TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-194-3p
miRNA Sequence: CCAGUGGGGCUGCUGUUAUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr551030 876 455 287 160 ------
NM_000037chr832493 1559 575 1676 ----
NM_000038chr521971 171 ------
NM_000052chrX2762 555 12097 21076 440 --
NM_000074chrX2909 848 ----1240
NM_000075chr121190 ------
NM_000084chrX106947 6170 5869 2719 2590 2503 2222 1706 1537 1471 35583 2109 323 26580 5772 --
NM_000088chr1761113 924 870 505 399 286 --11107 --
NM_000092chr294536 4317 3164 2852 1815 1256 983 948 734 --33799 3126 852 --
NM_000094chr3----2214 66 --
NM_000103chr153848 347 22 11289 ----
NM_000109chrX32216 2008 1943 1935 ----
NM_000127chr8178 ------
NM_000129chr61384 1967 ----
NM_000134chr421553 1096 --1388 --
NM_000138chr1542464 2303 1828 268 ----11747
NM_000141chr1021354 95 ------
NM_000147chr11190 --137 --
NM_000158chr32595 60 ------
NM_000163chr511944 --11576 --
NM_000165chr651302 657 488 163 30 ------
NM_000167chrX41744 629 328 269 1504 ----
NM_000168chr772684 2380 2272 2107 1067 975 774 ------
NM_000173chr171421 ------
NM_000176chr531328 1158 1103 11224 ----
NM_000188chr102686 210 --2503 24 --
NM_000189chr221585 773 1447 2240 124 --
NM_000192chr123635 316 258 ------
NM_000202chrX83812 3672 2728 2699 2658 2570 2422 1216 --12429 --
NM_000208chr1953778 3465 3259 2969 39 14389 14439 --
NM_000212chr1732479 1530 374 --1866 --
NM_000214chr2051803 1281 1215 621 304 11397 ----
NM_000217chr1274592 4180 3853 3664 1794 652 33 --15211 --
NM_000220chr112429 183 1413 ----
NM_000227chr182311 272 ------
NM_000230chr732769 719 628 ----1326
NM_000245chr762169 1434 785 545 492 55 --1589 --
NM_000248chr342372 2339 2023 1129 --11026 --
NM_000259chr15106330 6166 6099 4687 4663 2506 2121 1336 1279 57 1445 ----
NM_000264chr933249 2857 247 ------
NM_000266chrX1889 ------
NM_000267chr1743451 2520 1199 335 ------
NM_000276chrX52137 786 536 459 357 11738 ----
NM_000280chr112957 149 ------
NM_000289chr122394 252 ------
NM_000291chrX9888 731 718 709 339 233 207 171 67 ------
NM_000304chr17----1731 --
NM_000313chr311094 11065 ----
NM_000314chr1033274 642 636 12057 ----
NM_000321chr131480 1674 ----
NM_000330chrX42272 902 454 197 12252 ----
NM_000332chr6136670 6394 6130 5877 5506 5111 4574 2873 2751 2624 1188 452 327 ----12120
NM_000333chr3163 ------
NM_000334chr1772123 1889 1789 1341 627 404 337 ----126
NM_000335chr371524 899 728 698 563 529 498 ------
NM_000337chr5136445 6206 5809 5786 5629 5532 5491 4423 1926 1586 1224 878 262 36189 5660 4993 15445 --
NM_000346chr171223 11462 --11630
NM_000353chr1641094 470 454 228 --2795 89 --
NM_000361chr2091970 624 554 543 468 426 273 214 206 ------
NM_000378chr1171191 1007 816 281 194 85 75 1920 1257 --
NM_000380chr92480 405 ------
NM_000390chrX33169 2075 856 ----2941 778
NM_000393chr221758 1317 --1602 --
NM_000399chr103326 185 57 ------
NM_000408chr232931 2773 759 ------
NM_000430chr1753496 2636 1486 1460 947 13639 23436 3044 2844 73
NM_000435chr194993 657 651 255 --1706 --
NM_000439chr52489 312 ----11619
NM_000449chr121309 540 --1462 --
NM_000450chr141636 1391 218 104 ----1559
NM_000459chr93933 139 38 ------
NM_000461chr362933 1821 1431 794 60 40 23383 1215 ----
NM_000462chr1511812 ------
NM_000484chr212367 44 ------
NM_000489chrX42906 1074 982 606 ------
NM_000495chrX195 ------
NM_000503chr821527 1357 1704 ----
NM_000508chr43863 826 355 ------
NM_000516chr201237 ------
NM_000522chr721316 393 ------
NM_000527chr1952441 1844 1543 794 667 ------
NM_000533chrX1752 3628 487 352 ----
NM_000544chr6_cox_hap183390 3230 3127 3115 2885 1346 1230 699 --1361 --
NM_000551chr352059 1421 697 215 131 ------
NM_000555chrX137568 7502 6472 4856 2902 2632 2532 2178 1999 1977 1622 1109 505 31598 716 188 ----
NM_000575chr22998 24 1265 ----
NM_000578chr221250 1241 ------
NM_000594chr61761 --1246 --
NM_000596chr71165 ------
NM_000601chr71110 ------
NM_000602chr731218 518 319 ----1346
NM_000609chr1042820 2645 815 212 32870 2005 903 --1990
NM_000610chr1192907 2346 2269 2204 2101 1970 831 821 251 2448 91 12878 --
NM_000612chr1143445 3177 2666 696 12625 ----
NM_000615chr1142724 2423 930 230 --12962 --
NM_000618chr1255982 2418 2110 1441 1232 34329 4273 1096 36057 5365 2335 35975 5260 1733
NM_000618chr1255982 2418 2110 1441 1232 34329 4273 1096 36057 5365 2335 35975 5260 1733
NM_000621chr1311422 1943 ----
NM_000627chr23880 871 784 1685 ----
NM_000633chr1873758 3389 1992 1498 1321 1229 1113 12000 24530 1038 1657
NM_000641chr1921389 452 11288 ----
NM_000663chr1622825 2144 ------
NM_000668chr451172 1148 431 394 261 1279 ----
NM_000680chr8151 ----1423
NM_000684chr1011294 ------
NM_000693chr1531578 156 126 ------
NM_000719chr12185745 5681 5510 5268 4856 4704 4298 2620 2496 2362 2244 2092 2052 2003 1338 966 943 552 24094 694 56535 6025 5534 4451 76 --
NM_000720chr31452 ------
NM_000721chr142123 2086 471 315 ------
NM_000724chr1041480 1388 1282 440 ------
NM_000725chr124359 218 207 57 --21014 288 --
NM_000739chr7192 ------
NM_000740chr11162 1151 ----
NM_000757chr13879 802 325 ------
NM_000767chr1921104 416 --21429 293 --
NM_000793chr14104792 4645 4532 4009 3216 1928 1464 1329 1081 371 34868 3753 1426 13845 13791
NM_000800chr541655 1609 1287 86 1366 ----
NM_000801chr201111 ------
NM_000807chr41211 ------
NM_000811chr54664 310 287 171 ------
NM_000813chr575035 4321 3757 3644 1557 1281 283 13949 1510 --
NM_000814chr1583847 3556 3538 3227 1352 1158 795 628 1845 ----
NM_000816chr52452 72 139 ----
NM_000818chr102198 27 ----165
NM_000827chr5102633 2050 1986 1837 1694 971 572 500 304 112 12176 11006 --
NM_000829chr1131945 1764 685 11685 ----
NM_000833chr1631376 1154 174 --1282 --
NM_000834chr121101 --2223 156 --
NM_000836chr194941 770 658 355 ------
NM_000838chr672565 2068 1860 1018 637 143 125 1971 1569 --
NM_000841chr63586 248 157 ------
NM_000842chr112709 598 ------
NM_000844chr32434 89 2301 203 ----
NM_000870chr541560 1157 621 317 1363 1299 --
NM_000872chr101585 ----11377
NM_000875chr15146412 5377 5209 4962 4837 4494 2628 2504 2489 2151 1692 1350 438 299 14605 32376 2060 1027 --
NM_000883chr73729 166 51 ------
NM_000883chr73729 166 51 ------
NM_000891chr1713603 13575 ----
NM_000899chr1264105 4035 2850 938 639 511 ------
NM_000901chr422355 573 ------
NM_000902chr342954 2253 947 97 --1221 --
NM_000910chr421847 92 1430 ----
NM_000919chr51203 ------
NM_000922chr113323 263 166 ------
NM_000933chr2021245 34 1244 ----
NM_000944chr421695 1689 21569 1560 1323 --
NM_000945chr251687 1320 1298 803 718 ------
NM_000950chrX32953 916 838 21039 599 1875 --
NM_000958chr53859 416 210 ------
NM_000961chr2063813 3127 2673 541 325 211 1452 33580 2857 559 --
NM_000963chr132350 1617 803 11727 ----
NM_000964chr1721389 382 11380 11012 --
NM_000965chr321205 439 --1165 --
NM_000966chr121694 --31054 981 24 --
NM_000983chr121176 249 11347 11566 --
NM_001001132chr2141273 420 68 54 --2153 129 --
NM_001001323chr1222743 261 13143 ----
NM_001001331chr352522 2315 460 223 54 --32583 2211 45 --
NM_001001344chrX62186 2034 1962 1878 1746 843 --12248 1902
NM_001001389chr1192907 2346 2269 2204 2101 1970 831 821 251 2448 91 12878 --
NM_001001390chr1192907 2346 2269 2204 2101 1970 831 821 251 2448 91 12878 --
NM_001001391chr1192907 2346 2269 2204 2101 1970 831 821 251 2448 91 12878 --
NM_001001392chr1192953 2392 2315 2250 2147 2016 877 867 297 2494 137 12924 --
NM_001001395chr1262713 2295 2271 2098 578 489 11040 --195
NM_001001396chr154505 1702 1340 770 509 24389 2863 13599 --
NM_001001433chr20112939 2611 2576 2464 2312 2037 1074 981 729 574 548 11081 ----
NM_001001481chr81620 --1921 142
NM_001001484chr1042117 1720 400 70 2692 599 ----
NM_001001485chr31403 135 ----
NM_001001522chr112313 62 1129 --1341
NM_001001549chr751915 1869 962 795 647 ------
NM_001001550chr751915 1869 962 795 647 ------
NM_001001555chr751915 1869 962 795 647 ------
NM_001001664chr233317 1533 1208 ------
NM_001001669chr531809 1004 743 12380 21844 535 11891
NM_001001791chr1031590 1536 73 ------
NM_001001870chr172788 30 1260 ----
NM_001001872chr141442 ------
NM_001001890chr2173169 2848 2767 2702 1558 1452 738 13873 ----
NM_001001928chr22146978 5319 3339 3141 3099 2181 1858 1215 1105 1028 978 830 375 366 --28292 941 --
NM_001001933chr1--169 ----
NM_001001995chrX3640 569 118 ----1670
NM_001002009chr71212 ------
NM_001002010chr71212 ------
NM_001002243chr21342 ------
NM_001002255chr6----1358 --
NM_001002257chr243261 2924 1140 669 13230 12507 --
NM_001002295chr1021109 452 1185 1161 --
NM_001002296chr861193 349 192 144 50 23 ------
NM_001002814chr853766 2672 1252 696 220 ------
NM_001002838chrX21678 1468 --1656 --
NM_001002860chr1484651 4634 1753 1437 1426 1075 555 46 21470 887 12977 --
NM_001002909chr1722075 1740 ------
NM_001002914chr1731224 1015 981 --11256 --
NM_001003652chr18198032 7481 7135 6460 5817 5351 5279 3364 3251 3174 2823 2783 2583 2367 2210 1676 750 450 209 37503 5856 3230 12307 13072
NM_001003674chr1875818 4932 2667 2287 1974 1331 57 --26445 1131 --
NM_001003675chr1875818 4932 2667 2287 1974 1331 57 --26445 1131 --
NM_001003681chr2242091 785 631 42 1398 1584 --
NM_001003682chr13576 479 219 ------
NM_001003688chr411197 ------
NM_001003694chr31562 --162 --
NM_001003698chr641964 1306 1275 700 --21531 1497 --
NM_001003699chr641964 1306 1275 700 --21531 1497 --
NM_001003712chr1233949 3836 499 12736 ----
NM_001003790chr82298 202 1866 ----
NM_001003791chr82298 202 1866 ----
NM_001003794chr343017 2930 2836 899 1272 ----
NM_001003800chr933158 1110 184 ------
NM_001004019chr31358 ------
NM_001004127chr132920 716 ----1726
NM_001004304chr1252673 2040 1280 1067 105 32942 2661 869 ----
NM_001004308chrX11339 1968 11474 --
NM_001004317chr624122 745 1969 2935 427 --
NM_001004323chr7137 ------
NM_001004329chr1241363 1028 573 143 1403 ----
NM_001004342chr1115842 5809 5214 4708 4165 4158 1746 1681 1576 199 68 25907 3759 24946 1252 24140 614
NM_001004360chr251711 1414 334 174 116 ------
NM_001004441chr51650 ------
NM_001005158chr3----1369 --
NM_001005159chr3----1369 --
NM_001005209chr21690 --1227 --
NM_001005266chr151561 1640 ----
NM_001005267chr151561 1640 ----
NM_001005268chr151561 1640 ----
NM_001005269chr151561 1640 ----
NM_001005271chr1741100 1039 181 113 ------
NM_001005273chr1741100 1039 181 113 ------
NM_001005360chr192796 775 ------
NM_001005361chr192796 775 ------
NM_001005362chr192796 775 ------
NM_001005375chrY21830 155 --11457 --
NM_001005386chr2----21834 942 --
NM_001005463chr1082492 2445 1926 966 805 692 576 188 --21826 719 --
NM_001005473chr596232 5933 5847 5676 4851 4131 2043 1342 200 194 14729 --
NM_001005476chr22698 669 ------
NM_001005505chr3126 --21421 647 1107
NM_001005527chr331127 945 219 ------
NM_001005732chr21--2618 257 ----
NM_001005739chr21857 ------
NM_001005781chr2--1105 ----
NM_001005849chr171145 ------
NM_001005861chr3151 ------
NM_001005862chr172583 381 ------
NM_001006115chr3102782 2749 2440 2426 2118 1956 443 401 55 38 ----1731
NM_001006600chr552301 1679 798 749 170 2842 732 ----
NM_001006610chr161637 1207 ----
NM_001006617chr9--11149 1118 --
NM_001006619chr9--11149 1118 --
NM_001006620chr9--11149 1118 --
NM_001006621chr9--11149 1118 --
NM_001006626chr7192 ------
NM_001006627chr7192 ------
NM_001006628chr7192 ------
NM_001006629chr7192 ------
NM_001006630chr7192 ------
NM_001006631chr7192 ------
NM_001006632chr7192 ------
NM_001006634chr16----1125 --
NM_001006636chr2----11028 --
NM_001006665chr12313 223 ------
NM_001006944chr114670 513 130 59 ------
NM_001006946chr251288 470 170 49 38 1447 ----
NM_001007023chr14104792 4645 4532 4009 3216 1928 1464 1329 1081 371 34868 3753 1426 13845 13791
NM_001007067chr82287 260 ------
NM_001007068chr82287 260 ------
NM_001007069chr82287 260 ------
NM_001007070chr82287 260 ------
NM_001007075chr4----1937 --
NM_001007097chr9104534 3979 3815 3642 3543 3254 3121 3104 1902 619 14710 2352 309 --
NM_001007102chr6--1229 ----
NM_001007156chr1571477 1292 1272 668 394 213 181 --21728 1703 --
NM_001007214chr1--11863 1150 --
NM_001007237chr142550 2148 2098 690 ------
NM_001007246chr2121744 289 ------
NM_001007257chr121045 1033 11336 ----
NM_001007271chr101196 --1320 --
NM_001007277chr113938 220 111 1122 ----
NM_001007466chr6104774 3945 3916 3815 3659 1798 1479 1138 873 396 11385 --23549 716
NM_001007471chr9--1883 ----
NM_001007553chr13804 298 31 ------
NM_001007559chr1822036 595 --11691 --
NM_001007794chr12791 644 ------
NM_001008220chr5103656 2719 1067 982 866 844 720 332 197 24 --32918 740 317 --
NM_001008222chrX41179 912 562 333 ------
NM_001008239chr1863539 3436 2510 2396 1358 41 23495 2798 1417 --
NM_001008388chr42117 72 ------
NM_001008392chr352801 2237 1055 840 677 11175 33337 1132 1081 --
NM_001008401chr192465 455 11408 ----
NM_001008405chr731207 423 240 1481 ----
NM_001008407chr71402 --11728 --
NM_001008408chr7206441 5998 5923 5576 5564 5440 5342 4159 4075 4024 2358 2175 1798 1792 1120 906 863 660 612 110 --11936 14613
NM_001008410chr242098 2069 1785 838 --11552 --
NM_001008491chr221641 754 21428 353 ----
NM_001008492chr221641 754 21428 353 ----
NM_001008495chr831898 659 364 --1783 --
NM_001008529chr17------1461
NM_001008539chr865366 4650 3782 3711 1219 522 24691 394 ----
NM_001008541chr1021710 41 ------
NM_001008541chr1021710 41 ------
NM_001008564chr1352223 2163 1451 747 125 1251 ----
NM_001008701chr1952746 2624 2177 1174 304 --31249 894 410 --
NM_001008707chr142356 69 --11320 --
NM_001008738chr562803 2361 2088 1790 983 316 --22352 1876 --
NM_001008744chr1421619 81 --1976 --
NM_001008777chr17--137 ----
NM_001008801chr1941942 1745 1389 819 --11533 --
NM_001008895chr1321282 536 ------
NM_001008938chr111410 ------
NM_001009552chr81402 ------
NM_001009554chr463862 1716 1340 1031 867 314 --11233 --
NM_001009554chr463862 1716 1340 1031 867 314 --11233 --
NM_001009555chr441441 1101 610 40 --11334 --
NM_001009571chr731525 1224 413 ------
NM_001009880chr2294737 4570 4267 4150 3554 3047 1787 1719 906 13909 23991 995 21403 953
NM_001009899chr326019 5289 25891 380 35376 2047 1401 --
NM_001009960chr762839 2526 1916 948 334 124 ------
NM_001010000chr1852808 2720 2559 1080 1073 ------
NM_001010861chr162666 1806 1796 859 157 25 ------
NM_001010862chrX73141 2550 1310 460 314 246 191 13308 ----
NM_001010867chr1145944 5856 5647 5601 5210 5169 4881 4712 4606 2635 2216 1851 456 353 --75346 4963 2054 1539 1377 800 101 1819
NM_001010888chrX73633 2965 1724 1571 1404 698 441 13421 1485 --
NM_001010895chr921456 1376 ------
NM_001010898chr1133491 3368 3237 2570 1343 1102 1080 1053 444 322 222 137 50 --33389 2940 2801 13100
NM_001010908chr101210 ------
NM_001010924chr10----1399 --
NM_001010927chr61228 ------
NM_001010932chr71110 ------
NM_001010934chr741023 890 470 306 1770 1273 --
NM_001010984chr132325 1797 864 --1117 1299
NM_001010986chrX62217 2198 2191 1776 670 652 ------
NM_001011546chr20--1631 --194
NM_001011554chr2041810 1700 510 143 --11456 --
NM_001011663chr101863 ------
NM_001011666chr7166579 5987 4905 4856 4591 2628 1968 1738 1622 1609 1568 1403 1205 763 621 588 25151 535 ----
NM_001011708chr232390 2369 232 ----1830
NM_001012264chr142900 743 --2714 307 --
NM_001012329chr112098 --21593 663 --
NM_001012420chr1522928 307 21841 191 ----
NM_001012423chr1522928 307 21841 191 ----
NM_001012426chr673166 3142 3133 2830 2111 1117 437 --32846 2614 2136 --
NM_001012427chr673166 3142 3133 2830 2111 1117 437 --32846 2614 2136 --
NM_001012642chr1552033 1402 786 419 25 --11638 --
NM_001012643chr192521 124 ------
NM_001012751chr101510 1718 ----
NM_001012753chr1911235 --1234 --
NM_001012755chrX114839 4564 4441 3794 3472 1642 1584 940 520 498 477 24583 1845 21756 1256 --
NM_001012968chrX3540 464 260 ------
NM_001012977chrX41144 1008 427 163 ------
NM_001012989chrX3564 556 177 ------
NM_001013031chr1083003 2788 2706 1336 944 736 701 461 --2748 93 12585
NM_001013399chr6147 ------
NM_001013415chr41567 1383 ----
NM_001013438chr31680 1863 1338 --
NM_001013439chr31526 1709 1184 --
NM_001013690chr1261800 1680 1583 911 382 368 174 12406 --
NM_001013693chr182770 2456 2349 1976 1860 886 845 137 12941 --12779
NM_001013693chr182770 2456 2349 1976 1860 886 845 137 12941 --12779
NM_001013699chr121393 ------
NM_001014283chr1331421 701 136 --11768 --
NM_001014435chr16----1458 --
NM_001014797chr10137683 7220 7099 7004 5273 2823 2784 2738 1982 1803 1752 1054 217 --17534 11151
NM_001014809chr44894 766 309 297 ----1977
NM_001014812chr152430 145 ------
NM_001014831chr194731 607 297 84 1155 --157
NM_001014832chr194731 607 297 84 1155 --157
NM_001014834chr194731 607 297 84 1155 --157
NM_001014835chr194731 607 297 84 1155 --157
NM_001014839chr11858 ------
NM_001014841chr11858 ------
NM_001014972chr2----1238 --
NM_001015045chr462216 2123 1766 1564 512 154 ------
NM_001015053chr1751526 1487 454 243 35 ------
NM_001015508chr81133 1762 ----
NM_001015877chrX51142 1017 406 169 68 --12054 1575
NM_001015880chr1031540 461 266 ------
NM_001015881chrX41195 958 251 160 1916 11090 --
NM_001015882chr9----11094 --
NM_001015887chr331645 1317 1238 ------
NM_001017368chr1722431 2012 ------
NM_001017392chr1951341 916 904 865 364 ------
NM_001017395chr393507 3188 3144 3019 3013 653 641 341 76 13063 ----
NM_001017415chr11101 ------
NM_001017416chr11101 ------
NM_001017423chr102516 76 ----1671
NM_001017424chr141852 1274 582 206 ------
NM_001017425chr141852 1274 582 206 ------
NM_001017440chr7137982 7962 6756 6523 6268 4978 2415 1989 1703 1481 636 393 386 27029 6290 22653 1634 16650
NM_001017523chr1251746 1503 279 165 125 1256 21471 266 --
NM_001017923chr1421223 446 ------
NM_001017926chr861452 1412 677 668 620 175 11294 ----
NM_001017961chr1--1217 ----
NM_001017970chr1431882 1711 619 ------
NM_001017979chr41227 ------
NM_001017992chr51941 ------
NM_001017995chr573301 1930 1627 1552 834 592 207 --33381 343 31 13501
NM_001018004chr153609 275 98 ------
NM_001018006chr153609 275 98 ------
NM_001018007chr153609 275 98 ------
NM_001018009chr32798 401 ------
NM_001018020chr153609 275 98 ------
NM_001018050chr2262802 2748 2606 310 184 150 2615 229 32500 2248 675 --
NM_001018052chr2262802 2748 2606 310 184 150 2615 229 32500 2248 675 --
NM_001018054chr12488 274 ------
NM_001018056chr91568 ------
NM_001018064chr951565 814 728 703 79 ------
NM_001018065chr985482 4840 4459 2324 1945 1094 1066 35 45202 5110 4670 4299 11697 --
NM_001018066chr985482 4840 4459 2324 1945 1094 1066 35 45202 5110 4670 4299 11697 --
NM_001018072chr1251746 1503 279 165 125 1256 21471 266 --
NM_001018074chr531328 1158 1103 11224 ----
NM_001018075chr531328 1158 1103 11224 ----
NM_001018076chr531328 1158 1103 11224 ----
NM_001018077chr531328 1158 1103 11224 ----
NM_001018089chr1532475 444 400 ----13424
NM_001018100chr154697 660 217 139 ------
NM_001018108chr1551931 1904 1605 915 730 ------
NM_001018111chr762842 1259 1205 988 633 205 --32727 1367 874 --
NM_001018676chr81446 ------
NM_001018677chr81446 ------
NM_001020658chr121277 303 --251 43 135
NM_001020658chr121277 303 --251 43 135
NM_001020818chr1961884 1495 1489 1315 460 311 --2655 355 --
NM_001020819chr1961884 1495 1489 1315 460 311 --2655 355 --
NM_001020820chr1961884 1495 1489 1315 460 311 --2655 355 --
NM_001020821chr1961884 1495 1489 1315 460 311 --2655 355 --
NM_001023567chr1522320 307 11862 --1191
NM_001023587chr32996 95 ----1923
NM_001024071chr142364 245 ------
NM_001024094chr531328 1158 1103 11224 ----
NM_001024226chr1123 --1265 --
NM_001024227chr1123 --1265 --
NM_001024228chr1123 --1265 --
NM_001024401chr1652343 1840 1800 1097 462 --1710 12646
NM_001024455chrX3931 683 82 1478 --1426
NM_001024463chr153449 337 327 --1218 --
NM_001024649chr572884 2226 2176 2160 1917 861 755 22603 2560 ----
NM_001024666chrX1494 ------
NM_001024668chr124750 694 373 283 ------
NM_001024688chr842164 1531 759 311 ------
NM_001024809chr1721389 382 11380 11012 --
NM_001024912chr1941358 684 292 252 --1154 --
NM_001024937chr173639 570 119 ------
NM_001024948chr143245 2943 2277 240 22734 969 ----
NM_001024956chr1165192 4882 2279 1465 987 977 25624 832 1931 --
NM_001025076chr10116221 5947 5597 5185 4147 4075 2429 2260 1332 576 402 12329 24765 4019 1173
NM_001025077chr10147579 7305 6955 6543 5505 5433 2690 1934 1760 1357 553 404 238 159 --26123 5377 11531
NM_001025081chr182380 69 --11170 11206
NM_001025090chr182380 69 --11170 11206
NM_001025092chr182380 69 --11170 11206
NM_001025101chr182380 69 --11170 11206
NM_001025107chr152480 2431 2195 1008 156 1280 12373 --
NM_001025107chr152480 2431 2195 1008 156 1280 12373 --
NM_001025108chr253798 3157 2919 1083 889 21618 74 ----
NM_001025205chr31394 ------
NM_001025266chr3104747 4557 4178 4030 3335 3288 1521 559 270 110 --13786 24405 460
NM_001025366chr641752 583 520 471 --11191 --
NM_001025366chr641752 583 520 471 --11191 --
NM_001025367chr641752 583 520 471 --11191 --
NM_001025367chr641752 583 520 471 --11191 --
NM_001025368chr641752 583 520 471 --11191 --
NM_001025368chr641752 583 520 471 --11191 --
NM_001025369chr641768 599 536 487 --11207 --
NM_001025369chr641768 599 536 487 --11207 --
NM_001025370chr641752 583 520 471 --11191 --
NM_001025370chr641752 583 520 471 --11191 --
NM_001025579chr174416 389 371 236 ------
NM_001025580chrX125 11622 ----
NM_001025595chr421276 582 ------
NM_001025596chr111402 ------
NM_001025603chr121309 540 --1462 --
NM_001025616chr421540 193 --1709 11570
NM_001025780chr941207 1194 986 23 11635 ----
NM_001029858chr672943 2485 2374 1221 692 405 167 --11265 --
NM_001029860chr8189 ------
NM_001029863chr632262 1004 932 1749 --22861 1031
NM_001029875chr572801 2646 2587 2080 1975 1949 1180 ----125
NM_001029998chr41579 ----11391
NM_001030001chr14178 ------
NM_001030006chr172804 198 --11685 --
NM_001030007chr1693090 3026 2474 538 446 401 363 191 33 --13734 --
NM_001030055chr1434035 3491 3330 1496 11033 --
NM_001030272chr11--1138 ----
NM_001030273chr11--1138 ----
NM_001031679chr1241291 1189 1093 915 ----1528
NM_001031680chr121991 776 --31897 303 25 --
NM_001031690chr742749 2734 2407 29 1697 13037 1478
NM_001031695chr2264936 4423 3596 2022 1455 163 --24999 1289 21311 1278
NM_001031711chr521828 382 ------
NM_001031716chr231083 269 46 ------
NM_001031717chr32910 136 ------
NM_001031723chr4----1151 --
NM_001031738chr23450 403 120 ----1417
NM_001031740chr161653 1428 1237 1211 435 301 ------
NM_001031801chr221167 ------
NM_001031803chr17--145 ----
NM_001031804chr1654240 2905 1389 1316 574 11732 ----
NM_001031812chr52582 103 ------
NM_001032280chr661587 1254 1103 234 140 107 --11515 --
NM_001032282chr821186 75 ------
NM_001032288chr2081600 1332 1149 620 581 485 232 128 ------
NM_001032296chr1352415 884 486 163 111 ------
NM_001032380chr1041933 1913 1845 134 --2780 216 --
NM_001032730chr12657 103 ------
NM_001033044chr131771 271 49 1222 ----
NM_001033045chr254410 3298 1456 842 590 ----13838
NM_001033047chr441795 1635 1067 924 ----11923
NM_001033049chr211896 1313 ----
NM_001033056chr131771 271 49 1222 ----
NM_001033059chr632011 460 104 ------
NM_001033081chr12617 287 --1542 --
NM_001033082chr12617 287 --1542 --
NM_001033085chr21226 ------
NM_001033087chr2042798 2767 2454 1249 ------
NM_001033112chr52623 93 ------
NM_001033117chr364107 3466 3170 1554 1339 306 11629 41965 1597 668 34 --
NM_001033507chr161969 1655 1537 1500 743 66 ------
NM_001033551chr1783966 3936 3602 2899 2547 496 152 41 13898 34046 3369 1200 --
NM_001033557chr2--1384 146 --
NM_001033561chr172352 23 ------
NM_001033566chr173765 350 341 ------
NM_001033568chr173765 350 341 ------
NM_001033578chr852225 2002 1505 836 480 126 ----
NM_001033602chr132947 275 ------
NM_001033756chr641686 517 454 405 --11125 --
NM_001033756chr641686 517 454 405 --11125 --
NM_001034841chr1674241 3525 3363 1684 872 544 197 11155 24445 51 --
NM_001034850chr521562 240 1654 ----
NM_001034852chr1431913 1848 490 1266 ----
NM_001034954chr1042893 1286 542 276 1626 ----
NM_001034955chr1042893 1286 542 276 1626 ----
NM_001034956chr1042893 1286 542 276 1626 ----
NM_001034957chr1042893 1286 542 276 1626 ----
NM_001035003chr4--1201 1991 --
NM_001035004chr4--1201 1991 --
NM_001035254chr952482 766 408 214 160 --2715 666 --
NM_001035260chr101342 ------
NM_001035511chr142115 2097 310 141 --11342 --
NM_001035512chr142222 2204 417 248 --11449 --
NM_001035513chr142222 2204 417 248 --11449 --
NM_001035521chr23628 612 152 ------
NM_001037132chr71613 ------
NM_001037133chr71613 ------
NM_001037317chr162666 1806 1796 859 157 25 ------
NM_001037324chr33490 313 218 1519 1570 --
NM_001037331chr181112 ------
NM_001037339chr121404 374 11481 --1344
NM_001037340chr121404 374 11481 --1344
NM_001037341chr121404 374 11481 --1344
NM_001037341chr121404 374 11481 --1344
NM_001037582chr431741 1104 232 11307 2581 276 --
NM_001037872chr22649 580 1657 ----
NM_001037954chr1143365 3275 3233 2906 --1476 --
NM_001038702chr532185 955 282 1172 ----
NM_001038707chr151886 523 511 232 41 --11624 --
NM_001038707chr151886 523 511 232 41 --11624 --
NM_001039348chr241050 839 345 219 1382 ----
NM_001039349chr241050 839 345 219 1382 ----
NM_001039350chr731572 635 460 ------
NM_001039457chr1131 ------
NM_001039459chr72242 209 --1267 --
NM_001039479chr1451948 1650 1580 864 416 4907 854 799 77 1531 --
NM_001039538chr21321 --1402 --
NM_001039547chr3127616 6996 6481 6284 6196 6184 5828 5720 3004 2293 2167 1899 --12686 --
NM_001039570chr2253243 3027 1593 1001 644 11161 34119 3804 3350 --
NM_001039571chr2253243 3027 1593 1001 644 11161 34119 3804 3350 --
NM_001039573chr172461 344 ------
NM_001039574chr11189 1344 ----
NM_001039577chr164219 3857 3767 3389 864 740 --14160 --
NM_001039590chrX31222 491 134 --1350 --
NM_001039591chrX31222 491 134 --1350 --
NM_001039618chr1175693 5466 5386 4186 3968 1695 1302 24483 966 14360 25057 1814
NM_001039675chr151235 ------
NM_001039690chr1682323 2225 2051 1952 1471 830 190 56 --41968 1855 312 128 --
NM_001039711chr12918 906 1251 ----
NM_001039712chr12918 906 1251 ----
NM_001039762chr1042073 734 118 103 1219 145 --
NM_001039771chr142939 915 --21082 1074 1902
NM_001039772chr113178 106 79 ------
NM_001039802chr12543 377 ------
NM_001039840chrX66014 5360 4407 4144 1686 932 11968 ----
NM_001039888chr11798 ------
NM_001039916chr121917 --122 --
NM_001039917chr121917 --122 --
NM_001039918chr121917 --122 --
NM_001039919chr121917 --122 --
NM_001039920chr121917 --122 --
NM_001039937chr1343970 1224 1206 742 12524 ----
NM_001039960chr1221350 305 2371 288 ----
NM_001040001chr621930 767 ------
NM_001040057chr741294 1027 987 151 ------
NM_001040092chr81148 ------
NM_001040100chr31412 ------
NM_001040110chr721850 222 1529 ----
NM_001040144chr1682323 2225 2051 1952 1471 830 190 56 --41968 1855 312 128 --
NM_001040146chr1682323 2225 2051 1952 1471 830 190 56 --41968 1855 312 128 --
NM_001040151chr11144256 4129 4100 4050 3864 3524 3446 3199 3014 2962 2911 1027 516 125 14457 23019 1071 --
NM_001040152chr753556 1637 1240 671 442 15031 15040 14096
NM_001040153chr131782 ------
NM_001040158chr5----181 --
NM_001040172chr541560 1157 621 317 1363 1299 --
NM_001040173chr541560 1157 621 317 1363 1299 --
NM_001040181chr311079 ------
NM_001040182chr311079 ------
NM_001040183chr311079 ------
NM_001040199chr311079 ------
NM_001040200chr311079 ------
NM_001040202chr452186 2065 986 85 67 --12169 --
NM_001040214chr661967 1593 896 887 335 196 ------
NM_001040272chr941956 833 540 111 11550 ----
NM_001040284chr1675775 5690 2269 1300 1198 1130 959 24680 1746 ----
NM_001040402chr442693 1062 54 31 --1243 --
NM_001040424chr2182885 2846 2630 2541 2325 2215 2065 477 1662 12913 --
NM_001040429chr1343420 2551 162 81 2855 481 ----
NM_001040436chr121612 1488 ----
NM_001040439chr1641331 1293 451 343 --31270 1169 1000 --
NM_001040441chr185249 4694 4361 3790 2092 1872 1018 155 15403 ----
NM_001040445chr294488 4474 4463 3480 1865 1325 1182 765 306 22083 160 24981 624 --
NM_001040446chr552087 1858 1728 712 562 --32728 2105 760 --
NM_001040624chr832164 2033 524 12304 ----
NM_001040625chr832164 2033 524 12304 ----
NM_001040626chr832164 2033 524 12304 ----
NM_001040627chr832164 2033 524 12304 ----
NM_001040628chr832164 2033 524 12304 ----
NM_001040629chr832164 2033 524 12304 ----
NM_001040630chr832164 2033 524 12304 ----
NM_001040633chr731069 747 298 ------
NM_001040661chr741119 1076 1005 128 --1729 --
NM_001040665chr774779 4613 4588 4582 4356 967 805 21774 1217 12004 --
NM_001040666chr74481 290 284 58 ------
NM_001040709chr162483 2397 2303 2189 1924 541 ------
NM_001040712chr932699 2549 803 ------
NM_001040715chr1641146 1025 819 810 --1430 11163
NM_001042355chr1665200 5189 4978 4857 962 88 23676 344 14411 --
NM_001042357chr10124 ------
NM_001042358chr10124 ------
NM_001042360chr10124 ------
NM_001042363chr10124 ------
NM_001042368chr94663 644 342 160 --1138 --
NM_001042389chr10124 ------
NM_001042390chr10124 ------
NM_001042392chr10124 ------
NM_001042395chr10124 ------
NM_001042404chr131610 753 478 ------
NM_001042406chr61896 11264 ----
NM_001042412chr1665200 5189 4978 4857 962 88 23676 344 14411 --
NM_001042413chr962983 1447 1172 1072 932 262 13071 1924 --
NM_001042424chr482420 1269 742 687 493 293 238 180 1157 12070 11174
NM_001042425chr661587 1254 1103 234 140 107 --11515 --
NM_001042440chr521868 1521 ------
NM_001042441chr521868 1521 ------
NM_001042442chr521868 1521 ------
NM_001042443chr521868 1521 ------
NM_001042444chr521868 1521 ------
NM_001042445chr521868 1521 ------
NM_001042446chr521868 1521 ------
NM_001042473chr1031500 358 32 ----1666
NM_001042475chr6--1260 ----
NM_001042479chrX21398 413 --12021 --
NM_001042480chrX21398 413 --12021 --
NM_001042481chr1432364 2323 642 21017 235 1486 --
NM_001042492chr1743451 2520 1199 335 ------
NM_001042494chr1593279 3175 3056 3030 2801 2453 1117 676 87 12705 22440 527 12357
NM_001042495chr1593279 3175 3056 3030 2801 2453 1117 676 87 12705 22440 527 12357
NM_001042496chr1593279 3175 3056 3030 2801 2453 1117 676 87 12705 22440 527 12357
NM_001042497chr1593279 3175 3056 3030 2801 2453 1117 676 87 12705 22440 527 12357
NM_001042498chrX11004 1137 ----
NM_001042506chrX41168 1008 427 163 ------
NM_001042510chr821902 44 ------
NM_001042511chr821902 44 ------
NM_001042533chr383337 2898 2809 1131 1023 867 450 26 12770 ----
NM_001042537chrX31858 587 547 ------
NM_001042555chr1254768 4085 3901 3548 1267 --11888 --
NM_001042599chr277188 7019 6139 5601 4752 2698 292 32278 1021 985 --25488 5203
NM_001042601chr342505 2108 649 371 11060 ----
NM_001042603chr12105339 4701 3728 1968 1674 1477 1333 712 465 83 11173 24851 3973 --
NM_001042604chr353468 3339 3269 1785 1724 24833 3007 ----
NM_001042632chr2062527 2127 2002 1836 681 162 12355 --12439
NM_001042633chr2062527 2127 2002 1836 681 162 12355 --12439
NM_001042646chr321736 569 11581 ----
NM_001042669chr421540 193 --1709 11570
NM_001042681chr152479 1740 977 933 348 ------
NM_001042682chr152479 1740 977 933 348 ------
NM_001042682chr152479 1740 977 933 348 ------
NM_001042683chr631258 722 485 21391 597 ----
NM_001042692chr22567 222 ------
NM_001042724chr192146 94 1709 ----
NM_001042728chr121694 --31054 981 24 --
NM_001042749chrX41720 1653 771 697 ------
NM_001042750chrX41720 1653 771 697 ------
NM_001042751chrX41720 1653 771 697 ------
NM_001043318chr1433610 867 393 --22678 23 --
NM_001043351chr12489 379 1824 11468 --
NM_001044305chr641348 1295 501 107 ----1449
NM_001044387chr1994205 3490 3342 2950 2819 1049 965 640 92 11363 33756 2695 684 --
NM_001044388chr1994205 3490 3342 2950 2819 1049 965 640 92 11363 33756 2695 684 --
NM_001044722chr52582 103 ------
NM_001044723chr52582 103 ------
NM_001046chr552322 2157 1952 1020 433 2471 156 ----
NM_001048183chr183283 3045 2964 2482 1410 1339 1082 155 --22664 944 --
NM_001049chr1482462 1836 1697 682 607 486 275 256 11730 2866 513 --
NM_001076778chr362156 1563 941 725 381 26 1487 ----
NM_001077628chr12545 120 ------
NM_001080418chr1175 --1483 --
NM_001092chr1782286 2231 827 763 733 609 484 331 --11630 --
NM_001095chr123718 546 179 --21292 778 --
NM_001096chr173621 606 124 ----1552
NM_001100108chr1167906 7720 6999 6287 5905 5832 5652 5581 5265 3346 3009 2958 2013 1226 607 517 27050 2466 17496 --
NM_001106chr3108108 7740 6762 6182 3654 3541 2240 1922 335 218 19278 16940 --
NM_001111chr152480 2431 2195 1008 156 1280 12373 --
NM_001113490chrX53642 3591 2599 2268 929 13663 11180 --
NM_001116chr1622157 1240 13089 2598 211 --
NM_001117chr181470 ------
NM_001121chr1021578 1570 --1426 --
NM_001122679chr551030 876 455 287 160 ------
NM_001123chr101106 ------
NM_001126chr1----1154 --
NM_001128chr1693090 3026 2474 538 446 401 363 191 33 --13734 --
NM_001135chr153618 160 116 ------
NM_001146chr841738 1664 467 294 1235 ----
NM_001148chr451958 761 600 436 284 1474 ----
NM_001151chr4164 ------
NM_001172chr141169 ------
NM_001173chr1434035 3491 3330 1496 11033 --
NM_001177chr1241924 1547 1541 680 1556 ----
NM_001178chr11--1138 ----
NM_001186chr2152089 2064 717 490 367 ------
NM_001187chr212534 29 ------
NM_001191chr202448 74 ------
NM_001194chr193655 637 73 --1421 --
NM_001198chr641882 946 895 313 --11707 --
NM_001199chr82207 97 ------
NM_001201chr433860 3269 1276 --22878 1541 --
NM_001202chr14183 ------
NM_001206chr942818 1214 414 120 ----12093
NM_001219chr762001 1900 1518 874 381 143 181 11407 --
NM_001222chr1041784 1459 753 568 ------
NM_001232chr14893 194 134 46 ------
NM_001233chr751913 1515 443 361 73 ------
NM_001234chr33770 274 169 1618 ----
NM_001241chr222103 207 21644 757 173 --
NM_001241chr222103 207 21644 757 173 --
NM_001256chr1722803 2119 12785 --1804
NM_001259chr776311 6219 6191 5269 4189 1548 1156 1552 12271 --
NM_001271chr15123169 3070 2946 2774 2724 2524 2392 1201 293 243 219 166 --2742 127 --
NM_001277chr113443 83 32 1120 ----
NM_001282chr172804 198 --11685 --
NM_001286chr182792 2727 2585 2326 2249 224 112 53 1981 ----
NM_001289chrX51658 1301 1269 225 166 ------
NM_001290chr42780 23 ------
NM_001293chr11166 ------
NM_001299chr192501 367 --1171 --
NM_001304chr1793665 3350 3312 3152 1270 971 722 674 153 1941 --1452
NM_001305chr74810 630 173 98 ------
NM_001310chr1232108 1894 1143 22312 1028 1101 --
NM_001313chr44894 766 309 297 ----1977
NM_001315chr642283 1429 36 30 ------
NM_001343chr521542 647 11182 --1274
NM_001344chr141172 ------
NM_001345chr12----1156 --
NM_001346chr311990 22300 2007 ----
NM_001349chr22557 178 ------
NM_001351chr3167 ------
NM_001356chrX22391 623 1125 ----
NM_001364chr1173784 3762 3620 3454 1552 924 395 --24720 3032 24181 609
NM_001383chr173601 249 131 --1606 --
NM_001386chr862357 959 884 768 204 24 ------
NM_001389chr211449 ------
NM_001390chr1853413 3302 2908 2498 2214 12339 ----
NM_001396chr2131793 984 244 ----1659
NM_001400chr1--11083 ----
NM_001402chr642035 1311 276 29 --21910 1274 --
NM_001406chr1731446 182 149 --31407 377 175 --
NM_001408chr12300 92 31680 1547 1376 1216 --
NM_001412chrX53749 3395 3184 1253 198 ------
NM_001419chr1943944 3633 586 520 --34405 4308 1911 --
NM_001421chrX61673 1596 1264 1126 1085 148 --1345 --
NM_001429chr2231060 924 419 ------
NM_001430chr221376 173 ----11955
NM_001431chr61329 ------
NM_001432chr463391 3158 2911 2895 1341 63 13951 ----
NM_001438chr163683 3191 2985 2763 354 303 11225 ----
NM_001448chrX31248 696 130 ------
NM_001449chrX21136 136 --1431 2469 351
NM_001451chr1621077 193 ------
NM_001453chr621264 222 ------
NM_001461chr11195 ------
NM_001478chr124837 253 125 97 ------
NM_001497chr982713 2273 1978 1929 1782 1108 528 519 --11092 --
NM_001498chr6--1488 1288 --
NM_001514chr11442 ------
NM_001521chr23628 612 152 ------
NM_001527chr674478 4082 3984 3265 1398 893 583 --34749 4126 2971 --
NM_001530chr141235 ------
NM_001542chr142550 2148 2098 690 ------
NM_001543chr583795 3587 3212 1848 1532 1390 618 189 --1307 --
NM_001546chr621426 358 ------
NM_001560chrX61901 1756 755 100 53 28 ------
NM_001565chr4--1247 ----
NM_001584chr1121035 245 --11108 --
NM_001587chrX52137 786 536 459 357 11738 ----
NM_001604chr112957 149 ------
NM_001614chr171649 ------
NM_001614chr171649 ------
NM_001616chr263515 3393 3308 1081 680 371 --11127 --
NM_001621chr761058 712 701 533 387 77 --12212 --
NM_001621chr761058 712 701 533 387 77 --12212 --
NM_001634chr632011 460 104 ------
NM_001635chr72830 198 --1704 --
NM_001642chr1171265 968 420 297 290 149 89 1526 11127 --
NM_001650chr1893770 2854 2602 1477 1297 1081 536 357 66 12968 13826 --
NM_001654chrX3337 297 111 ------
NM_001655chr1162004 1773 1472 861 382 95 --1426 --
NM_001656chr51743 1436 ----
NM_001658chr1123 --1265 --
NM_001659chr12102574 2496 2446 2267 2172 2158 2118 1709 1059 851 --32070 569 51 --
NM_001660chr31814 ------
NM_001663chr1432513 837 49 ------
NM_001664chr3----1928 --
NM_001668chr142115 697 337 44 ------
NM_001677chr14245 198 69 24 ------
NM_001678chr1761810 1228 1197 1166 300 169 ----1345
NM_001681chr122676 134 ------
NM_001682chr1212457 12857 ----
NM_001683chr352522 2315 460 223 54 --32583 2211 45 --
NM_001684chr164222 1658 1419 1057 487 226 24106 2580 13316 --
NM_001690chr352046 1655 578 345 262 12327 1693 --
NM_001695chr853833 3069 2616 601 383 11445 11640 --
NM_001699chr1961328 698 395 102 76 54 --3720 485 442 --
NM_001701chr931542 1285 1265 --1580 --
NM_001703chr12212 62 --123 --
NM_001704chr62484 156 ------
NM_001706chr32959 110 --1195 --
NM_001709chr1142010 2001 938 784 ----12671
NM_001717chr151968 1228 ----
NM_001730chr13--1483 ----
NM_001730chr13--1483 ----
NM_001742chr741389 681 364 136 132 1205 --
NM_001743chr2----195 --
NM_001746chr572884 2226 2176 2160 1917 861 755 22603 2560 ----
NM_001750chr521868 1521 ------
NM_001753chr731549 371 213 --1471 --
NM_001754chr2173169 2848 2767 2702 1558 1452 738 13873 ----
NM_001755chr1632266 518 351 ------
NM_001759chr1264876 4714 3822 3438 2087 1422 --23957 3797 --
NM_001789chr311376 11424 ----
NM_001791chr12543 377 ------
NM_001796chr16124 ------
NM_001799chr5--130 ----
NM_001800chr192573 189 --196 --
NM_001810chr202799 228 --3514 185 77 --
NM_001826chr1199 ------
NM_001830chrX63849 3074 2943 1408 1334 243 ----13295
NM_001833chr9147 ------
NM_001839chr1----1749 --
NM_001845chr132410 349 --197 --
NM_001850chr31142 ------
NM_001851chr61146 ------
NM_001854chr131381 1227 60 ------
NM_001858chr694995 4075 3753 1185 1009 795 703 539 47 24323 651 --11506
NM_001860chr921120 170 --1432 --
NM_001862chr2166 ------
NM_001872chr131341 ------
NM_001878chr13133 64 38 ------
NM_001893chr171337 ------
NM_001895chr202376 366 11104 ----
NM_001901chr61899 ----1381
NM_001903chr55931 705 304 199 54 ------
NM_001907chr162122 33 ------
NM_001918chr1139094 8673 8251 7720 6926 5652 3679 2988 2676 2596 2525 1863 145 11043 48146 6975 5645 3647 --
NM_001927chr2----2134 50 --
NM_001935chr21980 ------
NM_001936chr731572 635 460 ------
NM_001937chr14893 825 327 208 ------
NM_001938chr11693 ------
NM_001939chrX72549 2464 1427 1401 1299 441 93 12477 13816 1778
NM_001944chr1831943 662 376 --181 --
NM_001945chr531095 466 271 ------
NM_001949chr632093 782 727 22488 934 32032 1252 1069 --
NM_001951chr83551 428 226 1111 ----
NM_001954chr62593 586 --1340 --
NM_001957chr432006 1414 620 ------
NM_001964chr52181 141 ----11040
NM_001966chr3--11252 ----
NM_001968chr43910 269 208 ------
NM_001978chr81997 ------
NM_001980chr1231690 1668 855 --2434 253 22002 1775
NM_001981chr11561 ------
NM_001991chr1772097 2014 1687 1587 1577 121 67 ------
NM_001992chr522207 1934 ------
NM_001993chr1123 --1446 --
NM_001998chr31358 ------
NM_001999chr521075 457 ------
NM_002006chr494783 3609 2154 1629 1014 823 643 379 152 15576 ----
NM_002009chr15--22013 125 ----
NM_002010chr131102 --1511 --
NM_002015chr1352274 2238 1285 277 244 21146 535 12364 --
NM_002023chr151303 497 488 436 204 ------
NM_002024chrX21897 463 ------
NM_002025chrX98936 8210 7967 6826 6504 3598 3288 81 68 11591 52145 1895 1385 520 86 13660
NM_002026chr211003 ------
NM_002027chr81446 ------
NM_002031chr6----1216 --
NM_002037chr6156 ------
NM_002040chr2122845 1049 ------
NM_002045chr33342 134 79 ------
NM_002046chr12----157 --
NM_002048chr931122 533 46 ------
NM_002051chr1021109 452 1185 1161 --
NM_002056chr23772 299 144 ------
NM_002060chr11497 ------
NM_002061chr131940 1465 717 ------
NM_002063chrX21033 803 ------
NM_002065chr131771 271 49 1222 ----
NM_002069chr731520 1198 679 ------
NM_002074chr131231 1151 1137 ----1183
NM_002076chr1253254 1239 1187 528 337 --42672 2353 1283 264 13146
NM_002077chr971886 1833 1778 625 371 148 92 21904 1803 ----
NM_002083chr142123 32 ------
NM_002086chr1762039 1796 1550 867 234 137 ------
NM_002092chr444891 4846 4828 1318 --24597 1671 13223
NM_002094chr16158 ----191
NM_002103chr193955 747 84 --1857 --
NM_002106chr41339 ------
NM_002114chr61347 ------
NM_002119chr651616 592 557 206 190 --2391 101 --
NM_002126chr1751084 1015 808 373 128 23289 1640 33784 3501 3403 --
NM_002128chr1371889 1646 1014 848 706 534 67 ------
NM_002130chr521632 1105 21484 690 ----
NM_002136chr121473 ------
NM_002137chr7130 11833 ----
NM_002140chr931043 778 359 ------
NM_002145chr172141 53 ------
NM_002146chr1721329 535 ------
NM_002156chr2--1297 ----
NM_002157chr2143 150 ----
NM_002158chr253420 3138 2721 2323 846 22399 1167 ----
NM_002188chr5----1577 --
NM_002196chr202880 204 ------
NM_002196chr202880 204 ------
NM_002199chr42639 238 --1190 --
NM_002202chr51335 ------
NM_002204chr1741290 1229 1003 56 1187 2909 439 --
NM_002205chr12125 161 1865 11020
NM_002207chr3------1110
NM_002214chr7104960 4901 4486 4347 4220 3710 3551 1235 735 209 25445 3932 ----
NM_002223chr1233768 3494 1610 2373 55 13728 --
NM_002232chr121033 1006 ------
NM_002234chr121157 ------
NM_002235chr12111623 1267 1256 1232 1127 1061 674 459 121 79 72 --11205 --
NM_002241chr183094 2091 2039 599 541 193 112 23 12990 1180 --
NM_002247chr1022314 21 --1278 --
NM_002254chr272173 1548 844 775 536 529 259 ----11732
NM_002264chr364036 3554 1917 1773 611 225 ------
NM_002265chr17--1436 139 --
NM_002267chr1322135 1499 11575 1927 1339
NM_002270chr565683 5088 4651 2028 1383 179 --1147 --
NM_002272chr123455 353 122 --127 --
NM_002283chr124839 581 249 53 ------
NM_002285chr253798 3157 2919 1083 889 21618 74 ----
NM_002293chr142075 1780 1750 98 ------
NM_002298chr1331315 1113 37 ------
NM_002309chr2242042 1142 302 149 23019 2537 ----
NM_002310chr566325 5143 2262 2173 1050 295 --1601 --
NM_002333chr194281 263 249 35 --1224 --
NM_002334chr114784 751 596 86 11473 12024 --
NM_002336chr1264949 3615 3518 2039 1432 597 1341 11349 --
NM_002345chr122623 251 ------
NM_002355chr1221194 149 11175 1319 --
NM_002356chr622563 875 11914 ----
NM_002359chr1752909 1676 1568 682 389 23483 1423 --12919
NM_002372chr5198 ------
NM_002373chr1561177 987 936 880 61 32 --1551 --
NM_002374chr21321 --1402 --
NM_002375chr392156 2002 616 400 392 346 278 238 90 --1899 --
NM_002382chr1451179 1089 1055 192 186 --11068 --
NM_002383chr163908 600 284 ------
NM_002385chr182380 69 --11170 11206
NM_002387chr5115029 4954 4779 3674 1653 1366 1014 364 288 204 56 34216 1896 1544 11767 --
NM_002397chr532116 457 264 ------
NM_002399chr1531336 572 141 ------
NM_002401chr1721006 150 1682 21995 884 --
NM_002402chr74204 123 62 38 1287 1961 --
NM_002408chr141322 ------
NM_002419chr111373 ------
NM_002442chr122195 125 --21600 1266 11118
NM_002444chrX71810 1759 385 291 265 198 173 21409 240 ----
NM_002460chr673600 3569 3156 1357 1195 440 196 --33671 802 118 --
NM_002473chr222514 442 11360 21070 1036 --
NM_002480chr122225 71 11427 11022 --
NM_002481chr1167748 7635 7425 7261 7233 7148 7035 6711 2690 2403 2288 977 907 847 783 729 27240 5512 35874 3152 1188 11322
NM_002485chr842164 1531 759 311 ------
NM_002499chr1542268 1640 1517 703 ------
NM_002500chr221219 92 --141 --
NM_002501chr1954085 3716 3229 1088 658 14134 ----
NM_002504chr91265 --1971 --
NM_002508chr131787 1635 576 11931 1149 --
NM_002515chr1451748 1333 656 365 48 1751 1802 11496
NM_002519chr111390 ------
NM_002522chr17103888 3759 2911 2705 2516 1282 1232 1062 240 201 11575 12628 --
NM_002524chr12912 198 1762 ----
NM_002536chrX1247 ----11079
NM_002546chr81295 1225 ----
NM_002552chr22305 133 1191 ----
NM_002553chr72451 384 ------
NM_002569chr1531309 1175 608 ------
NM_002572chr112286 56 ------
NM_002576chr1131205 1126 108 ----11176
NM_002577chr393717 3515 3238 2852 2773 2515 1070 783 324 --12559 1764
NM_002578chrX1151 ------
NM_002581chr955646 4724 1584 1179 964 15187 --24030 1088
NM_002583chr124557 476 458 437 143 ----
NM_002585chr1--1318 ----
NM_002586chr651576 1489 409 390 354 ------
NM_002588chr551313 1105 700 371 211 ------
NM_002589chr42117 106 ------
NM_002594chr2011578 --22055 138 --
NM_002595chr1251519 1289 738 722 333 --11790 --
NM_002597chr11316 ------
NM_002599chr1151049 935 334 252 51 ------
NM_002600chr121404 374 11481 --1344
NM_002603chr81167 ------
NM_002605chr153802 440 200 1455 ----
NM_002607chr7188 ------
NM_002608chr22----11501 --
NM_002623chr201138 ------
NM_002636chr61431 --1341 --
NM_002641chrX--1257 ----
NM_002645chr1172944 2081 963 921 702 393 216 22694 600 ----
NM_002646chr132151 802 658 11926 11464 --
NM_002653chr56926 913 335 188 151 144 ------
NM_002655chr895053 3225 1758 1340 1193 925 298 220 78 11471 --13966
NM_002657chr20103598 2751 2559 2479 1549 1363 1324 1303 525 471 --13169 --
NM_002662chr382136 2102 1919 1909 1865 1801 1647 574 --11969 --
NM_002677chr832247 1084 615 165 --12228
NM_002698chr1942663 2528 321 226 22782 2417 1646 --
NM_002714chr64846 165 133 86 ------
NM_002716chr1163349 2977 2354 2295 1324 697 --23553 295 12500
NM_002717chr83177 90 29 1696 ----
NM_002718chr332584 2195 611 ------
NM_002719chr1431825 1540 558 --21521 191 --
NM_002720chr162196 49 ------
NM_002721chr9127 ------
NM_002729chr101794 ------
NM_002730chr1961233 1218 1169 425 283 229 ------
NM_002731chr133111 2804 777 --22965 2917 --
NM_002733chr12----148 --
NM_002736chr721749 1489 161 ----
NM_002738chr1621079 387 ------
NM_002740chr322768 2164 ----12854
NM_002745chr2251764 1264 417 407 108 --44200 1327 262 225 --
NM_002748chr15----1870 --
NM_002752chr51134 ------
NM_002755chr152612 577 ------
NM_002757chr151280 1334 ----
NM_002758chr171378 --132 --
NM_002760chrY85977 5940 4984 4834 4671 4220 4096 3692 24496 3834 ----
NM_002763chr13555 429 177 ------
NM_002776chr1981978 1921 1661 1650 1455 1321 709 190 1792 1700 --
NM_002814chrX1215 ------
NM_002816chr171285 ------
NM_002822chr1221591 588 ------
NM_002823chr2164 ------
NM_002827chr203720 391 205 --133 --
NM_002828chr182848 714 ------
NM_002830chr2156 ------
NM_002833chr1531345 1298 359 161 --11021
NM_002834chr1221639 175 --11593 22998 2811
NM_002839chr932699 2549 803 ------
NM_002840chr161567 1304 1266 417 253 110 ------
NM_002841chr31523 ----1169
NM_002843chr1163228 3016 2294 2240 1170 1127 12874 32968 795 415 --
NM_002849chr122919 731 ------
NM_002851chr7--1559 ----
NM_002852chr32585 393 ------
NM_002855chr1183438 3389 3096 3082 2484 1225 390 82 ------
NM_002858chr131267 923 285 ------
NM_002859chr1251822 1660 1559 232 125 1625 11224 11205
NM_002860chr102516 76 ----1671
NM_002863chr14166 ------
NM_002865chr8138 ------
NM_002868chr1262004 1911 820 335 209 192 ------
NM_002869chr1151784 1777 412 402 371 --2499 39 --
NM_002871chr161744 1345 1245 320 88 45 --1681 --
NM_002874chr941810 797 542 58 ------
NM_002886chr324838 3826 --1785 --
NM_002890chr51771 ------
NM_002891chr15178 ------
NM_002892chr141609 ------
NM_002901chr111406 1811 ----
NM_002906chr1141954 1918 416 231 ------
NM_002911chr1951331 682 256 118 97 --11431 --
NM_002912chr62180 104 ------
NM_002924chr1140 ------
NM_002942chr321361 313 ------
NM_002953chr12313 223 ------
NM_002955chr641964 1306 1275 700 --21531 1497 --
NM_002958chr3151 ------
NM_002959chr152846 1414 561 521 340 --194 --
NM_002968chr16166 ------
NM_002970chrX1105 ------
NM_002973chr122490 49 ------
NM_002994chr451732 1319 1202 308 155 ------
NM_002997chr251288 470 170 49 38 1447 ----
NM_002998chr832166 796 546 21522 37 21621 135 --
NM_002999chr2041818 1515 1495 162 ------
NM_003001chr142222 2204 417 248 --11449 --
NM_003010chr1741913 1507 974 343 --11851 --
NM_003011chr931679 1444 1083 ------
NM_003012chr842777 979 264 151 ------
NM_003013chr41287 --1732 --
NM_003017chr631198 1089 962 --1953 --
NM_003022chrX147 ------
NM_003026chr93960 918 57 ------
NM_003029chr121461 1036 ------
NM_003030chr31232 --169 1124
NM_003031chr161637 1207 ----
NM_003032chr31622 --11841 11758
NM_003034chr12107313 7027 6219 5987 3156 2937 2342 2098 966 952 22271 1556 11297 --
NM_003035chr12378 105 1208 ----
NM_003036chr11180 --1165 --
NM_003042chr321709 1692 --1822 --
NM_003045chr13104527 3677 3370 3159 3125 695 666 426 256 244 34692 4231 1421 1118 --
NM_003046chr865366 4650 3782 3711 1219 522 24691 394 ----
NM_003051chr141457 772 464 64 ------
NM_003060chr531147 996 404 11288 ----
NM_003068chr821099 696 ------
NM_003069chrX--1107 ----
NM_003070chr91599 ------
NM_003071chr331934 1725 1542 ------
NM_003072chr193421 352 316 --1362 --
NM_003074chr351867 1467 922 914 141 1690 11794 --
NM_003075chr122329 76 ------
NM_003079chr172847 810 --1335 --
NM_003081chr20----1117 --
NM_003088chr731067 198 173 ------
NM_003101chr151446 1247 1145 173 130 2363 32 ----
NM_003107chr632579 2139 226 11625 ----
NM_003108chr286555 5065 2921 2479 1861 1837 601 433 --36186 5465 2909 12023
NM_003110chr174756 430 361 110 ------
NM_003112chr722749 1069 12581 ----
NM_003113chr22662 64 ------
NM_003128chr232602 2410 916 12250 ----
NM_003131chr641920 1909 224 148 ------
NM_003137chr662147 1800 594 542 282 186 22212 688 ----
NM_003139chr114681 242 203 147 ----1211
NM_003142chr2191 ------
NM_003144chr651877 788 738 378 109 ------
NM_003149chr331442 1215 298 --1176 --
NM_003150chr1772281 2190 2179 2149 2001 830 134 ------
NM_003155chr842434 1732 882 331 ------
NM_003156chr1141227 1034 468 250 ------
NM_003161chr1742446 1123 1064 326 12738 ----
NM_003168chr172926 837 1751 1722 --
NM_003178chr31200 2796 571 22020 90 --
NM_003179chrX41127 389 199 181 ------
NM_003181chr6175 ----1272
NM_003186chr112313 62 1129 --1341
NM_003189chr162613 1326 1098 841 469 300 12961 ----
NM_003198chr1------1229
NM_003199chr1821089 101 11820 ----
NM_003201chr10--1220 ----
NM_003202chr561755 1745 1300 610 119 57 --1594 --
NM_003204chr1751575 1113 675 512 182 ------
NM_003214chr62329 167 --11237 --
NM_003216chr2253285 2426 2379 818 437 --23249 204 --
NM_003217chr1251852 1578 1504 445 215 21586 1404 1469 --
NM_003220chr661587 1254 1103 234 140 107 --11515 --
NM_003221chr683471 3198 3117 2909 2857 2836 1627 251 ------
NM_003234chr332089 1913 1622 ------
NM_003236chr252740 2528 2207 1281 110 23169 852 22595 442 --
NM_003238chr11232 ------
NM_003239chr143843 57 43 ----191
NM_003243chr131018 792 56 ------
NM_003246chr1571949 1770 1735 1600 751 393 292 ------
NM_003247chr641460 808 489 214 11963 ----
NM_003250chr171340 --1357 --
NM_003253chr2131803 1660 1307 ------
NM_003255chr171859 ------
NM_003257chr151277 --11248 --
NM_003259chr191125 ------
NM_003262chr354436 3762 3475 1587 701 1113 14480 --
NM_003270chrX1264 11059 ----
NM_003274chr2132963 2470 967 1977 ----
NM_003286chr204448 342 308 73 1317 ----
NM_003291chr131103 1153 ----
NM_003292chr1--12258 ----
NM_003298chr345230 4297 1059 532 --13765 --
NM_003304chr3----11559 --
NM_003309chr631734 383 189 --1675 --
NM_003319chr21406 ------
NM_003320chr1184114 3933 3675 3071 1585 1323 1305 549 1175 21263 1021 --
NM_003329chr9131 ------
NM_003334chrX2148 71 ------
NM_003336chrX2889 69 ------
NM_003338chr102408 124 ------
NM_003339chr521618 363 ------
NM_003340chr41447 11340 1335 --
NM_003342chr1733046 3023 2945 ------
NM_003344chr7--1286 11585 --
NM_003345chr161136 ------
NM_003347chr2252284 2223 849 379 234 --32207 1939 1890 --
NM_003348chr1231554 562 177 ------
NM_003349chr2081600 1332 1149 620 581 485 232 128 ------
NM_003350chr821053 161 ------
NM_003359chr42941 921 --2173 132 --
NM_003363chr32559 517 ----1509
NM_003368chr11101 ------
NM_003369chr1142685 2392 2031 627 --1567 --
NM_003371chr96625 534 524 198 170 117 --1544 --
NM_003372chrX1353 ------
NM_003375chr10163 1346 ----
NM_003376chr641752 583 520 471 --11191 --
NM_003376chr641752 583 520 471 --11191 --
NM_003383chr91568 ------
NM_003387chr252079 1102 1039 769 321 --1456 --
NM_003390chr112256 219 163 ----
NM_003392chr393879 2916 1548 1300 1272 1095 920 41 28 13556 --11675
NM_003400chr22258 172 --1561 --
NM_003403chr141692 ------
NM_003404chr2021642 400 ------
NM_003406chr831794 1569 561 ------
NM_003409chr1841216 571 561 200 --1117 --
NM_003410chrX12728 12088 ----
NM_003411chrY2362 134 ----1729
NM_003412chr352715 2327 2240 1974 1127 --12070 --
NM_003413chrX1276 2783 614 ----
NM_003418chr32250 70 ------
NM_003431chr1----1489 1213
NM_003439chr72526 412 1690 --13007
NM_003445chr192805 333 ------
NM_003458chr363273 3252 2806 962 812 238 --22978 1510 --
NM_003463chr662850 2628 2600 615 497 23 1554 ----
NM_003468chr273965 3049 2832 952 702 504 352 --12768 --
NM_003469chr22139 24 ------
NM_003470chr1631867 1632 598 11317 ----
NM_003471chr331885 740 160 12097 22115 492 --
NM_003474chr101136 1259 21654 856 --
NM_003478chr1122247 249 ------
NM_003482chr1252057 2041 1113 583 268 --2766 740 1384
NM_003483chr1252892 481 374 304 102 --12258 --
NM_003489chr21--1199 13213 --
NM_003490chr2241045 835 821 165 ------
NM_003496chr74802 708 606 116 ------
NM_003498chr1672670 2570 2301 2257 913 660 304 32772 1882 1784 22417 204 --
NM_003507chr232025 1946 511 1115 ----
NM_003558chr94684 546 272 106 ------
NM_003565chr1221433 334 ------
NM_003566chr121214 ------
NM_003574chr18115178 5061 4537 3687 3577 1656 916 787 655 408 191 ------
NM_003576chr1352415 884 486 163 111 ------
NM_003583chr1232610 1032 917 1288 ----
NM_003586chr161476 ------
NM_003589chr1321282 536 ------
NM_003590chr232956 1619 845 23570 129 1763 --
NM_003607chr193835 3778 3647 2665 1691 943 434 276 58 21744 1724 12805 --
NM_003613chr152240 51 1158 ----
NM_003615chr333927 808 640 23234 2528 12868 --
NM_003617chr1114706 4168 3275 3243 1764 877 507 416 201 178 67 --1676 --
NM_003618chr22896 51 ------
NM_003624chr1921211 550 --4917 516 292 117 --
NM_003626chr1111401 ------
NM_003628chr22698 669 ------
NM_003629chr132890 792 203 22824 2673 22720 2446 --
NM_003633chr572356 2199 2168 2018 1029 517 38 ------
NM_003637chr131225 432 413 ------
NM_003642chr21226 ------
NM_003644chr1775352 2217 1195 1106 952 553 316 1106 45620 5265 1551 516 11489
NM_003645chr15----1206 --
NM_003654chr114495 240 194 136 ------
NM_003658chr113671 589 147 --1730 --
NM_003663chr321156 592 --1161 --
NM_003664chr5157 ------
NM_003671chr922749 146 1974 31084 1021 777 13098
NM_003672chr111727 21280 773 ----
NM_003677chr121299 --1506 --
NM_003679chr183411 2891 2356 915 762 725 681 74 13327 12317 --
NM_003685chr191173 ------
NM_003690chr22574 243 1542 ----
NM_003692chr91312 ------
NM_003709chr21115 --2335 92 --
NM_003713chr151486 1216 695 447 410 11247 ----
NM_003714chr562444 2410 2313 940 701 634 ----12306
NM_003716chr32696 76 1179 ----
NM_003718chr71467 ------
NM_003735chr551313 1105 700 371 211 ------
NM_003736chr551313 1105 700 371 211 ------
NM_003737chr112421 61 1375 ----
NM_003741chr33335 277 138 ------
NM_003743chr211394 22177 1652 ----
NM_003759chr453668 3077 1560 712 585 ----12753
NM_003763chr20112939 2611 2576 2464 2312 2037 1074 981 729 574 548 11081 ----
NM_003768chr181786 1479 750 736 320 305 248 100 1688 ----
NM_003769chr121315 ------
NM_003779chr1----2144 76 --
NM_003787chr182586 48 2362 25 ----
NM_003792chr91132 ------
NM_003794chr31404 ------
NM_003795chr62433 408 ------
NM_003797chr111187 ------
NM_003800chr662340 2219 2101 1977 1634 63 12438 1872 --
NM_003816chr831410 1328 521 ------
NM_003818chr20----1105 --
NM_003822chr12834 351 ----12649
NM_003825chr1521548 979 ------
NM_003829chr911108 --149 --
NM_003831chr1831790 1351 1194 ------
NM_003860chr112332 282 ------
NM_003861chr1441089 1022 727 189 --1544 --
NM_003872chr242933 2462 2012 1056 --12693 --
NM_003873chr1031858 795 678 1113 --1850
NM_003877chr121900 1817 ----
NM_003887chr231809 899 122 1637 --1888
NM_003888chr1541526 1165 1119 146 11144 11179 --
NM_003901chr1052704 2249 1675 1035 979 11992 42389 1900 573 557 --
NM_003902chr12685 648 1170 ----
NM_003908chr2051335 1183 1064 1008 184 ------
NM_003913chr673559 3160 1573 1212 1185 1054 199 ------
NM_003916chrX1916 ------
NM_003922chr15148 ------
NM_003927chr184876 393 287 75 ------
NM_003929chr151754 1149 544 333 112 --1132 --
NM_003939chr1073167 2845 2681 1107 431 106 39 --22661 317 --
NM_003941chr732027 359 236 ------
NM_003942chr114670 513 130 59 ------
NM_003947chr32316 211 --11022 --
NM_003948chr432156 917 224 ----12372
NM_003953chr162318 2193 1083 990 578 73 --2527 242 --
NM_003968chr3--1667 ----
NM_003972chr101147 ------
NM_003982chr143281 83 48 ------
NM_003983chr1694129 4054 4027 3797 3775 2972 2957 2808 141 --53756 3503 3438 3357 1747 --
NM_003994chr1264105 4035 2850 938 639 511 ------
NM_004006chrX32216 2008 1943 1935 ----
NM_004007chrX32216 2008 1943 1935 ----
NM_004009chrX32216 2008 1943 1935 ----
NM_004010chrX32216 2008 1943 1935 ----
NM_004011chrX32216 2008 1943 1935 ----
NM_004012chrX32216 2008 1943 1935 ----
NM_004013chrX32216 2008 1943 1935 ----
NM_004014chrX32216 2008 1943 1935 ----
NM_004015chrX32216 2008 1943 1935 ----
NM_004016chrX32130 1922 1857 1849 ----
NM_004017chrX32216 2008 1943 1935 ----
NM_004018chrX32130 1922 1857 1849 ----
NM_004020chrX32216 2008 1943 1935 ----
NM_004021chrX32130 1922 1857 1849 ----
NM_004022chrX32130 1922 1857 1849 ----
NM_004023chrX32130 1922 1857 1849 ----
NM_004024chr141425 1165 525 433 ------
NM_004028chr1893770 2854 2602 1477 1297 1081 536 357 66 12968 13826 --
NM_004036chr22694 289 ------
NM_004047chr1131 ------
NM_004050chr1432564 2557 876 11963 ----
NM_004067chr721390 375 ------
NM_004068chr31394 ------
NM_004073chr1----187 --
NM_004077chr1221144 286 ------
NM_004078chr13968 180 31 ----11114
NM_004080chr741488 1253 1194 941 ------
NM_004081chrY21830 155 --11457 --
NM_004083chr12278 26 165 ----
NM_004085chrX1291 1815 ----
NM_004087chr321419 1381 --11548 --
NM_004089chrX41195 958 251 160 1916 11090 --
NM_004090chr1743088 2945 2676 2478 13194 11077 --
NM_004093chr1352009 606 549 502 237 11024 1764 --
NM_004094chr1422938 863 22561 2095 12082 --
NM_004098chr1021017 437 ------
NM_004103chr83874 782 263 ------
NM_004105chr241050 839 345 219 1382 ----
NM_004113chr351725 1688 1602 65 57 ------
NM_004114chrX21014 179 ------
NM_004116chr22436 67 --1115 --
NM_004124chr1422257 309 11245 --13378
NM_004134chr51659 ------
NM_004136chr1553097 731 442 374 106 12610 ----
NM_004152chr192347 128 ------
NM_004156chr81402 ------
NM_004157chr34214 195 120 111 ------
NM_004171chr1189089 7795 7674 6296 3715 2820 754 220 25989 1804 49351 6265 6134 2009 --
NM_004183chr112623 218 ------
NM_004187chrX31464 1318 413 ------
NM_004193chr103372 366 58 ------
NM_004200chr1183049 2220 2069 1250 1211 565 518 343 --1884 --
NM_004202chrY127 ------
NM_004225chr811060 11529 ----
NM_004228chr19----1125 --
NM_004229chrX51580 1559 1490 1381 550 --11447 --
NM_004232chr1831556 1116 315 13794 ----
NM_004236chr15184 ------
NM_004272chr52720 162 ------
NM_004274chr1473041 2936 2871 2613 1261 343 120 ----139
NM_004277chr6----11405 --
NM_004290chr531257 949 537 1158 ----
NM_004296chr1494055 3914 3677 1390 887 533 361 267 105 --12597 --
NM_004301chr31125 ------
NM_004311chr1062751 2264 2216 969 607 153 11020 12841 --
NM_004316chr1211029 ------
NM_004319chr1103091 2949 2642 2223 2164 2067 1122 474 390 372 11164 11202 12568
NM_004323chr962163 2061 2013 1974 1047 127 --12432 --
NM_004327chr2251634 1566 923 505 338 --1399 --
NM_004330chr153960 912 163 ------
NM_004331chr8183 12063 --11860
NM_004338chr1875818 4932 2667 2287 1974 1331 57 --26445 1131 --
NM_004341chr2--1240 ----
NM_004342chr732311 2017 480 22226 259 ----
NM_004344chrX124 ------
NM_004346chr441347 1017 362 92 --11362 --
NM_004350chr121991 776 --31897 303 25 --
NM_004359chr19135 ------
NM_004360chr1641902 745 348 157 --1535 --
NM_004362chr42708 585 ------
NM_004364chr1921294 822 ----1324
NM_004370chr632159 1811 668 12213 ----
NM_004379chr221753 193 ------
NM_004380chr1652173 2115 1839 1660 831 --11020 --
NM_004384chr52582 103 ------
NM_004389chr21868 1166 ----
NM_004392chr1332322 2025 1681 2679 175 ----
NM_004393chr352120 1933 1527 794 90 12320 21795 742 --
NM_004397chr1142622 1590 645 197 14106 14332 --
NM_004404chr221641 754 21428 353 ----
NM_004405chr22413 151 1961 190 1821
NM_004408chr92514 345 ------
NM_004411chr7--2642 179 122 1757
NM_004414chr2131485 1181 396 1223 ----
NM_004415chr6154 ------
NM_004417chr5----136 --
NM_004419chr101233 ------
NM_004420chr1192234 2124 2014 1948 1857 1806 1632 953 887 --1588 12325
NM_004423chr361101 725 513 358 316 227 --12381 --
NM_004426chr1231862 1392 45 --1658 --
NM_004427chr141009 416 307 281 ------
NM_004430chr882213 1845 947 904 645 264 223 24 ------
NM_004432chr922206 2013 ------
NM_004434chr142356 69 --11320 --
NM_004437chr153254 2799 2293 1166 316 --11373 12196
NM_004438chr241323 1176 419 376 --12671 --
NM_004440chr611815 ------
NM_004442chr171501 1358 1351 1274 566 479 83 --11190 --
NM_004446chr1137 ------
NM_004447chr123328 168 28 --1422 --
NM_004448chr172583 381 ------
NM_004450chr141100 ------
NM_004454chr332065 575 48 --12102 --
NM_004457chr211146 ------
NM_004459chr1721655 1364 ------
NM_004464chr423388 578 --21104 1016 --
NM_004469chrX169 ------
NM_004474chr13960 931 399 --11037 --
NM_004482chr21638 ------
NM_004484chrX1311 ------
NM_004494chr16987 347 263 138 129 58 --11188 11143
NM_004497chr191257 1668 2209 95 --
NM_004498chr15--1321 ----
NM_004500chr1451912 1707 1533 175 33 --1113 --
NM_004501chr163532 3101 1454 929 767 353 ------
NM_004503chr122334 87 ------
NM_004504chr282973 2911 2763 2497 2402 847 446 440 186 ----
NM_004505chr1721653 577 181 ----
NM_004506chr61147 ------
NM_004514chr1773005 2864 2814 2617 2610 2326 869 2488 223 ----
NM_004515chr1162 ------
NM_004520chr5139 1494 ----
NM_004535chr2011794 --1707 --
NM_004538chrX--2766 653 ----
NM_004540chr211642 180 ----
NM_004543chr2174 ------
NM_004549chr1111051 132 21262 271 --
NM_004569chr141213 ------
NM_004575chr421392 1041 1630 ----
NM_004578chr13946 898 822 --1752 --
NM_004580chr1551628 1617 1208 710 123 --1722 --
NM_004583chr176529 281 271 254 98 62 --2594 21 --
NM_004586chrX105120 5074 4429 4067 2148 1928 1724 1367 1279 687 1245 ----
NM_004588chr11104054 3615 3263 3122 1574 1451 1362 637 337 175 ------
NM_004598chr5103066 2936 2710 2592 2454 2107 2083 1327 1062 104 33116 2209 1185 ----
NM_004602chr2041390 553 483 385 11517 ----
NM_004603chr731158 1084 25 ------
NM_004612chr954580 3620 3321 1620 1317 14142 --186
NM_004614chr1611522 ------
NM_004630chr1121109 1051 11186 1360 --
NM_004631chr12488 274 ------
NM_004634chr31562 --162 --
NM_004635chr35924 778 762 417 326 --11160 --
NM_004637chr331188 494 355 ------
NM_004640chr62148 78 ------
NM_004654chrY21049 133 ------
NM_004655chr1741170 1113 1059 849 ------
NM_004660chrY32259 916 619 ------
NM_004663chr1531170 281 164 ------
NM_004664chr121228 ------
NM_004670chr1031540 461 266 ------
NM_004673chr121488 1176 1483 ----
NM_004686chr851730 1704 671 343 259 ------
NM_004687chr172837 186 ------
NM_004694chr172101 27 ------
NM_004703chr1762417 2380 2002 1994 1891 502 2575 510 ----
NM_004705chr111296 2125 109 ----
NM_004713chr141653 ------
NM_004716chr112681 113 ------
NM_004717chr751417 1333 1246 1161 393 11081 --1189
NM_004719chr1221922 1011 12849 ----
NM_004721chr32264 77 ------
NM_004723chr11364 ----134
NM_004725chr101295 ------
NM_004726chrX74095 3812 3670 1682 1510 1363 1220 11274 35202 4262 1902 --
NM_004729chrX32070 1661 107 1727 146 --
NM_004730chr531820 781 459 ------
NM_004731chr1231791 1429 1215 11269 ----
NM_004734chr1342496 2469 1229 1077 13297 ----
NM_004736chr122179 40 --21393 164 --
NM_004737chr2241203 1095 826 146 ------
NM_004740chr17167 --1275 --
NM_004742chr331792 1449 504 21496 1222 ----
NM_004745chr8126464 6096 6037 5809 5730 5664 2347 2216 2029 1705 1325 483 ----21691 98
NM_004748chr1543715 1388 1041 232 186 ----
NM_004755chr14130 ------
NM_004758chr1731081 771 266 1473 ----
NM_004761chr63405 386 140 ------
NM_004763chr26870 794 738 402 346 290 ------
NM_004766chr31188 ------
NM_004768chr11854 ------
NM_004772chr51320 --11374 --
NM_004774chr1731229 1159 1031 --11111 --
NM_004776chr2053123 2682 939 185 173 23132 2931 1264 12446
NM_004779chr551350 1195 1161 884 220 ------
NM_004781chr11406 1503 31755 1690 88 --
NM_004781chr11406 1503 31755 1690 88 --
NM_004785chr162404 111 ------
NM_004786chr181152 ------
NM_004788chr1132530 2510 2020 ------
NM_004791chr132703 109 ------
NM_004794chrX136 ------
NM_004798chr2033219 2277 1224 ----23139 2701
NM_004801chr2--11466 ----
NM_004808chr1063146 2846 2758 2102 953 483 --22147 690 --
NM_004814chr12164 110 ------
NM_004815chr184809 4619 4266 4102 3866 3696 3231 1342 --24202 201 14702
NM_004831chr191855 ------
NM_004834chr243375 2645 647 182 --12112 --
NM_004836chr23858 832 50 ------
NM_004839chr152568 142 ------
NM_004840chrX52007 1619 756 377 82 --2802 152 158
NM_004841chr141090 869 250 43 ------
NM_004842chr641730 1658 1384 431 11425 ----
NM_004844chr32798 401 ------
NM_004845chrX94143 4089 3950 3782 1667 1059 880 704 165 1520 13036 --
NM_004849chr621208 199 31594 1367 248 ----
NM_004850chr231749 524 397 ------
NM_004857chr1441626 1508 1018 875 2751 176 23992 1552 --
NM_004859chr1763024 2920 1948 648 613 59 1811 ----
NM_004860chr173562 408 390 ------
NM_004862chr1631077 1033 1015 11517 ----
NM_004866chr524904 4340 11287 24951 4026 1286
NM_004867chrX2600 155 ------
NM_004869chr181122 ------
NM_004872chr1148 ------
NM_004883chr5138 --168 --
NM_004884chr1541189 663 72 45 ------
NM_004893chr5----181 --
NM_004896chr101257 ------
NM_004897chr103740 268 184 ------
NM_004898chr442644 2526 393 49 ------
NM_004902chr201102 --1194 --
NM_004904chr7166579 5987 4905 4856 4591 2628 1968 1738 1622 1609 1568 1403 1205 763 621 588 25151 535 ----
NM_004921chr132200 523 331 ------
NM_004922chr102762 266 ------
NM_004925chr95791 193 161 30 24 153 ----
NM_004926chr1471647 1140 494 395 250 85 30 ------
NM_004929chr821344 566 1359 ----
NM_004932chr55665 302 295 271 72 ------
NM_004945chr192796 775 ------
NM_004947chr352593 2479 2004 669 146 1572 11652 --
NM_004948chr1821432 1302 ------
NM_004956chr764271 3519 1805 785 490 412 13451 --11036
NM_004958chr13682 135 66 --1704 --
NM_004959chr961294 1014 929 217 140 77 ------
NM_004961chrX51168 1009 390 184 123 1190 21243 1221 --
NM_004962chr102480 118 --1261 --
NM_004965chr212672 147 ------
NM_004968chr72626 286 ------
NM_004973chr631483 352 228 11290 ----
NM_004976chr1184717 3991 3938 3672 3579 1715 1451 923 1329 24756 173 --
NM_004979chrX1281 ----1117
NM_004985chr1254162 3584 1501 1147 558 23673 2788 ----
NM_004992chrX148014 7890 7414 7364 7081 6823 6011 5894 5184 1893 1696 1004 684 452 36585 2722 293 --28508 5267
NM_004992chrX148014 7890 7414 7364 7081 6823 6011 5894 5184 1893 1696 1004 684 452 36585 2722 293 --28508 5267
NM_004995chr142474 23 ----11336
NM_004996chr16----1384 --
NM_005006chr21353 11068 ----
NM_005010chr71613 ------
NM_005011chr721850 222 1529 ----
NM_005012chr11137 ------
NM_005016chr121139 ------
NM_005017chr32261 41 ------
NM_005020chr71602 1468 ----
NM_005023chr511346 --1411 --
NM_005026chr151969 1593 1477 555 508 11810 1388 --
NM_005028chr1051955 1837 1789 1525 301 ------
NM_005036chr22146978 5319 3339 3141 3099 2181 1858 1215 1105 1028 978 830 375 366 --28292 941 --
NM_005044chrX104497 4335 3503 3454 3350 3245 3190 1503 1034 117 23578 3015 1273 --
NM_005045chr71724 ------
NM_005053chr191411 ------
NM_005056chr12105583 4945 3972 2212 1918 1721 1577 956 709 327 11417 25095 4217 --
NM_005057chr161859 1699 1536 431 373 31 ------
NM_005063chr1073653 3369 2984 2556 2414 1204 116 23378 74 1229 13022
NM_005065chr1475318 3580 1862 1847 1167 761 294 12041 11198 11412
NM_005066chr11768 1271 ----
NM_005073chr13179 --1239 --
NM_005077chr91361 ------
NM_005087chr31526 1709 1184 --
NM_005095chr141794 791 617 546 ------
NM_005096chrX51148 1076 999 431 131 ------
NM_005109chr3178 1427 ----
NM_005110chr52665 252 ------
NM_005114chr4--1263 135 --
NM_005116chr2081820 1435 1295 1173 1091 997 778 230 13448 ----
NM_005117chr114317 238 153 28 ------
NM_005121chr1743189 1309 764 701 22751 990 ----
NM_005124chr61791 1255 ----
NM_005126chr331715 1635 486 ----1761
NM_005131chr18173 ------
NM_005135chr1593279 3175 3056 3030 2801 2453 1117 676 87 12705 22440 527 12357
NM_005137chr22102204 2198 2144 1006 984 902 842 664 234 122 --11740 --
NM_005144chr881205 1163 1121 931 398 392 377 289 --2441 432 2806 385
NM_005156chr934789 839 608 12084 ----
NM_005160chr22116663 6427 6134 4657 4551 2329 2056 1723 1269 387 263 35527 4602 191 34570 2488 1155 11172
NM_005168chr221701 370 ----11200
NM_005180chr102485 279 --11631 --
NM_005182chr16----1458 --
NM_005187chr1631649 156 147 11979 ----
NM_005188chr11116251 5717 5627 3253 3189 3106 3082 2927 2613 1617 499 --12279 --
NM_005190chr6147 ------
NM_005197chr1485638 5342 4250 4241 3907 3816 573 299 35113 4228 467 25003 457 --
NM_005204chr101284 ------
NM_005206chr1721425 78 ------
NM_005207chr2243569 3212 2875 1332 23395 2433 12750 11338
NM_005215chr182291 243 ------
NM_005216chr12499 188 ------
NM_005221chr7139 ------
NM_005224chr19--1534 ----
NM_005225chr2021130 1123 1872 1958 --
NM_005227chr11449 ------
NM_005229chrX51214 945 348 291 246 --1812 --
NM_005231chr1131415 1113 1089 --1460 --
NM_005233chr342424 1047 795 499 1292 ----
NM_005235chr277188 7019 6139 5601 4752 2698 292 32278 1021 985 --25488 5203
NM_005238chr1132965 2554 350 --1724 1747
NM_005245chr41173 1499 ----
NM_005249chr142609 107 ------
NM_005254chr1521341 284 --11438 --
NM_005256chr112858 48 ------
NM_005261chr8152 --1108 --
NM_005263chr12327 91 ------
NM_005266chr141322 742 724 100 --191 --
NM_005271chr102981 25 ------
NM_005276chr1241710 1259 184 123 ------
NM_005276chr1241710 1259 184 123 ------
NM_005277chr421404 445 ------
NM_005281chr11845 ------
NM_005284chr61507 ------
NM_005296chrX--1394 ----
NM_005302chr71129 ------
NM_005308chr103428 351 176 ------
NM_005311chr751915 1869 962 795 647 ------
NM_005313chr1561128 1078 1053 930 376 60 ------
NM_005324chr1741696 1573 1385 393 --11749 --
NM_005328chr82292 105 ------
NM_005334chrX51621 1220 595 186 117 --1253 --
NM_005338chr763912 3684 3613 3118 607 112 13260 12870 --
NM_005339chr454035 3861 3645 3475 132 24181 3400 ----
NM_005342chrX102700 2677 2658 1893 1020 981 917 911 731 271 --12606 --
NM_005347chr921670 1318 11212 ----
NM_005359chr1854653 4285 4033 2364 1714 11760 22152 899 --
NM_005369chrX1510 --1435 --
NM_005370chr1951194 837 819 511 69 --1351 --
NM_005374chr17102327 2275 2145 2044 1601 1591 929 413 220 27 --3678 500 234 12405
NM_005375chr611089 ------
NM_005376chr121090 445 --1961 --
NM_005378chr2127 ------
NM_005382chr8----1362 --
NM_005384chr92107 85 ------
NM_005386chr202617 221 --1597 1721
NM_005392chr961563 1557 1524 1503 674 270 ------
NM_005397chr762842 1259 1205 988 633 205 --32727 1367 874 --
NM_005398chr1041460 1415 932 282 11293 ----
NM_005399chr174363 3083 1397 870 439 432 390 11362 24066 2735 --
NM_005400chr262239 1891 1051 287 270 124 ------
NM_005402chr741518 1280 669 392 21352 67 ----
NM_005407chr1421305 528 ------
NM_005410chr5--1129 ----
NM_005415chr21210 ------
NM_005418chr111534 ------
NM_005429chr41272 --1328 --
NM_005430chr123903 806 145 ------
NM_005433chr1821125 791 22788 2756 ----
NM_005434chr261659 1646 485 321 294 108 11773 21653 490 --
NM_005435chr71549 ------
NM_005436chr1063394 2990 2699 2563 772 135 13359 ----
NM_005437chr10--11024 1920 --
NM_005438chr111251 --2434 188 --
NM_005442chr31599 ------
NM_005443chr41209 ------
NM_005455chr151651 1574 427 396 73 ------
NM_005458chr982216 1680 1619 953 734 701 467 435 --22429 1917 --
NM_005460chr51582 1370 --1106
NM_005465chr161971 1950 1755 310 245 26 11501 --11601
NM_005474chr1751526 1487 454 243 35 ------
NM_005475chr1262141 1179 1171 772 734 622 2762 349 12559 --
NM_005479chr1051350 1309 1041 1023 438 11427 ----
NM_005487chr2242091 785 631 42 1398 1584 --
NM_005497chr17155708 5367 4981 4890 4805 4767 4462 4072 2424 2228 1814 1577 1253 945 699 21230 75 11684 158
NM_005501chr1751103 1042 816 476 425 1452 1252 --
NM_005502chr992759 2691 1271 1142 1135 902 718 548 471 --11989 --
NM_005504chr12126377 6232 5233 5202 5181 5119 2359 2211 1318 610 497 53 11036 16051 --
NM_005506chr432572 2008 349 --22051 1107 11118
NM_005509chr51395 ------
NM_005520chr5--1140 ----
NM_005523chr73598 358 298 --11207 11484
NM_005527chr61399 ------
NM_005540chr131436 1390 153 11497 2645 339 --
NM_005541chr231193 164 57 123 ----
NM_005544chr21918 ------
NM_005550chr16----140 --
NM_005566chr11128 1344 ----
NM_005574chr111611 139 ----
NM_005575chr5133 ------
NM_005578chr354828 1929 884 305 260 24215 1229 ----
NM_005584chr132540 87 ------
NM_005587chr151377 ------
NM_005595chr11623 ----1280
NM_005596chr934340 2532 372 25015 322 12160 --
NM_005599chr111040 --1319 --
NM_005604chr642085 1790 1594 851 12212 11025 --
NM_005611chr1611298 ------
NM_005614chr71831 11076 ----
NM_005625chr82287 260 ------
NM_005626chr1191 ------
NM_005629chrX31340 1324 148 ------
NM_005637chr1822036 595 --11691 --
NM_005638chrX41466 1170 579 124 --1692 --
NM_005639chr1241779 1711 1558 192 ------
NM_005647chrX1675 1238 1826 13237
NM_005650chr2211075 ------
NM_005652chr164917 469 460 454 --1158 --
NM_005655chr821186 75 ------
NM_005662chr8157 ------
NM_005665chr154109 4022 3332 782 203 64771 4702 1535 1350 868 193 1568 --
NM_005668chr5104647 4141 3482 3055 3041 3002 2862 1748 314 223 14484 1730 --
NM_005685chr7127 ------
NM_005688chr321233 875 --1849 --
NM_005704chr131012 406 154 11058 3768 714 27 --
NM_005707chr1511060 ------
NM_005708chr13157 ------
NM_005715chr622729 582 1832 ----
NM_005722chr2----21834 942 --
NM_005724chr154685 638 161 153 ------
NM_005731chr2157 ------
NM_005734chr112630 150 ------
NM_005736chr1051154 641 616 438 43 --1998 --
NM_005737chr252867 2403 425 387 216 22183 276 11840 11076
NM_005739chr1541962 1696 1547 538 32020 586 240 ----
NM_005744chr151189 ------
NM_005746chr732672 2292 833 ------
NM_005748chr1242440 2181 2162 1105 13085 ----
NM_005751chr71393 1362 ----
NM_005761chr121111 ------
NM_005768chr121664 ------
NM_005779chr533316 2441 901 23183 1286 1841 --
NM_005785chr1221756 1647 1495 1574 --
NM_005786chr1811259 ------
NM_005795chr262331 828 701 660 327 223 12902 125 --
NM_005796chr16164 2281 141 ----
NM_005803chr61237 199 176 --
NM_005807chr1----1236 --
NM_005808chr352801 2237 1055 840 677 11175 33337 1132 1081 --
NM_005811chr12191 ------
NM_005813chr242094 792 307 290 ------
NM_005814chr181189 588 536 519 338 279 255 53 --1200 --
NM_005819chr163059 2990 2407 2222 413 325 12772 33443 2353 472 12192
NM_005822chr63442 202 188 ------
NM_005828chr17124538 4171 4131 4062 3885 3769 3484 3196 1868 968 799 646 34924 3939 706 3821 811 122 --
NM_005832chr31517 ------
NM_005839chr11887 ------
NM_005840chrX77436 5143 2075 1581 1389 955 197 11856 ----
NM_005843chr21451 --1627 --
NM_005852chr1741100 1039 181 113 ------
NM_005853chr161600 ------
NM_005859chr52305 219 ----11213
NM_005862chr31234 ------
NM_005869chr52274 65 ------
NM_005871chr102297 109 ------
NM_005876chr21706 --3763 675 218 --
NM_005880chr1621516 1504 11043 ----
NM_005884chr194731 607 297 84 1155 --157
NM_005885chr52553 431 --1611 --
NM_005895chr1273574 1376 1131 1099 896 397 30 --22932 621 13912
NM_005897chr131193 258 249 ------
NM_005900chr411197 ------
NM_005901chr18198032 7481 7135 6460 5817 5351 5279 3364 3251 3174 2823 2783 2583 2367 2210 1676 750 450 209 37503 5856 3230 12307 13072
NM_005906chr6--21223 94 ----
NM_005907chr621331 41 ------
NM_005909chr562706 1193 1132 841 832 762 14263 ----
NM_005911chr21399 ------
NM_005920chr183599 3119 3081 2464 1279 252 98 87 12483 ----
NM_005922chr6145 ------
NM_005923chr61671 1609 ----
NM_005933chr11122859 2710 2464 2306 2297 2149 1054 889 751 705 519 508 ----11991
NM_005934chr1942483 2019 174 165 --31737 328 137 --
NM_005935chr4125053 4898 4231 3969 3507 3382 1542 859 630 558 548 139 24298 3782 1655 13857
NM_005937chr1721172 445 ----23811 1097
NM_005938chrX2290 280 --1226 --
NM_005941chr842732 1357 879 371 11534 ----
NM_005955chr184639 4363 4086 1930 1639 746 609 105 35321 4123 2209 14653 --
NM_005962chr1021710 41 ------
NM_005962chr1021710 41 ------
NM_005964chr172588 459 ------
NM_005966chr221769 1556 12257 --11698
NM_005969chr111497 1927 11002 --
NM_005996chr1251382 1243 612 380 247 11558 ----
NM_006007chr923931 3077 11136 13700 --
NM_006016chr6------152
NM_006022chr1341051 841 332 92 1897 1403 --
NM_006030chr3126 --21421 647 1107
NM_006036chr231971 198 160 1184 --1683
NM_006037chr254852 4846 4368 3210 1401 --24140 3317 --
NM_006047chr202968 165 --23095 1408 --
NM_006048chr131087 444 182 ------
NM_006055chr232136 2004 875 --22063 29 --
NM_006060chr794406 4102 3731 2773 2763 1100 814 710 260 --13480 --
NM_006062chr251024 499 266 113 91 --31251 1196 98 --
NM_006066chr1184 ------
NM_006068chr41271 ------
NM_006079chr63758 295 89 ------
NM_006080chr742430 1962 362 269 21880 599 ----
NM_006089chrX21852 448 --11330 --
NM_006090chr12791 644 ------
NM_006091chr1531494 1411 674 1426 --11756
NM_006094chr852058 1929 1650 722 388 --12228 --
NM_006095chr453388 2858 1182 1027 611 ------
NM_006106chr1142127 1072 255 163 ------
NM_006107chr17141 ------
NM_006135chr1--1348 --11355
NM_006136chr721351 116 11057 ----
NM_006139chr292627 2591 2198 2095 1842 692 516 325 58 ------
NM_006141chr1642633 1821 786 304 11061 ----
NM_006153chr31520 ------
NM_006154chr1542594 2509 1814 771 2373 98 ----
NM_006155chr221641 754 21428 353 ----
NM_006156chr143186 85 63 ------
NM_006160chr1721031 301 --11432 --
NM_006166chr1232273 1897 635 11778 ----
NM_006176chr112237 225 ------
NM_006178chr172486 71 ------
NM_006180chr951565 814 728 703 79 ------
NM_006185chr112418 171 --169 --
NM_006186chr221197 117 ------
NM_006190chr221108 1031 --1928 --
NM_006191chr123952 335 147 1368 ----
NM_006194chr1421094 933 ------
NM_006195chr91910 ------
NM_006197chr832260 1769 1459 1600 1251 --
NM_006201chrX4895 813 161 126 --1181 --
NM_006202chr1981934 1762 782 553 351 344 44 32 --1382 --
NM_006203chr595346 5316 4913 3984 2192 1738 1356 1112 661 --194 --
NM_006206chr462703 2476 2233 1991 670 28 --12055 --
NM_006209chr81148 ------
NM_006216chr21639 1259 ----
NM_006224chr174770 723 280 112 1665 11727 --
NM_006228chr82367 37 1445 ----
NM_006237chr1331934 1794 151 11948 ----
NM_006241chr341528 908 825 538 11697 ----
NM_006243chr11859 ------
NM_006245chr6----181 --
NM_006246chr1411171 11208 ----
NM_006251chr523223 2945 12931 1566 12858
NM_006252chr136130 5102 86 15473 --27237 2194
NM_006256chr132529 1920 1106 ------
NM_006264chr41569 ------
NM_006266chr94663 644 342 160 --1138 --
NM_006268chr112349 53 --11135 --
NM_006275chr2082465 2445 2234 2217 2200 1861 834 45 ------
NM_006283chr895002 4828 4756 4711 4150 1898 1807 1492 147 --1133 --
NM_006298chr653390 3285 1091 978 390 2661 652 1855 --
NM_006301chr121250 --1644 --
NM_006306chrX44468 2168 1003 844 14492 44822 4458 975 313 --
NM_006310chr1721079 311 ------
NM_006313chr121644 --11344 --
NM_006317chr52648 561 ------
NM_006321chr321390 116 1752 ----
NM_006322chr13--1865 --168
NM_006323chr41758 ------
NM_006325chr121310 ------
NM_006328chr113577 211 176 ------
NM_006334chr9148 ------
NM_006348chr75822 588 319 43 28 ------
NM_006350chr5--127 1135 --
NM_006352chr141655 1605 598 156 ------
NM_006353chr6143 ------
NM_006357chr2----150 --
NM_006359chrX31858 587 547 ------
NM_006367chr141039 887 812 329 1144 ----
NM_006373chr1741407 1307 1220 161 --11108 11272
NM_006375chrX31557 457 307 ----11644
NM_006377chr931257 894 309 ------
NM_006378chr941246 1181 1096 468 --21055 22 11086
NM_006379chr712093 1611 ----
NM_006380chr1754189 3930 3334 2987 1681 1121 13513 --
NM_006386chr2241900 1653 633 176 ------
NM_006387chr192919 112 ------
NM_006389chr1161366 940 543 375 226 23 --1166 --
NM_006393chr1054377 4268 3163 1711 631 31815 1043 1012 ----
NM_006400chr121107 ------
NM_006403chr631584 1384 1167 ------
NM_006408chr72984 413 ------
NM_006409chr71304 ------
NM_006411chr65933 782 410 221 113 --1242 --
NM_006421chr81893 ----1801
NM_006422chr122160 70 ------
NM_006430chr21407 ------
NM_006434chr1042893 1286 542 276 1626 ----
NM_006451chr531036 727 232 --1987 --
NM_006454chr462826 2448 919 687 557 152 12573 52891 2416 2369 1954 99 --
NM_006459chr1041842 1288 786 532 2506 145 ----
NM_006460chr1731766 1579 1430 ------
NM_006469chr121516 1419 ------
NM_006472chr141207 868 67 33 --21156 996 --
NM_006482chr1232610 1032 917 1288 ----
NM_006489chr1451748 1333 656 365 48 1751 1802 11496
NM_006516chr121444 487 ------
NM_006517chrX132116 2068 1980 1761 1673 1471 927 774 748 724 443 363 337 31932 870 605 11805 --
NM_006526chr2011997 1105 ----
NM_006532chr1961946 1307 830 755 453 355 12083 1233 --
NM_006534chr2042709 2627 2182 35 ------
NM_006538chr293987 3769 3574 2927 2758 1237 1192 655 539 --23654 2830 --
NM_006540chr841502 237 159 42 ------
NM_006544chr1455194 5092 4522 1087 278 16027 11253 --
NM_006546chr17136129 5762 5615 5552 5493 5353 5166 5108 1693 862 751 428 132 --26382 4128 --
NM_006547chr731735 1578 1413 ------
NM_006548chr331713 276 264 ------
NM_006549chr1272707 2653 2437 2430 2344 1128 208 --12549 --
NM_006557chr931436 1230 455 --11131 --
NM_006559chr121138 1091 ------
NM_006560chr111402 ------
NM_006561chr10116221 5947 5597 5185 4147 4075 2429 2260 1332 576 402 12329 24765 4019 1173
NM_006565chr1611268 ------
NM_006566chr182374 77 ------
NM_006575chr141190 149 ----
NM_006591chr112330 69 --1321 1297
NM_006593chr24748 310 243 103 ------
NM_006595chr112638 204 155 ----
NM_006599chr16128058 7480 7419 7280 7262 6404 6365 2950 2383 1872 1395 913 18041 17188 12328
NM_006601chr123181 127 117 ------
NM_006603chrX41720 1653 771 697 ------
NM_006609chr212110 1350 ----
NM_006614chr373072 2979 2571 2498 2278 286 27 13013 1780 --
NM_006618chr141038 516 367 27 ------
NM_006620chr653478 1809 1508 845 839 23138 1312 ----
NM_006621chr151611 605 576 379 213 11498 ----
NM_006622chr5142 ------
NM_006624chr1031552 1506 98 ------
NM_006626chr952003 1965 888 776 719 11686 ----
NM_006628chr1564386 4284 3979 3675 3465 571 --23507 1377 14048
NM_006633chr53602 583 93 ------
NM_006644chr131575 1263 ----
NM_006650chr5103656 2719 1067 982 866 844 720 332 197 24 --32918 740 317 --
NM_006654chr1254768 4085 3901 3548 1267 --11888 --
NM_006667chrX21211 60 --1970 --
NM_006670chr6392 79 65 ------
NM_006675chr1262703 2592 2485 2395 1133 995 1955 33170 3029 2560 --
NM_006682chr731092 1075 568 ------
NM_006690chr20142029 2008 1990 1786 1633 949 932 895 710 703 579 348 246 26 --22075 480 11491
NM_006695chr17----1327 --
NM_006699chr152167 1993 1768 1738 280 22006 1718 1581 --
NM_006703chr62466 82 ------
NM_006713chr51639 ------
NM_006721chr101106 ------
NM_006722chr342372 2339 2023 1129 --11026 --
NM_006724chr6145 ------
NM_006727chr5159 ------
NM_006731chr9145638 5408 4040 4000 3580 2125 1983 1964 1900 1592 720 416 238 157 1738 ----
NM_006734chr6141 ------
NM_006736chr271728 1688 1270 737 580 538 401 --155 --
NM_006738chr1554071 3918 996 850 249 1892 24100 100 --
NM_006750chr16137559 7526 7472 5976 5017 3048 2945 1716 914 722 629 508 278 12468 12033 --
NM_006751chr22829 339 ------
NM_006754chr71384 1910 ----
NM_006756chr821489 1209 --11384 --
NM_006761chr173800 731 618 2552 81 174 1633
NM_006763chr141844 1691 1582 832 --1574 --
NM_006766chr841799 754 623 471 --22289 377 --
NM_006769chr13676 656 123 ------
NM_006772chr651715 1703 1660 446 152 --21687 209 --
NM_006775chr643088 2763 2167 2085 ------
NM_006777chrX42165 1178 1005 964 --12696 --
NM_006788chr1842119 1986 1795 554 --2743 716 --
NM_006796chr183379 112 34 ------
NM_006801chr192467 235 ------
NM_006802chr111154 1450 ----
NM_006807chr1721018 889 21057 1039 ----
NM_006815chr122905 38 ------
NM_006818chr14756 676 79 68 --1102 --
NM_006826chr2297 69 ------
NM_006832chr141422 1272 ----
NM_006841chr31674 ------
NM_006846chr51146 ------
NM_006852chr172782 248 22685 1943 --12330
NM_006854chr71437 ----1652
NM_006861chr1221516 1319 --31954 523 206 --
NM_006870chr20--1631 --194
NM_006872chr21119 ------
NM_006874chr441229 848 439 273 ------
NM_006875chrX4923 594 359 302 ------
NM_006884chr31232 --169 1124
NM_006885chr1673387 3329 1571 1130 1088 1061 730 13419 13823 --
NM_006888chr1463153 2580 2435 1190 1107 666 --1533 --
NM_006895chr211881 11555 1549 --
NM_006896chr74735 463 453 172 --163 --
NM_006906chr112758 95 --2786 173 --
NM_006908chr721203 290 1494 11371 --
NM_006913chr62427 343 ------
NM_006914chr941445 555 385 94 ------
NM_006915chrX32247 2178 223 ------
NM_006918chr1165192 4882 2279 1465 987 977 25624 832 1931 --
NM_006922chr22835 164 ------
NM_006924chr1733931 704 670 12900 23907 1428 --
NM_006930chr522034 1767 11930 31664 573 443 --
NM_006931chr1232092 1366 432 1859 11657 12101
NM_006937chr171145 ------
NM_006939chr14--1125 ----
NM_006940chr1221590 358 11621 ----
NM_006941chr221846 --1152 --
NM_006947chr431779 1467 393 --1182 --
NM_006948chr2121708 53 12361 1874 --
NM_006950chrX3597 225 67 --1346 --
NM_006951chr102755 34 ----1552
NM_006979chr61564 ------
NM_006990chr122543 191 --12190 --
NM_006996chr11525 --1633 --
NM_006997chr101114 ------
NM_006999chr541960 1614 1457 1281 1124 ----
NM_007005chr931119 155 148 11378 ----
NM_007006chr1623530 2490 33071 2934 537 ----
NM_007008chr21883 ------
NM_007010chr1741431 1322 564 557 ------
NM_007011chr15136381 6187 5398 5072 5035 4995 4957 4917 4878 1210 1028 666 211 --14414 --
NM_007018chr92124 45 ----155
NM_007023chr21250 175 ----
NM_007026chr173462 449 72 ------
NM_007027chr3--1171 ----
NM_007033chr132247 795 51 --42179 775 523 304 --
NM_007034chr12361 201 ------
NM_007035chr122721 639 --1100 --
NM_007038chr2154865 2353 2177 1634 874 ----13835
NM_007042chr382685 2471 2300 2111 1939 778 128 36 ------
NM_007047chr672498 2484 2387 2352 2005 982 414 ------
NM_007061chr221367 ------
NM_007067chr1741455 1391 1229 297 ------
NM_007078chr1032766 923 627 --1484 --
NM_007080chr4--1122 ----
NM_007096chr9147 ------
NM_007106chr1342540 2451 2011 601 ------
NM_007107chr372360 1906 1738 1516 1479 749 666 ----1964
NM_007114chr312260 ------
NM_007124chr621626 671 1139 ----
NM_007144chr174842 332 51 42 ------
NM_007146chr1752607 1991 989 302 190 12497 ----
NM_007150chrX21373 568 1676 ----
NM_007158chr13804 298 31 ------
NM_007159chr321404 201 1514 ----
NM_007170chr1----1151 --
NM_007172chr2242296 2287 2184 2077 22861 1212 ----
NM_007174chr1242199 952 920 824 11925 ----
NM_007175chr8103679 3389 3234 3210 3152 3011 2785 844 763 144 ------
NM_007177chr362156 1563 941 725 381 26 1487 ----
NM_007185chr11215 ------
NM_007189chr731457 1315 1201 ------
NM_007191chr12--1138 ----
NM_007192chr141198 --31034 428 248 --
NM_007197chr1221012 352 ------
NM_007200chr1554071 3918 996 850 249 1892 24100 100 --
NM_007207chr11662 1185 ----
NM_007212chr142224 834 591 275 --11755 11668
NM_007214chr62996 497 ------
NM_007218chr81155 ------
NM_007219chr202826 807 --1801 --
NM_007221chr11167 1360 1161 --
NM_007222chr861452 1412 677 668 620 175 11294 ----
NM_007236chr1562172 1912 1503 432 258 112 --11547 --
NM_007246chr421028 90 ------
NM_007249chr13138141 7948 7275 7150 7064 6631 6202 5708 2201 1473 809 802 526 36066 5848 1045 --16319
NM_007271chr61706 1627 ----
NM_007275chr31239 179 ----
NM_007282chr311020 ------
NM_007283chr343017 2930 2836 899 1272 ----
NM_007287chr342954 2253 947 97 --1221 --
NM_007288chr342954 2253 947 97 --1221 --
NM_007289chr342954 2253 947 97 --1221 --
NM_007308chr42598 163 1191 ----
NM_007331chr432544 1016 552 --22221 104 --
NM_007345chr1832027 486 235 1220 ----
NM_007347chr1552514 2033 2002 890 652 13063 12299 12151
NM_007350chr1264404 4324 4317 3028 1774 1556 ----23224 143
NM_007357chr12480 207 --1487 --
NM_007358chr1127 1315 --1471
NM_007359chr1741716 1648 1391 1325 --1699 --
NM_007361chr141184 ------
NM_007363chrX1294 --1418 --
NM_007365chr162054 1983 1542 1498 850 591 --21403 100 --
NM_007372chr171300 ------
NM_007373chr1051741 1341 1276 584 499 ------
NM_007375chr121766 689 1354 ----
NM_012069chrX22712 236 --21894 843 --
NM_012074chr141817 1207 1994 11144
NM_012081chr573648 3337 2986 2351 2288 697 260 --22652 625 --
NM_012090chr13824 504 33 ------
NM_012095chr1053499 3238 2857 1136 700 --1596 12309
NM_012096chr342990 2731 2481 1239 13549 ----
NM_012098chr93193 144 34 ------
NM_012102chr152479 1740 977 933 348 ------
NM_012105chr212192 150 ------
NM_012120chr6--1265 ----
NM_012121chr172413 62 ------
NM_012123chr61311 ------
NM_012124chr11----1218 --
NM_012129chr731939 628 565 1995 ----
NM_012134chr151718 1633 1600 1260 177 1270 31744 1732 371 --
NM_012137chr152832 579 100 92 65 ------
NM_012141chr1343970 1224 1206 742 12524 ----
NM_012154chr81832 ------
NM_012155chr191194 ------
NM_012156chr2073041 2881 2401 2177 790 583 482 1122 --11064
NM_012157chr321008 104 ------
NM_012158chr131181 ------
NM_012164chr997480 7283 6362 6327 5662 4787 2732 2574 1038 47561 4951 222 22 12279 36375 6318 871
NM_012193chr1185402 4829 4318 4121 3587 3471 2106 1300 23875 3710 23999 139 --
NM_012197chr921173 141 1186 11148 --
NM_012199chr164573 3537 3250 2910 1650 1058 1992 53072 1830 761 257 24 --
NM_012214chr296360 6078 4365 4126 3956 1671 1499 136 110 --15633 13919
NM_012215chr1011430 --1169 --
NM_012216chrX126 ------
NM_012229chr1051433 1233 559 270 30 ------
NM_012232chr1751811 482 198 136 27 ----1372
NM_012234chr333085 1193 209 ------
NM_012247chr101161 ------
NM_012248chr162603 39 ------
NM_012250chr11----2980 375 --
NM_012252chr774850 4820 4617 4123 465 324 236 14712 ----
NM_012255chr20--1140 1153 --
NM_012257chr72742 708 ------
NM_012259chr611299 ------
NM_012261chr201546 ------
NM_012262chr174928 4313 4278 3888 3615 1633 867 44908 1103 425 399 11060 --
NM_012266chr961081 903 262 127 85 53 ------
NM_012279chr552108 1457 1416 848 274 21338 706 1621 --
NM_012281chr731765 1615 927 ----1260
NM_012287chr344039 3040 980 135 --33551 1556 1307 --
NM_012288chr6175678 5377 4926 4747 4711 4628 4456 4102 4092 3941 2235 2013 1896 1100 885 607 251 --24473 772 --
NM_012290chr21637 ------
NM_012296chr11133962 3932 3768 3675 3412 3301 3037 3025 2965 2838 637 407 200 ------
NM_012297chr4--12633 --1288
NM_012300chr532133 1585 48 12537 ----
NM_012301chr732028 1698 87 --1323 --
NM_012302chr13804 492 60 ------
NM_012304chr572545 2441 1770 1642 893 649 90 --11855 --
NM_012306chr12143495 3345 3098 3059 2592 2354 2342 1163 1133 1123 831 709 218 124 12234 1364 12926
NM_012307chr181963 ------
NM_012308chr1131837 1830 753 11612 --21033 826
NM_012309chr1174634 4173 3708 3212 1506 978 104 24627 3603 ----
NM_012316chr164852 3700 2071 1534 851 750 32034 1586 835 25412 1876 --
NM_012322chr72143 73 ------
NM_012325chr2031601 1518 1110 11335 196 --
NM_012326chr2159 --1749 --
NM_012330chr1031637 630 389 ------
NM_012334chr594314 4243 3905 3415 3123 3003 1854 1505 812 1342 11549 --
NM_012343chr52945 717 ------
NM_012384chr2032018 1996 1644 21914 1527 ----
NM_012395chr743405 2586 2542 2310 12706 ----
NM_012396chr12544 486 --1646 --
NM_012398chr1932698 2366 37 32405 2210 2024 42572 2319 1145 352 178
NM_012399chr2211604 --11555 --
NM_012402chr1131379 1145 245 --2484 433 1982
NM_012405chr183671 3658 3547 3536 3260 3154 302 76 --33744 494 176 --
NM_012408chr201739 --134 --
NM_012414chr12749 175 ------
NM_012419chr62620 113 ------
NM_012446chr51468 ------
NM_012454chr61228 ------
NM_012455chr211240 --11302 1593
NM_012464chr422018 576 ------
NM_012471chrX11769 11336 189 --
NM_012474chr11223 ------
NM_012479chr73967 916 41 --21099 990 --
NM_012482chr1169 ------
NM_013227chr153618 160 116 ------
NM_013231chr1464037 3920 2989 2967 1404 1300 34214 1759 943 33596 3158 2904 --
NM_013233chr251243 106 100 82 53 ------
NM_013235chr51898 ------
NM_013236chr22--2969 851 1438 1978
NM_013246chr112853 47 ------
NM_013257chr852225 2002 1505 836 480 126 ----
NM_013261chr463456 3133 3080 2391 919 104 1607 --13769
NM_013262chr621126 1120 --3915 385 161 --
NM_013275chr16----1239 --
NM_013279chr1172193 2084 1760 1669 847 356 115 11456 21629 92 --
NM_013281chr2021134 79 1306 --11203
NM_013293chr72167 96 ------
NM_013305chr181123 ------
NM_013314chr10128 ------
NM_013333chr194336 268 128 42 ------
NM_013336chr361952 1392 716 531 360 132 --11691 --
NM_013341chr232390 2369 232 ----1830
NM_013354chr81119 ------
NM_013363chr3138 ------
NM_013368chr192461 126 ------
NM_013372chr1542778 2703 2296 1074 12458 --11361
NM_013377chr122568 489 --2542 506 --
NM_013381chr121203 11961 12119 --
NM_013388chr22603 81 1113 ----
NM_013390chr92672 253 ------
NM_013396chr2111091 11478 ----
NM_013423chrX2189 78 1173 ----
NM_013427chrX2189 78 1173 ----
NM_013433chr1952023 789 701 290 173 ------
NM_013434chr251983 1513 691 682 474 1619 21757 651 --
NM_013434chr251983 1513 691 682 474 1619 21757 651 --
NM_013436chr21670 2209 200 ----
NM_013441chr12597 437 ------
NM_013443chr931191 966 356 ------
NM_013444chrX3229 176 167 11057 ----
NM_013446chr741362 1336 1034 571 ------
NM_013449chr1252996 2272 1125 879 318 --11135 --
NM_013450chr231112 1098 1054 ------
NM_013937chr62382 45 ------
NM_013943chr162915 1205 1117 488 320 307 --12357 --
NM_013981chr5138 --168 --
NM_013982chr5138 --168 --
NM_013983chr5138 --168 --
NM_013989chr14104792 4645 4532 4009 3216 1928 1464 1329 1081 371 34868 3753 1426 13845 13791
NM_013993chr62593 586 --1340 --
NM_013994chr62593 586 --1340 --
NM_013995chrX21757 238 ------
NM_014007chr9--1442 ----
NM_014011chr222544 2057 --22566 1825 --
NM_014021chr133432 3025 1309 21015 621 ----
NM_014023chr1082583 2293 1927 1840 1152 1054 878 27 32104 789 700 1949 --
NM_014028chr673150 2999 2535 2315 2058 694 168 1539 2957 443 --
NM_014030chr1731132 817 96 --2393 42 --
NM_014039chr1131029 266 252 ----11162
NM_014042chr111211 ------
NM_014048chr1684962 3835 3720 1733 1183 854 443 403 22109 1896 23643 1664 --
NM_014059chr131348 ------
NM_014089chr1352223 2163 1451 747 125 1251 ----
NM_014109chr81402 11130 ----
NM_014112chr874068 3326 1794 1415 876 753 399 ------
NM_014117chr1632188 953 104 --12256 --
NM_014154chr341347 1320 1034 395 ------
NM_014155chr11105029 4707 2807 2769 2257 2235 1522 1445 1276 554 12343 25198 1320 --
NM_014159chr3--1105 ----
NM_014181chr222911 2640 --22052 1163 --
NM_014190chr421417 23 ----31551 165 153
NM_014191chr1241064 968 770 193 ------
NM_014203chr19185 ------
NM_014211chr541710 1532 343 159 ------
NM_014216chr1451463 627 461 365 232 11687 2497 52 --
NM_014217chr141852 1274 582 206 ------
NM_014231chr1292074 1755 1738 1695 1542 443 404 128 31 ------
NM_014232chr1771295 1242 1115 548 524 418 92 ------
NM_014232chr1771295 1242 1115 548 524 418 92 ------
NM_014233chr1751720 1714 410 281 112 11489 ----
NM_014235chrX144 --11741 1321
NM_014240chr383914 3547 3506 3287 2871 1550 1541 1262 --23347 3331 12769
NM_014243chr41148 22115 657 ----
NM_014250chr2242091 785 631 42 1398 1584 --
NM_014253chrX21777 997 ------
NM_014264chr41592 ------
NM_014268chr1861440 936 320 162 147 31 ------
NM_014271chrX1694 ------
NM_014278chr42303 174 ------
NM_014280chr12249 79 2699 301 ----
NM_014283chr11392 --1570 --
NM_014284chr11858 ------
NM_014289chrX1509 --1989 --
NM_014293chr2293136 3104 2771 2758 2714 748 356 128 109 ----13969
NM_014294chr841358 1240 1233 576 ------
NM_014299chr1932081 1924 666 1626 1597 --
NM_014309chr2264926 4413 3586 2012 1445 153 --24989 1279 21301 1268
NM_014313chr13620 463 64 ------
NM_014314chr91437 1390 1358 --
NM_014323chr223388 157 133 1758 ----
NM_014325chr1211589 ------
NM_014331chr496172 6141 5718 5128 3065 2511 1585 1189 621 15406 ----
NM_014332chrX163 ------
NM_014333chr1172738 2218 2088 1909 1024 769 398 ------
NM_014352chr114551 299 114 21 --21517 1126 --
NM_014368chr941964 1426 450 272 21482 59 1675 --
NM_014372chr11511 165 ----
NM_014382chr341589 576 565 478 ------
NM_014391chr10137 1229 ----
NM_014393chr862348 2338 1687 958 656 263 --12318 --
NM_014399chr72310 258 --2392 348 --
NM_014400chr194417 396 84 34 ------
NM_014405chr1752336 2188 1825 729 516 --32204 1967 1871 1755
NM_014415chr311077 --11473 --
NM_014417chr191707 --1675 --
NM_014423chr575580 4785 4662 4536 3883 1705 1662 15118 ----
NM_014431chr1091563 1390 1333 1067 451 425 412 317 116 --21218 244 --
NM_014444chr153789 292 73 ------
NM_014445chr332404 2140 259 ------
NM_014447chr421275 582 ------
NM_014452chr621075 479 ------
NM_014454chr63894 159 112 ------
NM_014456chr1021672 356 ------
NM_014462chr81231 149 ----
NM_014472chr101727 --1204 --
NM_014489chr111790 1336 2828 36 --
NM_014491chr71293 143 ----
NM_014494chr162734 123 ------
NM_014497chr2----1238 --
NM_014502chr111313 ------
NM_014504chr72567 289 21662 1369 ----
NM_014507chr221918 --11123 --
NM_014517chr341671 1228 1217 175 --1169 --
NM_014554chr1241586 1561 800 302 ------
NM_014571chr173002 2953 2906 2570 2456 2400 1949 12132 32304 873 170 1676
NM_014572chr1331802 1170 219 ------
NM_014573chr1781838 1780 1435 1352 1222 711 468 201 --1250 --
NM_014574chr14161 ------
NM_014587chr1641504 1373 1289 1192 ------
NM_014588chr201300 --150 --
NM_014600chr221637 1340 11515 21546 1455 --
NM_014601chr1941623 1150 307 134 --1617 --
NM_014607chr241822 294 217 68 2679 378 ----
NM_014612chr921069 514 ------
NM_014613chr592660 2225 2170 1889 777 699 343 315 235 ------
NM_014615chr1672350 2297 2253 1140 1125 1054 82 --22328 1193 12817
NM_014621chr2--1243 ----
NM_014630chr1583968 3476 3310 2680 2598 1343 845 358 23043 1408 21023 303 --
NM_014633chr111460 ------
NM_014634chr2232744 2375 585 --21120 443 1998
NM_014636chr9104006 3909 3848 3317 3163 2941 1582 1014 847 329 14216 ----
NM_014646chr1842473 2289 374 293 1589 ----
NM_014647chr1621875 478 3357 157 114 ----
NM_014655chr172311 1606 1574 472 364 233 198 --11738 --
NM_014659chr153449 337 327 --1218 --
NM_014660chr71147 ------
NM_014661chr1063402 2909 988 438 249 53 23370 844 ----
NM_014663chr13880 387 167 --1891 --
NM_014665chr863059 2741 2482 2223 846 248 --32586 732 491 --
NM_014666chr5--1257 ----
NM_014667chr3--22267 2055 11706 --
NM_014670chr231049 537 272 ------
NM_014676chr121277 303 --251 43 135
NM_014677chr821371 1021 ------
NM_014682chr852117 1923 1655 1602 625 1552 ----
NM_014683chr1731902 1723 349 ----11529
NM_014686chr1921680 455 ------
NM_014690chr742749 2734 2407 29 1697 13037 1478
NM_014693chr33490 313 218 1519 1570 --
NM_014701chr15--1541 ----
NM_014702chr643302 1294 484 44 1639 ----
NM_014705chr72851 669 ------
NM_014707chr742187 418 298 180 ------
NM_014715chr111930 ------
NM_014721chr6126909 6389 5247 5240 4690 4625 2402 2391 2178 1696 1157 303 1687 ----
NM_014723chr2042830 2365 2018 545 2513 42 --12951
NM_014726chr1741208 1140 122 61 --1536 --
NM_014729chr831822 333 148 128 ----
NM_014730chr12145282 5275 5238 4890 3762 3257 2069 2063 1633 1498 1147 1131 830 336 ------
NM_014730chr12145282 5275 5238 4890 3762 3257 2069 2063 1633 1498 1147 1131 830 336 ------
NM_014735chrX21888 503 ------
NM_014737chr2033725 3579 44 21162 395 13364 --
NM_014738chr172673 58 --31074 175 150 --
NM_014742chr2021806 381 1492 21814 1457 --
NM_014743chr41285 ------
NM_014746chr244074 2659 1613 1136 --23185 866 1113
NM_014747chr1154866 4769 4053 3985 2197 2015 1986 1065 1031 818 524 498 473 368 125 24069 598 32061 1246 567 --
NM_014751chr82850 74 ------
NM_014752chr111609 --11814 --
NM_014755chr232728 1023 222 ------
NM_014756chr111410 ------
NM_014757chr552320 1911 889 604 374 --11546 --
NM_014759chr84505 447 438 109 --41538 1126 1021 287 --
NM_014762chr182572 2536 2004 1970 1794 889 716 316 1709 ----
NM_014764chr1211026 11196 ----
NM_014766chr752834 1271 764 678 630 ------
NM_014767chr1043594 2741 1327 1090 --1536 12522
NM_014770chr126969 326 263 229 83 67 --21000 513 --
NM_014772chr18113560 3387 3035 2992 2387 1225 1163 979 932 677 276 --42808 2263 909 611 --
NM_014774chr142817 877 822 102 --32807 2550 2342 --
NM_014779chr33885 73 59 ------
NM_014781chr81126 11096 ----
NM_014787chr142696 2147 1123 274 ------
NM_014795chr221271 506 ------
NM_014798chr1751372 759 546 404 21 --1596 --
NM_014800chr72242 209 --1267 --
NM_014807chr112813 40 ------
NM_014810chr12265 194 ----1694
NM_014812chr131610 753 478 ------
NM_014820chr341760 1408 602 524 ------
NM_014822chr4--1444 ----
NM_014824chr1111516 ------
NM_014826chr193835 3778 3647 2665 1691 943 434 276 58 21744 1724 12805 --
NM_014827chr141358 1191 470 212 ------
NM_014830chr1283894 3682 3142 2882 1258 400 369 290 --13113 13126
NM_014832chr1321710 181 1531 11400 --
NM_014836chr1041933 1913 1845 134 --2780 216 --
NM_014839chr132227 1825 1597 ------
NM_014840chr1262719 2486 2366 1116 700 127 11156 12181 --
NM_014841chr621142 198 ------
NM_014848chr1562509 2477 2264 1916 504 146 ------
NM_014849chr161230 1176 935 228 107 100 --21272 236 --
NM_014850chr364107 3466 3170 1554 1339 306 11629 41965 1597 668 34 --
NM_014859chr1751335 552 358 265 115 ------
NM_014860chr261951 1611 931 861 477 35 ------
NM_014871chr123579 488 95 ------
NM_014872chr932045 1969 641 --11702 --
NM_014873chr153710 3268 3020 2951 584 23869 3175 11274 --
NM_014876chr2262119 1949 1887 1712 375 340 --21515 644 --
NM_014877chr1766188 5588 5390 868 658 124 --15976 16783
NM_014880chr252893 2884 2046 1964 339 --12222 --
NM_014883chr462216 2123 1766 1564 512 154 ------
NM_014887chr13----1855 --
NM_014893chrY21537 928 21506 109 139 --
NM_014897chr1733253 1096 419 2213 132 12535 --
NM_014900chr261127 1068 1047 993 37 22 ------
NM_014903chr127889 877 702 650 565 492 78 --1822 --
NM_014904chr1063538 2967 2900 1230 277 255 11505 1644 --
NM_014906chr1794029 3604 3260 3089 3014 2888 1429 802 762 11086 ----
NM_014909chr1443825 2896 549 32 11234 13363 1166
NM_014912chr1023083 332 13067 ----
NM_014913chr1851533 1150 1141 291 111 --182 --
NM_014917chr15854 730 651 233 105 ------
NM_014920chr663256 1443 1259 1051 493 236 11155 ----
NM_014921chr1952746 2624 2177 1174 304 --31249 894 410 --
NM_014923chr1321850 914 --11954 --
NM_014924chr1463024 2736 975 920 479 53 --13145 --
NM_014926chr31770 1840 ----
NM_014931chr191177 --191 --
NM_014932chr311703 155 1687 --
NM_014933chr42377 21 ------
NM_014934chr1373365 3090 1360 1297 1121 730 226 23592 2543 ----
NM_014939chr1811286 11063 ----
NM_014945chr511948 161 --11477
NM_014947chr162502 2400 2239 2064 1985 1198 12362 1985 --
NM_014952chr151656 --1431 --
NM_014961chr452060 1870 856 783 413 --11597 --
NM_014962chr2052469 1078 954 879 764 --22152 898 --
NM_014964chr1752295 2186 1847 1570 537 --32268 1959 1549 --
NM_014969chr1--154 --1141
NM_014974chr1031388 475 252 2197 63 ----
NM_014977chr142481 221 ------
NM_014978chr1041806 1791 1571 262 ------
NM_014982chr1453479 1762 1593 846 179 ------
NM_014988chr452523 2160 2085 1129 1113 12410 ----
NM_014989chr661890 1592 1378 815 506 338 1232 11746 --
NM_014990chr141874 --1535 --
NM_014991chr43663 538 293 ------
NM_014994chr1562248 1958 1827 626 620 194 --11464 --
NM_014997chr741923 992 218 174 ------
NM_014999chr121614 --1306 --
NM_015000chr1231231 676 563 ------
NM_015001chr13996 807 109 ------
NM_015002chr1221690 142 ------
NM_015008chr393507 3188 3144 3019 3013 653 641 341 76 13063 ----
NM_015009chr3144 ----1689
NM_015015chr1941498 711 284 227 ----1298
NM_015017chr11121 --1295 --
NM_015020chr1643119 2651 2394 179 13275 13729 12884
NM_015024chr81176 11497 ----
NM_015025chr211943 --12173 --
NM_015026chr1254714 4657 3767 3362 974 31802 944 877 11299 --
NM_015027chr164635 540 216 116 ------
NM_015032chr1342808 2692 826 794 ------
NM_015033chr943289 3224 2225 1028 1274 22617 2546 --
NM_015039chr153263 2966 1158 673 109 --13867 --
NM_015042chr15104271 4229 3807 3398 3300 1220 920 808 613 330 --13326 --
NM_015044chr1663010 2812 2591 1222 664 392 --11234 --
NM_015045chr1032073 562 373 21577 413 ----
NM_015050chr631020 883 364 ------
NM_015057chr132694 187 ------
NM_015063chr1931335 1221 408 ------
NM_015064chr1293635 2985 2683 2229 1410 1041 488 316 152 13063 ----
NM_015068chr731550 489 92 23883 1557 13892 12948
NM_015071chr5112570 2019 1845 1837 1305 1243 1148 1128 1083 728 432 22512 89 ----
NM_015073chr1941709 762 149 70 --1287 --
NM_015074chr184576 4082 3731 1974 1968 1938 167 24 --21725 883 --
NM_015075chrX52165 2076 1980 760 731 11514 2868 589 --
NM_015076chr6104430 4386 4361 4017 2808 1775 1710 1385 970 230 --11428 --
NM_015079chr1592822 2634 2378 2289 1220 817 785 689 633 23120 2326 33131 3109 247 12795
NM_015080chr112351 187 --2834 23 --
NM_015082chr552463 2446 1909 1853 585 --12099 12194
NM_015085chr1744019 3842 1169 1024 ----12664
NM_015086chr123163 61 51 1524 ----
NM_015090chr176219 5974 5806 4309 4133 919 69 --32271 2127 967 --
NM_015092chr1674630 3972 2849 1755 892 652 400 ------
NM_015093chr64540 469 269 79 1337 31535 637 236 --
NM_015094chr22134523 4257 4126 3737 3693 3669 3438 3252 3196 2985 1615 722 512 --44221 1730 387 135 1598
NM_015097chr342278 1964 1551 296 --11669 --
NM_015100chr141835 1560 808 284 --1221 1596
NM_015101chr162765 2612 2335 1937 1834 924 --11898 --
NM_015103chr32937 289 --151 --
NM_015107chrX71652 1548 459 445 322 180 52 1214 2588 40 --
NM_015115chr442693 1062 54 31 --1243 --
NM_015129chrX41680 326 204 135 --21446 182 --
NM_015132chr731890 1537 1513 11407 ----
NM_015133chr1641331 1293 451 343 --31270 1169 1000 --
NM_015137chr862247 2143 1802 1632 1599 272 ------
NM_015138chr1532769 806 796 22341 2015 --1416
NM_015143chr41292 11245 ----
NM_015144chr1653791 3594 856 305 253 --11241 --
NM_015150chr32626 192 ------
NM_015155chr1063153 2992 2461 671 85 64 12123 13114 1759
NM_015156chr1443172 820 207 37 34045 3934 948 ----
NM_015157chr114782 425 411 404 --1436 --
NM_015161chr161114 11496 21374 41 --
NM_015163chr1451316 764 670 269 187 1560 ----
NM_015170chr81541 ----11944
NM_015176chr141344 694 593 400 ------
NM_015184chr3181 ------
NM_015185chrX52206 2064 1105 836 397 22395 533 22455 2403 --
NM_015191chr1122690 2241 1420 ----
NM_015192chr2032991 1022 76 12591 ----
NM_015194chr1751681 1462 525 395 86 --11521 --
NM_015198chr71837 11236 ----
NM_015200chr431764 556 105 1464 ----
NM_015213chr112823 702 --1117 --
NM_015215chr132880 2133 555 12698 ----
NM_015216chr5----11509 --
NM_015233chr132947 275 ------
NM_015236chr41988 ------
NM_015238chr51505 132 1159 --
NM_015247chr1665200 5189 4978 4857 962 88 23676 344 14411 --
NM_015250chr931460 132 107 --1282 --
NM_015251chr1612011 ------
NM_015252chr21869 ------
NM_015263chr15--21225 375 ----
NM_015264chr2294737 4570 4267 4150 3554 3047 1787 1719 906 13909 23991 995 21403 953
NM_015265chr222326 941 ------
NM_015267chr1261761 808 720 591 201 193 ------
NM_015270chr1222311 2235 --2720 66 --
NM_015271chr453289 3173 1562 456 23 21643 212 ----
NM_015272chr1641596 413 331 29 ------
NM_015275chr1222119 1799 ------
NM_015278chr643257 3083 1023 46 --11329 --
NM_015284chr191600 1370 1314 825 658 428 416 371 30 1207 21660 763 --
NM_015285chr1862517 2341 1793 864 776 171 21586 990 ----
NM_015286chr1532081 870 263 --12398 12377
NM_015288chr573805 3769 2638 1299 1045 560 336 13247 53741 822 504 421 330 12810
NM_015294chr172931 376 ------
NM_015296chr1321202 198 --1323 --
NM_015299chr1483751 3557 3404 3296 2798 791 725 87 --13264 --
NM_015305chr1431814 1473 511 --146 --
NM_015310chr878157 7736 7594 5490 1827 829 371 37303 7186 2572 17081 21950 1401
NM_015313chr1184801 3638 1692 1676 1272 795 235 221 23267 1066 13477 --
NM_015315chr543215 2915 1171 645 --23223 451 --
NM_015317chr262489 2234 2224 2217 2165 1841 1937 ----
NM_015326chr132266 371 281 1746 22388 188 --
NM_015327chr121305 319 ------
NM_015328chr772711 2091 1145 1035 756 499 58 ----1287
NM_015331chr12213 86 --3490 476 61 --
NM_015332chr753240 1384 1083 305 211 12737 23496 3182 --
NM_015336chr121522 ------
NM_015338chr202616 393 --1207 --
NM_015344chr841977 1966 1887 134 --11770 --
NM_015346chr1431541 534 141 11771 11328 --
NM_015347chr1242749 1969 1034 247 1989 12846 --
NM_015349chr653085 2895 1898 1228 249 11197 1444 --
NM_015353chr1732745 95 72 ----1817
NM_015361chr22848 696 ------
NM_015365chrX125 11622 ----
NM_015375chr194547 4357 4166 4099 1975 932 641 317 306 ----1202
NM_015379chr71282 ------
NM_015381chr2241639 1351 115 77 --1519 11582
NM_015382chr142307 263 ------
NM_015385chr1042893 1286 542 276 1626 ----
NM_015396chr311099 ------
NM_015397chr951583 1438 1341 1181 654 1496 ----
NM_015401chr124767 761 288 76 ------
NM_015404chr93481 469 30 --1144 --
NM_015416chr124750 694 373 283 ------
NM_015431chr1113358 3157 3036 2947 2941 2699 2586 1370 1056 469 93 --42337 2313 2287 1178 --
NM_015435chr8131 11279 ----
NM_015441chr1--1312 ----
NM_015443chr174947 291 135 30 --11010 --
NM_015447chr92568 270 1281 ----
NM_015449chr11522 ------
NM_015453chr361716 1704 625 561 415 34 11383 ----
NM_015455chr533735 1639 936 182 11083 --
NM_015457chr1111013 --1832 --
NM_015460chr361506 786 667 308 199 132 --132 --
NM_015463chr24688 124 94 24 1330 ----
NM_015464chr73349 95 82 ------
NM_015477chr151955 --1105 --
NM_015481chr122897 24 ------
NM_015483chr72743 134 ------
NM_015488chr231432 305 29 --1371 --
NM_015492chr1531029 637 141 ------
NM_015493chr1952139 538 530 422 93 ------
NM_015497chr151770 --1731 --
NM_015503chr161619 ------
NM_015508chr351519 1418 975 466 123 ------
NM_015520chr332141 2063 1938 ------
NM_015525chr611069 ------
NM_015526chr1961441 1315 468 375 149 38 ------
NM_015534chr12235 177 ------
NM_015535chr223939 1371 1331 23727 950 --
NM_015541chr311223 ------
NM_015542chr101966 1295 1772 --
NM_015549chr143630 207 184 ------
NM_015550chr743512 3082 3013 2409 23522 1214 ----
NM_015553chr695154 3469 3400 1149 792 748 613 437 406 21881 199 34107 3289 248 --
NM_015554chr1552705 2435 2259 786 327 11921 1764 12652
NM_015557chr162855 1284 1065 878 619 575 --23348 3180 --
NM_015564chr542885 2244 2227 387 21249 324 13127 --
NM_015565chr2122168 354 ------
NM_015567chr1311272 ------
NM_015568chr2074020 3624 3151 2789 995 943 488 --11513 --
NM_015569chr174708 4330 3895 3808 1622 1586 458 11371 ----
NM_015570chr731529 1401 227 ------
NM_015571chr621745 87 12653 ----
NM_015575chr293632 3510 3102 2865 2354 2236 547 304 284 ------
NM_015576chr332497 2263 121 --11978 --
NM_015578chr191627 21786 310 ----
NM_015601chr101787 ------
NM_015609chr172918 2585 2014 1991 1839 1136 1088 --42128 666 201 149 --
NM_015626chr1711011 ------
NM_015641chr72990 59 1452 ----
NM_015642chr32289 269 ------
NM_015645chr11132 ------
NM_015651chr971730 1596 1410 909 545 527 403 ------
NM_015657chr21793 1199 ----
NM_015660chr7129 1297 ----
NM_015670chr172333 99 ------
NM_015676chr142363 297 ------
NM_015678chr1331463 1312 376 ----11081
NM_015680chr22626 475 ------
NM_015686chrX42169 897 733 407 ------
NM_015691chrX52157 1937 1102 883 333 12802 22079 1889 12275
NM_015695chr692121 1679 1427 1415 465 361 355 345 137 21333 238 1514 --
NM_015713chr842882 2616 690 430 1209 ----
NM_015716chr173639 570 119 ------
NM_015833chr211896 1313 ----
NM_015840chr152480 2431 2195 1008 156 1280 12373 --
NM_015841chr152480 2431 2195 1008 156 1280 12373 --
NM_015850chr851911 1903 1521 938 158 ------
NM_015859chr141135 ------
NM_015866chr121045 1033 11336 ----
NM_015872chr161713 1479 1240 1211 712 322 ------
NM_015878chr841658 1605 311 295 ------
NM_015879chr18138190 7999 6341 6242 3286 3208 2986 2840 2708 2119 1277 1062 495 37861 1982 1226 ----
NM_015885chr111271 --1172 --
NM_015891chr651332 744 512 475 44 ------
NM_015902chr81320 ------
NM_015904chr21598 ------
NM_015905chr71156 ------
NM_015906chr154259 3380 2992 1501 1324 1675 13288 --
NM_015910chr22567 222 ------
NM_015912chr831752 713 317 11731 ----
NM_015913chr1----1141 --
NM_015915chr141306 ------
NM_015948chr61110 ------
NM_015960chr101389 ------
NM_015963chr2140 ------
NM_015974chr13124 ------
NM_015975chrX31709 601 560 1285 ----
NM_015980chr521089 286 11558 152 --
NM_015981chr562590 2304 2057 1956 622 46 --12657 --
NM_015984chr11547 ------
NM_015986chr1741421 585 291 112 ------
NM_015990chr4----1937 --
NM_015994chr142664 110 ------
NM_015995chr1595229 4051 3900 3591 2041 1918 1907 1828 1808 45081 4510 4370 4035 13403 1446
NM_015999chr11145 --1158 --
NM_016009chr194900 4704 4177 3596 3153 3074 1648 1033 294 34676 3472 604 --14093
NM_016018chr822798 579 22698 115 ----
NM_016021chr662796 2759 2315 2002 598 220 12603 --12276
NM_016022chr14937 120 81 44 ------
NM_016023chr8--188 ----
NM_016025chr1641938 1887 1410 1229 1422 ----
NM_016032chrX41179 912 562 333 ------
NM_016037chr121089 767 --2852 287 --
NM_016039chr142140 30 ------
NM_016041chr171391 --154 --
NM_016045chr2021412 432 --1388 --
NM_016059chr61320 1975 ----
NM_016061chr221462 548 144 ----
NM_016070chr17----145 --
NM_016072chr1231711 1673 394 --12374 --
NM_016076chr152954 2821 2720 603 221 ------
NM_016083chr633730 3111 926 13397 13549 --
NM_016096chr821902 44 ------
NM_016099chr861193 349 192 144 50 23 ------
NM_016100chr202334 271 ------
NM_016107chr53330 240 44 ------
NM_016120chrX3905 246 74 ------
NM_016124chr121356 1260 21390 1119 2398 58 --
NM_016125chr17--159 ----
NM_016126chr1--162 ----
NM_016131chr241891 1505 918 32 11663 21946 1799 --
NM_016132chr1512835 1687 13328 --
NM_016141chr31155 1564 ----
NM_016147chr1141137 1085 77 66 ------
NM_016152chr321205 439 --1165 --
NM_016169chr1053231 1161 997 828 208 --22280 950 --
NM_016201chr362177 2165 1789 589 287 90 --2727 505 1129
NM_016203chr731069 747 298 ------
NM_016210chr371425 1381 1374 1268 324 85 64 1207 ----
NM_016211chr42377 21 ------
NM_016213chr152177 62 ------
NM_016221chr542148 1967 1729 351 --11718 22219 230
NM_016227chr11392 --1570 --
NM_016230chr6--1197 ----
NM_016231chr17146 124 ----
NM_016235chr162985 395 --21174 290 --
NM_016248chr1363715 2972 1407 1330 1277 1171 --21305 792 --
NM_016252chr21267 1218 ----
NM_016255chr631093 765 488 --12749 --
NM_016258chr1--1101 ----
NM_016260chr257527 7304 5360 2356 1022 35350 3061 342 ----
NM_016261chr172773 252 ------
NM_016269chr451082 817 216 194 162 ------
NM_016272chr224997 567 470 112 1750 ----
NM_016275chr332369 1876 916 ------
NM_016277chr6------11026
NM_016281chr123999 106 85 ------
NM_016284chr163957 801 135 --146 1811
NM_016287chr141906 1361 644 506 --1788 --
NM_016308chr131659 1362 363 ------
NM_016312chr12194 ----1537
NM_016315chr231769 500 233 ------
NM_016316chr22649 580 1657 ----
NM_016320chr113364 147 36 ------
NM_016322chr9--13195 1345 --
NM_016328chr7127 ------
NM_016329chr3----1369 --
NM_016339chr1731828 1575 1216 --21692 186 --
NM_016351chr7177 1214 1388 --
NM_016352chr741182 1101 989 61 --11164 --
NM_016357chr123814 299 53 ------
NM_016374chr12276 252 ------
NM_016374chr12276 252 ------
NM_016376chr1794241 3377 3018 3008 2953 283 239 221 154 24373 654 --12754
NM_016377chr641730 1658 1384 431 11425 ----
NM_016396chr1542520 882 801 719 125 ----
NM_016410chr91523 ------
NM_016422chr1182635 2522 1987 1182 597 318 199 111 12257 --12950
NM_016424chr1731546 239 54 21749 291 ----
NM_016433chr12168 --11426 --
NM_016436chr203835 762 681 1299 ----
NM_016441chr241695 1577 852 180 --11482 --
NM_016448chr161789 1771 1620 1180 62 37 ----11723
NM_016470chr20----1113 --
NM_016472chr141504 ------
NM_016475chr1431207 1117 318 ------
NM_016480chr52623 93 ------
NM_016489chr71212 ------
NM_016505chr15669 514 505 247 105 1621 ----
NM_016506chr11131 ------
NM_016507chr1762418 2350 2120 660 146 116 --13119 1602
NM_016513chr663256 1443 1259 1051 493 236 11155 ----
NM_016516chr21857 ------
NM_016519chr4----1555 --
NM_016522chr1141439 1408 1394 1325 --1279 --
NM_016525chr91264 --1808 --
NM_016526chr1182445 2232 2127 1909 1667 1592 831 145 --1744 --
NM_016530chr15--1116 13939 12503
NM_016531chr4268 36 ------
NM_016532chr173340 169 62 1853 ----
NM_016544chr273521 3432 3401 3219 3149 1245 151 --199 13281
NM_016569chr1251382 1243 612 380 247 11558 ----
NM_016577chr394375 4363 4077 3915 1374 1357 1200 529 515 --11407 11764
NM_016578chr11199 ------
NM_016588chr64715 355 285 41 1667 ----
NM_016591chr52459 421 1371 --1218
NM_016596chr124767 761 288 76 ------
NM_016605chr532353 1691 726 11001 ----
NM_016620chr11933 1444 11421 --
NM_016621chr1154263 3144 3119 3030 796 --23242 760 --
NM_016623chr8--1263 ----
NM_016626chr1821261 575 --1683 --
NM_016628chr101728 ------
NM_016639chr163436 353 34 ------
NM_016641chr161130 11220 --11336
NM_016654chr1521341 284 --11438 --
NM_016824chr1021578 1570 --1426 --
NM_016830chr124436 117 100 57 ------
NM_016929chr653587 2948 537 455 86 --33921 3675 28 21746 1701
NM_016946chr193390 964 803 676 543 512 243 202 126 1283 13179 --
NM_016953chr2106110 5227 4925 4519 4396 3835 2319 2248 312 224 --15586 15932
NM_017412chr83466 278 126 ------
NM_017415chr5113808 3253 1589 1274 1013 972 939 750 582 564 382 34386 3983 399 1685 13393
NM_017420chr1432523 607 82 ------
NM_017423chr432014 1519 807 21673 855 1776 134
NM_017449chr171501 1358 1351 1274 566 479 83 --11190 --
NM_017452chr2041390 553 483 385 11517 ----
NM_017453chr2041390 553 483 385 11517 ----
NM_017454chr2041390 553 483 385 11517 ----
NM_017457chr19----1125 --
NM_017489chr83948 355 50 --2933 436 --
NM_017519chr61124 ------
NM_017522chr12488 274 ------
NM_017544chrX1159 ------
NM_017548chr332129 1566 439 ------
NM_017553chr151340 --1235 --
NM_017559chr172217 32 ------
NM_017582chr131580 546 40 ------
NM_017590chr2242004 700 464 363 ----22182 211
NM_017594chr972974 2278 1324 1051 863 178 47 22286 2226 ----
NM_017596chr1103512 3404 2975 2924 1566 1338 1008 980 500 68 --54088 3464 2980 1766 474 --
NM_017610chr1531907 1606 1416 12089 ----
NM_017612chr122459 167 ----1193
NM_017622chr171150 --1610 193
NM_017628chr445146 4308 4210 3270 14383 23618 634 --
NM_017629chr121357 502 ------
NM_017633chr643342 3199 1405 425 ------
NM_017634chr83782 676 72 ------
NM_017635chr1131632 616 556 ------
NM_017637chr9129485 8702 8641 8223 8023 7791 7142 6852 3426 3420 2629 1263 1551 38912 7955 6333 --
NM_017640chr61311 ------
NM_017643chr1732418 565 89 11258 12337 11990
NM_017644chr384136 3419 1533 1359 1153 1115 825 739 --11287 --
NM_017650chr7105693 5591 5227 3799 2107 1521 1404 808 577 481 1659 25234 541 --
NM_017651chr62214 118 1652 11414 --
NM_017654chr751767 1708 1111 316 44 ------
NM_017657chr21342 ------
NM_017658chr1414258 --14119 --
NM_017664chr132670 408 ------
NM_017666chrX11593 --21374 690 --
NM_017672chr151477 ------
NM_017684chr153510 204 44 11478 1475 --
NM_017709chr153172 1420 988 408 377 --1153 --
NM_017719chr331968 66 60 --1930 --
NM_017737chr131954 1652 382 11443 1620 --
NM_017739chr11480 ------
NM_017742chr1851324 504 456 417 21 ------
NM_017744chr12904 682 21717 980 1616 --
NM_017747chr5----1130 --
NM_017748chr173784 341 155 ------
NM_017754chr6134901 4671 4477 3954 3551 3528 3256 1926 1467 1037 1023 155 129 --13730 24744 4655
NM_017761chr111564 ------
NM_017762chr152802 543 11704 1726 --
NM_017766chr11442 --3490 177 88 --
NM_017769chr1433034 2483 1119 ------
NM_017772chr63188 67 58 ------
NM_017779chr122499 500 12759 22104 1761 22565 851
NM_017780chr82653 292 --2617 56 --
NM_017784chr32444 395 191 ----
NM_017787chr1042899 2587 1948 550 --22501 1042 12361
NM_017789chr22656 50 ------
NM_017798chr201988 ------
NM_017799chr1421726 1561 11811 ----
NM_017811chr972876 2628 2164 923 913 890 287 ------
NM_017812chr73739 631 82 ------
NM_017816chr4153 ------
NM_017822chr122303 180 ------
NM_017824chr1022656 1821 ----1420
NM_017826chr131561 1762 139 --
NM_017831chr1824794 3780 133 11734 --
NM_017836chr3121 ------
NM_017842chr123690 459 222 --2475 50 --
NM_017848chrX84457 3994 3735 3727 3248 3186 1639 1146 23399 3121 ----
NM_017849chr253187 1997 840 404 190 --22348 95 --
NM_017856chrX21398 413 --12021 --
NM_017860chr12607 71 1811 ----
NM_017866chr821141 842 --1440 --
NM_017873chr942131 1083 772 737 1750 11153 12666
NM_017893chr1061388 1237 1089 933 101 62 ------
NM_017896chr201342 --12532 23161 1206
NM_017902chr10115385 4724 4386 2255 2230 2090 1894 1780 1006 989 175 --34760 1119 473 15455
NM_017907chr111394 --177 --
NM_017910chr2172 1353 ----
NM_017921chr1732307 1780 1720 ----1149
NM_017923chr41267 ----1116
NM_017933chr221548 1182 ------
NM_017938chrX22155 1641 ------
NM_017944chr1132060 167 64 1427 ----
NM_017954chr731525 1224 413 ------
NM_017983chr172460 127 ------
NM_017987chr1011899 --1175 --
NM_017990chr1674365 3566 1604 959 295 241 150 23964 1153 23732 3720 1565
NM_017994chr742752 2180 789 775 ------
NM_018010chr321496 203 21049 409 ----
NM_018011chr131179 --1625 --
NM_018013chr662356 2151 2091 1980 1075 821 12194 --12385
NM_018019chr172487 54 ----1339
NM_018027chr1032254 2175 863 --32448 296 158 --
NM_018028chr1941338 1046 1030 175 1327 ----
NM_018032chr162618 336 1602 ----
NM_018045chr182918 2752 1190 936 904 764 591 275 --12007 --
NM_018046chr521759 717 ------
NM_018048chr1231842 1504 764 --11466 --
NM_018049chr191121 --1161 --
NM_018054chr16----1125 --
NM_018061chr121191 521 --11630 --
NM_018063chr10185 ------
NM_018064chr61313 ------
NM_018084chr273240 3074 2907 2650 692 298 210 1278 ----
NM_018085chr1127050 6628 6000 5242 5221 4979 2692 2653 1919 1833 1527 475 17777 36886 5060 65 --
NM_018086chr221756 1340 ------
NM_018094chrX166 ----185
NM_018095chr11131 ------
NM_018103chr1--1297 ----
NM_018105chr821024 987 ------
NM_018107chr144999 825 754 75 --3893 329 181 --
NM_018120chr82272 55 1467 --1165
NM_018121chr1012890 12904 ----
NM_018126chr411480 ------
NM_018131chr102903 895 1241 ----
NM_018133chr341880 882 527 24 --12166 --
NM_018157chr1253142 1225 879 504 354 ------
NM_018159chrX--2355 164 ----
NM_018171chr123881 799 714 ------
NM_018178chr132023 260 203 164 ----
NM_018182chr1762177 1959 1764 1428 583 91 1238 1752 --
NM_018189chr3----1337 --
NM_018192chr31662 11026 ----
NM_018193chr15--1173 --1120
NM_018195chr1132015 2005 692 ------
NM_018206chr161114 ------
NM_018207chr161729 1210 560 166 100 38 ----1571
NM_018211chr172074 1889 1844 728 587 245 200 ------
NM_018214chr641263 1062 884 253 ----1381
NM_018221chr2--1134 1120 --
NM_018227chr472761 2711 2443 2064 993 587 481 12879 ----
NM_018230chr1122 ------
NM_018234chr242098 2069 1785 838 --11552 --
NM_018244chr2021115 136 ------
NM_018247chr652905 2664 1015 713 309 11987 ----
NM_018254chr122310 667 ------
NM_018266chr31417 11051 ----
NM_018287chr1021207 988 ------
NM_018293chr33694 500 352 12921 ----
NM_018299chr81620 --1921 142
NM_018307chr173765 350 341 ------
NM_018312chr1141823 860 104 93 --11876 11949
NM_018315chr41567 1383 ----
NM_018319chr1421619 81 --1976 --
NM_018323chr411671 ------
NM_018327chr2031308 444 303 ------
NM_018330chr1031758 1066 314 ------
NM_018332chr1641210 406 225 129 ------
NM_018339chr941721 1275 1203 30 ------
NM_018340chr16104715 4670 4046 1936 1770 1087 1061 849 824 295 13623 13831 14806
NM_018351chr12113956 3897 3854 3688 3590 3581 3308 3208 3177 1749 1514 ------
NM_018360chrX1130 1305 ----
NM_018362chr1173235 2809 2542 1577 1455 1186 957 --22742 230 --
NM_018364chr143708 3685 3349 1539 1958 ----
NM_018365chr15198 ------
NM_018369chr5136 1115 ----
NM_018374chr774933 4667 3696 3265 2088 1757 167 1323 1458 --
NM_018375chr1431677 501 75 2607 419 1217 --
NM_018383chr242025 1521 1308 94 ------
NM_018387chr91133 1413 ----
NM_018400chr11144256 4129 4100 4050 3864 3524 3446 3199 3014 2962 2911 1027 516 125 14457 23019 1071 --
NM_018403chr373293 3191 2989 2533 779 562 179 ------
NM_018416chr1252013 967 751 685 144 --22409 1870 --
NM_018425chr1042627 2506 2048 1051 ------
NM_018429chr532771 2082 93 --12500 --
NM_018433chr21490 ------
NM_018440chr888452 8255 6723 6488 5610 2735 2172 976 22065 425 26012 1894 --
NM_018448chr124905 885 155 111 ------
NM_018452chr6_random32689 1356 1074 13250 ----
NM_018469chr1731370 147 103 ------
NM_018475chr41131 ------
NM_018482chr831005 932 510 21955 578 ----
NM_018489chr122164 223 --1287 --
NM_018490chr111101 --11308 --
NM_018555chr1961444 884 840 698 322 27 21705 834 ----
NM_018566chr175070 4335 1513 1100 481 374 30 24231 646 --1263
NM_018571chr22606 520 ------
NM_018590chr1021508 355 21313 488 ----
NM_018638chr1295423 4536 3495 3468 2249 2215 2150 2052 564 35625 4406 2045 24513 188 --
NM_018640chr1262713 2295 2271 2098 578 489 11040 --195
NM_018649chr10----1434 --
NM_018650chr122103 1704 11949 22022 760 --
NM_018652chr151374 ------
NM_018657chr3185 1120 ----
NM_018660chr852422 2030 1915 1031 304 149 1163 --
NM_018667chr1632384 848 678 22516 2364 1175 --
NM_018671chr151235 ------
NM_018685chr72916 378 ------
NM_018695chr552301 1679 798 749 170 2842 732 ----
NM_018700chr52596 105 ------
NM_018704chr11769 ------
NM_018712chr1141575 1103 406 169 ------
NM_018717chr432908 2243 1903 1549 22603 856 --
NM_018718chr742021 785 530 416 --1817 2641 605
NM_018840chr201460 ------
NM_018841chr163944 3904 2545 866 217 95 ------
NM_018844chr731449 665 482 1723 ----
NM_018846chr71624 --1737 --
NM_018890chr721203 290 1494 11371 --
NM_018896chr17235 21 ------
NM_018898chr552137 1592 781 405 213 ----22172 623
NM_018899chr552137 1592 781 405 213 ----22172 623
NM_018900chr552137 1592 781 405 213 ----22172 623
NM_018901chr552137 1592 781 405 213 ----22172 623
NM_018902chr552137 1592 781 405 213 ----22172 623
NM_018903chr552137 1592 781 405 213 ----22172 623
NM_018904chr552137 1592 781 405 213 ----22172 623
NM_018905chr552137 1592 781 405 213 ----22172 623
NM_018906chr552137 1592 781 405 213 ----22172 623
NM_018907chr552137 1592 781 405 213 ----22172 623
NM_018908chr552137 1592 781 405 213 ----22172 623
NM_018909chr552137 1592 781 405 213 ----22172 623
NM_018910chr552137 1592 781 405 213 ----22172 623
NM_018911chr552137 1592 781 405 213 ----22172 623
NM_018912chr551313 1105 700 371 211 ------
NM_018913chr551313 1105 700 371 211 ------
NM_018914chr551313 1105 700 371 211 ------
NM_018915chr551313 1105 700 371 211 ------
NM_018916chr551313 1105 700 371 211 ------
NM_018917chr551313 1105 700 371 211 ------
NM_018918chr551313 1105 700 371 211 ------
NM_018919chr551313 1105 700 371 211 ------
NM_018920chr551313 1105 700 371 211 ------
NM_018921chr551313 1105 700 371 211 ------
NM_018922chr551313 1105 700 371 211 ------
NM_018923chr551313 1105 700 371 211 ------
NM_018924chr551313 1105 700 371 211 ------
NM_018925chr551313 1105 700 371 211 ------
NM_018926chr551313 1105 700 371 211 ------
NM_018927chr551313 1105 700 371 211 ------
NM_018928chr551313 1105 700 371 211 ------
NM_018929chr551313 1105 700 371 211 ------
NM_018945chr653684 3259 3014 2248 141 1814 13544 --
NM_018947chr794960 4670 4066 3561 3235 2000 1871 385 224 13829 ----
NM_018952chr172459 193 ------
NM_018953chr12----1787 --
NM_018957chr221232 --1131 --
NM_018959chr191216 1547 --1724
NM_018963chr2121429 1210 ------
NM_018970chr763009 2990 2481 2297 492 230 21142 987 12706 --
NM_018975chr162773 289 ------
NM_018976chr1222249 2219 1419 22806 1083 --
NM_018977chrX1915 ------
NM_018979chr123814 396 179 12374 1436 --
NM_018982chr1156 ------
NM_018999chr1084733 4174 3901 1938 956 808 418 238 23463 826 11976 14845
NM_019000chr521562 240 1654 ----
NM_019001chr353468 3339 3269 1785 1724 24833 3007 ----
NM_019004chr712334 1112 ----
NM_019006chr152512 171 ------
NM_019008chr2283259 3158 2781 2343 1453 1305 624 207 1471 ----
NM_019027chr432094 1684 756 22405 43 --11876
NM_019035chr43688 436 298 --12008 1397
NM_019036chr61896 11264 ----
NM_019042chr721246 989 ------
NM_019045chrX1698 ------
NM_019046chr101769 1277 ----
NM_019049chr12189 130 ------
NM_019050chr432046 593 566 ----1157
NM_019053chr101696 ------
NM_019055chr112263 240 1511 ----
NM_019058chr10--1514 1768 --
NM_019063chr242263 2136 396 93 ------
NM_019072chr513525 1456 33119 1565 1398 --
NM_019074chr153838 367 255 1753 ----
NM_019084chr1022476 1769 ------
NM_019087chr5--1205 ----
NM_019098chr831622 1184 510 --11813 --
NM_019106chr22133152 3073 3033 3008 2968 2568 2238 813 714 687 322 225 34 12824 32435 2203 675 --
NM_019116chr1653536 2416 2370 1064 817 1521 22604 1372 1849
NM_019555chr31315 ------
NM_019556chrX11172 1932 11289 --
NM_019557chr12576 330 1674 ----
NM_019558chr21122 ------
NM_019593chr2042849 920 569 41 168 ----
NM_019596chr2131142 710 663 ------
NM_019600chr151660 ------
NM_019613chr1731206 241 162 --1906 --
NM_019845chr2270 44 --1717 --
NM_019860chr101664 ----11456
NM_019862chr16----1384 --
NM_019884chr19125 ------
NM_019885chr251860 1852 974 222 169 1777 42266 2120 1034 437 --
NM_019892chr91936 --162 --
NM_019895chr311079 ------
NM_019898chr16----1384 --
NM_019899chr16----1384 --
NM_019900chr16----1384 --
NM_019903chr1021578 1570 --1426 --
NM_020039chr123718 546 179 --21292 778 --
NM_020066chr11326 1374 ----
NM_020116chr451233 1196 661 448 60 ------
NM_020122chr295656 4936 4289 3734 2407 1712 712 369 167 ------
NM_020123chr1021072 474 1164 ----
NM_020125chr131995 1579 1485 11694 143 --
NM_020133chr666049 5346 5287 1077 543 495 ------
NM_020139chr43628 408 138 11769 ----
NM_020141chr122395 1748 ------
NM_020142chr124162 108 62 53 --2532 522 --
NM_020144chr72713 469 ------
NM_020148chr18--12987 ----
NM_020150chr1062195 2005 1647 710 657 308 ------
NM_020151chr231367 442 147 ----2691 252
NM_020154chr15--1220 ----
NM_020159chr421070 363 ------
NM_020168chr1541159 468 360 343 --21011 154 --
NM_020177chr552911 2882 2729 2399 1326 1761 23283 2227 --
NM_020178chr171994 --11219 --
NM_020179chr11----1399 --
NM_020182chr2053449 2972 2225 1269 793 --13522 --
NM_020193chr1121390 1079 1347 ----
NM_020205chr132592 2407 1082 ----13286
NM_020235chr3138 ------
NM_020239chr151886 523 511 232 41 --11624 --
NM_020240chr532185 955 282 1172 ----
NM_020243chr223609 296 205 ------
NM_020245chr6104680 3851 3822 3721 3565 1704 1385 1044 779 302 11291 --23455 622
NM_020246chr73311 250 85 --1335 --
NM_020248chr112098 --21593 663 --
NM_020309chr1931092 344 47 1786 ----
NM_020310chr1762567 829 722 684 618 57 --32370 2024 1881 --
NM_020336chr20133180 2824 2709 2555 1345 1058 1006 892 766 630 381 152 77 12395 ----
NM_020337chr431021 744 57 --12737 --
NM_020341chr2031575 557 501 21613 190 ----
NM_020342chr222296 2197 1637 ----
NM_020344chr91162 ------
NM_020346chr1111563 --1271 --
NM_020351chr31142 ------
NM_020357chr31625 ------
NM_020362chr13817 625 171 ------
NM_020374chr1231592 1420 1283 21750 1431 1623 --
NM_020381chr61816 11714 1604 --
NM_020382chr1241475 1129 149 31 ----1495
NM_020384chrX7689 527 475 349 280 137 90 --11238 1365
NM_020390chr321520 947 --1991 --
NM_020403chr131234 ------
NM_020405chr1774496 3386 3264 3078 2767 1200 823 --43629 2983 2899 1633 --
NM_020416chr432019 1761 823 --1437 --
NM_020420chrY21830 155 --11457 --
NM_020424chr162639 350 --1229 --
NM_020426chr17287 50 --179 --
NM_020429chr742414 2175 856 218 12959 22946 1099 --
NM_020432chr71324 177 --1839
NM_020438chr911403 ------
NM_020440chr143145 2324 1209 867 23000 716 21006 287 --
NM_020443chr1116459 6440 6286 5582 2302 1547 1286 860 815 657 472 26931 4399 25807 1488 --
NM_020444chr531344 602 48 11065 ----
NM_020452chr12366 252 160 ----
NM_020457chr163653 604 64 ------
NM_020466chr644800 3857 1293 539 24897 1085 --14365
NM_020473chrX--1257 ----
NM_020474chr1811546 --12003 --
NM_020475chr822430 512 1613 ----
NM_020476chr822430 512 1613 ----
NM_020477chr822430 512 1613 ----
NM_020478chr832493 1559 575 1676 ----
NM_020480chr822430 512 1613 ----
NM_020526chr141750 1668 1274 735 ------
NM_020530chr221883 2272 119 1674 --
NM_020532chr21883 ------
NM_020640chr321954 1719 ------
NM_020647chr812033 --11863 --
NM_020654chr311559 ------
NM_020666chr51588 ------
NM_020673chr20107746 7086 6991 5624 5067 3119 2822 1616 909 415 1973 46036 5651 5111 1970 --
NM_020682chr103875 783 350 1469 11070 --
NM_020686chr1622825 2144 ------
NM_020689chr2041328 1141 677 566 ------
NM_020697chr821078 500 --21307 226 --
NM_020699chr1105007 4934 4389 3873 3368 1840 1807 1672 1454 415 --21321 874 --
NM_020708chr2062462 2134 865 369 354 76 11642 2611 128 --
NM_020715chr145812 735 562 288 79 ------
NM_020717chrX94923 4166 3661 3074 3054 1547 1286 645 136 --11088 13751
NM_020718chr1676278 6168 5560 5234 5132 1878 1858 46451 5550 4721 199 1663 --
NM_020727chr2133995 3972 1501 13809 23002 1059 --
NM_020728chr732851 1156 563 1328 13094 --
NM_020732chr61124 ------
NM_020734chr1253312 3303 3217 1243 564 ------
NM_020739chr1543715 1388 1041 232 186 ----
NM_020742chrX31810 992 41 ----1127
NM_020747chr51856 ------
NM_020748chr1721608 249 ------
NM_020750chr65608 491 243 106 95 21150 1008 --1452
NM_020752chr1041984 1948 1025 908 --12649 --
NM_020753chr173213 137 40 --2747 21 1529
NM_020760chr211806 11398 11242 --
NM_020766chrX94454 3767 3509 3434 3373 3245 1470 412 336 13071 ----
NM_020768chr563016 2707 2132 2103 145 139 1129 ----
NM_020769chrX5784 639 149 121 70 ------
NM_020771chr611398 130 ----
NM_020772chr1778367 6858 6526 2606 1760 486 401 25943 2650 28249 385 --
NM_020776chr1872591 1974 1071 473 353 289 116 1382 11082 --
NM_020778chr1584241 1916 1254 828 774 654 301 214 13933 33603 1388 195 1530
NM_020787chr1731181 994 182 ------
NM_020791chr1731262 84 29 21436 1219 ----
NM_020792chr352686 2368 1958 1712 97 11848 ----
NM_020795chr17--11680 1236 --
NM_020796chr532628 1158 54 1857 12779 1783
NM_020800chr331270 1151 277 ------
NM_020801chr5----1668 --
NM_020805chr1821722 500 ------
NM_020808chr12795 29 ------
NM_020809chr1131982 1816 751 --1586 --
NM_020810chr141502 43545 3322 1091 886 ----
NM_020814chr221308 1275 138 ----
NM_020818chr141398 ------
NM_020821chr153510 204 44 11478 1475 --
NM_020824chr10140 1273 ----
NM_020839chr341466 1023 549 329 --11430 178
NM_020841chr1233949 3836 499 12736 ----
NM_020844chr8117565 6897 6833 6565 6419 5038 2142 1673 1463 902 456 33026 2881 1400 12077 --
NM_020845chr1282250 1881 951 494 389 371 358 252 --22353 460 11000
NM_020850chr16113043 2930 2757 2553 2395 2043 1214 1208 179 112 36 --22415 867 --
NM_020858chr1561503 944 720 618 372 170 --1641 --
NM_020860chr45722 461 164 109 65 ------
NM_020861chr621164 534 ------
NM_020866chr132958 825 ----1129
NM_020868chr251711 1414 334 174 116 ------
NM_020871chrX1757 --11990 --
NM_020872chr341572 1561 522 377 ------
NM_020886chr112842 24 --1885 11234
NM_020898chr124724 303 166 84 ----1542
NM_020899chr1732412 1545 483 ----11760
NM_020920chr14----122 --
NM_020922chrX21678 1468 --1656 --
NM_020924chr93357 350 190 ------
NM_020927chr162611 151 ------
NM_020935chr254158 3718 3515 1751 538 43832 3430 1844 1046 ----
NM_020940chr1041910 1176 754 38 1518 ----
NM_020947chr16162039 1949 1926 1828 1527 1504 590 515 496 477 458 439 420 401 382 363 11902 2571 344 --
NM_020948chr143498 2717 2241 1135 13402 ----
NM_020951chr1921981 1706 ------
NM_020952chr9--1883 ----
NM_020956chr1964241 3649 3479 3102 1120 536 13615 44033 1424 1114 551 1654
NM_020962chr1552165 2069 1845 631 452 12295 11688 --
NM_020964chr1864145 3068 727 424 346 264 44489 3573 2960 1025 23443 30 --
NM_020967chr202303 53 ------
NM_020972chr42105 99 --3955 294 81 --
NM_020977chr451958 761 600 436 284 1474 ----
NM_020983chr1222311 2235 --2720 66 --
NM_021032chr351725 1688 1602 65 57 ------
NM_021033chr1322675 66 12989 ----
NM_021035chr203433 421 344 2882 38 ----
NM_021061chr843817 3546 3137 1348 63811 3387 3302 3269 2906 2816 33958 1509 707 --
NM_021064chr621452 527 11139 21227 647 --
NM_021072chr552426 590 493 296 100 ------
NM_021076chr221531 1506 ----
NM_021079chr1773346 2838 2672 1185 1076 865 68 135 --12225
NM_021097chr252109 1884 1161 892 170 12476 ----
NM_021109chrX--1149 ----
NM_021109chrX--1149 ----
NM_021116chr7198842 8641 8561 8204 7595 7366 6858 6484 6044 5602 5499 3292 2632 2417 2198 1206 938 587 256 39055 6301 379 68849 8400 2029 1446 1347 633 18783
NM_021120chrX62638 2540 1009 293 237 100 ------
NM_021132chr1021217 117 ------
NM_021140chrX31051 173 68 2727 276 ----
NM_021143chr192407 48 ----1483
NM_021144chr9------1131
NM_021145chr721081 829 ------
NM_021155chr1942936 1131 243 115 --42270 1033 1012 642 --
NM_021159chr451351 1242 1236 1138 135 ----21148 494
NM_021183chrX22363 377 ------
NM_021184chr63675 652 270 ------
NM_021189chr141088 908 754 105 ------
NM_021191chr1222032 653 1842 ----
NM_021192chr22161 34 --178 --
NM_021198chr221451 565 ------
NM_021215chr2071651 990 944 750 551 430 243 --11940 --
NM_021229chr121401 ------
NM_021238chr1221471 381 1776 1150 --
NM_021239chr142423 252 --1510 --
NM_021240chr92557 176 ------
NM_021242chrX1857 ------
NM_021249chr1411212 --189 --
NM_021255chr1453491 3095 2588 1379 1278 --11484 --
NM_021260chr1411382 ------
NM_021574chr2251634 1566 923 505 338 --1399 --
NM_021629chr384341 4182 4064 3505 3422 1956 1190 318 2658 29 ----
NM_021630chr82334 242 --129 --
NM_021633chr131031 365 93 --1259 --
NM_021637chrX41027 912 873 867 11064 ----
NM_021638chr4184979 4929 4920 4841 4813 4209 3769 3349 1991 1973 1952 1905 1851 1451 905 308 176 160 24947 3104 ----
NM_021643chr231454 572 291 --1221 --
NM_021647chr463862 1716 1340 1031 867 314 --11233 --
NM_021649chr541830 1734 1531 630 11161 ----
NM_021722chr7--1173 ----
NM_021723chr7177 1214 1388 --
NM_021728chr141370 ------
NM_021809chr2062461 2352 1749 612 160 94 1619 --12439
NM_021813chr684753 4127 4107 2205 1979 1384 1293 1184 --11471 11859
NM_021814chr611324 ------
NM_021905chr642023 1444 570 284 2502 328 129 11623
NM_021911chr575035 4321 3757 3644 1557 1281 283 13949 1510 --
NM_021912chr1583847 3556 3538 3227 1352 1158 795 628 1845 ----
NM_021913chr1961328 698 395 102 76 54 --3720 485 442 --
NM_021914chr1441572 360 108 61 2677 663 ----
NM_021931chr203831 267 254 1345 1157 --
NM_021940chr641348 1295 501 107 ----1449
NM_021943chr671757 1489 673 655 545 290 214 --11656 --
NM_021946chrX41337 1187 934 499 --11114 --
NM_021947chr172845 364 1921 ----
NM_021949chrX82481 2329 2257 2173 2041 1138 270 105 --12543 --
NM_021954chr1373446 2855 2323 1285 1092 817 214 32621 2265 1472 ----
NM_021959chr61367 1975 1268 --
NM_021960chr132343 1916 197 11971 --1183
NM_021961chr11126567 6276 5935 5184 4785 4600 2841 2587 1984 1930 1917 1563 26227 958 ----
NM_021962chr1782286 2231 827 763 733 609 484 331 --11630 --
NM_021963chrX1767 ------
NM_021964chr385078 5055 4558 4443 4230 4024 2529 622 16529 16278 --
NM_021977chr653867 3452 2814 2524 296 ------
NM_021984chrX51168 1009 390 184 123 1190 21243 1221 --
NM_021987chrX51168 1009 390 184 123 1190 21243 1221 --
NM_021988chr2081600 1332 1149 620 581 485 232 128 ------
NM_021990chrX51168 1009 390 184 123 1190 21243 1221 --
NM_021998chrX31461 386 67 ------
NM_022041chr1642611 999 444 91 ------
NM_022048chr15116073 5546 4899 4358 4340 2106 2077 1697 1671 644 237 --25708 278 14233
NM_022059chr171177 --1357 --
NM_022060chr1461357 1129 436 377 257 72 --11143 --
NM_022062chr1141824 1388 1264 202 130 ----
NM_022066chr17159 --3893 115 104 1850
NM_022079chr101787 ------
NM_022093chr13763 692 75 ------
NM_022100chr11504 ------
NM_022107chr62463 34 --2545 58 --
NM_022114chr174194 4051 3655 3509 3147 1329 336 34316 3918 3279 --13642
NM_022118chr131259 ------
NM_022121chr6187 ------
NM_022130chr511256 --1249 --
NM_022137chr1431913 1848 490 1266 ----
NM_022164chr13679 629 278 1149 1539 --
NM_022166chr16105793 5692 5636 4936 4249 4084 2535 1959 1904 1833 ------
NM_022169chr11101519 1274 1239 1171 478 466 358 278 248 198 ------
NM_022170chr741599 241 231 105 1489 11432 --
NM_022307chr72626 286 ------
NM_022334chr26870 794 738 402 346 290 ------
NM_022336chr262087 1526 847 714 425 249 --1504 22237 287
NM_022351chr853270 3250 2960 2861 96 ------
NM_022361chr62393 129 ------
NM_022442chr2081600 1332 1149 620 581 485 232 128 ------
NM_022455chr51293 --1119 --
NM_022459chr1366380 5425 4361 4141 4134 1383 22347 1158 24174 2298 15892
NM_022463chr1741449 1396 519 346 11423 ----
NM_022465chr1283044 2441 2406 1889 575 346 104 36 ------
NM_022469chr183376 3133 3113 3031 2817 1204 977 45 23262 1051 32753 703 89 --
NM_022470chr321242 911 ------
NM_022475chr41285 ------
NM_022477chr2041496 1086 482 26 2587 116 11167 --
NM_022482chr2052218 1586 588 388 246 --11732 --
NM_022484chr71124 21257 945 ----
NM_022488chr31150 ------
NM_022494chr10187 ------
NM_022497chr382975 2632 1203 669 647 615 522 361 ------
NM_022550chr51141 ------
NM_022552chr221196 843 ------
NM_022566chr151525 ------
NM_022571chr14140 ------
NM_022572chr231432 305 29 --1371 --
NM_022576chr11316 ------
NM_022648chr2124598 4525 4341 3702 3664 3658 3645 3639 1480 1223 632 563 --11384 --
NM_022650chr51771 ------
NM_022719chr2293230 3062 2822 1431 1261 1060 695 571 130 13388 23074 1482 --
NM_022726chr621173 683 1409 ----
NM_022728chr72784 229 ------
NM_022731chr13289 198 74 ------
NM_022745chr152917 2753 1035 912 650 ------
NM_022748chr762729 2659 1992 1799 833 80 1929 12578 --
NM_022753chr121953 1755 --1157 --
NM_022757chr311001 ------
NM_022763chr312186 1305 23004 903 --
NM_022771chr121834 ------
NM_022776chr341383 1256 491 136 ------
NM_022777chr721744 1413 ------
NM_022781chr933135 2963 2601 167 ----
NM_022784chr15135 ------
NM_022787chr182469 2404 1882 1804 918 617 368 34 ------
NM_022817chr211664 188 --11973
NM_022818chr1631416 613 321 11360 ----
NM_022821chr13388 372 184 ------
NM_022824chr531823 553 24 21836 396 ----
NM_022829chr2041810 1700 510 143 --11456 --
NM_022836chr13668 163 98 1531 ----
NM_022841chr1551850 1712 989 497 239 ------
NM_022843chr1321398 995 11440 ----
NM_022845chr1632220 472 305 1882 ----
NM_022893chr273171 3122 2835 2031 881 83 26 ------
NM_022894chr211628 11581 --1190
NM_022897chr531016 985 414 --11040 --
NM_022898chr1423562 1578 --13935 24464 3989
NM_022900chr71806 1259 ----
NM_022902chr52329 118 ------
NM_022912chr232739 895 207 12643 12397 --
NM_022913chr52248 107 ------
NM_022918chr1121629 226 ------
NM_022970chr1021354 95 ------
NM_023000chr141609 ------
NM_023001chr141609 ------
NM_023009chr1164 --1632 --
NM_023015chr11704 ------
NM_023016chr242448 892 824 225 2645 506 --22397 2200
NM_023037chr131214 1274 122 --
NM_023079chr1741719 569 520 29 ------
NM_023105chr851911 1903 1521 938 158 ------
NM_023106chr851911 1903 1521 938 158 ------
NM_023110chr851911 1903 1521 938 158 ------
NM_023111chr851911 1903 1521 938 158 ------
NM_023923chr183283 3045 2964 2482 1410 1339 1082 155 --22664 944 --
NM_023929chr822634 1938 --1508 --
NM_023930chr113833 167 161 ----1581
NM_024007chr543092 1048 951 266 ------
NM_024017chr1741464 1062 331 47 --11077 --
NM_024019chr42909 114 ------
NM_024034chr2021022 978 --179 --
NM_024040chr101134 ------
NM_024046chr321042 86 --171 11298
NM_024052chr1742855 2602 1949 306 1296 22732 2218 12307
NM_024055chr51654 --1170 --
NM_024056chr121596 ------
NM_024068chr121484 2103 72 ----
NM_024086chr1763422 2850 983 736 168 90 --11440 --
NM_024087chrX3613 499 451 ------
NM_024090chr42635 241 ----1199
NM_024095chr121196 11479 ----
NM_024103chr19121838 1449 1345 726 707 662 445 360 204 146 84 52 --2736 416 --
NM_024117chr9--11149 1118 --
NM_024165chr62207 28 --1117 --
NM_024295chr821470 394 1665 1829 --
NM_024306chr165777 765 230 200 78 --1885 --
NM_024328chr143503 273 52 1244 165 --
NM_024329chr141279 1004 187 177 1571 ----
NM_024341chr1994205 3490 3342 2950 2819 1049 965 640 92 11363 33756 2695 684 --
NM_024345chr9135909 5579 5169 5040 4569 4071 3943 2081 1857 1781 1328 493 307 34589 2418 247 14358 --
NM_024420chr1--1382 ----
NM_024424chr1171191 1007 816 281 194 85 75 1920 1257 --
NM_024425chr1171191 1007 816 281 194 85 75 1920 1257 --
NM_024426chr1171191 1007 816 281 194 85 75 1920 1257 --
NM_024429chr731069 747 298 ------
NM_024430chr1841585 313 292 216 11627 11371 --
NM_024490chr151458 ----1436
NM_024491chr31415 ------
NM_024496chr14--1668 ----
NM_024511chr42787 345 --22164 388 11326
NM_024522chr181883 1818 1737 1727 1567 1542 428 404 1476 1106 --
NM_024524chr322004 676 ------
NM_024529chr131194 823 242 ------
NM_024539chrX11186 ------
NM_024546chr132890 390 ------
NM_024551chr1262562 2243 2214 1955 1819 962 42545 2158 261 75 ----
NM_024551chr1262562 2243 2214 1955 1819 962 42545 2158 261 75 ----
NM_024569chr162395 2270 1160 1067 655 150 --2604 319 --
NM_024590chr421330 276 ------
NM_024595chr111216 --1224 --
NM_024602chr12691 649 ------
NM_024607chr883915 3633 3322 2892 1191 673 342 198 14049 3732 407 59 --
NM_024611chr1532475 444 400 ----13424
NM_024612chr1731036 986 828 ------
NM_024626chr121575 1030 ------
NM_024631chr11259 52 ------
NM_024632chr51282 ------
NM_024636chr722032 2002 1418 11160 --
NM_024639chr61185 ------
NM_024640chr12773 645 160 ----
NM_024645chr831590 1457 1389 11148 11253 --
NM_024646chr152973 2679 2530 2471 517 23704 1431 22605 1060 --
NM_024656chr1911423 --3542 436 183 --
NM_024659chr2----11028 --
NM_024663chr20144 ------
NM_024665chr353700 3061 2891 108 88 13073 ----
NM_024667chr1271623 1537 1491 1439 627 418 314 --1597 1506
NM_024700chr1--1845 ----
NM_024704chr202735 229 --1271 --
NM_024713chr1521235 302 21424 1376 ----
NM_024719chr13179 ------
NM_024721chr81747 ------
NM_024742chr164662 643 594 195 --31540 1531 1412 --
NM_024745chr163932 72 63 ------
NM_024751chr452038 1956 850 737 300 ------
NM_024761chr9114322 4155 3607 2077 1080 1066 1023 590 379 153 98 14333 --14071
NM_024770chr285675 5645 4921 4500 2155 1040 884 56 --31488 1212 403 --
NM_024811chr1121812 1648 11547 ----
NM_024834chr1031500 708 557 1488 ----
NM_024835chr172357 49 ------
NM_024850chr52778 47 ------
NM_024852chr12599 565 ------
NM_024859chrX51023 820 98 67 28 --1121 --
NM_024871chr32573 376 --166 --
NM_024887chr142106 1322 720 53 ----1596
NM_024899chr181643 ------
NM_024900chr472176 1929 1760 891 487 268 216 2639 167 21973 478 --
NM_024900chr472176 1929 1760 891 487 268 216 2639 167 21973 478 --
NM_024909chr661560 1123 628 619 527 359 --11514 --
NM_024913chr72426 281 ------
NM_024915chr862390 1907 702 486 307 181 --1158 --
NM_024922chr1652096 1621 1319 427 278 ------
NM_024930chr572507 2427 2035 1944 1741 633 499 --1993 --
NM_024939chr1621400 159 ------
NM_024947chr3108337 6593 5810 3275 2805 2483 1650 1292 833 764 26754 1702 58972 8082 7373 2865 2388 13551
NM_024948chr10--1100 ----
NM_024953chr1262722 2403 2269 2060 1995 266 12441 12301 1757
NM_024971chr9--1883 ----
NM_024979chr1331595 1385 497 --1182 --
NM_024989chr2117562 7555 7544 6735 6537 5974 2518 1447 1375 1020 808 13134 32250 1630 353 --
NM_024991chr1042893 1286 542 276 1626 ----
NM_024993chr22634 30 --1571 --
NM_025052chr2132 ----194
NM_025054chr853995 3168 2743 2734 1479 23140 1202 12876 --
NM_025057chr1421255 530 ------
NM_025073chr164508 4145 3797 3347 825 61 --23934 581 --
NM_025074chr442691 2481 2170 892 1177 ----
NM_025076chr22606 33 ------
NM_025083chr1541797 1758 1582 323 --1187 --
NM_025099chr173971 126 76 --21300 369 --
NM_025104chr1751769 1526 1175 506 431 ------
NM_025133chr221005 32 ------
NM_025134chr1621656 463 1895 ----
NM_025138chr1321050 359 11328 ----
NM_025146chr312211 11032 --161
NM_025147chr231103 251 161 1133 ----
NM_025160chr123094 1661 ----1277
NM_025164chr1122038 1829 11718 ----
NM_025182chr95925 918 426 419 181 ------
NM_025187chr1631228 987 474 --11269 --
NM_025191chr133396 2731 1056 --1790 --
NM_025194chr19--11171 ----
NM_025196chr42576 35 1541 ----
NM_025211chr91274 ------
NM_025221chr4--1201 1991 --
NM_025224chr2052110 1774 1495 474 71 ----12200
NM_025230chr142747 96 --1685 --
NM_025235chr1031968 1482 1458 130 ----
NM_025236chr63268 73 36 --1104 --
NM_025237chr1731485 545 285 ------
NM_025238chr151995 ------
NM_025248chr17103193 2728 2259 2079 1298 611 551 384 93 42 --22904 2763 --
NM_025250chr762530 2436 2305 2191 853 258 1445 22511 2264 12411
NM_025257chr62347 61 ------
NM_030576chr1741964 683 677 664 1892 21026 365 --
NM_030579chr1652872 2791 2348 246 34 --22614 206 --
NM_030593chr191529 --1232 --
NM_030594chr1521076 78 ------
NM_030621chr1493965 3833 3822 3568 3399 2595 917 783 239 13661 --1952
NM_030623chr241428 615 517 142 1570 --1602
NM_030625chr1062532 2488 2076 2016 461 104 11748 12464 --
NM_030627chr533631 3484 178 1783 ----
NM_030629chr1661895 1559 1251 497 472 376 --11348 --
NM_030647chr784146 2274 1746 935 422 166 153 72 12469 15958 --
NM_030648chr475018 4969 4693 4382 2216 1293 541 --13637 1213
NM_030650chr224248 2755 --13040 11577
NM_030664chr1042117 1720 400 70 2692 599 ----
NM_030674chr1275698 5639 5159 4556 3881 1763 547 34313 1630 1232 1834 21749 383
NM_030751chr1021671 113 1723 ----
NM_030751chr1021671 113 1723 ----
NM_030755chr1421915 393 22072 595 32512 2219 440 --
NM_030759chr102196 165 ------
NM_030761chr192688 2638 2367 2147 2089 1761 1692 1038 244 3354 269 218 ----
NM_030762chr1221386 1283 ------
NM_030763chrX2844 776 1677 ----
NM_030767chr932095 1905 471 12456 --12007
NM_030784chr6178 ------
NM_030786chr121811 569 ------
NM_030792chr111646 ------
NM_030796chr782065 2041 2006 1974 1686 868 784 680 ------
NM_030797chr21259 ------
NM_030802chr173254 202 21 ------
NM_030806chr1179042 8955 8898 8352 8345 8328 8216 8119 8054 6440 6254 1963 1111 788 730 138 36 28085 1613 47108 7046 3274 484 --
NM_030808chr174330 303 285 150 ------
NM_030809chr1242236 429 262 31 --11942 --
NM_030816chr122996 2631 --12377 --
NM_030820chr62308 280 ------
NM_030881chr2241900 1653 633 176 ------
NM_030884chr392156 2002 616 400 392 346 278 238 90 --1899 --
NM_030885chr322353 749 ------
NM_030915chr242409 2372 1822 682 ------
NM_030916chr14928 837 205 91 ----1121
NM_030918chr1115291 5072 4560 3680 3614 3352 3339 2114 2023 1660 877 --34266 4128 1897 --
NM_030920chr121582 815 --1217 --
NM_030927chr1041311 1000 642 363 11042 31081 1019 509 --
NM_030934chr11510 --1260 1247
NM_030937chr121183 353 --11124 --
NM_030939chr631136 1044 345 1985 ----
NM_030940chr911418 --31063 486 62 --
NM_030948chr62210 87 ------
NM_030952chr131297 1219 390 ------
NM_030953chr521304 636 11577 ----
NM_030962chr111314 11072 11506 --
NM_030964chr593579 3349 1338 783 678 525 515 400 121 32709 1129 597 33570 1176 1113 --
NM_030981chr1171221 1124 947 846 839 792 402 ------
NM_031157chr121473 ------
NM_031216chr1812000 ------
NM_031226chr153848 347 22 11289 ----
NM_031243chr7130 11833 ----
NM_031262chr93986 721 302 ------
NM_031263chr931043 778 359 ------
NM_031267chr71467 ------
NM_031284chr152353 334 1845 ----
NM_031286chr11396 ------
NM_031296chr452742 2448 1067 545 165 --1856 --
NM_031305chr421540 193 --1709 11570
NM_031314chr1451912 1707 1533 175 33 --1113 --
NM_031371chr12276 252 ------
NM_031371chr12276 252 ------
NM_031372chr41131 ------
NM_031407chrX140 ------
NM_031411chr552137 1592 781 405 213 ----22172 623
NM_031417chr1951905 830 736 147 76 --22767 70 --
NM_031427chr1485689 5557 5487 4081 3652 1764 1487 525 1850 ----
NM_031438chr531968 546 522 --1512 --
NM_031439chr821328 1202 1287 11482 --
NM_031442chrX41030 805 398 291 --12576 --
NM_031444chr2242255 1922 631 60 --32563 1737 709 --
NM_031445chr253031 2826 849 798 670 --11229 1150
NM_031450chr114559 479 255 28 --1437 --
NM_031461chr831803 839 482 1846 ----
NM_031468chr7137982 7962 6756 6523 6268 4978 2415 1989 1703 1481 636 393 386 27029 6290 22653 1634 16650
NM_031469chr653574 3568 369 237 83 ------
NM_031476chr1642645 2337 1987 1903 1938 --2778 172
NM_031478chr161192 1668 --1256
NM_031483chr2063544 3162 2804 2364 310 262 ------
NM_031492chr113538 451 97 ------
NM_031844chr163532 3101 1454 929 767 353 ------
NM_031845chr21321 --1402 --
NM_031847chr21321 --1402 --
NM_031849chr552137 1592 781 405 213 ----22172 623
NM_031857chr552137 1592 781 405 213 ----22172 623
NM_031860chr552137 1592 781 405 213 ----22172 623
NM_031866chr1031002 742 170 1227 ----
NM_031886chr1942311 2109 1696 785 1825 ----
NM_031890chr22133014 2629 2570 2329 1902 1861 1181 1098 933 875 420 388 289 1429 --12158
NM_031892chrX2758 747 ------
NM_031908chr551354 1283 998 947 213 ------
NM_031911chr432590 1729 93 11105 ----
NM_031922chr61427 --187 --
NM_031953chr4------1348
NM_031954chr12102891 2813 2696 2681 1924 1854 906 841 490 42 --2720 530 --
NM_031989chr121139 ------
NM_031992chr741599 241 231 105 1489 11432 --
NM_032013chr2041496 1086 482 26 2587 116 11167 --
NM_032017chr11329 --31995 1579 1403 --
NM_032041chr832164 2033 524 12304 ----
NM_032047chr341891 775 586 29 136 ----
NM_032050chr223388 157 133 1758 ----
NM_032052chr224991 542 518 179 11143 ----
NM_032088chr551313 1105 700 371 211 ------
NM_032092chr551313 1105 700 371 211 ------
NM_032102chr1122256 978 --12793 --
NM_032104chr1239 26 ------
NM_032105chr1187881 7768 7558 7394 7366 7281 7168 6844 2823 2536 2421 1110 1040 980 916 862 39 26 27373 5645 26007 1321 11455
NM_032109chr531007 149 22 ------
NM_032124chr1831179 850 331 ------
NM_032138chr13133 ------
NM_032145chr61112 ------
NM_032153chr342283 1982 1063 713 --11966 --
NM_032154chr101863 ------
NM_032181chr22557 27 ------
NM_032186chr11933 1444 11421 --
NM_032189chr1354428 3270 1642 699 271 ------
NM_032195chr211375 --1118 --
NM_032199chr1073880 3443 3230 2804 2418 1506 565 12676 22531 1058 --
NM_032205chr8129 ------
NM_032217chr441328 935 556 178 195 ----
NM_032221chr2031270 310 73 1362 ----
NM_032228chr1122285 81 ------
NM_032229chr1321172 162 1799 ----
NM_032231chr152306 21 ------
NM_032236chr11903 ------
NM_032239chr4268 47 ----1553
NM_032256chr12----1191 --
NM_032289chr531903 1491 587 1603 ----
NM_032298chr191504