TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-192-5p
miRNA Sequence: CUGACCUAUGAAUUGACAGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr576450 6370 5891 5676 4151 1880 1334 24624 922 --26640 2226
NM_000489chrX32770 995 939 13211 --1915
NM_000555chrX87582 6558 5890 5386 5372 3093 2185 1481 15008 17691 15460
NM_001014380chr1354959 4781 3981 1181 646 --25875 4190 --
NM_001033576chr1772499 1847 977 809 320 275 83 1394 22310 1039 --
NM_001099678chr355769 5510 4803 4444 2227 ----16243
NM_001106chr399674 8049 7534 7395 7061 3053 2784 1665 939 16309 39216 3161 2610 12280
NM_001204chr277742 7032 4889 2317 918 624 360 11685 12808 --
NM_001432chr441428 1292 516 315 ----2102 90
NM_001918chr197621 7493 6767 3043 2867 2425 1839 1682 363 38644 6813 2103 1218 --
NM_002006chr434470 1096 627 34229 2125 538 --11872
NM_002025chrX67418 3207 2790 1717 1109 952 ----28556 3713
NM_002264chr364621 4308 3957 3946 3809 3140 --14528 14145
NM_003034chr1265016 2693 1890 757 447 47 --17355 --
NM_003112chr743014 2879 833 703 1145 --1693
NM_003617chr154592 4201 4019 3523 1244 13716 --1783
NM_004171chr1168586 8473 8405 6997 3803 1885 --13396 12271
NM_005188chr1175655 5411 3250 2838 2557 2495 202 --36172 1202 991 12289
NM_006306chrX85329 4870 4775 3756 2232 1810 746 167 24903 4886 13910 --
NM_006599chr1665695 5551 5287 5104 3121 2620 26884 3168 11880 --
NM_006750chr1667341 7311 5700 2053 754 267 12595 27201 481 21700 826
NM_007050chr20147408 7021 6858 6778 6525 6158 6113 5863 5836 5387 3176 2513 2053 453 17953 15543 16703
NM_012316chr155619 4994 4679 2105 1382 14232 --11193
NM_014388chr143923 1265 1138 155 --15647 15556
NM_015275chr12--1190 199 21913 1786
NM_015314chr762363 2163 1774 858 347 192 ----1150
NM_015569chr174809 3900 3186 1685 1667 1148 238 --23802 811 14611
NM_016260chr235346 1509 1223 --12640 27021 5699
NM_017658chr1464615 4102 3570 3326 1685 1286 1695 ----
NM_018177chr42945 300 ----2831 43
NM_019084chr1042287 1012 987 898 ----1806
NM_020772chr1758414 7159 5757 2862 265 11467 --12762
NM_020774chr1856262 6045 4525 3788 2356 24395 441 ----
NM_024345chr966021 2333 2007 1608 1308 125 ----1105
NM_024989chr278103 7028 7017 2641 1077 901 852 27210 488 1401 --
NM_032116chr1354959 4781 3981 1181 646 --25875 4190 --
NM_032373chr1035644 3959 1716 1771 34382 4259 1929 11110
NM_032457chr4--1677 --22571 1155
NM_033224chr797837 7384 6920 5156 5146 2268 933 490 393 1591 ----
NM_133170chr20147408 7021 6858 6778 6525 6158 6113 5863 5836 5387 3176 2513 2053 453 17953 15543 16703
NM_138270chrX32770 995 939 13211 --1915
NM_138713chr1665695 5551 5287 5104 3121 2620 26884 3168 11880 --
NM_138714chr1665695 5551 5287 5104 3121 2620 26884 3168 11880 --
NM_152409chr573571 3096 964 824 654 556 210 ----13586
NM_152624chr555989 2329 1717 925 874 25602 2181 47334 5432 1049 761 --
NM_173167chr1772499 1847 977 809 320 275 83 1394 22310 1039 --
NM_173214chr1665695 5551 5287 5104 3121 2620 26884 3168 11880 --
NM_173536chr424082 3711 33178 781 586 14087 1217
NM_173829chr555103 4504 4233 2071 1737 --34186 1699 341 --
NM_178151chrX87582 6558 5890 5386 5372 3093 2185 1481 15008 17691 15460
NM_178152chrX87582 6558 5890 5386 5372 3093 2185 1481 15008 17691 15460
NM_178153chrX87582 6558 5890 5386 5372 3093 2185 1481 15008 17691 15460
NM_181783chr1211590 --21736 1547 11276
NM_206854chr643847 2089 1633 413 13919 --11798
NM_207306chr1274399 4061 1412 1393 1382 1357 1321 1285 1249 1213 1177 1105 1069 1033 997 986 925 857 846 821 785 713 641 630 569 497 461 ------
NM_207406chr456042 5654 4188 3977 2463 44834 2329 1382 587 16025 1736