 ------
NM_001744chr5--1141 ----
NM_001759chr1285171 4821 4415 4265 3346 1113 879 673 --24214 920 13973
NM_001806chr1932685 1902 1001 --1739 --
NM_001822chr23705 667 648 ------
NM_001830chrX1434 ------
NM_001895chr201410 ------
NM_001920chr121599 ------
NM_001955chr611022 ------
NM_001968chr42601 346 1663 ----
NM_002017chr11--1159 ----
NM_002024chrX2565 153 --11581 --
NM_002025chrX69233 6875 3571 3290 3014 2946 1945 16373 --
NM_002026chr21854 ------
NM_002032chr111158 ------
NM_002045chr3--1260 ----
NM_002063chrX11131 ------
NM_002069chr711829 ------
NM_002092chr475091 4353 3393 1801 1634 607 507 ------
NM_002126chr1714108 34033 3102 1093 ----
NM_002141chr72280 124 ------
NM_002146chr1711070 ------
NM_002149chr21750 ------
NM_002199chr4----1193 --
NM_002202chr531104 796 409 ------
NM_002229chr191490 ------
NM_002264chr343834 3163 3145 1453 14425 1577 13191
NM_002266chr17144 ------
NM_002267chr133929 521 384 ------
NM_002268chr31725 ------
NM_002271chr1332310 1999 877 --2609 251 --
NM_002285chr233378 2616 2592 --1536 --
NM_002290chr6----11344 --
NM_002298chr1331527 1451 1044 ------
NM_002336chr1234884 3944 3651 1760 ----
NM_002349chr2------1288
NM_002358chr42166 93 ------
NM_002374chr222407 52 13294 ----
NM_002451chr953505 3072 2529 2503 1314 31234 985 422 1395 --
NM_002486chr932015 441 291 ----22166 1995
NM_002489chr7--1339 ----
NM_002515chr14------21937 576
NM_002524chr11818 ------
NM_002538chr51223 ------
NM_002553chr71161 ------
NM_002556chr1121738 171 ----1715
NM_002581chr955150 3864 2020 1973 57 25402 4564 --12110
NM_002590chr131152 --1142 --
NM_002595chr1211541 --11207 1564
NM_002607chr7--11163 ----
NM_002657chr2073619 3450 3374 3220 1139 721 700 ------
NM_002709chr243542 2193 902 865 22309 808 ----
NM_002711chr7161 ------
NM_002721chr91536 1393 ----
NM_002731chr162919 2893 965 782 591 294 1498 ----
NM_002734chr1731554 736 572 12146 12089 --
NM_002745chr2243605 650 396 227 ----13141
NM_002758chr17141 ------
NM_002764chrX161 ------
NM_002765chrX21353 1145 ------
NM_002791chr14--154 ----
NM_002830chr21297 ------
NM_002836chr20----1114 --
NM_002839chr933537 2509 788 12555 11068 --
NM_002840chr1--11508 ----
NM_002844chr61269 ------
NM_002852chr3----1409 --
NM_002874chr92365 101 12276 1736 --
NM_002890chr51741 ------
NM_002894chr18170 ------
NM_002906chr1132395 1639 698 22307 892 ----
NM_002922chr11577 ------
NM_002941chr311354 ------
NM_002955chr62586 359 ------
NM_002959chr131463 414 201 1656 ----
NM_002968chr161728 ------
NM_002990chr1611745 ------
NM_002994chr411942 21759 279 ----
NM_002998chr821462 260 ------
NM_003001chr121506 458 11650 ----
NM_003010chr171120 ------
NM_003011chr941294 1188 1085 593 ------
NM_003016chr171318 ----11319
NM_003031chr161915 ------
NM_003051chr11490 1608 21879 195 --
NM_003070chr9125 1306 ----
NM_003095chr121382 ------
NM_003106chr3--1802 ----
NM_003108chr277220 6138 5453 2177 2050 1088 503 ------
NM_003111chr21339 ------
NM_003112chr742229 2212 2194 1059 ------
NM_003128chr21322 ----1774
NM_003143chr7133 ------
NM_003146chr11167 ------
NM_003155chr822846 1718 ------
NM_003161chr1722232 599 ----11096
NM_003182chr71400 ------
NM_003182chr71400 ------
NM_003185chr2021028 891 1431 ----
NM_003194chr6172 ------
NM_003199chr1834982 1741 469 ------
NM_003201chr10--1102 ----
NM_003211chr1211511 ------
NM_003243chr111001 1384 ----
NM_003255chr1732325 1948 300 11734 ----
NM_003257chr151217 ------
NM_003262chr3158 24614 4055 3710 182 170 --
NM_003269chr611119 1381 ----
NM_003286chr201366 ------
NM_003298chr345944 4477 1945 81 11269 ----
NM_003319chr21295 ------
NM_003320chr1134481 1710 1452 11046 ----
NM_003339chr511203 11241 ----
NM_003340chr4----1511 --
NM_003341chr31636 191 --1187
NM_003344chr731111 362 220 ------
NM_003358chr91113 ------
NM_003359chr42931 44 ------
NM_003368chr11113 ----155
NM_003369chr11--12767 11048 --
NM_003375chr101417 ------
NM_003376chr621745 461 11567 ----
NM_003376chr621745 461 11567 ----
NM_003385chr21719 ------
NM_003387chr252781 2207 1955 664 491 21996 1946 ----
NM_003406chr851295 727 383 278 264 ------
NM_003409chr1821293 464 ------
NM_003410chrX31955 1948 35 22148 1120 --1364
NM_003412chr342571 2451 2242 228 3977 833 218 2636 315 --
NM_003413chrX32011 1943 204 ------
NM_003452chr92876 866 1209 ----
NM_003453chr131607 ------
NM_003468chr263140 3009 1222 805 333 60 2937 290 ----
NM_003472chr621481 601 ------
NM_003489chr2142314 2185 212 132 13018 ----
NM_003505chr721775 1761 ------
NM_003506chr81489 1296 ----
NM_003558chr91472 ------
NM_003574chr1874359 4102 3694 1826 1806 1348 1065 11098 182 12221
NM_003581chr2----1908 --
NM_003583chr1243188 2672 2575 322 11323 ----
NM_003589chr1321456 961 ------
NM_003628chr21477 ------
NM_003631chr102779 165 ------
NM_003633chr532282 597 586 ------
NM_003659chr21341 ------
NM_003663chr322613 2163 12909 22297 809 --
NM_003664chr51415 ------
NM_003670chr341189 968 227 202 ------
NM_003671chr91844 ------
NM_003672chr121568 255 1288 ----
NM_003690chr21467 ------
NM_003713chr121125 232 ------
NM_003716chr31332 ------
NM_003718chr71427 ------
NM_003750chr101319 1680 ----
NM_003757chr11380 1387 ----
NM_003763chr2043062 1288 1064 439 ------
NM_003774chr1232909 214 148 11031 12820 11195
NM_003783chr111099 ------
NM_003787chr18--1542 ----
NM_003794chr3--1396 ----
NM_003798chr9--1186 ----
NM_003816chr81324 ------
NM_003819chr11262 ------
NM_003825chr1531531 1375 231 --11470 --
NM_003861chr1482774 2335 2186 1872 1034 1024 546 191 ------
NM_003902chr13637 550 208 ------
NM_003939chr1073750 3304 3169 1558 1456 924 319 12928 ----
NM_003941chr732129 1982 759 1983 1631 --
NM_003948chr432419 1870 773 ------
NM_003980chr621255 985 ----1369
NM_003983chr1643200 1579 1277 351 1292 --1152
NM_003994chr1263688 3017 2777 1243 706 39 1553 1789 --
NM_004027chr2193 ------
NM_004028chr1823198 1317 1513 1368 1914
NM_004034chr101485 ------
NM_004047chr11275 ------
NM_004056chr81878 ------
NM_004067chr72962 488 --11393 1322
NM_004075chr12139 1204 1476 1181
NM_004096chr1021317 678 1762 ----
NM_004124chr1451360 1211 1185 973 658 ----1209
NM_004161chr2----1322 11000
NM_004171chr1199353 7483 6536 6476 2950 1850 1357 1029 878 --17903 11412
NM_004183chr111508 ------
NM_004186chr31137 ------
NM_004228chr19--1153 ----
NM_004232chr1823447 2518 1889 33076 2635 786 --
NM_004241chr101727 2630 295 ----
NM_004261chr11294 3897 664 175 1965 --
NM_004280chr61303 ------
NM_004281chr101109 ------
NM_004293chr923421 1312 1631 --12915
NM_004301chr3----1304 --
NM_004346chr4164 ------
NM_004397chr1144162 3972 3625 3155 11516 14178 --
NM_004415chr61559 ------
NM_004437chr112833 32579 2450 594 23518 3093 --
NM_004438chr211186 ------
NM_004440chr611497 --2650 587 --
NM_004450chr14--1384 ----
NM_004454chr32818 171 1868 1148 --
NM_004457chr21391 ------
NM_004459chr171130 ------
NM_004474chr111039 ------
NM_004501chr134051 3831 2529 11647 1582 --
NM_004504chr21236 12814 1200 12937
NM_004505chr171609 169 --11943
NM_004529chr911265 ------
NM_004586chrX55247 4069 1324 910 25 ------
NM_004603chr711142 ------
NM_004630chr112362 45 ------
NM_004634chr31522 ------
NM_004654chrY----1536 11276
NM_004660chrY3425 351 194 ----11936
NM_004663chr151330 ------
NM_004666chr62210 69 ------
NM_004680chrY1126 ------
NM_004687chr1741624 618 600 136 ----11871
NM_004690chr61254 --1725 --
NM_004701chr152155 53 ------
NM_004703chr171504 ----12276
NM_004713chr14--1645 ----
NM_004726chrX55396 3591 2032 1115 476 22175 680 --11514
NM_004730chr521503 290 --11381 --
NM_004736chr142264 2090 1486 412 ------
NM_004738chr203663 317 34 --1307 --
NM_004739chr111627 ------
NM_004745chr875924 5762 4940 4677 2206 1632 1228 16800 12068 --
NM_004788chr1122229 2114 --1666 --
NM_004801chr211523 ------
NM_004815chr164960 4212 3858 3489 1344 448 1154 --1541
NM_004822chr1711591 ------
NM_004849chr621511 405 --1547 --
NM_004850chr221483 214 ------
NM_004866chr564827 3853 3613 3425 872 461 --13408 --
NM_004869chr1811741 ------
NM_004871chr1764403 3482 3206 3160 2878 2759 ------
NM_004872chr1----1163 --
NM_004873chr1443134 3087 2400 487 ------
NM_004898chr42449 143 --12070 12349
NM_004912chr71648 1596 ----
NM_004921chr11144 22025 1941 ----
NM_004922chr1021012 873 ------
NM_004949chr1812069 ------
NM_004952chr11244 ------
NM_004964chr11415 ------
NM_004982chr121489 ------
NM_004985chr1232871 1088 422 ------
NM_004999chr612872 1970 ----
NM_005000chr72713 139 11043 ----
NM_005010chr742106 1956 1472 487 ------
NM_005011chr71195 11344 ----
NM_005054chr221359 381 1680 ----
NM_005056chr1265617 4653 4472 4000 556 455 ------
NM_005065chr1444844 3585 1822 607 --15204 --
NM_005095chr122040 204 1396 137 --
NM_005113chr142459 28 ------
NM_005131chr18--184 ----
NM_005135chr15--1724 11143 1302
NM_005156chr912101 31161 1129 949 ----
NM_005157chr911793 ------
NM_005188chr1166547 5217 2220 1803 745 735 ------
NM_005190chr6--1767 ----
NM_005222chr71861 ------
NM_005233chr3--11792 --12482
NM_005235chr237343 5836 1367 --24866 1441 --
NM_005254chr15--11202 ----
NM_005257chr181446 ------
NM_005259chr221009 169 1472 --1393
NM_005277chr4140 ------
NM_005295chr71105 ------
NM_005296chrX--1331 ----
NM_005358chr131163 11552 ----
NM_005359chr1822281 1062 16188 34517 1928 1193 --
NM_005400chr232061 732 550 ----1274
NM_005414chr3--168 ----
NM_005417chr2011991 ------
NM_005436chr1083006 2854 2587 1244 1007 976 275 268 ------
NM_005465chr121246 571 ------
NM_005487chr2241988 1438 633 229 --1625 --
NM_005504chr1255755 2650 1920 1421 202 14008 ----
NM_005539chr101222 ------
NM_005544chr2------1870
NM_005596chr936041 1892 460 12383 ----
NM_005611chr1611010 ------
NM_005626chr1154 ------
NM_005643chr63745 78 46 ------
NM_005668chr511125 23444 3271 ----
NM_005700chr111115 ------
NM_005734chr111175 ------
NM_005738chr72462 223 ------
NM_005746chr732243 2189 934 ------
NM_005748chr1223191 994 1801 1327 1263
NM_005754chr52358 74 1831 ----
NM_005776chr142738 22 ------
NM_005786chr181817 ----1852
NM_005813chr21511 22559 1918 ----
NM_005819chr11362 33187 3051 2980 1728 --
NM_005841chr41384 ------
NM_005843chr211299 ------
NM_005852chr1711143 ------
NM_005862chr3----1794 --
NM_005871chr101120 ------
NM_005880chr16----1139 --
NM_005882chr4----1198 --
NM_005896chr2--140 ----
NM_005898chr111455 --3893 815 683 --
NM_005899chr1721295 478 --1568 --
NM_005901chr1866971 5385 3474 1721 1585 903 25421 5413 16597 --
NM_005902chr1533014 1252 936 11623 11480 --
NM_005904chr1811431 ------
NM_005917chr21139 ------
NM_005935chr454841 3292 1669 787 169 1445 ----
NM_005941chr811382 ------
NM_005955chr145227 4540 3418 1614 --23553 987 --
NM_005966chr212272 ----1495
NM_005977chr13--1260 ----
NM_005994chr17----1650 --
NM_005999chr11375 11042 ----
NM_006007chr933239 565 539 13442 ----
NM_006015chr1--11348 ----
NM_006016chr631602 732 343 ------
NM_006047chr2083496 2770 1219 1108 392 301 233 142 11264 ----
NM_006090chr1------1137
NM_006095chr454449 3838 2746 408 343 ------
NM_006141chr1642658 2444 1008 147 --12512 1347
NM_006186chr2----1795 --
NM_006195chr9--1136 ----
NM_006196chr21343 ------
NM_006197chr811801 1264 ----
NM_006251chr523277 3080 11223 ----
NM_006252chr137307 6886 4734 36405 5687 337 ----
NM_006265chr81280 ------
NM_006267chr221463 441 1427 ----
NM_006292chr11--1149 ----
NM_006317chr51722 ------
NM_006323chr41233 1140 ----
NM_006328chr111516 ------
NM_006352chr112050 ------
NM_006363chr201210 ------
NM_006380chr1732982 1016 664 1884 ----
NM_006401chr9142 1185 ----
NM_006420chr2042943 2619 315 99 11160 --13322
NM_006451chr511001 ------
NM_006469chr111013 11492 ----
NM_006482chr1243188 2672 2575 322 11323 ----
NM_006489chr14------21937 576
NM_006496chr131860 1693 523 ----11825
NM_006503chr191106 ------
NM_006529chr421731 1399 11289 ----
NM_006544chr1445196 3764 1310 1110 1707 35271 4120 3926 12409
NM_006561chr1045409 3981 974 860 --1386 --
NM_006572chr1723331 3155 1829 12956 --
NM_006599chr1676575 5930 2430 1514 1442 1332 488 --12022 26479 2937
NM_006654chr1223563 332 --33411 3325 1655 14072
NM_006658chr721065 42 ------
NM_006699chr122652 788 22033 972 ----
NM_006717chr911336 1249 ----
NM_006722chr332936 1965 877 --1483 --
NM_006746chrX21295 1056 ------
NM_006754chr71114 ------
NM_006766chr8----12198 --
NM_006769chr11164 ------
NM_006811chr2011006 ------
NM_006813chr61595 --169 --
NM_006815chr1231361 1067 978 --1195 --
NM_006822chr17--1251 ----
NM_006832chr141966 ------
NM_006838chr1211670 ----11876
NM_006851chr1212767 ------
NM_006885chr1653804 3026 1437 1375 273 23001 2795 ----
NM_006888chr1443136 2842 470 177 12690 ----
NM_006897chr121198 ------
NM_006915chrX2622 27 1597 --12425
NM_006916chr21171 ------
NM_006924chr1763051 2913 1599 1172 1014 947 21684 645 1522 13699
NM_006939chr14------1969
NM_006948chr2112337 ----2854 767
NM_006963chr1021204 497 ------
NM_006997chr101188 ------
NM_007045chr61105 2475 462 ----
NM_007050chr2057003 5305 2889 2308 1340 1334 12582 27571 2260
NM_007054chr533251 2848 1548 --23951 3240 --
NM_007099chr24829 779 643 173 ------
NM_007126chr91212 ------
NM_007159chr331397 1314 295 ------
NM_007174chr1242114 1948 562 383 21787 1490 ----
NM_007217chr31301 ------
NM_007236chr1531677 558 519 21801 645 12365 --
NM_007287chr322854 709 12654 ----
NM_007288chr322854 709 12654 ----
NM_007289chr322854 709 12654 ----
NM_007313chr911793 ------
NM_007363chrX1995 ------
NM_007372chr17--158 ----
NM_007373chr1011228 --191 --
NM_007375chr132230 109 25 22743 895 --1254
NM_012073chr5--1138 ----
NM_012081chr533375 3315 1438 ------
NM_012082chr82178 28 ------
NM_012090chr111104 ------
NM_012104chr1133610 516 385 ----13063
NM_012104chr1133610 516 385 ----13063
NM_012110chr4190 ------
NM_012115chr61414 ------
NM_012141chr1364006 2632 2625 835 722 103 12641 ----
NM_012155chr191196 ------
NM_012157chr32975 314 --1282 --
NM_012160chr62424 61 ------
NM_012161chr421154 344 1280 ----
NM_012164chr997510 7075 2409 1398 1059 625 611 343 299 26128 5873 ----
NM_012176chr5--1240 ----
NM_012193chr1134339 4128 1373 34640 988 365 --11277
NM_012197chr941645 1376 599 133 ------
NM_012214chr276230 5821 5285 2327 2080 2069 258 34680 4647 4545 11019 --
NM_012223chr2--1121 21164 1008 --
NM_012234chr322824 2309 --13059 --
NM_012238chr10--1129 ----
NM_012250chr11180 ------
NM_012257chr71388 ----1904
NM_012262chr154620 4494 3729 3617 448 ------
NM_012287chr354210 4101 3535 3065 102 1496 13680 --
NM_012308chr1122239 1839 ------
NM_012316chr133710 2028 1204 ------
NM_012330chr103209 120 96 11413 ----
NM_012338chr71496 ------
NM_012383chr9--183 ----
NM_012395chr722888 2800 --13256 --
NM_012416chr91457 ------
NM_012464chr412924 --181 1733
NM_013229chr1222799 774 1271 1337 --
NM_013255chr746485 5429 3066 2442 28762 2747 36169 685 222 --
NM_013257chr822219 538 --2729 434 --
NM_013261chr4--13174 ----
NM_013341chr212642 ----11047
NM_013346chrX150 ------
NM_013354chr821345 1048 ------
NM_013377chr121626 ------
NM_013396chr2121496 391 ------
NM_013410chr1163 ------
NM_013423chrX1296 1994 ----
NM_013427chrX1296 1994 ----
NM_013450chr22876 198 ------
NM_013943chr1--12731 --12300
NM_013989chr1455092 4750 3326 413 94 11651 1582 --
NM_013996chr71400 ------
NM_013996chr71400 ------
NM_013997chr71400 ------
NM_013997chr71400 ------
NM_013998chr71400 ------
NM_013998chr71400 ------
NM_014005chr5------12201
NM_014007chr92501 429 ------
NM_014011chr211886 ------
NM_014028chr623190 1129 22678 777 ----
NM_014038chr71363 ------
NM_014043chr311150 1575 ----
NM_014106chr1562865 2553 2325 2069 772 573 ----1485
NM_014112chr855342 1276 1085 881 537 ------
NM_014210chr17161 ------
NM_014243chr41789 11379 ----
NM_014250chr2241988 1438 633 229 --1625 --
NM_014282chr911287 ------
NM_014283chr121015 969 --11091 --
NM_014284chr111108 ------
NM_014302chr7139 ------
NM_014323chr221223 ------
NM_014325chr12167 ------
NM_014331chr476514 6327 5449 5180 5146 2384 793 125 ----
NM_014333chr1132754 2458 2352 --12233 --
NM_014361chr11--143 ----
NM_014372chr111375 ----11914
NM_014423chr565066 1599 1506 674 484 170 14940 ----
NM_014432chr61165 --11323 --
NM_014496chrX1227 ------
NM_014504chr722092 1982 1301 ----
NM_014515chr121134 ----1407
NM_014516chr19--1226 ----
NM_014522chrX1127 ------
NM_014584chr1411659 --1623 --
NM_014614chr211284 ----1968
NM_014635chr221327 345 1644 ----
NM_014646chr1842840 2475 2299 1258 12912 ----
NM_014647chr1611654 ------
NM_014667chr342426 1729 348 173 --21591 972 --
NM_014678chr22------1126
NM_014682chr82935 911 1845 ----
NM_014685chr161176 ------
NM_014702chr61742 --1576 --
NM_014705chr722011 1335 --1630 --
NM_014715chr112932 618 ------
NM_014719chr711115 ------
NM_014721chr655556 5218 5051 1691 583 --11626 1944
NM_014729chr82641 335 ----1529
NM_014730chr12105153 4925 4817 4533 4517 4407 3551 1397 917 60 --14247 --
NM_014730chr12105153 4925 4817 4533 4517 4407 3551 1397 917 60 --14247 --
NM_014733chr5----11823 --
NM_014738chr171952 ------
NM_014739chr664178 4054 3265 1451 1059 872 12771 13138 --
NM_014743chr4--12216 --1126
NM_014764chr121388 ------
NM_014765chr131945 1662 57 12513 12618 --
NM_014787chr112212 ------
NM_014793chr151599 1152 ----
NM_014800chr7--1100 ----
NM_014810chr112405 13418 12536 --
NM_014829chr532161 2126 1680 1145 ----
NM_014840chr1273313 3294 3261 3247 3208 1118 226 13161 1117 --
NM_014872chr922253 1618 159 ----
NM_014873chr164169 3234 3072 2965 1404 452 14796 33581 3572 939 --
NM_014877chr1766107 5571 2411 1591 974 686 11250 ----
NM_014897chr1792665 2641 2433 2316 2050 1272 866 853 601 ------
NM_014903chr1212382 ----1881
NM_014904chr10----13603 --
NM_014912chr101254 ----11013
NM_014947chr132931 2069 658 12406 --1742
NM_014982chr1424212 1997 15376 ----
NM_014989chr611926 ------
NM_014990chr1421110 917 --11209 --
NM_014991chr412815 12863 ----
NM_014997chr72150 94 ------
NM_015000chr1242170 491 168 65 12836 ----
NM_015011chr13----1463 --
NM_015026chr1274154 3786 3778 3339 901 116 104 ------
NM_015027chr1621342 127 21745 355 1717 --
NM_015032chr1321918 467 ------
NM_015040chr2--13109 ----
NM_015042chr1534308 3154 1409 11194 23401 516 --
NM_015045chr101271 ----11640
NM_015068chr743411 2718 2540 1018 ------
NM_015100chr131843 293 223 ------
NM_015110chr932317 2103 227 12521 1592 --
NM_015115chr43541 221 148 ------
NM_015132chr73733 433 375 --21469 652 --
NM_015144chr1613703 ----11389
NM_015153chr62148 115 ----1313
NM_015155chr102544 454 --1292 13294
NM_015156chr1462919 1196 849 616 439 184 1867 23250 2508 --
NM_015176chr11502 11515 ----
NM_015192chr2032226 790 783 ------
NM_015196chr42104 91 ------
NM_015206chr1533878 3553 1457 ------
NM_015208chr1851311 1165 1058 436 253 11604 1584 --
NM_015225chr93817 720 642 13092 ----
NM_015245chr611982 ------
NM_015252chr21797 1389 1276 --
NM_015263chr151883 ------
NM_015271chr443802 3744 3647 112 23281 2632 11532 --
NM_015285chr1811761 ----12398
NM_015313chr1144245 3876 1576 880 11360 23506 917 --
NM_015317chr232759 2620 2392 12635 --12330
NM_015326chr151030 764 757 366 168 ------
NM_015339chr201317 ------
NM_015354chr9--1373 ----
NM_015355chr17------11525
NM_015378chr122638 228 11114 --1852
NM_015387chr21391 1265 ----
NM_015393chr422489 119 13638 --13690
NM_015446chr141214 604 588 332 ------
NM_015464chr71971 ------
NM_015509chr1211648 ------
NM_015517chr11--1534 ----
NM_015532chr1562569 2555 2409 2045 1964 243 ------
NM_015559chr1831071 804 752 ------
NM_015565chr21----11638 --
NM_015569chr134720 4317 854 13837 --11634
NM_015571chr612223 1726 11672 --
NM_015575chr273284 2989 2889 2707 2664 2447 462 ----13661
NM_015626chr1711114 ------
NM_015640chr174996 2116 1523 1061 954 817 787 --1222 --
NM_015693chr41252 ------
NM_015878chr812044 2739 111 ----
NM_015891chr6--11428 --1245
NM_015902chr81198 ------
NM_015906chr154501 3027 1002 341 326 ----1917
NM_015912chr811929 128 --1644
NM_015975chrX----11773 --
NM_015995chr1545231 4142 2144 1937 ------
NM_016009chr134471 1457 745 24639 1529 13707 13676
NM_016021chr612244 ------
NM_016025chr1631469 557 512 ------
NM_016045chr201527 ------
NM_016096chr812039 ------
NM_016121chr111044 ------
NM_016156chr1121948 312 11475 11454 --
NM_016157chrX164 ------
NM_016200chr73656 569 193 ------
NM_016206chr399046 7872 7589 6951 6687 5650 5600 2384 824 ------
NM_016227chr121015 969 --11091 --
NM_016231chr1711312 ------
NM_016248chr1323550 2526 --1537 --
NM_016252chr21375 --1224 --
NM_016260chr226844 2105 12884 --15723
NM_016264chr192461 31 ------
NM_016284chr161909 ------
NM_016287chr121971 181 11565 ----
NM_016298chr31268 42310 1140 948 669 ----
NM_016308chr121504 1298 21882 469 ----
NM_016396chr1522547 1074 ------
NM_016423chr141397 ------
NM_016424chr1731489 405 383 --1413 --
NM_016441chr222407 340 12074 ----
NM_016485chr621443 34 --1683 --
NM_016507chr1742589 2453 1951 184 ----12016
NM_016519chr42464 430 ------
NM_016531chr421527 1146 23588 1363 ----
NM_016542chrX31442 546 446 ------
NM_016577chr3104407 4240 4055 3274 3265 3259 3151 1488 550 61 1815 12791 --
NM_016578chr11--1236 ----
NM_016603chr522139 641 ------
NM_016617chr1322181 614 --21553 48 --
NM_016620chr111400 ------
NM_016626chr181394 ----1542
NM_016651chr14--1958 ----
NM_016654chr15--11202 ----
NM_016937chrX2853 800 ----1906
NM_017420chr1442949 2661 909 30 --11013 --
NM_017423chr4--22063 261 11773 --
NM_017431chr21696 ------
NM_017447chr2131524 1410 40 ------
NM_017457chr19--1153 ----
NM_017545chr201497 1433 ----
NM_017548chr312164 21832 768 ----
NM_017563chr385995 5685 4906 4147 1719 1247 890 381 ------
NM_017626chr1011688 ------
NM_017633chr633205 2698 1356 1147 ----
NM_017635chr112574 558 ------
NM_017637chr999203 8914 7136 6976 6672 3771 3553 1424 1063 16869 19282 --
NM_017643chr1742510 997 547 405 32934 2271 308 --12693
NM_017650chr735204 5051 4283 45027 4874 2164 1978 --15445
NM_017651chr6----1241 21401 395
NM_017655chr131511 494 480 1150 ----
NM_017657chr2--1126 ----
NM_017666chrX21645 227 --11846 11960
NM_017672chr1531162 501 24 188 1365 --
NM_017673chr11833 1885 ----
NM_017709chr143141 2952 2695 401 --12889 --
NM_017719chr322571 1022 2956 900 --11822
NM_017748chr17123 ------
NM_017769chr1442276 904 442 204 --1962 --
NM_017780chr81286 --1295 --
NM_017786chr82451 113 ------
NM_017799chr1421507 330 ----11777
NM_017813chr875849 5076 3723 2296 1977 1659 77 --14355 14493
NM_017848chrX64625 4051 3775 3369 1500 599 --13310 --
NM_017945chr311387 ------
NM_017987chr102330 112 1897 ----
NM_017994chr71184 ------
NM_018009chr12------1143
NM_018026chr1111450 ------
NM_018030chr181168 ------
NM_018036chr1434232 3959 3243 23912 718 13505 --
NM_018043chr11--11039 ----
NM_018084chr232568 830 520 13191 11029 --
NM_018121chr1042804 1203 894 636 32362 2327 807 ----
NM_018126chr42495 156 ----1345
NM_018133chr321378 522 22047 271 ----
NM_018149chr173213 73 52 ------
NM_018155chr323371 501 12806 1369 --
NM_018156chr122638 228 11114 --1852
NM_018171chr121828 ------
NM_018184chr31353 ----12043
NM_018206chr16--1191 ----
NM_018211chr111437 1691 11640 --
NM_018221chr21442 ------
NM_018241chr41176 ------
NM_018243chr424006 3289 33999 2663 1126 23246 996 --
NM_018268chr51617 ----196
NM_018287chr10--1313 --1885
NM_018293chr312751 13008 ----
NM_018299chr833118 341 332 --1662 13285
NM_018312chr1122127 837 --1627 1578
NM_018313chr322520 257 ------
NM_018314chr111634 ------
NM_018360chrX172 ------
NM_018364chr143534 2963 2637 926 1315 13826 --
NM_018374chr711039 ------
NM_018388chrX11234 1271 ----
NM_018403chr331527 1327 781 ------
NM_018416chr1272470 2195 1624 790 753 512 256 ------
NM_018427chr16----1506 --
NM_018439chr1832514 1747 643 ------
NM_018442chr11143 ------
NM_018444chr852262 2081 1893 1549 854 ------
NM_018445chr151194 ------
NM_018451chr132791 280 ------
NM_018452chr6_random11324 ------
NM_018490chr111189 11734 ----
NM_018555chr1911547 1574 11740 --
NM_018566chr154654 3537 843 813 617 24176 1856 13642 --
NM_018657chr3--1819 139 --
NM_018696chr182389 143 ----1344
NM_018710chr811220 152 ----
NM_018834chr511021 ------
NM_018841chr113560 2223 89 ----
NM_018898chr532358 655 448 --22368 477 --
NM_018899chr532358 655 448 --22368 477 --
NM_018900chr532358 655 448 --22368 477 --
NM_018901chr532358 655 448 --22368 477 --
NM_018902chr532358 655 448 --22368 477 --
NM_018903chr532358 655 448 --22368 477 --
NM_018904chr532358 655 448 --22368 477 --
NM_018905chr532358 655 448 --22368 477 --
NM_018906chr532358 655 448 --22368 477 --
NM_018907chr532358 655 448 --22368 477 --
NM_018908chr532358 655 448 --22368 477 --
NM_018909chr532358 655 448 --22368 477 --
NM_018910chr532358 655 448 --22368 477 --
NM_018911chr532358 655 448 --22368 477 --
NM_018945chr62657 435 12675 13687 --
NM_018970chr752497 2096 744 697 578 12419 --11188
NM_018976chr1212640 12847 1553 11925
NM_018999chr1034940 3046 376 24746 203 13761 --
NM_019001chr344189 3538 3087 323 ------
NM_019004chr722171 713 12228 ----
NM_019042chr711098 ------
NM_019063chr21705 11524 ----
NM_019083chr1--1139 --1251
NM_019091chr21999 ------
NM_019593chr2032489 2077 223 ------
NM_019597chrX1550 ----1104
NM_019854chr121133 ------
NM_020116chr42376 184 ------
NM_020123chr1011025 ------
NM_020135chr6------1371
NM_020144chr72653 132 1357 ----
NM_020156chr7----1546 --
NM_020177chr533188 158 123 ----143
NM_020180chr181842 ------
NM_020182chr2013182 ------
NM_020184chr222228 1862 ----12335
NM_020193chr111461 ------
NM_020199chr5----188 --
NM_020235chr3--1294 ----
NM_020245chr624641 1953 ------
NM_020310chr1712096 1197 ----
NM_020337chr421279 590 --12214 --
NM_020357chr311325 11358 ----
NM_020432chr721429 278 1438 --1294
NM_020466chr633986 3073 814 14329 ----
NM_020529chr141462 1451 ----
NM_020640chr352101 2014 1905 1727 366 ------
NM_020673chr2021459 234 11243 31597 1044 672 17090
NM_020689chr2021563 1115 ------
NM_020711chr252223 2109 719 538 385 12046 ----
NM_020717chrX34196 3663 1568 ------
NM_020718chr1656297 5762 5328 4509 1774 12522 --14449
NM_020734chr1253027 2922 2200 2152 952 --1627 --
NM_020752chr101585 22884 220 ----
NM_020766chrX23775 2790 43989 3894 3540 2987 ----
NM_020772chr1747881 6418 3002 815 12824 ----
NM_020779chr232680 1242 1165 ------
NM_020803chr412075 ------
NM_020809chr1121766 237 ------
NM_020819chr61305 ----1762
NM_020832chr11549 ------
NM_020841chr1222745 1040 22722 1600 --21489 1469
NM_020856chr1921412 90 --11475 11286
NM_020870chr432109 1451 669 --1120 --
NM_020872chr31554 ------
NM_020917chr1953049 2848 2600 2584 611 11547 --23301 3276
NM_020925chr111391 ------
NM_020959chr191110 ------
NM_020981chr22525 64 ------
NM_021045chr1051905 1609 898 523 34 11030 ----
NM_021072chr532519 2162 2113 ------
NM_021133chr12696 629 156 1450 --
NM_021136chr141601 ------
NM_021151chr71333 168 ----
NM_021155chr1911909 ------
NM_021165chr11263 ------
NM_021177chr6137 ------
NM_021183chrX1505 1112 ----
NM_021190chr11359 ------
NM_021252chr104829 717 606 372 ------
NM_021255chr1433013 1463 1263 ------
NM_021620chr62690 585 ------
NM_021622chr1041990 796 724 419 ------
NM_021647chr494696 4001 3906 3626 1683 1554 974 562 284 1300 ----
NM_021728chr144992 881 234 77 1857 ----
NM_021911chr545601 3759 1350 636 13555 ----
NM_021912chr1544146 3698 3558 3540 ------
NM_021914chr1432260 1971 401 21900 457 ----
NM_021946chrX1477 ------
NM_021961chr1177176 7098 5675 5620 4727 2345 629 --22651 987 --
NM_021964chr356449 4752 1796 941 726 25540 1037 12073 --
NM_022037chr211028 ------
NM_022041chr1632696 2097 109 22299 384 ----
NM_022048chr1556327 6226 4430 659 183 1976 ----
NM_022080chr2052703 1791 1109 1076 391 --2808 278 --
NM_022105chr201590 ------
NM_022114chr131479 840 212 21216 448 ----
NM_022118chr13--199 ----
NM_022130chr521258 106 --21089 222 --
NM_022173chr211028 ------
NM_022462chr1933802 3643 1517 ------
NM_022473chr1544401 3402 310 54 ------
NM_022483chr551442 1358 1205 715 679 ------
NM_022488chr3134 ------
NM_022650chr51741 ------
NM_022716chr153040 2851 2086 824 647 ------
NM_022728chr7----185 1572
NM_022735chr12721 115 ------
NM_022745chr1--1108 11920 --
NM_022756chr111309 --11424 --
NM_022771chr12185 ------
NM_022781chr973036 2739 2683 2650 2603 2046 748 13328 --12364
NM_022784chr151233 ------
NM_022893chr243139 2885 2405 2356 ------
NM_022898chr1464602 4281 3564 3408 2936 257 ------
NM_022912chr21484 1315 ----
NM_022918chr1142160 1650 1515 673 11555 1462 --
NM_023009chr1--1560 ----
NM_023079chr1741919 1535 1201 190 2733 281 --11331
NM_023925chr12188 ------
NM_023929chr842721 2245 865 510 12794 11976 --
NM_024050chr191241 ------
NM_024077chr91587 ------
NM_024345chr92466 388 --1459 14028
NM_024408chr133619 2839 629 ------
NM_024423chr1832656 1480 1158 14294 ----
NM_024496chr141250 ------
NM_024529chr11244 ------
NM_024665chr31612 ----11863
NM_024713chr1511497 1287 ----
NM_024770chr296635 6344 5650 4903 4776 2657 2639 2248 1799 ------
NM_024899chr181459 ------
NM_024945chr92817 405 ------
NM_024947chr3109190 8254 7503 7082 6744 6074 3605 2562 1595 849 ----1200
NM_024949chr4--1103 ----
NM_024989chr256849 4982 2871 2380 522 1606 12929 --
NM_024993chr2--11190 ----
NM_025054chr843307 966 157 58 1547 11125 --
NM_025057chr142532 143 ----1191
NM_025079chr11170 ------
NM_025106chr111582 ------
NM_025133chr211018 ------
NM_025138chr131429 ------
NM_025151chr822027 436 --11986 --
NM_025160chr154289 4114 3089 3010 2850 ------
NM_025179chr144566 4345 4289 1989 13150 13304 --
NM_025191chr142954 2857 935 22 ------
NM_025208chr111304 ------
NM_025222chr31284 ------
NM_030571chr511245 ----1586
NM_030621chr1432909 1060 593 ------
NM_030627chr533196 2868 1113 ------
NM_030634chr122453 1529 11925 ----
NM_030647chr765771 5723 4002 2452 1293 285 15187 ----
NM_030664chr1011670 --11873 1794
NM_030751chr1011507 ----1443
NM_030751chr1011507 ----1443
NM_030766chr122939 286 --11047 --
NM_030780chr821249 284 ------
NM_030806chr165754 3566 2912 2576 2348 672 16735 23770 2970 --
NM_030816chr11943 13059 12314 --
NM_030934chr111732 ------
NM_030945chr532301 250 116 11848 ----
NM_030949chr6--1374 ----
NM_031267chr71427 ------
NM_031283chr2184 ------
NM_031411chr532358 655 448 --22368 477 --
NM_031419chr31189 ----192
NM_031427chr1434823 4560 4072 25865 4766 ----
NM_031435chr1232987 792 348 12617 22746 445 --
NM_031439chr81302 11776 ----
NM_031468chr787904 7469 6783 6035 5656 3099 1976 186 16889 22399 639 --
NM_031469chr612946 ------
NM_031483chr2013322 2409 370 13411 --
NM_031844chr134051 3831 2529 11647 1582 --
NM_031845chr222407 52 13294 ----
NM_031847chr222407 52 13294 ----
NM_031849chr532358 655 448 --22368 477 --
NM_031857chr532358 655 448 --22368 477 --
NM_031858chr1721295 478 --1568 --
NM_031860chr532358 655 448 --22368 477 --
NM_031862chr1721295 478 --1568 --
NM_032028chr5--1146 ----
NM_032047chr321893 837 ------
NM_032050chr221223 ------
NM_032102chr11------1323
NM_032105chr125518 2919 15347 ----
NM_032147chr121261 ----1926
NM_032151chr5--1484 ----
NM_032154chr101307 ----11039
NM_032156chr12188 ------
NM_032160chr1863813 3422 3413 3366 2991 1168 ------
NM_032186chr111400 ------
NM_032199chr1023480 2689 12995 32847 2813 1168 --
NM_032228chr1122474 426 12434 ----
NM_032271chr16--11428 ----
NM_032312chr2------1316
NM_032357chr21721 ------
NM_032410chr8----1892 --
NM_032434chr221244 1185 11604 11502 --
NM_032439chr10154 11393 ----
NM_032440chr10------12886
NM_032457chr421071 1053 12972 11171 --
NM_032458chrX33368 2397 2350 11059 23416 1182 --
NM_032505chr332606 1714 795 --11001 --
NM_032547chr421304 457 11189 ----
NM_032557chr41292 ------
NM_032558chr911458 ------
NM_032575chr1611873 ------
NM_032622chr41328 ------
NM_032632chr141662 ------
NM_032682chr352614 2393 2280 1453 250 ------
NM_032689chr1931530 185 141 ------
NM_032801chr1132532 2190 602 ------
NM_032804chr10------1481
NM_032857chr151172 ------
NM_032859chr1312736 22952 576 13997 --
NM_032870chr61104 ------
NM_032873chr1124320 4051 13263 22981 2917 --
NM_032884chr1182 1304 ----
NM_032906chr4--1667 ----
NM_032949chr131152 --1142 --
NM_032975chr18----13477 --
NM_032980chr18----13477 --
NM_032991chr4164 ------
NM_033020chr154501 3027 1002 341 326 ----1917
NM_033023chr7--11139 ----
NM_033044chr111104 ------
NM_033089chr201177 ------
NM_033117chr92250 37 1125 ----
NM_033132chr1312254 ------
NM_033135chr111304 ------
NM_033161chr941710 1702 1356 640 1117 1365 11497
NM_033224chr766797 1962 1772 1028 954 887 33189 2804 1285 15906 --
NM_033254chr3----184 --
NM_033331chr91844 ------
NM_033360chr1242992 2812 1209 543 ------
NM_033389chr1734519 1106 85 13530 ----
NM_033407chr1--1535 ----
NM_033425chr1122481 389 13085 ----
NM_033426chr1462750 2661 2649 2564 2066 2052 11843 --11144
NM_033427chr71600 ------
NM_033430chr42342 98 ------
NM_033437chr42342 98 ------
NM_033503chr1542527 2481 1388 739 --13868 --
NM_033535chr421154 344 1280 ----
NM_033637chr1073750 3304 3169 1558 1456 924 319 12928 ----
NM_052834chr1811761 ----12398
NM_052885chr1271402 1328 1058 909 802 442 62 14726 ----
NM_052886chr811898 --1439 1361
NM_052911chr183766 369 54 ------
NM_052923chr6132 ------
NM_052932chr1142483 2397 1924 291 ------
NM_052971chr51150 ------
NM_053002chr321079 286 ------
NM_053023chr1132726 2096 506 ------
NM_053024chr31231 ------
NM_053064chr1422349 249 12912 ----
NM_054016chr11343 ------
NM_054016chr11343 ------
NM_054016chr11343 ------
NM_057175chr412242 ------
NM_058170chr11401 --1565 11129
NM_080546chr911613 ----12023
NM_080597chr181168 ------
NM_080614chr20--132 ----
NM_080617chr201100 ------
NM_080742chr61188 ------
NM_080796chr201590 ------
NM_080840chr20----1114 --
NM_080841chr20----1114 --
NM_080867chr1434286 3764 326 13951 ----
NM_080872chr843901 3520 3244 1589 12925 ----
NM_130391chr933537 2509 788 12555 11068 --
NM_130392chr933537 2509 788 12555 11068 --
NM_130393chr933537 2509 788 12555 11068 --
NM_130395chr6------1371
NM_130434chr152881 398 ------
NM_130436chr2132187 1966 1043 ------
NM_130440chr1--11508 ----
NM_130442chr7--1100 ----
NM_130443chr111115 ------
NM_130798chr1531531 1375 231 --11470 --
NM_133170chr2057003 5305 2889 2308 1340 1334 12582 27571 2260
NM_133329chr21112 ------
NM_133334chr495705 5578 4534 4234 4077 3904 1919 1217 1079 15614 11622 12281
NM_133372chr542645 940 687 27 --12754 --
NM_133378chr21295 ------
NM_133432chr21295 ------
NM_133433chr5----1775 --
NM_133437chr21295 ------
NM_133486chrX--1300 ----
NM_133503chr121599 ------
NM_133504chr121599 ------
NM_133505chr121599 ------
NM_133506chr121599 ------
NM_133507chr121777 ------
NM_133631chr311354 ------
NM_133647chr15--1724 11143 1302
NM_134265chr1711114 ------
NM_134269chr221320 ------
NM_134270chr221149 ------
NM_134421chr21750 ------
NM_138468chr266162 4593 4538 4249 576 203 14438 ----
NM_138576chr1464602 4281 3564 3408 2936 257 ------
NM_138578chr201306 ------
NM_138638chr1432260 1971 401 21900 457 ----
NM_138713chr1676575 5930 2430 1514 1442 1332 488 --12022 26479 2937
NM_138714chr1676575 5930 2430 1514 1442 1332 488 --12022 26479 2937
NM_138731chr1423755 3025 13487 ----
NM_138735chr211505 ------
NM_138927chr211329 1234 --1897
NM_138962chr171335 ------
NM_138971chr1133610 516 385 ----13063
NM_138971chr1133610 516 385 ----13063
NM_138972chr1133610 516 385 ----13063
NM_138972chr1133610 516 385 ----13063
NM_138973chr1133610 516 385 ----13063
NM_138973chr1133610 516 385 ----13063
NM_139045chr9125 1306 ----
NM_139135chr1--11348 ----
NM_139283chr1272347 2219 1819 933 689 489 232 22069 339 11730 --
NM_139321chr2024114 3615 --13827 1896
NM_144571chr4116924 6782 6348 5490 5193 4890 2792 2550 1307 634 172 --1162 --
NM_144578chr1424841 1384 15162 --1359
NM_144632chr232284 2010 356 ------
NM_144633chr32603 403 1250 --11376
NM_144664chr1122466 115 --1593 --
NM_144775chr17114860 4367 4240 3375 1848 1785 1682 1669 1470 1083 63 ------
NM_144778chr1311836 ------
NM_144949chr211886 ------
NM_145037chr321014 363 ------
NM_145055chr1843566 2786 2701 1292 12993 2469 420 11092
NM_145203chr131299 ------
NM_145690chr851295 727 383 278 264 ------
NM_145698chr1011884 21419 299 ----
NM_145800chrX1768 1747 ----
NM_145802chrX1717 1696 ----
NM_145859chr31301 ------
NM_145860chr31301 ------
NM_145891chr1611127 ------
NM_145892chr1611127 ------
NM_145893chr1611249 ------
NM_147156chr1011007 1536 ----
NM_147166chr71603 ------
NM_148174chr812044 2739 111 ----
NM_152263chr155469 5440 4789 2338 1517 14609 14546 --
NM_152265chr12610 218 ------
NM_152275chr22661 77 ----12193
NM_152277chr5------11948
NM_152284chr8------1948
NM_152407chr531182 388 126 22412 1035 1257 --
NM_152437chr1212192 21973 842 1640 --
NM_152519chr221734 805 ------
NM_152520chr21296 ------
NM_152546chr5--11065 ----
NM_152556chr752186 1840 1645 1010 555 ------
NM_152622chr542742 788 775 732 11085 ----
NM_152624chr577458 5486 5193 5044 5005 1873 1461 16276 15709 --
NM_152653chr31495 ------
NM_152666chr11576 --1761 --
NM_152716chr1111594 ------
NM_152737chr621882 145 11396 ----
NM_152745chr71984 ------
NM_152758chr8----12579 --
NM_152772chr122394 47 ------
NM_152792chr2135 ------
NM_152793chr764043 3849 2018 1746 1489 236 ------
NM_152838chr2083496 2770 1219 1108 392 301 233 142 11264 ----
NM_152910chr132449 47 --1518 --
NM_152999chr724407 3287 11868 --14876
NM_153042chr6----11462 1659
NM_153183chrX51258 1178 1024 1011 211 ------
NM_153207chr121535 43133 2671 980 270 ----
NM_153226chr104830 331 193 100 ------
NM_153252chrX1114 ------
NM_153261chr1621139 183 ------
NM_153267chr91248 1799 ----
NM_153333chrX1128 ------
NM_153456chr1375826 5285 4751 2216 505 432 205 12527 1733 --
NM_153686chr432375 905 414 --11520 --
NM_153816chr61394 ------
NM_170675chr15----1967 --
NM_170676chr15----1967 --
NM_170709chr822219 538 --2729 434 --
NM_170719chr131429 ------
NM_170721chr1711079 ------
NM_172037chr811309 ------
NM_172069chr222298 2163 22087 376 ----
NM_172070chr211936 1154 ----
NM_172071chr1106510 6248 6109 5969 5891 5765 2900 2170 1716 387 ------
NM_172169chr1031947 1400 688 1309 ----
NM_172170chr1031947 1400 688 1309 ----
NM_172171chr1031947 1400 688 1309 ----
NM_172173chr1031947 1400 688 1309 ----
NM_172337chr144992 881 234 77 1857 ----
NM_172344chr21112 ------
NM_172373chr1311365 ------
NM_173083chr111220 ------
NM_173156chr11269 ------
NM_173163chr161455 ------
NM_173171chr2----1795 --
NM_173172chr2----11103 --
NM_173173chr2----1795 --
NM_173214chr1676575 5930 2430 1514 1442 1332 488 --12022 26479 2937
NM_173359chr3140 ------
NM_173468chr42390 320 --13897 11796
NM_173469chr1521482 423 21529 1051 ----
NM_173470chrX21136 203 22317 2088 ----
NM_173473chr1032645 718 665 ------
NM_173495chrX52249 1855 987 839 768 --1691 --
NM_173500chr1511352 ------
NM_173552chr36948 750 546 409 339 315 ------
NM_173564chr71674 ------
NM_173576chr10--12094 ----
NM_173609chr152631 263 ------
NM_173642chr146472 2995 2298 1807 26783 618 16932 17056
NM_173694chrX22606 600 ------
NM_173797chr511123 ------
NM_173808chr1--11056 ----
NM_173822chr2194 11375 --11407
NM_173829chr555333 5096 2190 2061 260 --1803 --
NM_173854chr122307 754 12417 ----
NM_174916chr1522178 288 12109 ----
NM_175566chr11--143 ----
NM_175610chr151217 ------
NM_175624chr1267261 6709 6681 5301 2696 1550 --12784 166
NM_175625chr1267261 6709 6681 5301 2696 1550 --12784 166
NM_175861chr1275240 5118 5017 4666 4196 1426 466 ------
NM_175875chr19135 ------
NM_175884chr711140 ------
NM_176814chr721489 62 1423 ----
NM_177414chr121125 232 ------
NM_177438chr1432909 1060 593 ------
NM_177538chr288598 8267 6440 6304 3240 790 654 517 ----12571
NM_177556chrX164 ------
NM_177559chr201410 ------
NM_177560chr201410 ------
NM_177968chr241909 1782 1738 864 ------
NM_177972chr1134481 1710 1452 11046 ----
NM_177989chr3----1304 --
NM_178042chr3----1304 --
NM_178151chrX86846 5251 5124 4881 2527 2480 1755 92 16480 1409 15333
NM_178152chrX86846 5251 5124 4881 2527 2480 1755 92 16480 1409 15333
NM_178153chrX86846 5251 5124 4881 2527 2480 1755 92 16480 1409 15333
NM_178450chr52718 492 ------
NM_178454chr11633 ------
NM_178539chr1221651 329 1609 --1597
NM_178585chr412815 12863 ----
NM_178815chr1032624 2425 2014 --12246 --
NM_181054chr142999 369 ------
NM_181442chr201317 ------
NM_181453chr221327 345 1644 ----
NM_181457chr211247 ------
NM_181458chr211380 ------
NM_181460chr211193 ------
NM_181521chr1666492 6162 2824 2804 2643 2080 22523 116 ----
NM_181706chr1131949 957 826 ----12024
NM_181782chr6--1313 ----
NM_181836chr542004 1863 838 291 ----188
NM_181838chr511203 11241 ----
NM_181861chr1222799 774 1271 1337 --
NM_181868chr1222799 774 1271 1337 --
NM_181869chr1232884 859 56 1356 1422 --
NM_181886chr4----1511 --
NM_181887chr4----1511 --
NM_181888chr4----1511 --
NM_181889chr4----1511 --
NM_181890chr4----1511 --
NM_181891chr4----1511 --
NM_181892chr4----1558 --
NM_181893chr4----1511 --
NM_182502chr4--190 ----
NM_182511chr1821295 1250 1994 ----
NM_182641chr171130 ------
NM_182666chr31636 191 --1187
NM_182697chr731111 362 220 ------
NM_182715chr71114 ------
NM_182789chr511001 ------
NM_182830chr1411914 ------
NM_182947chr121293 ------
NM_182948chr162919 2893 965 782 591 294 1498 ----
NM_182976chr11267 ------
NM_183043chr13--1260 ----
NM_183044chr13--1260 ----
NM_183323chr511001 ------
NM_183393chr31332 ------
NM_183394chr31332 ------
NM_194247chr243788 2875 1699 1534 13014 ----
NM_194250chr21127 ------
NM_194283chr542856 1042 555 269 ------
NM_194286chr1285926 5896 5801 4848 3916 2361 2318 977 --14940 --
NM_194291chr812630 1970 ----
NM_194298chr102630 542 ----11345
NM_194301chr142938 745 --11037 --
NM_194328chr973036 2739 2683 2650 2603 2046 748 13328 --12364
NM_194329chr973036 2739 2683 2650 2603 2046 748 13328 --12364
NM_194330chr973036 2739 2683 2650 2603 2046 748 13328 --12364
NM_194332chr973036 2739 2683 2650 2603 2046 748 13328 --12364
NM_194429chr61105 2475 462 ----
NM_194434chr1874359 4102 3694 1826 1806 1348 1065 11098 182 12221
NM_194454chr71648 1596 ----
NM_194455chr71648 1596 ----
NM_194456chr71648 1596 ----
NM_197968chr131607 ------
NM_197977chr92876 866 1209 ----
NM_198077chr11257 ------
NM_198129chr18--1258 ----
NM_198158chr332936 1965 877 --1483 --
NM_198159chr332936 1965 877 --1483 --
NM_198177chr332936 1965 877 --1483 --
NM_198178chr332936 1965 877 --1483 --
NM_198270chrX33214 2492 393 ------
NM_198291chr2011991 ------
NM_198395chr52358 74 1831 ----
NM_198404chr13----1621 --
NM_198485chr322327 1736 --11826 11764
NM_198513chr81393 --11618 --
NM_198565chr3--1215 ----
NM_198581chr296998 6613 5669 5645 5341 5317 4590 2356 2103 27439 843 --1549
NM_198597chr1021012 873 ------
NM_198859chr334663 3636 180 12024 ----
NM_198904chr5--11929 --12027
NM_198965chr121151 ------
NM_198966chr121151 ------
NM_198971chr11--1534 ----
NM_199169chr2013182 ------
NM_199170chr2013182 ------
NM_199171chr2013182 ------
NM_199189chr511021 ------
NM_199229chr21171 ------
NM_199327chr41384 ------
NM_199355chr1611186 ------
NM_199421chr1434286 3764 326 13951 ----
NM_199454chr131479 840 212 21216 448 ----
NM_199482chr21391 1265 ----
NM_201269chr111400 ------
NM_201278chr1121948 312 11475 11454 --
NM_201281chr1121948 312 11475 11454 --
NM_201568chr11269 ------
NM_201569chr11269 ------
NM_201591chr4140 ------
NM_201592chr4140 ------
NM_201613chr121595 ------
NM_203291chr18170 ------
NM_203292chr18163 ------
NM_203301chr141171 ------
NM_203303chrX----1190 --
NM_203341chr11367 3970 737 248 11038 --
NM_203342chr112833 32579 2450 594 23518 3093 --
NM_203343chr112833 32579 2450 594 23518 3093 --
NM_203349chr1511962 ------
NM_203372chr21391 ------
NM_203437chr2--1126 ----
NM_203458chr142972 2670 1324 1220 1833 ----
NM_203464chr1163 ------
NM_203499chr17--158 ----
NM_205768chr112050 ------
NM_205852chr122872 190 ------
NM_206832chr171331 1270 ----
NM_206852chr141601 ------
NM_206853chr634017 2941 1184 1734 13867 --
NM_206854chr645278 4202 3621 1161 11995 35128 1179 912 --
NM_206855chr656243 5167 4586 2126 290 1184 36093 2144 1877 --
NM_206857chr141601 ------
NM_206860chr101188 ------
NM_206861chr101188 ------
NM_206876chr243542 2193 902 865 22309 808 ----
NM_206886chr1144 ------
NM_206907chr523277 3080 11223 ----
NM_207015chr332005 849 482 ------
NM_207032chr2041529 1222 631 353 1371 --1996
NM_207171chr131843 293 223 ------
NM_207304chr1311723 ------
NM_207337chr121157 1808 ----
NM_207344chr1231260 1182 955 11385 ----
NM_207361chr1346173 1084 777 729 35539 4334 1345 ----
NM_207371chr1011310 ------
NM_207406chr435824 1947 1366 14424 --11183
NM_207645chr1111020 --11176 --
NM_207647chr9179 21646 820 ----
NM_212460chr72462 223 ------
NM_212471chr1731554 736 572 12146 12089 --
NM_212472chr1731554 736 572 12146 12089 --
NM_212474chr21854 ------
NM_212475chr21854 ------
NM_212476chr21854 ------
NM_212478chr21854 ------
NM_212482chr21854 ------
NM_212554chr102231 78 31438 1264 435 ----