TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-196a-3p
miRNA Sequence: CGGCAACAAGAAACUGCCUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr142720 292 ------
NM_000038chr532077 1329 744 ------
NM_000044chrX1275 ------
NM_000067chr82542 94 ------
NM_000081chr121814 614 11629 ----
NM_000084chrX106781 5466 4950 4906 2212 2058 1855 1653 411 57 --31129 677 121 26505 4736
NM_000109chrX12410 ------
NM_000110chr12272 22 ------
NM_000115chr1332489 1678 532 ------
NM_000138chr151398 ------
NM_000141chr10----189 --
NM_000142chr411325 11604 ----
NM_000161chr142660 30 --11781 --
NM_000168chr743010 2512 2276 942 --32917 2280 377 --
NM_000176chr53119 91 23 12601 ----
NM_000194chrX2227 159 ------
NM_000202chrX22707 797 13269 --11337
NM_000214chr2041467 537 503 90 ------
NM_000217chr1255171 4931 2134 1648 150 ------
NM_000222chr411728 --32106 1576 1553 11712
NM_000252chrX1399 ------
NM_000259chr1586334 6325 5883 5787 5583 5352 4484 381 22366 2266 ----
NM_000267chr1743154 2692 2516 90 ----1142
NM_000293chr162291 51 ------
NM_000297chr411724 2760 273 ----
NM_000304chr171145 ------
NM_000314chr1023005 650 12893 1182 --
NM_000332chr666251 4907 4353 1855 1234 769 14565 26329 4615 14336
NM_000333chr32949 148 ------
NM_000335chr32837 306 --12175 --
NM_000337chr535771 5572 4959 --11834 12096
NM_000338chr15175 1195 ----
NM_000345chr41913 --1320 --
NM_000346chr1731387 1247 639 ------
NM_000362chr2223599 1121 --11115 13515
NM_000368chr944843 1054 486 426 ------
NM_000397chrX11655 --12102 --
NM_000408chr242592 1364 1115 413 23073 788 13413 --
NM_000430chr1743589 2852 1388 204 --23719 1230 12860
NM_000459chr9----1325 --
NM_000462chr1511317 ------
NM_000489chrX23172 2642 --42718 2224 863 195 --
NM_000495chrX11161 ------
NM_000503chr81125 --11649 --
NM_000516chr201317 ------
NM_000522chr72485 56 ------
NM_000525chr1121496 1004 11040 ----
NM_000533chrX21602 1587 ----1739
NM_000555chrX47709 7016 4811 116 --1538 --
NM_000575chr22421 177 ------
NM_000582chr42479 387 ------
NM_000594chr61677 ------
NM_000600chr7284 22 ------
NM_000611chr1145791 4751 1933 1916 --14850 1451
NM_000618chr1244845 1410 1377 322 ------
NM_000618chr1244845 1410 1377 322 ------
NM_000627chr21297 ------
NM_000673chr4------131
NM_000681chr10----11169 11347
NM_000684chr101204 --11063 --
NM_000719chr1256493 5064 4153 1199 741 16421 12261 --
NM_000722chr71278 ------
NM_000724chr1011421 --1138 1290
NM_000767chr1931365 1326 145 --1257 --
NM_000780chr81124 --1793 --
NM_000806chr541395 1253 653 23 --11231 --
NM_000813chr545193 1394 161 122 13703 1263 --
NM_000814chr1522802 768 --1649 --
NM_000818chr10--1210 1523 --
NM_000824chr4------1590
NM_000826chr412600 ------
NM_000833chr161125 11526 ----
NM_000840chr72416 387 ------
NM_000859chr521566 1539 --21408 1123 --
NM_000868chrX31958 593 554 --12568 --
NM_000872chr103435 380 111 ------
NM_000875chr1546920 2249 1918 672 15447 --25071 4906
NM_000891chr173647 424 220 --12944 13191
NM_000901chr431007 498 46 12156 ----
NM_000908chr51615 --2793 292 --
NM_000917chr102961 32 ------
NM_000933chr2011350 ------
NM_000945chr212049 ----11647
NM_000950chrX33434 2921 2393 11252 --11160
NM_000958chr51446 --11237 --
NM_000959chr173984 3962 3429 2972 2914 653 561 ------
NM_001001395chr1222569 378 --12598 12550
NM_001001396chr134381 1055 710 194 --24232 1060
NM_001001419chr555092 5075 4816 809 206 ----23427 3232
NM_001001420chr555092 5075 4816 809 206 ----23427 3232
NM_001001481chr843091 1258 1206 711 ------
NM_001001483chr111378 ------
NM_001001484chr101289 ----12269
NM_001001502chr51500 ------
NM_001001556chr151441 1114 ----
NM_001001664chr222736 2703 13237 14089 13849
NM_001001787chr1----1414 --
NM_001001933chr11513 ------
NM_001001971chr10--11403 --1564
NM_001002032chr172702 625 --1726 --
NM_001002033chr172802 725 --1826 --
NM_001002243chr2----1251 --
NM_001002259chr121325 ------
NM_001002295chr101756 ------
NM_001002762chr101810 --1321 11179
NM_001002838chrX11345 ------
NM_001002843chr152296 82 ------
NM_001002860chr1443921 3422 1352 194 --13948 13427
NM_001002909chr1721702 755 1393 ----
NM_001002914chr1721059 812 ----11083
NM_001003406chr2223298 3227 --12115 12265
NM_001003407chr1064768 4235 3456 1787 1253 1010 --1316 15061
NM_001003408chr1064768 4235 3456 1787 1253 1010 --1316 15061
NM_001003652chr1898097 8074 7978 7661 5595 5540 3350 2293 1235 ----27653 1436
NM_001003674chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_001003675chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_001003694chr31444 ------
NM_001003712chr1223441 1300 ------
NM_001003792chr31112 ------
NM_001003793chr31112 ------
NM_001003845chr21105 --1468 --
NM_001003927chr17180 ------
NM_001003940chr152310 104 --1830 --
NM_001003942chr152310 104 --1830 --
NM_001003943chr152314 108 --1834 --
NM_001004051chrX188 ------
NM_001004065chr932479 469 311 --13791 --
NM_001004196chr321078 214 ------
NM_001004317chr644306 1677 1128 870 11728 14162 --
NM_001004360chr22316 80 --11949 1182
NM_001004419chr1212894 13272 21584 1556 --
NM_001005266chr152664 112 ------
NM_001005267chr152664 112 ------
NM_001005268chr152664 112 ------
NM_001005269chr152664 112 ------
NM_001005354chr122459 72 --1197 --
NM_001005404chr1733802 3738 3125 ------
NM_001005609chrX43698 797 316 103 ----1299
NM_001005732chr211665 ------
NM_001005733chr211622 ------
NM_001005849chr171583 ------
NM_001005861chr3----1903 --
NM_001006600chr521943 266 --1973 --
NM_001006612chrX------1104
NM_001006613chrX------1104
NM_001006614chrX------1104
NM_001006617chr911183 ------
NM_001006619chr911183 ------
NM_001006620chr911183 ------
NM_001006621chr911183 ------
NM_001006623chr21382 --1157 --
NM_001006636chr21297 ------
NM_001006641chr9--11763 ----
NM_001006642chr9--11763 ----
NM_001006643chr9--11763 ----
NM_001006681chrX1136 ------
NM_001006682chrX1136 ------
NM_001006683chrX1136 ------
NM_001006684chrX1230 ------
NM_001006938chrX------1561
NM_001006946chr2----1723 11518
NM_001007024chr1721439 245 ------
NM_001007025chr1721439 245 ------
NM_001007098chr12781 94 ----1899
NM_001007102chr611438 --11596 --
NM_001007224chr722328 477 ------
NM_001007237chr132850 2619 211 22211 115 22006 582 --
NM_001007246chr2131857 1783 240 --11861 --
NM_001007257chr161466 1403 1330 537 391 369 ------
NM_001007278chr1375272 4957 4796 4306 3525 3491 1313 --12107 --
NM_001007466chr685192 4983 4637 4607 1610 1561 1548 64 ------
NM_001007559chr1811384 11367 --12051
NM_001007794chr11110 ----1205
NM_001008220chr533523 2859 1261 --23901 3811 --
NM_001008222chrX1568 ------
NM_001008225chr72524 301 ------
NM_001008239chr1853461 3351 2858 1209 667 11370 13587 --
NM_001008405chr7163 ------
NM_001008408chr756345 6242 5837 1591 463 --12076 --
NM_001008495chr822257 1753 ------
NM_001008564chr1312278 ----22211 1838
NM_001008738chr512250 --21126 1101 1327
NM_001008895chr132977 915 ------
NM_001008925chr432945 2589 913 --12185 --
NM_001009552chr8------1480
NM_001009814chr13--179 ----
NM_001009899chr323969 3948 2376 173 35381 4820 1365 --
NM_001009993chr234588 4210 418 1526 23578 1290 --
NM_001010000chr1833524 2855 1380 ------
NM_001010853chr632921 2700 2208 --1545 --
NM_001010861chr112154 ------
NM_001010891chr565885 5493 4361 1093 762 40 --42703 2535 1176 309 --
NM_001010924chr102787 489 ------
NM_001010934chr721062 99 ------
NM_001010986chrX11678 --22447 1682 --
NM_001011513chr434153 3994 2696 --33189 2754 2734 --
NM_001011515chr431036 268 145 ------
NM_001011516chr431036 268 145 ------
NM_001011551chrX------151
NM_001011553chr721007 287 137 ----
NM_001011645chrX1275 ------
NM_001011666chr746447 5630 5357 2306 --56049 5205 5123 1543 152 --
NM_001011708chr232718 755 494 ------
NM_001011713chr1421407 152 --11545 --
NM_001011885chr1521728 727 ------
NM_001012267chr911411 --1760 --
NM_001012420chr1532955 650 424 ----1702
NM_001012423chr1522955 650 ----1702
NM_001012478chr191637 --1419 --
NM_001012751chr101616 --11630 --
NM_001012968chrX1914 --22741 921 --
NM_001012977chrX------21181 907
NM_001012980chrX1231 ------
NM_001012989chrX1222 ------
NM_001013031chr1033386 1317 838 ----12628
NM_001013399chr61834 ------
NM_001013406chr711354 ------
NM_001013415chr411198 --1619 --
NM_001013437chr181425 ------
NM_001013438chr31403 ------
NM_001013439chr31249 ------
NM_001013620chr1278055 7329 6618 5953 5152 1714 1475 26180 2200 ----
NM_001013703chr15167 ------
NM_001013843chr151178 1578 1918 --
NM_001014797chr1026332 1230 --12585 --
NM_001014809chr41918 ------
NM_001014812chr15--1378 ----
NM_001015045chr432194 2076 878 ------
NM_001015877chrX22886 829 --12890 --
NM_001017395chr321246 497 ------
NM_001017434chr11165 ------
NM_001017923chr1411627 ------
NM_001017962chr102961 32 ------
NM_001017969chr91659 ------
NM_001017977chr1----1369 --
NM_001017979chr42646 268 ------
NM_001017999chr11278 ------
NM_001017999chr11278 ------
NM_001018000chr11278 ------
NM_001018000chr11278 ------
NM_001018001chr11278 ------
NM_001018008chr152519 103 ------
NM_001018037chr921328 1226 1951 ----
NM_001018057chr112485 146 --1543 11228
NM_001018064chr91430 ------
NM_001018065chr925538 165 --25839 413 12419
NM_001018066chr925538 165 --25839 413 12419
NM_001018074chr53119 91 23 12601 ----
NM_001018075chr53119 91 23 12601 ----
NM_001018076chr53119 91 23 12601 ----
NM_001018077chr53119 91 23 12601 ----
NM_001018111chr731352 1164 982 ------
NM_001020658chr131102 307 113 1595 ----
NM_001020658chr131102 307 113 1595 ----
NM_001020818chr1951872 1853 1717 492 221 --1230 --
NM_001020819chr1951872 1853 1717 492 221 --1230 --
NM_001020820chr1951872 1853 1717 492 221 --1230 --
NM_001020821chr1951872 1853 1717 492 221 --1230 --
NM_001020825chr5--176 ----
NM_001023560chr6----1875 --
NM_001024071chr14----2803 212 --
NM_001024094chr53119 91 23 12601 ----
NM_001024380chr81209 ----12059
NM_001024381chr81209 ----12059
NM_001024647chr1237160 4793 4664 1239 ----
NM_001024649chr532953 2515 957 ----12166
NM_001024808chr1212782 --1296 --
NM_001024934chr61264 ------
NM_001024935chr61264 ------
NM_001024936chr61264 ------
NM_001024948chr122692 2605 11371 12621 --
NM_001024956chr1134545 1037 226 15881 15753 --
NM_001025068chr321755 306 ------
NM_001025069chr321755 306 ------
NM_001025076chr1056114 5891 5872 4050 3971 --35468 4483 1260 --
NM_001025077chr1087472 7249 7230 5408 5329 4948 4734 639 --46826 5841 2618 1353 --
NM_001025079chr374076 3571 3220 1082 1071 245 215 2617 128 --13712
NM_001025108chr244218 3134 2712 2700 --22927 2655 --
NM_001025203chr21140 ------
NM_001025204chr21140 ------
NM_001025248chr15------11264
NM_001025249chr15------11264
NM_001025616chr421462 318 ------
NM_001025780chr931369 499 105 ------
NM_001029860chr81244 ------
NM_001029863chr622190 910 ------
NM_001029875chr511107 ------
NM_001029882chr11604 ------
NM_001029882chr11604 ------
NM_001030007chr1663770 3553 1424 1133 405 387 ------
NM_001030055chr1453205 1128 930 678 516 31842 1771 695 --13602
NM_001031679chr121601 ----1574
NM_001031695chr2233856 2092 1851 11464 25376 2072 --
NM_001031712chr6--1395 ----
NM_001031716chr2------1951
NM_001031732chr431066 930 472 ----13315
NM_001031812chr571436 879 705 680 448 315 150 ----11669
NM_001031835chr162291 51 ------
NM_001032282chr811309 --11002 --
NM_001032367chr151442 ------
NM_001032380chr1051997 1921 694 499 364 ------
NM_001032394chr632864 2666 2574 1323 --12320
NM_001032395chr632731 2533 2441 1190 --12187
NM_001033045chr23771 568 114 ------
NM_001033047chr421033 406 --2240 35 --
NM_001033057chr311447 --21579 842 --
NM_001033059chr611659 ------
NM_001033081chr121821 1540 11335 11908 1340
NM_001033082chr121821 1540 11335 11908 1340
NM_001033087chr2011314 --23260 3105 --
NM_001033117chr324755 4497 --24782 4228 --
NM_001033507chr121794 132 ------
NM_001033551chr17----33093 2851 1296 --
NM_001033557chr211216 --1131 --
NM_001033602chr1322692 873 ----11728
NM_001034850chr5------1248
NM_001034954chr1032096 2044 138 ------
NM_001034955chr1032096 2044 138 ------
NM_001034956chr1032096 2044 138 ------
NM_001034957chr1032096 2044 138 ------
NM_001035511chr121945 323 ------
NM_001035512chr122052 430 ------
NM_001035513chr122052 430 ------
NM_001035521chr21512 ------
NM_001037132chr721614 478 ------
NM_001037133chr721614 478 ------
NM_001037163chr7144 --1760 --
NM_001037164chr7----1153 1776
NM_001037165chr758899 8397 8342 7321 6009 --22044 1923 --
NM_001037172chr311386 1290 --11344
NM_001037317chr112154 ------
NM_001037334chr1842163 1971 1587 712 --1476 --
NM_001037339chr1--11219 2640 232 --
NM_001037340chr1--11219 2640 232 --
NM_001037341chr1--11219 2640 232 --
NM_001037341chr1--11219 2640 232 --
NM_001037872chr2----1634 --
NM_001037954chr1121402 598 --1570 --
NM_001038493chr241372 1343 1327 185 --11064 --
NM_001038707chr112040 --22064 707 --
NM_001038707chr112040 --22064 707 --
NM_001039029chr1211996 ------
NM_001039395chr921998 464 21989 384 193 --
NM_001039467chr20166 --170 --
NM_001039538chr22977 882 --13673 --
NM_001039570chr2224701 3547 ------
NM_001039571chr2224701 3547 ------
NM_001039574chr11354 ----1706
NM_001039577chr11380 --31179 1161 1143 --
NM_001039585chr184241 4219 3686 3229 3171 910 818 212 ------
NM_001039590chrX43245 2776 2589 717 --23107 371 --
NM_001039591chrX43245 2776 2589 717 --23107 371 --
NM_001039618chr1144955 4773 3996 1003 --15382 11617
NM_001039802chr12301 247 ------
NM_001039840chrX22428 767 1257 25391 878 --
NM_001039937chr1324071 68 ----13809
NM_001040057chr7----21189 175 --
NM_001040058chr42479 387 ------
NM_001040060chr42479 387 ------
NM_001040100chr3----146 --
NM_001040101chr421265 1193 ------
NM_001040108chr141308 22127 245 ----
NM_001040110chr721842 1726 11791 ----
NM_001040135chr7----2757 103 --
NM_001040142chr2----12237 --
NM_001040143chr2----12237 --
NM_001040152chr744530 3822 3516 260 24365 3473 1173 --
NM_001040158chr52365 209 --1535 --
NM_001040167chr731168 1096 65 ----11173
NM_001040181chr31429 ------
NM_001040182chr31429 ------
NM_001040183chr31429 ------
NM_001040199chr31429 ------
NM_001040200chr31429 ------
NM_001040202chr422235 419 ------
NM_001040272chr911971 ------
NM_001040284chr1645234 4841 2136 1020 ------
NM_001040402chr423006 2932 ----12617
NM_001040429chr1311117 --32525 2420 1157 --
NM_001040441chr135413 3425 754 --3708 193 178 --
NM_001040653chr3--22180 897 ----
NM_001040708chr821150 1137 1996 --162
NM_001040712chr921321 881 ------
NM_001040715chr162984 353 ------
NM_001040875chr812428 --1896 --
NM_001041chr3--125 ----
NM_001042355chr1641170 1110 602 417 ------
NM_001042388chr183832 644 140 ------
NM_001042412chr1641170 1110 602 417 ------
NM_001042413chr943197 905 552 188 --23454 45 --
NM_001042473chr10--1486 1116 --
NM_001042478chr1168 ------
NM_001042492chr1743154 2692 2516 90 ----1142
NM_001042494chr1533835 3454 3141 --33132 2543 855 --
NM_001042495chr1533835 3454 3141 --33132 2543 855 --
NM_001042496chr1533835 3454 3141 --33132 2543 855 --
NM_001042497chr1533835 3454 3141 --33132 2543 855 --
NM_001042506chrX------21191 907
NM_001042537chrX62263 2177 1596 629 510 248 ------
NM_001042550chr931912 1733 738 ----11917
NM_001042555chr1254283 4109 1033 958 21 --21194 886 24635 1355
NM_001042603chr1223870 1555 --22038 95 --
NM_001042604chr343391 940 583 209 --23548 539 --
NM_001042646chr331965 1720 23 --11312 --
NM_001042669chr421462 318 ------
NM_001042749chrX31908 1639 746 --11811 --
NM_001042750chrX31908 1639 746 --11811 --
NM_001042751chrX31908 1639 746 --11811 --
NM_001043351chr12305 271 --11432 --
NM_001044305chr641540 1320 1097 510 ------
NM_001044385chr263702 3167 2996 2718 948 605 13407 ----
NM_001044722chr571436 879 705 680 448 315 150 ----11669
NM_001044723chr571436 879 705 680 448 315 150 ----11669
NM_001046chr522997 149 ------
NM_001068chr3----146 --
NM_001069chr6----145 --
NM_001071775chr1311915 ----11926
NM_001083620chr412598 ------
NM_001083621chr1--1649 --13956
NM_001100108chr157306 6710 2344 1821 1759 --18250 18177
NM_001106chr337203 3686 2441 --69351 7786 3776 2334 1513 586 18726
NM_001116chr1642575 2268 93 70 ------
NM_001117chr181668 ------
NM_001121chr1021668 1619 ------
NM_001124chr11----1468 --
NM_001126chr12734 286 --1222 --
NM_001128chr1663770 3553 1424 1133 405 387 ------
NM_001143chrY146 ------
NM_001146chr81485 11477 12118 --
NM_001148chr431984 1701 401 ----11781
NM_001149chr1011007 ----1943
NM_001152chrX142 ------
NM_001160chr122260 103 --11075 1612
NM_001167chrX45114 1753 489 30 --25545 2617 --
NM_001172chr14185 1559 1286 --
NM_001173chr1453205 1128 930 678 516 31842 1771 695 --13602
NM_001186chr2112113 --2946 85 --
NM_001199chr81236 ------
NM_001200chr201790 ------
NM_001204chr267250 6554 6499 6419 5043 2320 ------
NM_001206chr912163 12739 13148 --
NM_001227chr1011355 11067 ----
NM_001233chr722344 689 --1646 --
NM_001235chr11------1644
NM_001241chr221674 956 12463 31907 450 200 --
NM_001241chr221674 956 12463 31907 450 200 --
NM_001256chr1742671 2481 489 369 --1698 --
NM_001257chr1621445 1327 --11437 --
NM_001258chr171177 ------
NM_001271chr1533200 2235 981 ------
NM_001273chr121121 ------
NM_001278chr10------145
NM_001280chr191651 ------
NM_001284chr5----1170 --
NM_001290chr41744 ------
NM_001304chr1742981 1411 890 309 --1771 12986
NM_001310chr121254 --21946 694 --
NM_001313chr41918 ------
NM_001315chr62469 94 ----1805
NM_001316chr20----1140 1352
NM_001329chr1041593 1459 343 130 ------
NM_001343chr511253 --21331 129 --
NM_001351chr3135 ------
NM_001356chrX32501 2248 2159 ----12506
NM_001363chrX2679 305 --172 --
NM_001364chr1133538 982 93 14701 --1866
NM_001379chr192287 61 ------
NM_001389chr212613 485 ------
NM_001390chr1853367 3250 3137 3094 2363 12435 ----
NM_001396chr2112118 22331 1777 ----
NM_001399chrX43698 797 316 103 ----1299
NM_001400chr12994 954 ------
NM_001408chr111651 --11627 --
NM_001415chrX41984 1919 1612 723 --21448 799 --
NM_001418chr11------144
NM_001418chr11------144
NM_001419chr1924131 818 1507 11950 21804 752
NM_001427chr711955 ------
NM_001429chr2211009 ------
NM_001430chr221723 414 --11827 1419
NM_001438chr143179 2310 2289 1160 12705 ----
NM_001448chrX31758 1287 519 --11401 --
NM_001449chrX21061 1013 ------
NM_001452chr61707 ------
NM_001453chr6----11723 11731
NM_001457chr341401 1222 128 41 1422 150 --
NM_001495chr8----11134 --
NM_001497chr932664 2176 695 12452 ----
NM_001498chr611099 --1462 --
NM_001521chr21512 ------
NM_001530chr14--11048 ----
NM_001542chr132850 2619 211 22211 115 22006 582 --
NM_001564chr41138 ------
NM_001584chr1131008 981 433 ------
NM_001610chr112648 606 1574 169 --
NM_001614chr17----1174 --
NM_001614chr17----1174 --
NM_001616chr222969 447 1610 1151 --
NM_001618chr13282 186 90 ------
NM_001620chr111549 ------
NM_001621chr71968 ----1796
NM_001621chr71968 ----1796
NM_001634chr611659 ------
NM_001650chr1834114 2931 111 ------
NM_001656chr541579 1330 1279 473 ------
NM_001660chr31671 --1679 2166 137
NM_001663chr1432327 2026 464 1268 ----
NM_001677chr1----11052 --
NM_001679chr3134 --2187 40 --
NM_001684chr134098 772 427 ----23949 777
NM_001690chr332186 1690 194 --1657 --
NM_001704chr62589 210 ------
NM_001706chr3------1419
NM_001709chr1142555 2267 673 239 1257 22649 250 1507
NM_001730chr1331496 1390 528 ------
NM_001730chr1331496 1390 528 ------
NM_001735chr9150 ------
NM_001742chr72738 700 --1171 --
NM_001746chr532953 2515 957 ----12166
NM_001753chr711144 181 ----
NM_001755chr1621776 567 --1729 --
NM_001761chr1611805 ------
NM_001777chr374076 3571 3220 1082 1071 245 215 2617 128 --13712
NM_001788chr721007 287 137 ----
NM_001789chr321521 1273 ------
NM_001791chr12301 247 ------
NM_001797chr16----1765 --
NM_001798chr12--1762 --11004
NM_001800chr192549 391 ------
NM_001845chr13------21327 843
NM_001855chr93839 348 84 ------
NM_001895chr201121 ------
NM_001903chr51612 ------
NM_001904chr331025 1005 361 ------
NM_001932chr174747 647 174 157 ------
NM_001935chr21352 ------
NM_001939chrX52663 2648 2641 791 269 23600 2744 1886 12827
NM_001944chr1812402 ----1181
NM_001946chr12----1839 --
NM_001948chr15------11264
NM_001949chr673092 2831 2807 2494 2217 695 652 --178 --
NM_001964chr511027 ------
NM_001967chr3----141 1521
NM_001968chr41380 ------
NM_001969chr1432985 2742 1034 13967 ----
NM_001977chr4----21410 581 --
NM_001981chr112067 ------
NM_001987chr121389 ----13186
NM_001999chr511054 1369 ----
NM_002009chr151401 ------
NM_002017chr1111379 ------
NM_002025chrX99197 8009 6931 5708 3083 2086 1836 1792 532 17864 26725 2569 --
NM_002026chr21988 1839 ----
NM_002031chr61348 ------
NM_002040chr2111278 --1418 --
NM_002044chr151441 1114 ----
NM_002051chr101756 ------
NM_002054chr21145 ------
NM_002071chr181689 ----1181
NM_002072chr91917 ----11002
NM_002073chr2221570 1024 ------
NM_002074chr131269 1161 623 ----1563
NM_002077chr922073 721 ------
NM_002107chr11441 --1472 --
NM_002114chr62179 144 ------
NM_002126chr1753080 1581 1125 982 543 ----11344
NM_002128chr1332511 358 327 --1473 --
NM_002130chr51202 ------
NM_002131chr61982 ------
NM_002133chr223489 479 404 ------
NM_002136chr121516 ------
NM_002137chr762296 2104 1495 594 481 276 --1639 --
NM_002139chrX1249 ------
NM_002140chr911084 ------
NM_002141chr71200 1180 1579 --
NM_002146chr1731423 948 168 ------
NM_002148chr23563 130 122 ------
NM_002154chr51395 152 ----
NM_002158chr212635 13703 1513 13494
NM_002160chr91230 ------
NM_002192chr7138 ------
NM_002199chr4152 ------
NM_002239chr2--1821 ----
NM_002247chr1032341 600 415 21492 155 --1810
NM_002253chr4169 ------
NM_002264chr354519 3710 1640 1541 452 1653 1811 --
NM_002265chr171409 ------
NM_002270chr575114 4765 4450 4346 1978 988 973 --1172 --
NM_002285chr244218 3134 2712 2700 --22927 2655 --
NM_002310chr5105577 4934 2546 2346 1573 1375 1207 765 625 346 --15100 160
NM_002313chr1064768 4235 3456 1787 1253 1010 --1316 15061
NM_002356chr61160 ------
NM_002359chr17----33935 3308 3186 --
NM_002374chr22977 882 --13673 --
NM_002375chr312292 ------
NM_002381chr2----1778 --
NM_002382chr1411268 ------
NM_002397chr531602 312 268 12086 ----
NM_002401chr1732497 713 76 --12130 --
NM_002430chr221415 ------
NM_002445chr821617 135 ------
NM_002473chr2241314 1241 1086 162 ------
NM_002478chr111482 ------
NM_002480chr1221142 182 ------
NM_002481chr157890 5281 5185 2791 772 11890 ----
NM_002500chr21444 ------
NM_002518chr221085 336 ------
NM_002520chr5----1127 --
NM_002527chr121289 ------
NM_002538chr51128 ------
NM_002539chr21303 ------
NM_002556chr112667 179 --11558 --
NM_002577chr361575 940 846 564 454 311 --13946 --
NM_002578chrX1339 ------
NM_002581chr944857 4201 3786 1845 --11279 --
NM_002588chr511612 ------
NM_002589chr41123 ------
NM_002590chr13176 ------
NM_002594chr2032468 2133 1699 --12424 --
NM_002595chr1231922 1684 1346 ----1174
NM_002600chr1--11219 2640 232 --
NM_002607chr711081 ------
NM_002613chr1685188 4069 4015 1829 1431 1203 978 266 ----14382
NM_002628chr3----11123 1991
NM_002641chrX41982 1730 1292 769 ------
NM_002645chr1132975 2849 606 --22606 1911 --
NM_002646chr121734 525 --1387 --
NM_002655chr845057 4124 3953 1958 --23371 572 14269
NM_002687chr1421001 108 1530 ----
NM_002699chr1187 ------
NM_002703chr411835 ------
NM_002706chr21499 ------
NM_002707chr21356 ------
NM_002709chr221135 956 --23079 362 --
NM_002716chr1133161 3077 2615 --13388 13168
NM_002721chr91164 ------
NM_002730chr1921377 518 ------
NM_002731chr153060 2982 2027 414 248 --1387 --
NM_002734chr172600 139 ------
NM_002737chr1744660 4625 863 734 --34715 1804 293 --
NM_002738chr1631089 812 429 ------
NM_002742chr142684 199 1151 ----
NM_002755chr151802 ------
NM_002756chr172974 885 ------
NM_002814chrX2279 33 --2220 42 --
NM_002821chr6----1755 --
NM_002823chr21599 --1646 --
NM_002834chr1253540 3309 3231 3092 2771 22505 1386 1814 --
NM_002839chr921321 881 ------
NM_002843chr1123395 3184 ----12328
NM_002847chr7------150
NM_002865chr8----1255 --
NM_002867chr12546 132 ------
NM_002868chr1222359 826 ----1189
NM_002873chr51436 ------
NM_002874chr922365 1788 --1499 --
NM_002886chr374434 3470 3460 3192 1378 1336 1183 ------
NM_002890chr52924 747 1339 ----
NM_002892chr1441163 440 259 170 ------
NM_002895chr201825 ------
NM_002897chr21751 --2525 509 --
NM_002902chr15183 ------
NM_002906chr1122347 1867 ------
NM_002923chr1----1489 --
NM_002924chr13618 100 65 --2492 191 --
NM_002941chr321209 175 ------
NM_002942chr31360 ------
NM_002951chr20----1250 --
NM_002958chr3----1903 --
NM_002966chr1140 ------
NM_002971chr33909 848 92 ------
NM_002997chr2----1723 11518
NM_002998chr81776 --1394 --
NM_003001chr122052 430 ------
NM_003009chr191273 ------
NM_003010chr171647 --1541 --
NM_003017chr641397 1277 1194 527 ------
NM_003038chr222615 2183 --12021 11723
NM_003042chr311920 ------
NM_003045chr1344998 4902 1875 1827 14291 1548 13101
NM_003068chr8----1936 --
NM_003069chrX1493 --1574 --
NM_003071chr321860 1321 --11967 --
NM_003079chr171183 ------
NM_003081chr20----21011 128 --
NM_003085chr51500 ------
NM_003091chr20197 ------
NM_003107chr632294 300 288 ------
NM_003108chr256586 6046 4908 4737 1670 25186 1955 11642 --
NM_003112chr722382 2201 13116 12894 --
NM_003113chr22350 319 ------
NM_003128chr211126 22573 851 --12449
NM_003137chr61501 ------
NM_003144chr63877 727 473 --3743 733 319 --
NM_003150chr1742237 2141 346 300 ------
NM_003151chr21174 ------
NM_003155chr822152 367 ----12404
NM_003161chr17----33328 1054 314 --
NM_003176chr11220 ------
NM_003176chr11220 ------
NM_003178chr332166 1694 101 11942 1865 11650
NM_003182chr71513 ------
NM_003182chr71513 ------
NM_003189chr1--2352 297 ----
NM_003194chr63431 221 92 ------
NM_003198chr11260 ------
NM_003199chr1825129 1026 14934 21322 889 --
NM_003200chr19----1305 1114
NM_003206chr61328 ------
NM_003211chr121560 152 ----
NM_003222chr2011224 --1805 --
NM_003246chr1521624 1532 ------
NM_003247chr641778 1654 1627 465 1443 --11234
NM_003250chr171312 ------
NM_003257chr151474 ------
NM_003274chr2142430 1173 795 163 ------
NM_003286chr201176 ------
NM_003295chr131184 ------
NM_003298chr356208 6127 5012 2229 601 14175 12180 --
NM_003304chr311579 ------
NM_003309chr621784 342 --11255 --
NM_003317chr142793 680 ------
NM_003319chr21876 ------
NM_003330chr1221670 479 1348 --124
NM_003336chrX2250 112 ------
NM_003337chr5138 ------
NM_003338chr10--11359 1354 1731
NM_003339chr51152 ------
NM_003340chr41236 21289 391 ----
NM_003341chr34646 624 279 149 ------
NM_003342chr1743216 2225 864 105 --13154 --
NM_003344chr721421 637 --11451 --
NM_003345chr16184 --1528 --
NM_003356chr112867 115 1838 1127 --
NM_003373chr1031697 1632 85 --1479 --
NM_003374chr53718 590 81 ------
NM_003392chr333592 1260 1056 --22819 1540 --
NM_003400chr2----1685 --
NM_003405chr221190 ------
NM_003411chrY1220 ------
NM_003412chr322909 711 12027 ----
NM_003413chrX2574 507 ------
NM_003423chr191445 162 11053 --
NM_003432chr51122 --1136 --
NM_003439chr723060 2800 1870 11360 --
NM_003458chr3----13436 --
NM_003468chr263740 3078 2873 1300 453 280 1983 23157 104 --
NM_003471chr3----1673 --
NM_003472chr631308 496 298 ------
NM_003473chr101311 1423 ----
NM_003478chr1152603 1244 1100 670 192 --33144 750 330 12593
NM_003482chr1242721 2571 1905 909 ------
NM_003483chr1232667 2503 2262 ------
NM_003489chr2112333 ------
NM_003506chr821260 879 ------
NM_003558chr9----1217 --
NM_003566chr1233041 1250 421 --23452 410 --
NM_003567chr11280 ------
NM_003574chr1834421 2288 1486 --24324 365 24197 4151
NM_003583chr1253908 3057 2840 2516 732 --22660 830 --
NM_003589chr132977 915 ------
NM_003590chr243070 3033 755 640 23296 3242 23285 384 --
NM_003603chr42775 556 188 11942 --
NM_003607chr141430 1037 649 253 21655 1438 --1481
NM_003615chr323653 1364 --13666 --
NM_003620chr171203 --1933 --
NM_003621chr111480 ------
NM_003622chr122261 106 22003 172 12276 --
NM_003629chr11932 33350 2386 1142 23246 2757 1674
NM_003631chr101353 1158 ----
NM_003633chr512323 1401 ----
NM_003659chr2--1233 2833 311 --
NM_003663chr332894 2151 610 ----1323
NM_003671chr97722 618 611 516 339 237 105 1788 11026 12381
NM_003701chr131673 ------
NM_003702chr81222 ----1268
NM_003709chr2--124 --1341
NM_003710chr151442 ------
NM_003714chr542426 2320 2204 305 ------
NM_003722chr332656 2009 991 ------
NM_003728chr41462 ------
NM_003735chr511612 ------
NM_003736chr511612 ------
NM_003750chr103612 223 106 ----1708
NM_003758chr151625 1216 2249 36 21091 259
NM_003758chr151625 1216 2249 36 21091 259
NM_003759chr443956 3261 829 176 ------
NM_003769chr121272 ------
NM_003787chr1811272 ----1436
NM_003794chr3----11073 1845
NM_003797chr11----140 --
NM_003800chr62910 773 --159 --
NM_003821chr8----158 --
NM_003822chr122971 2687 --22500 839 --
NM_003870chr1532094 1588 286 1464 12081 --
NM_003872chr232784 2052 625 --1629 --
NM_003873chr1042422 2087 2059 612 ------
NM_003877chr122888 853 ----1813
NM_003885chr17----12170 --
NM_003893chr101360 ------
NM_003895chr2121923 1700 ------
NM_003899chr1352588 2169 1939 1844 1612 ------
NM_003908chr2021171 33 --11110 11214
NM_003913chr612627 12774 21158 1027 --
NM_003927chr181947 ------
NM_003930chr7--1478 --1227
NM_003931chr61264 ------
NM_003934chr93891 357 105 ------
NM_003941chr732523 2292 2135 --21569 121 --
NM_003953chr132662 612 202 --2998 909 --
NM_003958chr633049 482 305 --1936 --
NM_003968chr3------195
NM_003980chr611384 ------
NM_004006chrX12410 ------
NM_004007chrX12410 ------
NM_004009chrX12410 ------
NM_004010chrX12410 ------
NM_004011chrX12410 ------
NM_004012chrX12410 ------
NM_004013chrX12410 ------
NM_004014chrX12410 ------
NM_004015chrX12410 ------
NM_004016chrX12324 ------
NM_004017chrX12410 ------
NM_004018chrX12324 ------
NM_004020chrX12410 ------
NM_004021chrX12324 ------
NM_004022chrX12324 ------
NM_004023chrX12324 ------
NM_004028chr1834114 2931 111 ------
NM_004035chr1775042 4994 4780 4716 4329 4055 737 --13408 --
NM_004056chr831046 960 169 ------
NM_004061chr51253 ------
NM_004067chr721457 451 ------
NM_004075chr123413 120 26 ------
NM_004087chr351996 1913 1297 1288 1276 --11280 --
NM_004093chr1323085 1049 33024 2324 2158 ----
NM_004100chr632142 651 248 --12115 --
NM_004114chrX51228 1067 886 831 450 --1875 --
NM_004124chr1423039 348 ----12664
NM_004130chr3--198 ----
NM_004136chr1532799 2458 231 1867 11107 1978
NM_004143chrX148 ------
NM_004152chr191105 ------
NM_004156chr8------1480
NM_004161chr231436 1078 555 --1256 --
NM_004162chr31954 ------
NM_004185chr1--1186 ----
NM_004200chr112732 557 11310 ----
NM_004229chrX1743 ------
NM_004232chr1813561 11302 2753 659 --
NM_004238chr21109 ------
NM_004251chrX1220 ------
NM_004263chr251797 1332 1313 648 472 ------
NM_004272chr52663 454 ------
NM_004274chr1421052 639 12915 ----
NM_004279chr732294 2029 528 --1805 --
NM_004281chr101209 ----1386
NM_004293chr943731 2649 971 612 --13155 --
NM_004299chrX130 ------
NM_004304chr21277 ------
NM_004319chr123142 1189 ----11065
NM_004331chr82714 240 --12116 --
NM_004338chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_004342chr731937 511 405 ------
NM_004346chr41551 --11401 --
NM_004349chr811312 ------
NM_004352chr161463 --1517 --
NM_004369chr22651 235 ------
NM_004370chr632030 1468 758 ------
NM_004379chr2----2671 591 1476
NM_004384chr571436 879 705 680 448 315 150 ----11669
NM_004388chr1------182
NM_004392chr1332518 2203 1850 --1778 --
NM_004393chr31662 --161 22167 748
NM_004397chr1124233 1071 13808 11579 --
NM_004408chr91123 ------
NM_004411chr71258 ----1813
NM_004426chr122398 162 ----2639 509
NM_004429chrX----11456 11376
NM_004430chr832689 1774 1693 ----12296
NM_004432chr921896 361 ------
NM_004438chr223329 143 --22116 539 --
NM_004441chr331211 532 323 ----1150
NM_004447chr1211041 --1349 --
NM_004449chr2121449 1423 ------
NM_004457chr211290 --1505 --
NM_004458chrX2591 559 --21010 156 --
NM_004459chr1731955 404 48 --1690 11579
NM_004469chrX162 ------
NM_004480chr141543 ------
NM_004481chr122450 1853 ------
NM_004483chr16154 --1420 --
NM_004500chr141363 11492 ----
NM_004504chr2----174 --
NM_004505chr1722009 1727 --1393 --
NM_004514chr1732802 2510 826 ------
NM_004525chr22542 225 --11460 --
NM_004529chr941307 1231 984 88 ------
NM_004540chr211180 --1190 --
NM_004566chr101440 12562 11781 --
NM_004571chr21--1342 33412 2997 1300 --
NM_004575chr431567 240 228 ------
NM_004576chr51341 ------
NM_004586chrX14035 --14990 --
NM_004598chr53441 215 199 --23185 109 --
NM_004602chr2021183 199 --11172 --
NM_004612chr914409 --34618 3978 943 --
NM_004616chr12----151 --
NM_004622chr231894 893 206 3449 97 44 21884 714 --
NM_004634chr31444 ------
NM_004635chr32447 116 1424 ----
NM_004654chrY31141 1108 341 ------
NM_004687chr1712014 --21478 311 --
NM_004689chr141308 ------
NM_004694chr17----1782 --
NM_004719chr1211837 ------
NM_004723chr121046 678 ------
NM_004725chr1011446 1414 --11015
NM_004726chrX24790 919 1805 24694 3612 --
NM_004730chr532166 1894 294 ------
NM_004734chr1321147 538 ------
NM_004736chr12835 578 ------
NM_004741chr101341 --1261 --
NM_004742chr331750 1657 1338 --11831 --
NM_004744chr433843 3716 987 13873 ----
NM_004759chr122147 2137 1325 1397 --
NM_004760chr732394 2021 571 1176 ----
NM_004772chr511215 ------
NM_004774chr1723116 475 ------
NM_004779chr52839 252 ----2377 351
NM_004781chr11576 ----1283
NM_004781chr11576 ----1283
NM_004788chr11--22499 2446 1270 --
NM_004792chr2179 ------
NM_004795chr1321829 83 ----11850
NM_004796chr1432365 1690 755 ------
NM_004815chr133415 132 30 13825 11306 --
NM_004834chr221313 716 12774 13399 --
NM_004840chrX32294 1895 201 --32326 1766 638 --
NM_004841chr121054 371 ----195
NM_004859chr1732328 676 293 12373 ----
NM_004863chr1435089 3883 3847 ----11886
NM_004871chr1721439 245 ------
NM_004879chr111385 ------
NM_004893chr52365 209 --1535 --
NM_004904chr746447 5630 5357 2306 --56049 5205 5123 1543 152 --
NM_004905chr1--2890 117 ----
NM_004906chr62619 126 ----1237
NM_004912chr711354 ------
NM_004938chr91186 --11260 --
NM_004949chr1832078 636 118 ------
NM_004966chr101880 ------
NM_004973chr631569 1497 1076 --11327 --
NM_004976chr1143613 3547 703 248 --23468 1776 --
NM_004978chr1------11369
NM_004985chr12------23578 1079
NM_004992chrX26580 2992 12718 35570 2203 55 17399
NM_004992chrX26580 2992 12718 35570 2203 55 17399
NM_004999chr623129 1192 --1680 --
NM_005010chr721614 478 ------
NM_005011chr721842 1726 11791 ----
NM_005025chr31216 ------
NM_005034chr82576 69 ------
NM_005044chrX34481 544 263 --13788 14309
NM_005045chr71240 --147 --
NM_005056chr1224114 1799 --1339 --
NM_005068chr6--11386 ----
NM_005078chr1521649 388 1254 ----
NM_005087chr31249 ------
NM_005095chr121992 314 ------
NM_005096chrX11219 ----11237
NM_005099chr111349 --176 --
NM_005109chr3--1646 158 --
NM_005116chr2064536 3903 2820 1312 1095 1063 34201 1396 1348 1509 --
NM_005119chr111196 ------
NM_005121chr1743653 3229 3110 596 ------
NM_005123chr121122 ------
NM_005124chr62804 750 ------
NM_005126chr3------11712
NM_005134chr183832 644 140 ------
NM_005135chr1533835 3454 3141 --33132 2543 855 --
NM_005137chr2242099 1555 921 46 ------
NM_005139chr4----1322 --
NM_005151chr1842163 1971 1587 712 --1476 --
NM_005153chr162807 513 --1220 --
NM_005156chr954691 4570 4452 3928 3306 --24177 1563 --
NM_005180chr1031641 1188 197 11119 --1551
NM_005188chr1178362 6195 2879 2870 2808 2372 959 15850 16893 1774
NM_005190chr61834 ------
NM_005194chr20----1443 --
NM_005197chr1475282 5206 5044 4436 2463 2153 447 --16061 1736
NM_005201chr33857 366 123 ----1128
NM_005219chr521530 241 --21608 478 --
NM_005224chr191613 --1557 --
NM_005233chr322534 1727 --1880 --
NM_005238chr1132723 2247 561 ------
NM_005240chr11635 ------
NM_005241chr321124 428 ------
NM_005249chr142776 660 --1815 --
NM_005277chr43728 687 152 ------
NM_005295chr71113 ------
NM_005313chr151242 1511 ----
NM_005316chr112412 316 ------
NM_005339chr464013 3468 3346 3194 1669 388 ------
NM_005342chrX21770 563 --22636 88 22220 1785
NM_005358chr1351706 182 81 52 29 ----1599
NM_005359chr1866118 5785 5250 4730 4009 3990 1799 24223 2116 --
NM_005369chrX2663 106 ------
NM_005375chr631032 921 111 ------
NM_005385chr332560 1718 78 ------
NM_005397chr731352 1164 982 ------
NM_005400chr211057 ------
NM_005410chr51605 ------
NM_005415chr2----1311 --
NM_005429chr4------154
NM_005433chr18--12698 ----
NM_005436chr1063966 3578 1228 406 172 141 --1767 12730
NM_005440chr17--13108 23183 573 --
NM_005493chr63673 650 213 ----1557
NM_005494chr71222 ------
NM_005502chr943261 2963 2742 73 ------
NM_005504chr122630 67 15414 25229 2632 --
NM_005506chr42421 270 --193 --
NM_005509chr511485 ------
NM_005517chr131259 153 127 ------
NM_005520chr5182 ------
NM_005536chr821177 32 ------
NM_005537chr131744 ------
NM_005539chr1021333 1095 ----1263
NM_005576chr152216 208 ------
NM_005578chr314685 11401 24853 3979 --
NM_005587chr151923 ------
NM_005595chr12291 169 ------
NM_005596chr965262 5170 4284 4074 1719 476 ------
NM_005599chr131104 536 207 --11472 --
NM_005602chr321193 182 --2427 239 --
NM_005610chr13808 649 609 ------
NM_005618chr61239 ------
NM_005637chr1811384 11367 --12051
NM_005639chr122325 274 ------
NM_005647chrX23419 877 --33137 648 632 --
NM_005650chr2211165 ----1990
NM_005655chr811309 --11002 --
NM_005660chrX1246 ------
NM_005664chr151749 ----1253
NM_005668chr533406 3016 1230 --1694 --
NM_005669chr522053 139 --21994 98 1264
NM_005678chr15----2656 403 --
NM_005688chr321161 1154 ------
NM_005734chr111507 ------
NM_005736chr1021143 1023 ----1505
NM_005738chr7----1153 1776
NM_005739chr1512257 ------
NM_005742chr22690 203 ------
NM_005746chr72701 24 ------
NM_005754chr51797 ------
NM_005759chr233862 3072 1070 --24775 3138 24686 735
NM_005779chr532877 2686 450 1245 13139 --
NM_005795chr222291 2233 ------
NM_005796chr163290 248 149 ------
NM_005798chr1375272 4957 4796 4306 3525 3491 1313 --12107 --
NM_005803chr6263 44 --1296 --
NM_005819chr11858 --2795 342 1863
NM_005822chr642208 1463 324 61 ------
NM_005829chr1531616 1231 771 --11224 --
NM_005832chr321075 903 1353 ----
NM_005839chr11101 ------
NM_005840chrX37432 6595 1972 1243 25269 2310 --
NM_005841chr4------2769 127
NM_005842chr131714 ------
NM_005859chr5----1215 --
NM_005862chr31395 ------
NM_005869chr5----1119 --
NM_005871chr101937 ------
NM_005873chr20166 --170 --
NM_005875chr31298 ------
NM_005876chr2----1774 --
NM_005880chr1621220 1134 ------
NM_005885chr521641 598 1311 ----
NM_005898chr1112164 ------
NM_005901chr1898097 8074 7978 7661 5595 5540 3350 2293 1235 ----27653 1436
NM_005903chr555092 5075 4816 809 206 ----23427 3232
NM_005905chr131335 ------
NM_005906chr61357 ------
NM_005910chr1733615 3365 409 11572 24124 1169 --
NM_005920chr133874 1452 1349 ------
NM_005924chr731027 775 43 ------
NM_005935chr434749 3948 601 11789 11013 --
NM_005941chr823700 145 --12982 --
NM_005944chr321078 214 ------
NM_005955chr143754 1758 1222 1032 1784 21883 414 2550 272
NM_005966chr21200 --2404 90 11733
NM_005996chr1211141 ----11388
NM_005999chr111286 11309 ----
NM_006007chr934032 1773 1236 13362 ----
NM_006011chr1514313 --12909 1393
NM_006015chr12484 309 --169 --
NM_006035chr14----185 --
NM_006036chr221601 826 ----12074
NM_006040chr1611415 1307 ----
NM_006047chr202819 571 13004 --13458
NM_006048chr11246 ------
NM_006060chr743585 3554 2729 112 ----11199
NM_006089chrX21665 597 --11294 --
NM_006090chr11110 ----1205
NM_006095chr464139 3298 965 782 732 701 159 --12896
NM_006099chr11859 ------
NM_006100chr3----1115 --
NM_006106chr1143210 2912 2548 2203 --12988 --
NM_006135chr11161 ------
NM_006136chr711328 ----1103
NM_006141chr1621740 769 12137 1842 --
NM_006153chr32622 100 ------
NM_006156chr14--1244 ----
NM_006158chr82711 156 ----11558
NM_006166chr1222564 432 --1250 --
NM_006180chr91430 ------
NM_006183chr121200 ------
NM_006186chr23925 368 309 --1979 1182
NM_006190chr2174 ----11037
NM_006194chr1421235 1164 --1259 --
NM_006198chr211255 ------
NM_006203chr52925 851 --11042 --
NM_006206chr412758 --2875 195 --
NM_006216chr22613 531 ------
NM_006226chr221410 331 --1420 --
NM_006237chr1311826 ------
NM_006239chr41167 ------
NM_006251chr543046 2612 2342 196 --1697 --
NM_006252chr186982 6854 6791 6285 5420 2627 2414 1395 15945 12353 --
NM_006256chr12999 106 ------
NM_006259chr4--1929 ----
NM_006265chr8----11483 --
NM_006267chr221508 1324 --11864 1143
NM_006282chr2014709 --34266 3071 924 --
NM_006283chr844846 4281 3685 1511 --33622 1718 738 --
NM_006287chr222371 159 ----12268
NM_006293chr1521024 247 ------
NM_006306chrX21552 1545 25003 4918 ----
NM_006315chr414393 11339 21327 471 --
NM_006317chr5----1195 --
NM_006343chr21137 ------
NM_006352chr1----11664 --
NM_006353chr62938 113 --21373 140 --
NM_006357chr21417 ------
NM_006359chrX62263 2177 1596 629 510 248 ------
NM_006362chr113345 304 65 ------
NM_006364chr1421253 812 ------
NM_006372chr61510 ------
NM_006377chr911236 --1444 --
NM_006379chr721686 301 12289 ----
NM_006380chr1733617 271 75 13430 33476 1455 983 --
NM_006400chr121372 ------
NM_006403chr621652 380 ------
NM_006420chr2042921 2825 453 194 ------
NM_006434chr1032096 2044 138 ------
NM_006439chr41396 ----1408
NM_006457chr434153 3994 2696 --33189 2754 2734 --
NM_006458chr111340 ------
NM_006459chr1011716 --21792 1701 --
NM_006460chr1721381 207 ------
NM_006464chr224590 3885 11769 21754 989 --
NM_006465chr1522291 214 ------
NM_006471chr181103 ----138
NM_006476chr112169 50 ------
NM_006478chr22--1183 ----
NM_006482chr1253908 3057 2840 2516 732 --22660 830 --
NM_006496chr111990 ------
NM_006504chr1022481 304 --12876 --
NM_006517chrX21639 501 --12027 --
NM_006520chrX11642 ------
NM_006526chr2012121 --1589 --
NM_006532chr1941889 1759 1741 1527 ------
NM_006534chr201530 --13323 --
NM_006537chr151171 ------
NM_006542chr11167 ------
NM_006549chr1242682 1076 418 149 ------
NM_006555chr742001 1914 1904 588 ------
NM_006559chr11261 1992 178 --
NM_006561chr1056114 5891 5872 4050 3971 --35468 4483 1260 --
NM_006565chr161868 ------
NM_006575chr14----11198 --
NM_006577chr221057 58 1506 ----
NM_006595chr112624 346 ------
NM_006599chr1646103 3127 2410 168 17877 ----
NM_006601chr1211088 --11122 --
NM_006603chrX31908 1639 746 --11811 --
NM_006618chr1------11469
NM_006621chr1----1693 --
NM_006624chr1021470 246 --11610 11632
NM_006628chr1543800 3064 1215 657 --1989 --
NM_006646chr1362967 2252 2180 1897 1146 1136 --11977 --
NM_006650chr533523 2859 1261 --23901 3811 --
NM_006654chr1254283 4109 1033 958 21 --21194 886 24635 1355
NM_006681chr41146 ----1121
NM_006699chr1----1827 1862
NM_006706chr51584 ----1794
NM_006713chr51256 ------
NM_006720chr1064768 4235 3456 1787 1253 1010 --1316 15061
NM_006726chr421060 803 ------
NM_006729chrX25228 4735 13762 14150 --
NM_006734chr631389 566 527 ------
NM_006736chr23756 484 377 --3522 505 339 --
NM_006750chr1628121 389 --1458 --
NM_006751chr21384 ------
NM_006754chr711142 1928 11209 155
NM_006756chr831540 1334 1213 ------
NM_006758chr21140 ------
NM_006763chr131388 1333 228 --21556 643 --
NM_006766chr822364 701 ----1399
NM_006769chr1------1577
NM_006772chr631611 1467 664 ------
NM_006775chr6--22100 1074 1172 --
NM_006788chr1821313 794 ------
NM_006791chr151478 ------
NM_006800chrX3601 139 129 ------
NM_006805chr521470 403 11255 1679 --
NM_006810chr3156 ------
NM_006826chr2------1926
NM_006838chr12----2385 85 --
NM_006852chr1721854 869 1516 --12786
NM_006874chr411065 ------
NM_006885chr1622640 868 --1983 14173
NM_006888chr1433370 3215 626 ----12788
NM_006896chr7----21089 1022 --
NM_006899chr201130 ------
NM_006908chr721140 344 2490 313 ----
NM_006915chrX22578 974 --11747 --
NM_006918chr1134545 1037 226 15881 15753 --
NM_006920chr21805 ------
NM_006922chr221664 206 ------
NM_006924chr1744456 4341 608 36 1893 14151 --
NM_006931chr1221318 732 --21565 1322 --
NM_006937chr171583 ------
NM_006991chr31970 11026 ----
NM_006999chr531355 817 639 ------
NM_007005chr921151 519 --21161 512 --
NM_007006chr1652786 2244 711 511 337 ------
NM_007007chr1231791 1734 412 --1196 --
NM_007008chr23815 297 149 ------
NM_007010chr1721731 657 --21798 223 --
NM_007011chr1524257 277 ----32355 2256 1497
NM_007017chr51897 1743 --1680
NM_007035chr121621 ------
NM_007038chr2155610 4551 2170 1532 1353 ------
NM_007039chr1432263 2199 468 1555 1896 11702
NM_007050chr2027184 2572 --22433 181 --
NM_007067chr1741183 338 209 188 --181 --
NM_007078chr1021942 837 ------
NM_007106chr1332846 1960 1763 ------
NM_007107chr322142 636 ------
NM_007111chr132588 363 ------
NM_007114chr312897 12563 ----
NM_007118chr52900 857 ------
NM_007125chrY11203 ------
NM_007126chr93523 421 164 ------
NM_007137chrX85305 4340 3744 3668 3418 3358 1788 1174 15317 13672 23497 248
NM_007146chr171985 12260 ----
NM_007150chrX2526 80 ------
NM_007174chr1232404 944 487 --21817 1543 --
NM_007178chr121475 ------
NM_007187chr13----1378 --
NM_007203chr932479 469 311 --13791 --
NM_007212chr122208 103 ------
NM_007236chr1531860 775 119 --1624 --
NM_007246chr41274 ------
NM_007249chr1389051 8391 8112 7213 7165 6857 1691 1682 --26358 1160 11699
NM_007260chr11767 ------
NM_007274chr1----2219 117 --
NM_007275chr311170 ------
NM_007276chr71214 ----1822
NM_007279chr191637 --1419 --
NM_007292chr1775042 4994 4780 4716 4329 4055 737 --13408 --
NM_007294chr1731342 1028 330 --21167 1129 --
NM_007295chr1731342 1028 330 --21167 1129 --
NM_007296chr1731342 1028 330 --21167 1129 --
NM_007297chr1731342 1028 330 --21167 1129 --
NM_007298chr1731342 1028 330 --21167 1129 --
NM_007299chr1731342 1028 330 --21167 1129 --
NM_007300chr1731342 1028 330 --21167 1129 --
NM_007302chr1731342 1028 330 --21167 1129 --
NM_007303chr1731342 1028 330 --21167 1129 --
NM_007304chr1731342 1028 330 --21167 1129 --
NM_007305chr1731342 1028 330 --21167 1129 --
NM_007317chr16_random151 ------
NM_007353chr73576 336 247 --175 --
NM_007358chr121678 1479 --1753 --
NM_007373chr1031582 358 228 ------
NM_007375chr132223 2155 2002 ------
NM_012081chr553727 1499 920 636 68 ------
NM_012082chr82954 47 ------
NM_012090chr111266 --11084 --
NM_012095chr1023460 1011 --12168 --
NM_012104chr1123760 722 ------
NM_012104chr1123760 722 ------
NM_012110chr4----139 --
NM_012115chr61626 ------
NM_012120chr642777 2701 549 96 --2878 697 --
NM_012124chr112916 92 ------
NM_012137chr142387 1883 73 24 2801 323 ----
NM_012141chr1324071 68 ----13809
NM_012153chr1112581 --22194 455 12097
NM_012164chr977357 6428 5140 5074 1847 432 347 11532 --1666
NM_012183chr11599 ------
NM_012193chr1145047 4651 3909 1620 14292 24544 3494 --
NM_012199chr124378 596 --13542 --
NM_012214chr266101 5707 5643 5247 2338 1852 12175 12572 1998
NM_012218chr1922235 125 1222 12791 11134
NM_012224chr41767 ------
NM_012232chr1722191 253 --11723 --
NM_012238chr101613 --11359 --
NM_012249chr22420 286 ------
NM_012250chr111559 11321 ----
NM_012252chr745055 1866 1251 117 --183 --
NM_012255chr201183 --1164 --
NM_012257chr711089 --11028 --
NM_012262chr145129 3818 3779 1339 --13335 14594
NM_012281chr73790 764 753 --1524 --
NM_012286chrX1467 1192 ----
NM_012294chr73706 95 72 ------
NM_012300chr562568 2046 1900 954 807 517 ----1959
NM_012307chr181688 ------
NM_012308chr1112009 1762 12054 --
NM_012309chr111866 --24048 3297 --
NM_012316chr125663 2140 --14473 --
NM_012325chr2041434 662 597 384 --11572 --
NM_012326chr21244 ------
NM_012328chr721280 1062 ------
NM_012329chr1741577 1238 1227 553 ------
NM_012330chr1031790 506 294 ------
NM_012333chr121304 1113 ------
NM_012334chr513551 ------
NM_012338chr7------1105
NM_012347chr662318 2167 2134 1133 287 269 1920 ----
NM_012383chr91120 --139 --
NM_012395chr723409 3340 141 1569 --
NM_012399chr2211704 ------
NM_012414chr11638 ----1543
NM_012416chr921257 59 ----1279
NM_012428chr15----1236 --
NM_012445chr4----1534 --
NM_012446chr51426 ------
NM_012464chr442838 2807 925 416 --21850 909 22701 947
NM_012471chrX21784 250 --1353 1473
NM_012479chr722247 1962 ----12434
NM_012481chr171677 ------
NM_012484chr5293 44 --157 --
NM_013229chr122260 103 --11075 1612
NM_013231chr142773 251 ------
NM_013233chr22465 408 --1261 1922
NM_013253chr112485 146 --1543 11228
NM_013255chr758834 3407 1281 1055 401 --46704 5385 2357 405 --
NM_013261chr433701 2629 2539 ------
NM_013269chr1212821 13199 21511 1483 --
NM_013281chr20------11251
NM_013283chr5----2864 686 --
NM_013286chr31871 1294 12492 12644
NM_013293chr71584 --1153 1200
NM_013302chr1642944 2873 1826 114 --44352 4035 2955 1833 13819
NM_013322chr71408 --21191 164 --
NM_013333chr19168 ------
NM_013341chr232718 755 494 ------
NM_013354chr8--11020 ----
NM_013372chr1522861 2147 ------
NM_013374chr332183 1209 197 2737 488 ----
NM_013376chr19123 ------
NM_013381chr122719 406 ----1611
NM_013396chr2141472 1411 1004 276 --184 --
NM_013436chr21597 --2601 41 --
NM_013437chr821058 1037 ------
NM_013438chr9----11541 --
NM_013446chr731395 272 179 --21287 1051 --
NM_013450chr221204 1120 ------
NM_013958chr8----134 1370
NM_013959chr8----134 1370
NM_013961chr8----134 1370
NM_013962chr8----134 1370
NM_013996chr71513 ------
NM_013996chr71513 ------
NM_013997chr71513 ------
NM_013997chr71513 ------
NM_013998chr71513 ------
NM_013998chr71513 ------
NM_014000chr1031697 1632 85 --1479 --
NM_014016chr321219 312 --11268 --
NM_014021chr122854 1162 ------
NM_014035chr5------11366
NM_014043chr321667 1245 --1411 --
NM_014048chr1635078 591 96 ----1114
NM_014071chr203440 400 192 ------
NM_014089chr1312278 ----22211 1838
NM_014109chr811025 ------
NM_014112chr864443 3866 3364 2180 2143 2039 --21962 432 25293 2187
NM_014155chr1186449 6098 4908 4599 2876 1174 728 704 --25398 1284 --
NM_014181chr212896 ----12886
NM_014210chr17180 ------
NM_014231chr12----126 --
NM_014233chr1721834 865 ----1673
NM_014240chr3150 --23464 3295 1213
NM_014243chr432128 473 159 ----1250
NM_014251chr7----3910 793 785 --
NM_014279chr91685 ------
NM_014282chr91129 --21116 103 11162
NM_014283chr141483 1325 1197 39 ------
NM_014309chr2233846 2082 1841 11454 25366 2062 --
NM_014319chr1231705 1244 379 --1469 --
NM_014331chr437772 6866 1316 16838 12191 --
NM_014333chr1142345 2138 1056 319 1925 1586 --
NM_014345chr63857 408 401 ------
NM_014351chr2211163 ------
NM_014363chr133514 501 41 --1856 --
NM_014372chr121947 411 --11618 --
NM_014381chr141308 22127 245 ----
NM_014382chr31662 ------
NM_014392chr421265 1193 ------
NM_014397chr92476 232 ------
NM_014399chr71178 ------
NM_014415chr331636 1379 611 ------
NM_014423chr545290 4761 134 21 24091 3811 --1871
NM_014426chr201700 ------
NM_014445chr311729 22327 2274 12363 --
NM_014452chr62255 85 11106 ----
NM_014454chr6----2828 304 --
NM_014482chr21134 ------
NM_014494chr162606 587 11720 32164 1882 512 --
NM_014521chr221244 366 21407 204 ----
NM_014548chr1521388 293 ------
NM_014554chr1231766 368 102 --2796 54 --
NM_014562chr21746 --166 --
NM_014572chr1311698 ------
NM_014585chr221240 826 11162 ----
NM_014587chr1611345 ------
NM_014612chr91999 --11096 --
NM_014615chr161922 1197 12890 1384
NM_014616chr323270 526 --21388 295 --
NM_014618chr9134 ------
NM_014620chr12----1236 --
NM_014630chr1543491 3186 2879 2501 --1869 --
NM_014636chr944293 4116 4024 425 11648 12690 --
NM_014647chr1642240 2215 1883 1673 12282 ----
NM_014665chr853222 3153 3010 2886 2545 13083 13226 --
NM_014667chr341928 603 507 138 ------
NM_014670chr241499 1130 229 155 ------
NM_014676chr131102 307 113 1595 ----
NM_014677chr8199 ----21368 23
NM_014683chr1711537 ------
NM_014686chr1912064 --11869 11842
NM_014705chr752121 577 347 166 148 --11843 --
NM_014707chr722236 1558 ------
NM_014711chr162767 591 ------
NM_014718chr12----1694 --
NM_014721chr686834 6356 5863 5589 4848 2720 721 610 26386 630 --21799 1339
NM_014729chr822206 923 1111 ----
NM_014730chr1224779 1813 ------
NM_014730chr1224779 1813 ------
NM_014732chr1615713 15866 25421 3659 --
NM_014735chrX32023 818 200 ------
NM_014743chr412412 ----1241
NM_014746chr234269 774 708 --11490 21099 364
NM_014751chr8--12066 --11933
NM_014752chr1111267 --1370 --
NM_014755chr241447 1204 507 262 12672 21647 1260 11309
NM_014764chr122450 111 1372 ----
NM_014767chr101326 --13038 --
NM_014772chr1832455 1339 723 ------
NM_014774chr133115 2853 2068 --12404 --
NM_014779chr31937 ------
NM_014781chr8--11092 --11155
NM_014787chr112132 --11780 --
NM_014810chr112992 ------
NM_014820chr332004 156 122 ------
NM_014824chr1121813 1558 ----1193
NM_014826chr141430 1037 649 253 21655 1438 --1481
NM_014827chr141459 1279 1152 356 ------
NM_014830chr122174 125 11159 12797 --
NM_014832chr1332033 634 207 --11740 2743 212
NM_014836chr1051997 1921 694 499 364 ------
NM_014840chr12--1625 --13025
NM_014841chr631001 539 319 ----21158 1087
NM_014846chr8190 ------
NM_014847chr11179 ------
NM_014849chr111289 ------
NM_014850chr324755 4497 --24782 4228 --
NM_014858chr121177 1059 --11031 --
NM_014860chr221628 804 --21039 271 --
NM_014870chr1--1649 --13956
NM_014871chr122621 172 ----1479
NM_014873chr174686 1786 1565 1506 1194 530 507 11734 23706 3658 1318
NM_014874chr121801 1481 --1188 --
NM_014876chr2232211 1437 576 1337 1608 --
NM_014877chr1726572 591 12352 26576 5940 --
NM_014883chr432194 2076 878 ------
NM_014887chr133772 210 31 ------
NM_014892chr6--142 ----
NM_014897chr1732288 1167 671 --12499 --
NM_014901chr532153 760 709 12222 12272 --
NM_014903chr1222031 478 11869 ----
NM_014904chr1022541 1084 --23257 3071 --
NM_014905chr232003 386 357 ------
NM_014909chr1423855 1101 --1756 13935
NM_014912chr1062945 885 559 421 366 355 ------
NM_014913chr1811445 --175 --
NM_014917chr1----1971 --
NM_014920chr621269 522 --13754 --
NM_014924chr1443130 2573 2319 119 --1999 --
NM_014932chr311345 ------
NM_014946chr272626 2559 2385 801 608 323 197 --1441 --
NM_014947chr122052 238 12624 53107 1970 1115 949 626 --
NM_014949chr111030 ------
NM_014950chr141195 ------
NM_014964chr1722308 964 --32263 325 284 --
NM_014974chr1021832 1734 ------
NM_014978chr1011564 --1703 --
NM_014982chr1433718 3657 2030 --11239 --
NM_014988chr422802 730 --1850 --
NM_014991chr442946 1086 795 648 ------
NM_014992chr14----1191 --
NM_014996chr32738 222 1725 ----
NM_014997chr72731 574 --32941 1121 735 --
NM_014999chr121674 ----11092
NM_015002chr1221454 135 --1190 --
NM_015008chr321246 497 ------
NM_015015chr1931785 1674 527 ------
NM_015020chr1653884 3218 2615 2491 702 ----13735
NM_015023chr1--1157 11807 1426
NM_015025chr242638 2055 1829 428 ----12729
NM_015039chr111489 --11267 14334
NM_015044chr162590 427 --12818 --
NM_015045chr101548 ----1379
NM_015049chr242865 2393 933 101 --12078 --
NM_015051chr9--23267 3139 ----
NM_015059chr151305 --13634 --
NM_015068chr743382 2674 1597 1409 13217 ----
NM_015071chr545699 2144 1754 1569 ----26383 118
NM_015074chr164519 4512 2001 1878 1866 1660 14421 13572 --
NM_015076chr633981 3352 1184 --12765 --
NM_015090chr121293 635 --15706 13829
NM_015092chr1644172 3999 3134 1881 --23025 485 --
NM_015094chr2233348 1714 313 --1584 --
NM_015097chr332332 1592 800 ------
NM_015100chr111975 ------
NM_015107chrX42406 2378 1995 1985 ------
NM_015115chr423006 2932 ----12617
NM_015132chr731653 1616 86 ------
NM_015143chr441141 475 375 282 ------
NM_015144chr162948 81 ------
NM_015149chr111938 --11430 --
NM_015155chr1022546 790 23022 2114 1753 --
NM_015156chr1463843 3829 3601 2959 1587 1434 1759 ----
NM_015172chr1----11366 --
NM_015178chr82447 345 --21852 37 --
NM_015185chrX73003 2599 1093 852 669 606 213 ------
NM_015191chr1132375 688 547 --31680 887 163 1934
NM_015197chr1421105 428 --1592 13347
NM_015206chr1533325 2739 1270 ----12367
NM_015209chr11278 ------
NM_015233chr1322692 873 ----11728
NM_015234chr621123 970 ----11083
NM_015236chr431483 1079 310 ------
NM_015238chr51163 ------
NM_015247chr1641170 1110 602 417 ------
NM_015252chr21380 ------
NM_015263chr15----1342 1964
NM_015265chr242112 1904 1014 174 --12164 --
NM_015267chr1252053 1882 730 427 145 ------
NM_015272chr1611952 ----11758
NM_015277chr1831761 1317 263 --11564 --
NM_015285chr1811753 --2300 61 --
NM_015288chr533581 1182 1055 --43765 2386 2368 168 --
NM_015291chr123453 2870 --22860 2241 --
NM_015310chr8118299 8161 6186 5759 5170 2899 2511 1778 1068 564 523 --12700 --
NM_015315chr552493 1175 1127 1045 917 --21395 1199 --
NM_015326chr112827 --22150 1903 --
NM_015327chr111315 ----1191
NM_015328chr722867 851 12136 22509 2144 --
NM_015330chr2212586 --11809 --
NM_015336chr1232476 2081 602 --1532 --
NM_015339chr202977 866 ------
NM_015347chr1252705 1955 815 602 584 12546 ----
NM_015349chr632648 1064 513 --1973 --
NM_015353chr1732080 936 608 2921 544 ----
NM_015379chr7159 ------
NM_015385chr1032096 2044 138 ------
NM_015387chr2----11776 --
NM_015393chr443812 3180 3053 642 --12480 --
NM_015397chr921503 380 ----1258
NM_015409chr1232651 2634 2455 --12321 --
NM_015446chr111044 ------
NM_015455chr534057 3314 1259 ----12674
NM_015458chr834797 3688 3413 ------
NM_015460chr331735 1428 745 ------
NM_015464chr721012 798 --11016 1408
NM_015483chr71925 ------
NM_015503chr161684 ------
NM_015508chr321406 1299 ------
NM_015509chr1221548 174 ------
NM_015515chr17126 ------
NM_015527chr161836 1292 ----
NM_015530chr2----1643 --
NM_015534chr111013 1825 ----
NM_015535chr21309 --11079 --
NM_015542chr1021270 45 ------
NM_015549chr142582 564 ------
NM_015553chr643451 1164 493 59 --35182 4221 4071 --
NM_015554chr1532684 559 541 1324 ----
NM_015560chr352758 730 680 346 216 --1303 --
NM_015565chr2122099 886 ------
NM_015567chr1321276 88 ------
NM_015568chr2024282 3177 ------
NM_015570chr711613 ------
NM_015571chr612217 --12356 --
NM_015575chr223079 1426 --43386 3344 2478 1406 --
NM_015576chr321908 639 ----12935
NM_015607chr11180 ------
NM_015626chr1721162 988 11123 ----
NM_015676chr14199 ------
NM_015678chr1321467 266 ------
NM_015686chrX32482 2408 851 ----1427
NM_015687chr6126 ------
NM_015691chrX32851 616 199 --42522 2209 2043 669 --
NM_015695chr611782 ------
NM_015855chr111766 ------
NM_015866chr161466 1403 1330 537 391 369 ------
NM_015878chr821798 1788 ------
NM_015879chr1853179 2606 805 587 227 16910 ----
NM_015881chr112485 146 --1543 11228
NM_015885chr111198 ------
NM_015891chr622003 533 ------
NM_015892chr102540 465 11856 11535 --
NM_015895chr6--1204 ----
NM_015904chr22707 47 ------
NM_015906chr124774 3085 --23698 91 --
NM_015920chr151592 --139 --
NM_015955chr21486 1515 ----
NM_015975chrX11757 --11217 --
NM_015976chr11337 ------
NM_015980chr521541 170 --11382 --
NM_015986chr171170 ------
NM_015999chr1190 ------
NM_016002chr11311 2697 527 ----
NM_016018chr831128 448 303 --12124 --
NM_016021chr623006 1172 12206 ----
NM_016022chr12740 256 ------
NM_016025chr1621678 1630 --11954 --
NM_016032chrX1568 ------
NM_016033chr831950 431 107 ------
NM_016037chr1----146 1253
NM_016060chr1711108 ------
NM_016061chr21659 ------
NM_016072chr1221677 277 ------
NM_016073chr153237 157 60 ----2887 107
NM_016076chr143012 2058 2039 776 --12644 12424
NM_016078chr1731018 972 85 ------
NM_016083chr632449 936 216 ------
NM_016107chr52361 265 ----11278
NM_016126chr1--158 ----
NM_016127chr83743 606 198 ------
NM_016131chr211950 126 11971 --
NM_016132chr1552961 2486 1000 976 264 --21352 1129 --
NM_016133chr231234 553 476 ------
NM_016141chr3--1579 1617 --
NM_016185chr172802 725 --1826 --
NM_016201chr311421 1344 ----
NM_016205chr431240 394 251 --1905 1539
NM_016227chr141483 1325 1197 39 ------
NM_016231chr171618 ------
NM_016235chr16191 11049 11098 --
NM_016248chr1333628 2993 2472 --13049 --
NM_016260chr257405 5461 5119 1280 544 11513 ----
NM_016271chr182607 259 --1309 --
NM_016272chr2232682 806 597 ------
NM_016279chr5------1129
NM_016284chr162920 21 ------
NM_016287chr142053 2029 708 289 11474 1721 --
NM_016303chrX------1104
NM_016306chr31378 ------
NM_016316chr2----1634 --
NM_016322chr942561 505 412 129 --1950 --
NM_016339chr1731763 1434 551 11813 1444 --
NM_016374chr121341 1098 ------
NM_016374chr121341 1098 ------
NM_016410chr91468 ------
NM_016422chr11------127
NM_016424chr172782 647 --11504 --
NM_016436chr2021746 891 --12669 --
NM_016441chr272269 1832 1810 1730 1611 860 435 1237 1864 --
NM_016463chr5----1161 --
NM_016467chr211122 ------
NM_016481chr9180 ------
NM_016513chr621269 522 --13754 --
NM_016522chr1121637 481 ------
NM_016525chr92880 337 ------
NM_016529chr134471 360 329 48 ------
NM_016530chr1531320 1226 263 --11425 --
NM_016531chr433210 3178 3118 1772 ----
NM_016544chr231143 738 462 --13362 22997 122
NM_016547chr11707 ------
NM_016559chr31189 ------
NM_016569chr1211141 ----11388
NM_016575chr1233931 3732 3545 --183 --
NM_016577chr3145 --21048 51 11138
NM_016587chr71214 ----1822
NM_016588chr61691 ------
NM_016607chrX----1210 --
NM_016617chr1322214 59 --22008 150 --
NM_016621chr1111589 --13369 --
NM_016623chr82549 451 ------
NM_016628chr101911 --153 1656
NM_016630chr151381 ------
NM_016824chr1021668 1619 ------
NM_016834chr1733615 3365 409 11572 24124 1169 --
NM_016835chr1733615 3365 409 11572 24124 1169 --
NM_016836chr21751 --2525 509 --
NM_016839chr21751 --2525 509 --
NM_016841chr1733615 3365 409 11572 24124 1169 --
NM_016946chr132997 1049 621 13145 11149 --
NM_017409chr121763 ------
NM_017410chr1211182 ------
NM_017412chr821142 917 ------
NM_017420chr1453551 3040 1509 1428 1353 ------
NM_017423chr432208 428 240 --1309 --
NM_017425chr112123 100 ------
NM_017437chr1421881 641 --12026 --
NM_017452chr2021183 199 --11172 --
NM_017453chr2021183 199 --11172 --
NM_017454chr2021183 199 --11172 --
NM_017455chr15----1236 --
NM_017519chr62318 252 ------
NM_017563chr386197 5670 5388 4875 2216 1630 471 281 15297 ----
NM_017577chr311598 ------
NM_017588chr931921 1742 189 21673 1251 ----
NM_017593chr42148 127 --1465 --
NM_017596chr124637 3598 14683 24013 1255 --
NM_017617chr911310 ----1629
NM_017628chr484838 4404 1734 1702 1523 847 837 473 14128 --11067
NM_017629chr111403 --11923 --
NM_017632chr41342 --1446 --
NM_017633chr633767 3454 3336 --1830 --
NM_017637chr9116627 5763 3457 2615 2478 2198 2109 1385 1365 465 389 27468 5724 42624 1823 1700 405 17723
NM_017643chr1722038 216 --1779 --
NM_017644chr334622 4095 476 --23514 1538 --
NM_017645chr963178 3068 3053 1246 821 364 ----12775
NM_017650chr766065 5616 5346 3684 355 285 ----25313 5258
NM_017657chr2----1251 --
NM_017658chr1433741 3192 172 ------
NM_017660chr1952765 2422 1120 911 572 ------
NM_017661chr152296 82 ------
NM_017686chr121070 888 --2806 85 --
NM_017719chr332479 1837 307 ------
NM_017736chr1631250 395 222 --156 --
NM_017742chr18----2781 641 --
NM_017745chrX1708 ------
NM_017753chr92375 71 ------
NM_017754chr625001 4306 --21016 838 --
NM_017762chr1522469 1838 --21589 256 --
NM_017768chr11216 ------
NM_017769chr1422411 870 ------
NM_017772chr63352 256 106 ------
NM_017778chr81930 --11085 --
NM_017780chr81856 ------
NM_017785chr52421 392 ------
NM_017789chr21839 ------
NM_017794chr9------1320
NM_017811chr912837 1771 ----
NM_017813chr873830 2274 1053 1038 660 506 185 1237 15302 11792
NM_017824chr1021764 50 ------
NM_017848chrX24632 909 ------
NM_017902chr1025262 4544 1286 ----
NM_017919chr924129 157 ----15464
NM_017922chr142580 91 ------
NM_017925chr911957 ----11435
NM_017926chr142316 171 --2302 41 --
NM_017933chr2----11570 --
NM_017938chrX2758 584 1310 22138 341 --
NM_017944chr1142917 915 673 189 12797 ----
NM_017972chr142316 171 --2302 41 --
NM_018003chr1532302 1532 449 ------
NM_018004chr3----1387 --
NM_018011chr131208 --1496 --
NM_018027chr1033118 2870 937 --12193 13300
NM_018030chr181281 ----1288
NM_018032chr163918 376 245 ------
NM_018046chr51458 11312 --1595
NM_018048chr1211957 ------
NM_018063chr101405 ------
NM_018067chr12501 131 ------
NM_018078chr42693 401 ------
NM_018084chr21803 --1881 --
NM_018110chr1621380 1079 ------
NM_018112chr91232 ------
NM_018117chr10--1550 1754 --
NM_018120chr82201 59 ------
NM_018121chr1021188 980 ----1644
NM_018133chr321712 1526 ------
NM_018155chr342963 2553 603 136 ------
NM_018159chrX31498 234 183 ----11085
NM_018178chr1----11832 --
NM_018182chr1711511 --1757 1409
NM_018184chr331683 1620 1531 1189 11354 --
NM_018201chr922521 249 ------
NM_018202chr1------1121
NM_018206chr16----1632 --
NM_018211chr151854 1650 611 347 132 1863 1886 --
NM_018214chr6------11083
NM_018243chr41157 ------
NM_018247chr642538 2164 692 140 --12542 12043
NM_018254chr11877 --1567 --
NM_018257chr20--1608 21604 401 11948
NM_018266chr31403 ----11059
NM_018270chr201719 ------
NM_018293chr312697 ----12080
NM_018299chr843091 1258 1206 711 ------
NM_018313chr322649 2441 ----1299
NM_018315chr411198 --1619 --
NM_018320chr11------11238
NM_018323chr42611 243 195 1463 --
NM_018325chr911452 --11043 --
NM_018330chr1031093 274 106 ------
NM_018334chr71359 ------
NM_018348chr161434 --167 --
NM_018362chr1123774 1612 --23810 3200 --
NM_018364chr123775 1501 --13616 11024
NM_018369chr5140 ------
NM_018371chr82590 305 ------
NM_018373chr1426401 4573 15262 --15926
NM_018374chr713882 --1941 --
NM_018387chr91375 ------
NM_018388chrX41396 482 472 108 ------
NM_018399chr6------2280 80
NM_018403chr322562 985 ------
NM_018412chr71160 ------
NM_018416chr1212373 ----12612
NM_018424chr911738 ----11549
NM_018425chr1032590 2075 471 --12218 --
NM_018442chr1----1369 --
NM_018444chr812093 12086 ----
NM_018448chr121159 ------
NM_018452chr6_random12821 2780 757 12683 --
NM_018457chr122459 72 --1197 --
NM_018469chr1721457 1387 ----11006
NM_018482chr832440 1874 148 11630 ----
NM_018486chrX1489 ------
NM_018489chr12932 126 ------
NM_018490chr1121645 1554 ------
NM_018557chr231489 1429 1157 ------
NM_018638chr1244542 2237 279 95 --14099 --
NM_018640chr1222569 378 --12598 12550
NM_018649chr101229 ------
NM_018650chr11302 ------
NM_018686chr12185 ------
NM_018691chr52313 200 --1146 --
NM_018695chr521943 266 --1973 --
NM_018697chr7----1249 --
NM_018700chr521374 1366 --21210 303 --
NM_018704chr12773 256 ------
NM_018712chr1111326 ------
NM_018841chr123747 159 ------
NM_018844chr71305 ------
NM_018890chr721140 344 2490 313 ----
NM_018898chr51891 ------
NM_018899chr51891 ------
NM_018900chr51891 ------
NM_018901chr51891 ------
NM_018902chr51891 ------
NM_018903chr51891 ------
NM_018904chr51891 ------
NM_018905chr51891 ------
NM_018906chr51891 ------
NM_018907chr51891 ------
NM_018908chr51891 ------
NM_018909chr51891 ------
NM_018910chr51891 ------
NM_018911chr51891 ------
NM_018912chr511612 ------
NM_018913chr511612 ------
NM_018914chr511612 ------
NM_018915chr511612 ------
NM_018916chr511612 ------
NM_018917chr511612 ------
NM_018918chr511612 ------
NM_018919chr511612 ------
NM_018920chr511612 ------
NM_018921chr511612 ------
NM_018922chr511612 ------
NM_018923chr511612 ------
NM_018924chr511612 ------
NM_018925chr511612 ------
NM_018926chr511612 ------
NM_018927chr511612 ------
NM_018928chr511612 ------
NM_018929chr511612 ------
NM_018951chr71208 ------
NM_018953chr121568 --1795 --
NM_018972chr812428 --1896 --
NM_018975chr161780 --1129 --
NM_018976chr1221954 947 ------
NM_018977chrX1974 ------
NM_018979chr1222566 700 --1888 --
NM_018993chr2011428 ------
NM_018999chr10--24314 1093 14081 --
NM_019000chr5------1248
NM_019001chr343391 940 583 209 --23548 539 --
NM_019003chrX1136 ------
NM_019004chr7------1751
NM_019022chr1832905 2740 2030 ------
NM_019024chr2------134
NM_019027chr42898 293 ------
NM_019028chr111378 ------
NM_019045chrX2904 823 ------
NM_019058chr101522 ------
NM_019072chr521383 63 13704 1559 --
NM_019087chr521742 267 ------
NM_019091chr231121 854 116 ------
NM_019096chr62916 438 ----1949
NM_019106chr2213436 --11274 13421
NM_019116chr1643064 2914 1282 278 23129 3110 13357 --
NM_019555chr32271 214 ------
NM_019590chr10--1196 ----
NM_019593chr2032945 2740 2702 --32037 940 861 --
NM_019610chr131822 1678 258 ------
NM_019613chr1721342 140 --11240 --
NM_019854chr12----1611 1231
NM_019857chrX21752 360 --11551 --
NM_019859chr103466 411 142 ------
NM_019885chr232918 2896 2332 ------
NM_019895chr31429 ------
NM_019903chr1021668 1619 ------
NM_020116chr431418 547 404 --11265 --
NM_020122chr216060 14474 21582 890 14378
NM_020144chr7----1282 --
NM_020148chr181538 --2650 542 12173
NM_020156chr71426 --2526 417 --
NM_020159chr431657 1648 1123 ------
NM_020177chr52556 71 ------
NM_020180chr1831213 1139 943 ------
NM_020182chr2063577 3386 3291 2723 2568 2505 12797 ----
NM_020184chr212260 ----1689
NM_020189chr8121 ------
NM_020193chr11----1144 --
NM_020198chr1711261 --1375 --
NM_020239chr112040 --22064 707 --
NM_020245chr675098 4889 4543 4513 1516 1467 1454 ------
NM_020336chr201617 12475 --23647 1077
NM_020338chr1023709 972 ------
NM_020340chr661849 1757 875 644 556 70 --1304 --
NM_020341chr2011521 11561 11314 --
NM_020342chr212128 ------
NM_020362chr13759 530 335 --1317 --
NM_020390chr341830 1448 1429 447 171 11123 14234
NM_020403chr1361187 1137 663 651 619 592 ------
NM_020429chr731959 293 126 --32434 2078 861 --
NM_020432chr732300 2280 2266 ------
NM_020437chr22186 ----1328
NM_020443chr136800 5724 945 25096 638 ----
NM_020445chr7----2757 103 --
NM_020449chrX----1201 --
NM_020452chr12556 489 ------
NM_020453chr411448 ----1773
NM_020455chr632864 2666 2574 1323 --12320
NM_020456chr131542 --21833 616 --
NM_020463chr23440 423 335 ------
NM_020466chr641930 956 150 49 13811 13145 14003
NM_020473chrX41982 1730 1292 769 ------
NM_020482chr6--145 ----
NM_020532chr23815 297 149 ------
NM_020630chr101647 1612 ----
NM_020640chr31556 ------
NM_020648chr1812853 --1900 --
NM_020651chr221747 368 --21512 71 --
NM_020654chr311381 ------
NM_020673chr2067755 7608 7355 3098 2015 1688 ------
NM_020693chr111474 ------
NM_020697chr841161 1007 374 351 11042 21074 977 --
NM_020699chr121313 372 --11422 --
NM_020703chr12574 412 ------
NM_020708chr20----12218 --
NM_020732chr62318 252 ------
NM_020734chr1213361 12279 1789 --
NM_020742chrX12328 ------
NM_020747chr51646 1625 1164 --
NM_020752chr1032905 2895 2503 ------
NM_020762chr12----1132 --
NM_020766chrX84371 4023 3793 3740 3611 2857 968 587 1899 34346 3973 1159 --
NM_020769chrX2799 701 --1100 1677
NM_020772chr1787258 6649 5760 5635 5329 2844 1399 1293 --28034 6048 16369
NM_020774chr1835167 1826 771 --16209 --
NM_020783chr1832322 500 108 ----1122
NM_020791chr1711315 11198 1943 --
NM_020792chr322198 713 ------
NM_020796chr572961 2875 2358 2337 2265 2097 605 ------
NM_020799chr102174 59 ------
NM_020800chr3--179 ----
NM_020801chr531701 1628 888 --1777 --
NM_020805chr18------11712
NM_020808chr11757 ------
NM_020810chr1463002 2976 2728 1363 1000 336 ------
NM_020818chr14------1333
NM_020819chr6----1769 --
NM_020830chr2--1658 1857 1411
NM_020839chr341251 996 581 527 ------
NM_020841chr1223441 1300 ------
NM_020850chr1633315 2994 919 ------
NM_020856chr192183 82 11248 ----
NM_020858chr1541809 564 63 46 ------
NM_020859chr433719 2680 515 ------
NM_020860chr4--11092 11047 --
NM_020868chr22316 80 --11949 1182
NM_020871chrX----11878 1791
NM_020872chr311693 ------
NM_020873chr33754 610 273 ------
NM_020917chr1931360 905 578 --11278 --
NM_020918chr1013514 --22793 1336 --
NM_020921chr1422533 889 ----13126
NM_020922chrX11345 ------
NM_020926chrX--125 ----
NM_020927chr161155 ------
NM_020935chr244381 4023 632 260 --1642 --
NM_020940chr1032017 182 172 ----12628
NM_020951chr1922155 461 ----1195
NM_020958chr14----1134 --
NM_020962chr151129 ------
NM_020975chr101387 ----11321
NM_020977chr431984 1701 401 ----11781
NM_020987chr1011007 ----1943
NM_020993chr1212782 --1296 --
NM_021003chr142261 234 ------
NM_021007chr2----12237 --
NM_021033chr1333377 2762 896 12963 23119 3020 13077
NM_021038chr343286 3189 736 647 --22622 198 12103
NM_021045chr1031988 262 222 ------
NM_021069chr42775 556 188 11942 --
NM_021072chr521983 755 ------
NM_021090chr2244248 3863 3438 243 24738 283 24612 699 --
NM_021096chr2223298 3227 --12115 12265
NM_021111chr921325 199 --21266 1098 --
NM_021120chrX32790 1151 1002 --13110 --
NM_021132chr101946 ------
NM_021136chr141590 ----1246
NM_021144chr91452 ------
NM_021145chr721132 1072 --1141 --
NM_021159chr421697 269 --21632 238 --
NM_021180chr11612 ------
NM_021183chrX21733 543 --12280 1139
NM_021190chr1------1329
NM_021191chr1212036 ------
NM_021205chr112873 ------
NM_021242chrX2862 832 1372 ----
NM_021249chr1421678 1463 --11377 --
NM_021252chr1041887 1879 1608 640 --11655 --
NM_021255chr1444024 2632 995 181 --11174 --
NM_021620chr61714 ------
NM_021629chr365087 4556 4357 1534 991 254 ------
NM_021637chrX31223 1109 862 ------
NM_021639chr12583 94 ------
NM_021804chrX138 ------
NM_021813chr644988 4795 3661 1339 ----13886
NM_021911chr545193 1394 161 122 13703 1263 --
NM_021912chr1522802 768 --1649 --
NM_021940chr641540 1320 1097 510 ------
NM_021946chrX31297 523 220 ------
NM_021951chr91750 1802 ----
NM_021960chr1--12753 ----
NM_021961chr1136163 5239 4522 12049 14940 12838
NM_021964chr366398 5423 5140 2308 1988 1290 25166 1544 --1200
NM_021998chrX11223 ------
NM_021999chr131662 ------
NM_022048chr1534590 4239 748 11988 ----
NM_022051chr11142 ----1518
NM_022073chr1411454 ------
NM_022080chr2042788 2117 536 101 --1153 1306
NM_022093chr11677 ------
NM_022130chr521367 1076 ----1240
NM_022154chr42170 23 ------
NM_022351chr8------13442
NM_022372chr161175 --1529 --
NM_022456chr1237160 4793 4664 1239 ----
NM_022459chr1335643 5395 1934 --1999 --
NM_022463chr1711471 ------
NM_022474chr1412751 12551 12319 --
NM_022574chr731770 1524 583 --12007 --
NM_022650chr52924 747 1339 ----
NM_022652chr12----1839 --
NM_022658chr12----21069 1059 --
NM_022659chr81511 ------
NM_022716chr133148 2796 2346 12895 1791 --
NM_022726chr641408 1244 289 24 --11675 --
NM_022733chr13927 362 192 --1183 --
NM_022745chr121039 117 ----22297 1117
NM_022753chr11763 12729 ----
NM_022756chr12461 243 2557 261 11020 --
NM_022757chr31964 ------
NM_022780chr2--1243 ----
NM_022781chr942415 1231 827 623 --1290 --
NM_022802chr1041593 1459 343 130 ------
NM_022824chr5--21420 168 ----
NM_022826chr2----1172 1851
NM_022831chr131353 1310 316 11548 11675 --
NM_022838chrX1310 ------
NM_022841chr1522687 375 --12681 --
NM_022845chr1621730 521 --1683 --
NM_022893chr233145 412 338 11172 22319 428 --
NM_022894chr231105 638 391 ------
NM_022898chr1424545 4256 147 13972 11100
NM_022900chr711069 ------
NM_022901chr911804 ------
NM_022913chr51201 ------
NM_022965chr411325 11604 ----
NM_022970chr10----189 --
NM_022977chrX2591 559 --21010 156 --
NM_023000chr1441163 440 259 170 ------
NM_023001chr1441163 440 259 170 ------
NM_023009chr11636 ------
NM_023068chr2011021 11425 --11160
NM_023076chr1611977 22235 194 12701 --
NM_023079chr171449 --11694 --
NM_023925chr121325 ------
NM_023929chr832801 2358 2262 --1118 --
NM_024007chr5----22761 645 --
NM_024052chr1722934 415 ------
NM_024055chr51615 ------
NM_024057chr121130 ------
NM_024082chrX--1154 --1113
NM_024090chr411761 ------
NM_024095chr122100 50 ------
NM_024117chr911183 ------
NM_024122chrX------1251
NM_024319chr1127 ------
NM_024408chr163511 3261 1237 1180 857 662 13554 ----
NM_024494chr1--1186 ----
NM_024496chr143697 628 556 ------
NM_024520chr2140 ------
NM_024524chr322683 763 --1582 --
NM_024539chrX----1312 --
NM_024548chr331391 1295 58 ------
NM_024554chr121168 170 --11457 --
NM_024561chr1321148 1053 ------
NM_024569chr132739 689 279 --21075 986 --
NM_024612chr17--2202 182 1415 --
NM_024613chr821824 313 ------
NM_024615chr51249 ------
NM_024624chr221453 1438 ------
NM_024626chr111618 --1403 --
NM_024636chr71490 --12017 11962
NM_024645chr811327 ------
NM_024659chr21297 ------
NM_024665chr384646 4437 4194 2877 1786 1139 1001 656 ------
NM_024674chr121143 857 11256 12287 --
NM_024676chr111333 ------
NM_024686chr1----1500 --
NM_024700chr12905 283 --1141 --
NM_024711chr722328 477 ------
NM_024719chr13298 23 ------
NM_024721chr8----12684 12607
NM_024742chr1611311 ------
NM_024744chr212040 11922 --1150
NM_024755chr151178 1578 1918 --
NM_024779chr121306 ------
NM_024780chr161242 ----1392
NM_024811chr1121316 719 --11919 --
NM_024818chr321197 348 --11387 --
NM_024828chr921271 1067 ------
NM_024834chr101359 1674 21917 284 --
NM_024835chr171292 ------
NM_024837chr1511813 --1484 --
NM_024899chr181654 ------
NM_024909chr6----21591 1182 --
NM_024920chr411497 ------
NM_024930chr52639 280 --1851 12778
NM_024939chr1631536 1470 535 ------
NM_024944chr211856 ----1510
NM_024946chr1631620 527 431 ------
NM_024947chr389509 9362 8896 8352 5889 2849 2315 1233 3761 728 420 37337 3055 2477 17200
NM_024949chr414539 24631 988 1250 --
NM_024989chr258064 7492 6071 5845 5370 1836 11635 --
NM_024991chr1032096 2044 138 ------
NM_024993chr22471 355 --21347 1235 --
NM_025027chr191470 ------
NM_025054chr812637 14074 1656 --
NM_025076chr21286 --173 --
NM_025126chr12----1514 --
NM_025133chr2----1362 --
NM_025134chr1622215 494 ------
NM_025141chr151436 ------
NM_025146chr31809 ------
NM_025154chr711166 ------
NM_025160chr133726 3589 2786 --33001 642 339 --
NM_025164chr1122239 813 --11682 --
NM_025191chr153400 1369 1344 1285 772 --22168 309 --
NM_025195chr831771 1761 570 --11621 --
NM_025211chr91209 ------
NM_025219chr201265 ------
NM_025235chr101243 ------
NM_025238chr1521525 524 ------
NM_030579chr1623365 3054 13038 12413 13320
NM_030621chr1421142 555 --32590 996 505 --
NM_030625chr1032421 2356 572 --179 --
NM_030629chr1621686 520 --11872 --
NM_030647chr734823 4663 280 --14507 --
NM_030648chr464279 3787 3710 3566 1681 1415 23929 1822 ----
NM_030650chr223863 1139 ----12721
NM_030661chr72206 63 ------
NM_030664chr101289 ----12269
NM_030670chr12--12124 11864 --
NM_030671chr12--12124 11864 --
NM_030674chr1232353 2292 1363 --133 --
NM_030762chr12------21383 1258
NM_030763chrX4769 373 254 49 1751 ----
NM_030771chr111210 ------
NM_030772chr1------1457
NM_030780chr831438 1423 1404 ------
NM_030791chr141439 ------
NM_030799chr522220 1963 --12084 --
NM_030806chr146295 3046 1874 242 1518 22249 223 --
NM_030816chr121265 617 13159 ----
NM_030884chr312292 ------
NM_030915chr212281 --11713 --
NM_030918chr134078 714 197 11487 22031 312 --
NM_030920chr121662 507 ------
NM_030925chr1331979 1369 1329 --1483 --
NM_030934chr111872 ------
NM_030953chr5----11552 --
NM_031157chr121516 ------
NM_031217chr111208 ------
NM_031243chr762296 2104 1495 594 481 276 --1639 --
NM_031262chr911027 ------
NM_031263chr911084 ------
NM_031268chr1685188 4069 4015 1829 1431 1203 978 266 ----14382
NM_031305chr421462 318 ------
NM_031314chr141363 11492 ----
NM_031371chr121341 1098 ------
NM_031371chr121341 1098 ------
NM_031372chr41563 ----11579
NM_031407chrX1484 ------
NM_031411chr51891 ------
NM_031439chr821934 263 11919 ----
NM_031442chrX21051 737 --12443 --
NM_031445chr213383 1133 22158 1234 --
NM_031452chr151172 ------
NM_031483chr2043539 3260 664 68 ------
NM_031492chr111464 ------
NM_031845chr22977 882 --13673 --
NM_031847chr22977 882 --13673 --
NM_031849chr51891 ------
NM_031857chr51891 ------
NM_031860chr51891 ------
NM_031940chr81209 ----12059
NM_032042chr521964 942 ------
NM_032088chr511612 ------
NM_032092chr511612 ------
NM_032102chr1133066 634 191 12393 ----
NM_032105chr158023 5414 5318 2924 905 12023 ----
NM_032121chrX2844 649 ------
NM_032124chr181129 ------
NM_032128chr41887 ------
NM_032144chr211502 ------
NM_032145chr631300 337 176 ------
NM_032153chr312355 ------
NM_032156chr121325 ------
NM_032169chr32658 540 ----1216
NM_032189chr1324529 1212 14787 ----
NM_032199chr1043588 2895 1304 728 ------
NM_032208chr243652 2759 2400 2319 ----1672
NM_032211chr1011212 ------
NM_032221chr2011363 --1195 11399
NM_032231chr15--1254 ----
NM_032268chr1632527 2515 1296 13038 12617 --
NM_032295chr72176 66 ------
NM_032312chr21658 --190 --
NM_032321chr233302 2744 2728 --22794 2048 --
NM_032329chr244344 1062 930 919 ------
NM_032373chr1065318 2275 2096 1690 366 162 --2859 228 15508
NM_032379chr111827 ------
NM_032403chr511612 ------
NM_032410chr831124 844 248 ------
NM_032420chr51803 --1712 --
NM_032434chr21311 11541 11203 2474 50
NM_032435chr111574 --12394 --
NM_032438chr611438 --11596 --
NM_032439chr101574 --165 --
NM_032452chr141291 ------
NM_032457chr433019 2683 663 ------
NM_032458chrX23216 1159 --13220 133
NM_032471chr61142 ------
NM_032510chr1821794 89 ------
NM_032539chrX1615 --1577 --
NM_032560chr14--1322 ----
NM_032574chr2--133 ----
NM_032582chr1711735 --1404 --
NM_032590chr1221030 723 ------
NM_032622chr42459 416 --11076 --
NM_032626chr161326 ------
NM_032632chr141484 --31920 770 50 --
NM_032646chr17----21656 1166 --
NM_032682chr353535 2980 2601 290 97 11189 ----
NM_032711chr17----33935 3308 3186 --
NM_032784chr62347 209 1137 ----
NM_032833chr1--1300 ----
NM_032859chr1311093 1609 --1285
NM_032875chr171609 --2778 702 --
NM_032927chr41265 --131 1505
NM_032940chr161843 ------
NM_032943chr111827 ------
NM_032949chr13176 ------
NM_032960chr131520 1510 446 --2404 294 --
NM_032961chr431007 550 495 ------
NM_032968chrX3508 490 293 --11369 --
NM_032969chrX3508 490 293 --11369 --
NM_032973chrY2508 293 --11369 --
NM_032975chr1853367 3250 3137 3094 2363 12435 ----
NM_032980chr1853367 3250 3137 3094 2363 12435 ----
NM_032991chr41551 --11401 --
NM_033012chr131673 ------
NM_033020chr124774 3085 --23698 91 --
NM_033025chr19--2199 116 194 1279
NM_033044chr111266 --11084 --
NM_033056chr101686 ------
NM_033082chr121190 --1214 --
NM_033089chr2021073 565 --1230 --
NM_033105chr81112 ------
NM_033119chr162576 194 ------
NM_033121chr1211805 --1661 11455
NM_033124chr12------1111
NM_033132chr1311906 --11893 --
NM_033138chr731937 511 405 ------
NM_033139chr731937 511 405 ------
NM_033140chr731937 511 405 ------
NM_033157chr731937 511 405 ------
NM_033161chr922028 505 ------
NM_033181chr632449 936 216 ------
NM_033211chr521841 1609 --1339 --
NM_033224chr756488 891 826 441 273 --12419 13153
NM_033225chr81423 12429 1327 --
NM_033228chr51149 ------
NM_033278chr111340 ------
NM_033285chr823054 684 1498 21545 83 --
NM_033305chr921328 1226 1951 ----
NM_033326chr1152394 2378 1885 201 186 1743 ----
NM_033331chr97722 618 611 516 339 237 105 1788 11026 12381
NM_033338chr1011355 11067 ----
NM_033339chr1011355 11067 ----
NM_033340chr1011471 11183 ----
NM_033380chrX11161 ------
NM_033381chrX11161 ------
NM_033389chr1743175 1643 1536 1223 13854 11014 --
NM_033425chr1121402 598 --1570 --
NM_033427chr7----1178 --
NM_033430chr413776 ----12889
NM_033437chr413776 ----12889
NM_033480chr662318 2167 2134 1133 287 269 1920 ----
NM_033481chr662318 2167 2134 1133 287 269 1920 ----
NM_033503chr152310 104 --1830 --
NM_033505chr266449 5789 5418 4409 2292 283 1500 15336 --
NM_033512chr822774 765 --12941 --
NM_033542chr202717 308 --2441 410 --
NM_033551chr552493 1175 1127 1045 917 --21395 1199 --
NM_033624chr1221454 135 --1190 --
NM_033632chr411198 --1619 --
NM_033642chrX51228 1067 886 831 450 --1875 --
NM_033644chr562568 2046 1900 954 807 517 ----1959
NM_033645chr562568 2046 1900 954 807 517 ----1959
NM_033655chr911080 ----1125
NM_033656chr2113687 23660 636 24079 4028 --
NM_044472chr11230 --2512 506 --
NM_052811chr1375272 4957 4796 4306 3525 3491 1313 --12107 --
NM_052821chr931921 1742 189 21673 1251 ----
NM_052827chr12--1762 --11004
NM_052828chr631247 1143 510 ----1586
NM_052834chr1811753 --2300 61 --
NM_052840chr1511295 --11533 --
NM_052845chr1222856 829 2887 782 --12003
NM_052869chr17----21656 1166 --
NM_052879chr1243040 3033 1438 523 --13234 23991 568
NM_052901chr9--11763 ----
NM_052905chr221255 349 ------
NM_052911chr18158 ------
NM_052917chr242446 1270 1067 393 23220 328 ----
NM_052918chr1043585 1037 154 114 ----12827
NM_052927chr522231 2092 ----12067
NM_052937chr84485 476 464 217 ----11780
NM_053001chr82313 295 ------
NM_053016chr937707 6693 686 37115 980 482 ----
NM_053023chr1153327 3145 2808 2152 832 --2211 188 1898
NM_053024chr3----11445 11313
NM_053043chr756345 6242 5837 1591 463 --12076 --
NM_053053chr1----2895 148 --
NM_053056chr1152975 2204 1059 348 129 ------
NM_053064chr143813 725 648 ------
NM_054012chr9170 1173 ----
NM_054110chr31229 ------
NM_057164chr22651 235 ------
NM_057165chr22651 235 ------
NM_057166chr22651 235 ------
NM_057167chr22651 235 ------
NM_057175chr422433 545 ------
NM_058170chr111170 ------
NM_058229chr81165 ------
NM_058241chr221574 856 12363 31807 350 100 --
NM_058241chr221574 856 12363 31807 350 100 --
NM_078473chr81209 ----12059
NM_078474chr151436 ------
NM_078483chr543023 651 472 108 12994 1680 11098
NM_078629chrX3601 139 129 ------
NM_078630chrX3601 139 129 ------
NM_079421chr192549 391 ------
NM_080425chr201317 ------
NM_080426chr201317 ------
NM_080552chr20----1203 --
NM_080597chr181281 ----1288
NM_080599chr1021270 45 ------
NM_080617chr203937 902 717 ------
NM_080625chr2011200 ------
NM_080645chr632030 1468 758 ------
NM_080676chr2011314 --23260 3105 --
NM_080678chr22491 230 --1137 --
NM_080752chr20----1407 --
NM_080759chr1332518 2203 1850 --1778 --
NM_080760chr1332518 2203 1850 --1778 --
NM_080764chr2232525 2285 2212 --12751 13273
NM_080867chr141507 --21530 899 13596
NM_080872chr823373 964 23947 483 ----
NM_080927chr312066 ----13277
NM_100264chr101911 --153 1656
NM_100486chr101911 --153 1656
NM_130387chr3----11194 --
NM_130391chr921321 881 ------
NM_130392chr921321 881 ------
NM_130393chr921321 881 ------
NM_130435chr1022481 304 --12876 --
NM_130436chr2112118 22331 1777 ----
NM_130438chr2112695 22908 2354 ----
NM_130459chr911080 ------
NM_130811chr20----21011 128 --
NM_130831chr352758 730 680 346 216 --1303 --
NM_130832chr352758 730 680 346 216 --1303 --
NM_130833chr352758 730 680 346 216 --1303 --
NM_130834chr352758 730 680 346 216 --1303 --
NM_130835chr352758 730 680 346 216 --1303 --
NM_130836chr352758 730 680 346 216 --1303 --
NM_130837chr352758 730 680 346 216 --1303 --
NM_130838chr1511317 ------
NM_130839chr1511317 ------
NM_133170chr2027184 2572 --22433 181 --
NM_133264chr1722799 312 1973 22942 2598 11479
NM_133338chr51436 ------
NM_133339chr51436 ------
NM_133340chr51436 ------
NM_133341chr51436 ------
NM_133342chr51436 ------
NM_133343chr51436 ------
NM_133344chr51436 ------
NM_133370chr431066 930 472 ----13315
NM_133372chr512250 --21126 1101 1327
NM_133378chr21876 ------
NM_133432chr21876 ------
NM_133433chr51178 ------
NM_133437chr21876 ------
NM_133457chr71347 ------
NM_133468chr731944 814 259 1615 ----
NM_133478chr212415 ------
NM_133493chr644596 3533 2990 1040 --14258 24226 4093
NM_133625chr32145 130 ------
NM_133631chr321209 175 ------
NM_133646chr221747 891 13686 25108 2096 13899
NM_133647chr1533835 3454 3141 --33132 2543 855 --
NM_134265chr1721162 988 11123 ----
NM_134428chr9------194
NM_134442chr2----2671 591 1476
NM_138270chrX23172 2642 --42718 2224 863 195 --
NM_138288chr1431973 892 167 ------
NM_138290chr7136 ------
NM_138328chr1743379 1039 591 411 --23216 3113 --
NM_138333chr931708 501 433 --11981 --
NM_138340chr18180 ------
NM_138373chr1951872 1853 1717 492 221 --1230 --
NM_138423chr15179 ------
NM_138426chr742239 867 788 327 --1842 --
NM_138437chrX188 ------
NM_138444chr1344574 3952 3490 1652 --13225 14316
NM_138471chr112535 214 ------
NM_138473chr121555 --34875 722 585 --
NM_138492chr51330 ------
NM_138576chr1424545 4256 147 13972 11100
NM_138609chr52365 209 --1535 --
NM_138610chr52365 209 --1535 --
NM_138635chr7----1284 --
NM_138693chr7153 ------
NM_138713chr1646103 3127 2410 168 17877 ----
NM_138714chr1646103 3127 2410 168 17877 ----
NM_138729chr1199 ------
NM_138782chr51195 ------
NM_138927chr212667 221 ------
NM_138931chr3------1419
NM_138959chr155686 5677 4718 1170 350 11948 25764 523 --
NM_138966chr181201 ------
NM_138970chr1432365 1690 755 ------
NM_138971chr1123760 722 ------
NM_138971chr1123760 722 ------
NM_138972chr1123760 722 ------
NM_138972chr1123760 722 ------
NM_138973chr1123760 722 ------
NM_138973chr1123760 722 ------
NM_138980chr41220 ------
NM_138982chr41220 ------
NM_139012chr62469 94 ----1805
NM_139014chr62549 174 ----1885
NM_139015chr1241706 1225 627 599 ----21711 1665
NM_139035chrX1493 --1574 --
NM_139048chr321023 484 --11130 --
NM_139057chr1542695 2146 816 549 --32175 2138 596 --
NM_139135chr12484 309 --169 --
NM_139136chr122911 39 ------
NM_139168chr541666 1658 1521 1428 ------
NM_139211chr43139 97 76 ------
NM_139212chr43139 97 76 ------
NM_139276chr1742237 2141 346 300 ------
NM_139283chr121848 ------
NM_144568chr143639 250 219 ------
NM_144571chr446078 4481 2452 1155 --25930 5823 137
NM_144578chr1434589 3575 1767 --24792 1325 45007 4545 2118 1837
NM_144599chr1565455 5019 3528 3379 1525 209 12000 34387 941 402 --
NM_144632chr211742 2416 115 --12252
NM_144643chr41127 ------
NM_144664chr1122006 975 1819 ----
NM_144691chr19142 ----1603
NM_144709chr21149 ------
NM_144721chr41724 12652 ----
NM_144736chr21129 1250 ----
NM_144963chr812522 --122 22681 698
NM_144973chr1244753 1485 1463 155 ----15060
NM_144979chr41594 ------
NM_144992chr21534 ------
NM_145014chr112339 310 ------
NM_145025chr61180 ----1838
NM_145055chr1853461 3351 2858 1209 667 11370 13587 --
NM_145109chr172974 885 ------
NM_145112chr1411268 ------
NM_145113chr1411540 ------
NM_145117chr1152863 2838 2530 1036 226 --1254 --
NM_145251chr14----21142 117 --
NM_145284chrX22202 589 --1749 --
NM_145290chr4--1216 ----
NM_145305chrX41373 1105 472 42 ------
NM_145686chr221313 716 12774 13399 --
NM_145687chr221313 716 12774 13399 --
NM_145698chr10--1486 1116 --
NM_145733chr2211225 ----11210
NM_145735chr1352746 2060 2016 255 36 11088 1950 --
NM_145808chr723132 2015 --22127 1144 --
NM_145891chr1631419 590 227 ------
NM_145892chr1631419 590 227 ------
NM_145893chr1631541 712 349 ------
NM_145899chr61982 ------
NM_145901chr61982 ------
NM_145902chr61982 ------
NM_145903chr61982 ------
NM_145904chr61982 ------
NM_145905chr61982 ------
NM_147150chr932479 469 311 --13791 --
NM_147161chr11988 1401 --21211 747
NM_147189chr84893 717 111 80 --1105 --
NM_148174chr821798 1788 ------
NM_148177chr81165 ------
NM_148571chr1741686 1348 568 231 ------
NM_148921chr1722308 964 --32263 325 284 --
NM_148957chr132824 158 1808 ----
NM_152227chr201700 ------
NM_152233chr1421678 1463 --11377 --
NM_152236chr22--1183 ----
NM_152237chr2221648 73 11677 ----
NM_152238chr11337 ------
NM_152264chr11--1890 ----
NM_152267chr2222385 428 ------
NM_152277chr51520 --1603 160
NM_152278chrX----1117 146
NM_152280chr133471 3184 1376 --1262 --
NM_152282chr311386 1290 --11344
NM_152300chr1721731 657 --21798 223 --
NM_152323chr12----1156 --
NM_152375chr122636 394 ------
NM_152388chr263702 3167 2996 2718 948 605 13407 ----
NM_152409chr512977 --11235 --
NM_152414chr8--11158 ----
NM_152417chr81844 --21200 418 --
NM_152423chrX21514 1157 ------
NM_152424chrX43914 3414 860 92 23359 310 ----
NM_152437chr12----12363 --
NM_152450chr151486 --1407 --
NM_152470chr1833438 1471 449 13779 ----
NM_152493chr111647 ------
NM_152520chr2187 ----1833
NM_152529chr23771 568 114 ------
NM_152556chr722540 1649 12493 ----
NM_152557chr71121 ------
NM_152581chrX31428 1356 365 ------
NM_152588chr122464 345 ------
NM_152609chr121049 386 ------
NM_152622chr533476 1391 1349 13411 --1932
NM_152624chr557068 6005 5228 2080 234 ------
NM_152629chr943197 905 552 188 --23454 45 --
NM_152660chr12912 43 ------
NM_152676chr18124 ------
NM_152688chr61284 1395 ----
NM_152692chrX------151
NM_152716chr1131482 549 147 ------
NM_152736chr6----1875 --
NM_152737chr621545 387 ------
NM_152758chr832296 943 403 ------
NM_152787chrX23495 3173 ----13032
NM_152789chr7----21189 175 --
NM_152793chr734947 3454 230 15063 35075 4978 4470 --
NM_152835chr112726 12588 ----
NM_152838chr202819 571 13004 --13458
NM_152890chr11812 --2516 503 --
NM_152896chr9123 --1620 --
NM_152914chr1734347 3511 3264 ------
NM_152924chr1524257 277 ----32355 2256 1497
NM_152991chr111630 --1570 --
NM_153029chr1633975 1530 544 --21153 382 --
NM_153050chr2244248 3863 3438 243 24738 283 24612 699 --
NM_153051chr2244248 3863 3438 243 24738 283 24612 699 --
NM_153181chr181201 ------
NM_153188chr575114 4765 4450 4346 1978 988 973 --1172 --
NM_153207chr1232835 1062 673 1540 32586 2519 2477 --
NM_153226chr101225 ------
NM_153235chr611670 11788 --1173
NM_153251chr13--1253 ----
NM_153260chr15183 ----1402
NM_153262chr133209 2678 2587 ------
NM_153321chr171145 ------
NM_153322chr171145 ------
NM_153333chrX1230 ------
NM_153367chr1043082 3069 1599 1008 ----13756
NM_153456chr1376350 5271 4806 4546 4257 1215 562 --12204 --
NM_153499chr1252780 1174 516 247 27 ------
NM_153500chr1252780 1174 516 247 27 ------
NM_153616chr1541809 564 63 46 ------
NM_153617chr1541809 564 63 46 ------
NM_153618chr1541809 564 63 46 ------
NM_153619chr1543047 2440 1301 1284 --12432 --
NM_153631chr72206 63 ------
NM_153632chr72206 63 ------
NM_153633chr12----1236 --
NM_153649chr12305 271 --11432 --
NM_153690chr33824 731 205 ------
NM_153702chr4162 ------
NM_153715chr71208 ------
NM_153748chr122911 39 ------
NM_153810chr1054642 4246 3130 1211 190 21713 1554 --1641
NM_153828chr23815 297 149 ------
NM_170587chr81222 ----1268
NM_170679chr5----11334 --
NM_170692chr121054 371 ----195
NM_170706chr111489 --11267 14334
NM_170725chr11165 ------
NM_170731chr1142555 2267 673 239 1257 22649 250 1507
NM_170732chr1142555 2267 673 239 1257 22649 250 1507
NM_170733chr1142555 2267 673 239 1257 22649 250 1507
NM_170734chr1142555 2267 673 239 1257 22649 250 1507
NM_170735chr1142555 2267 673 239 1257 22649 250 1507
NM_170750chrX1179 --1188 --
NM_171998chrX12475 ------
NM_172037chr821043 106 ----1205
NM_172058chr81125 --11649 --
NM_172059chr81125 --11649 --
NM_172060chr81125 --11649 --
NM_172071chr165895 4828 4550 1849 1297 1152 --57344 7212 5035 2231 1080 --
NM_172103chr632142 651 248 --12115 --
NM_172105chr632142 651 248 --12115 --
NM_172159chr3----1673 --
NM_172160chr3----1673 --
NM_172216chr1242682 1076 418 149 ------
NM_172226chr1252780 1174 516 247 27 ------
NM_172231chr19--192 ----
NM_172373chr13--1261 --1938
NM_172387chr1811267 ------
NM_173054chr71240 --147 --
NM_173075chr421685 94 11388 ----
NM_173079chr1711829 ------
NM_173082chr61496 ------
NM_173171chr23925 368 309 --1979 1182
NM_173172chr221233 617 --11287 1490
NM_173173chr23925 368 309 --1979 1182
NM_173214chr1646103 3127 2410 168 17877 ----
NM_173355chr211025 ------
NM_173359chr31493 ------
NM_173468chr434652 4619 486 ------
NM_173469chr1511352 --136 --
NM_173470chrX22846 2839 --11068 --
NM_173475chr161246 ----11191
NM_173494chrX2694 636 ------
NM_173495chrX1659 --21995 359 12274
NM_173496chr101245 --12203 --
NM_173500chr1521322 336 ----1468
NM_173508chr1--11122 ----
NM_173510chr22--127 1655 1500
NM_173511chr232480 1060 24 --43940 1438 1193 1064 --
NM_173514chr5191 --1643 --
NM_173546chr31636 ------
NM_173552chr322020 758 21678 529 ----
NM_173557chr182603 127 1501 ----
NM_173560chr61512 ------
NM_173563chr62225 122 ------
NM_173576chr1022239 144 ------
NM_173582chr1156052 3914 3809 2304 1973 ----14243
NM_173591chr12------1895
NM_173602chr1243431 674 281 263 11205 23441 3161 --
NM_173609chr152664 112 ------
NM_173631chr1911186 --11190 --
NM_173644chr2011845 --1274 --
NM_173654chr332033 451 148 --1455 --
NM_173694chrX11744 --22513 1748 --
NM_173797chr5189 ----1412
NM_173798chrX1482 ------
NM_173808chr113667 --33908 2747 1719 --
NM_173814chr151469 ------
NM_173825chr342594 2203 723 451 ----1259
NM_173829chr535108 1305 530 ------
NM_173848chr8----1841 --
NM_173851chr834008 3007 1512 --13594 21517 787
NM_174856chr201130 ------
NM_174890chr10163 ------
NM_174902chr1131634 1463 201 ----152
NM_174911chr843673 2864 840 379 --11277 --
NM_174916chr15----1955 --
NM_175061chr731383 298 45 ------
NM_175607chr351169 1077 629 517 90 ------
NM_175610chr151474 ------
NM_175612chr351169 1077 629 517 90 ------
NM_175613chr3190 ------
NM_175623chr1237160 4793 4664 1239 ----
NM_175634chr811312 ------
NM_175635chr811312 ------
NM_175636chr811312 ------
NM_175709chr2222205 210 12742 ----
NM_175736chr1225778 5290 --199 --
NM_175748chr1422064 1951 --1367 --
NM_175852chr122638 1091 --13087 --
NM_175856chr52146 60 --1120 --
NM_175859chrX21752 360 --11551 --
NM_175863chr62318 252 ------
NM_175866chr111456 --2400 263 --
NM_175884chr741198 501 154 143 ------
NM_176812chr201145 --1702 --
NM_176814chr7------1234
NM_177398chr121794 132 ------
NM_177399chr121794 132 ------
NM_177424chr132000 1405 833 12072 ----
NM_177438chr1421142 555 --32590 996 505 --
NM_177452chr14----12088 --
NM_177454chr22338 57 --2353 273 --
NM_177559chr201121 ------
NM_177560chr201121 ------
NM_177947chrX----1210 --
NM_177948chrX----1210 --
NM_177952chr142261 234 ------
NM_177969chr21499 ------
NM_177974chr15179 ------
NM_177983chr21356 ------
NM_177990chr2011521 11561 11314 --
NM_178011chr1013192 129 1717 --
NM_178026chr20----1605 --
NM_178120chr231194 1165 1149 --1886 --
NM_178123chr21358 ----150
NM_178140chr5------12715
NM_178151chrX47709 7016 4811 116 --1538 --
NM_178152chrX47709 7016 4811 116 --1538 --
NM_178153chrX47709 7016 4811 116 --1538 --
NM_178154chr141543 ------
NM_178155chr141543 ------
NM_178156chr141543 ------
NM_178157chr141543 ------
NM_178161chr101248 1318 ----
NM_178232chr15------1589
NM_178424chr51634 1480 --1417
NM_178498chr1122501 1346 1103 ----
NM_178544chr191245 ----11648
NM_178548chr11630 --1602 --
NM_178554chr353623 3611 3223 434 314 23246 1284 23615 321 --
NM_178565chr831717 1581 469 ------
NM_178585chr442946 1086 795 648 ------
NM_178812chr81359 11437 --11400
NM_178832chr10154 ------
NM_180989chr1331917 1659 224 ------
NM_181054chr14--11194 ----
NM_181291chr141646 ------
NM_181332chrX12328 ------
NM_181349chr731959 293 126 --32434 2078 861 --
NM_181354chr821327 567 ------
NM_181358chr132916 2671 188 ----13781
NM_181361chr321075 903 1353 ----
NM_181442chr202977 866 ------
NM_181458chr231449 1423 996 ------
NM_181459chr221215 1189 1411 ----
NM_181460chr231262 1236 809 1458 ----
NM_181481chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_181482chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_181483chr18126384 6351 5522 5430 4957 4924 2588 1924 778 560 504 81 25350 2097 56996 6060 4345 1310 644 26637 6451
NM_181489chr345271 2454 2307 1376 16371 12626 1625
NM_181492chr2211103 ----1928
NM_181504chr544167 3180 1381 1196 --3906 890 459 --
NM_181523chr544167 3180 1381 1196 --3906 890 459 --
NM_181524chr544167 3180 1381 1196 --3906 890 459 --
NM_181571chr10141 ------
NM_181642chr151442 ------
NM_181659chr201530 --13323 --
NM_181659chr201530 --13323 --
NM_181672chrX1105 11720 12063 --
NM_181673chrX1105 11720 12063 --
NM_181674chr51341 ------
NM_181675chr51341 ------
NM_181676chr51341 ------
NM_181677chr51341 ------
NM_181678chr51341 ------
NM_181723chr841738 768 644 612 ------
NM_181762chrX2250 112 ------
NM_181777chrX2250 112 ------
NM_181787chr851416 1390 1352 931 780 --13682 --
NM_181794chr61142 ------
NM_181795chr61142 ------
NM_181807chr111307 ------
NM_181836chr552186 2047 1792 1684 973 ------
NM_181838chr51152 ------
NM_181861chr122260 103 --11075 1612
NM_181864chr1----2219 117 --
NM_181865chr1----2219 117 --
NM_181866chr1----2219 117 --
NM_181868chr122260 103 --11075 1612
NM_181869chr122345 188 --11160 1697
NM_181886chr41236 21289 391 ----
NM_181887chr41236 21289 391 ----
NM_181888chr41236 21289 391 ----
NM_181889chr41236 21289 391 ----
NM_181890chr41236 21289 391 ----
NM_181891chr41236 21289 391 ----
NM_181892chr41283 21336 438 ----
NM_181893chr41236 21289 391 ----
NM_182481chr2121245 1165 ------
NM_182482chr2121245 1165 ------
NM_182485chr443659 2933 2843 1436 ----1460
NM_182487chr914402 11698 33493 3343 3179 --
NM_182488chr131777 ------
NM_182493chr1615350 --21907 1757 34809 4426 826
NM_182526chr1432343 2201 74 --22639 2027 --
NM_182641chr1731955 404 48 --1690 11579
NM_182646chr443659 2933 2843 1436 ----1460
NM_182663chr132289 533 293 --12201 1775
NM_182664chr132419 663 423 --12331 1905
NM_182665chr132289 533 293 --12201 1775
NM_182666chr34646 624 279 149 ------
NM_182678chr21417 ------
NM_182691chr751427 1391 575 267 140 ------
NM_182692chr751427 1391 575 267 140 ------
NM_182697chr721421 637 --11451 --
NM_182715chr711142 1928 11209 155
NM_182717chr102446 147 ------
NM_182718chr10141 ------
NM_182719chr10141 ------
NM_182720chr102446 147 ------
NM_182721chr102446 147 ------
NM_182722chr102446 147 ------
NM_182723chr102446 147 ------
NM_182724chr10141 ------
NM_182725chr10141 ------
NM_182729chr1221670 479 1348 --124
NM_182742chr1221670 479 1348 --124
NM_182743chr1221670 479 1348 --124
NM_182752chr121483 398 11502 ----
NM_182765chr1031973 733 536 ------
NM_182767chr1211299 ------
NM_182769chr10141 ------
NM_182770chr10141 ------
NM_182771chr10141 ------
NM_182772chr10141 ------
NM_182796chr5----2864 686 --
NM_182797chr2011370 ------
NM_182798chr51324 ------
NM_182799chr51324 ------
NM_182801chr51324 ------
NM_182848chr1321277 188 ------
NM_182850chr10141 ------
NM_182853chr102446 147 ------
NM_182898chr746447 5630 5357 2306 --56049 5205 5123 1543 152 --
NM_182899chr746447 5630 5357 2306 --56049 5205 5123 1543 152 --
NM_182918chr2121449 1423 ------
NM_182948chr153060 2982 2027 414 248 --1387 --
NM_182964chr1152863 2838 2530 1036 226 --1254 --
NM_182970chr2053814 3456 3083 1672 924 13207 1760 --
NM_182972chr132353 1942 889 --2899 893 1491
NM_182975chr111187 ------
NM_182978chr181689 --1693 1181
NM_183004chr1432985 2742 1034 13967 ----
NM_183011chr102446 147 ------
NM_183012chr102446 147 ------
NM_183013chr102446 147 ------
NM_183060chr10141 ------
NM_183078chr632955 388 211 --1842 --
NM_183228chr171677 ------
NM_183229chr171677 ------
NM_183230chr171677 ------
NM_183231chr171677 ------
NM_183232chr171677 ------
NM_183397chr2045040 4571 3755 3707 ------
NM_183416chr121734 1497 ------
NM_194247chr254473 3450 1375 1258 282 154 11638 --
NM_194250chr21307 ------
NM_194259chr16184 --1528 --
NM_194260chr16184 --1528 --
NM_194261chr16184 --1528 --
NM_194271chr12----1514 --
NM_194285chr1133061 2205 351 ----1458
NM_194298chr1031800 1678 624 --31960 1519 1265 --
NM_194301chr141837 ------
NM_194314chr175543 4142 4055 3933 3926 3734 1315 --24021 533 --
NM_194317chr242242 2203 2097 1945 --32436 1761 163 --
NM_194328chr942415 1231 827 623 --1290 --
NM_194329chr942415 1231 827 623 --1290 --
NM_194330chr942415 1231 827 623 --1290 --
NM_194332chr942415 1231 827 623 --1290 --
NM_194434chr1834421 2288 1486 --24324 365 24197 4151
NM_194449chr181334 1367 ----
NM_194452chr11------11238
NM_194453chr11------11238
NM_194454chr711354 ------
NM_194455chr711354 ------
NM_194456chr711354 ------
NM_194463chrX----1312 --
NM_197941chr5----12867 --
NM_198056chr32837 306 --12175 --
NM_198128chr182607 259 --1309 --
NM_198173chr11612 ------
NM_198174chr11612 ------
NM_198195chr3------195
NM_198212chr722306 651 --1608 --
NM_198217chr131744 ------
NM_198218chr131744 ------
NM_198219chr131744 ------
NM_198225chr1051997 1921 694 499 364 ------
NM_198268chr132916 2671 188 ----13781
NM_198269chr132916 2671 188 ----13781
NM_198270chrX43033 2984 2930 800 ------
NM_198273chr5----22943 2375 --
NM_198279chrX11033 --11037 --
NM_198329chr321197 348 --11387 --
NM_198353chr42160 113 --1531 --
NM_198390chr1621686 520 --11872 --
NM_198391chr20------11251
NM_198395chr51797 ------
NM_198399chr321755 306 ------
NM_198465chrX1715 ------
NM_198484chr356175 5928 1239 998 558 14797 26191 779 11410
NM_198504chr3155 ----160
NM_198513chr81398 1557 ----
NM_198569chr632731 2533 2441 1190 --12187
NM_198570chr7------1351
NM_198576chr1----159 --
NM_198581chr257501 7129 4839 1723 299 16332 47093 5503 4876 1626 --
NM_198793chr374072 3567 3216 1078 1067 241 211 2613 124 --13708
NM_198794chr14----11198 --
NM_198829chr721140 344 2490 313 ----
NM_198859chr311051 24123 280 ----
NM_198900chr1225778 5290 --199 --
NM_198935chr2032823 2379 416 1430 ----
NM_199000chr712225 --11784 --
NM_199044chr121049 903 ------
NM_199169chr2063577 3386 3291 2723 2568 2505 12797 ----
NM_199170chr2063577 3386 3291 2723 2568 2505 12797 ----
NM_199171chr2063577 3386 3291 2723 2568 2505 12797 ----
NM_199185chr5----1127 --
NM_199188chr1243040 3033 1438 523 --13234 23991 568
NM_199190chr1243040 3033 1438 523 --13234 23991 568
NM_199262chr1731984 1593 938 --22135 583 --
NM_199320chr432637 2578 494 --11839 --
NM_199320chr432637 2578 494 --11839 --
NM_199324chr442884 2656 1201 640 --1524 --
NM_199327chr4------2769 127
NM_199421chr141507 --21530 899 13596
NM_199427chr201435 --2518 52 --
NM_199436chr272626 2559 2385 801 608 323 197 --1441 --
NM_199478chrX21602 1587 ----1739
NM_199482chr2----11776 --
NM_201266chr232784 2052 625 --1629 --
NM_201279chr232784 2052 625 --1629 --
NM_201437chr831540 1334 1213 ------
NM_201567chr321521 1273 ------
NM_201570chr1011421 --1138 1290
NM_201571chr1011421 --1138 1290
NM_201572chr1011421 --1138 1290
NM_201590chr1011421 --1138 1290
NM_201591chr43728 687 152 ------
NM_201592chr43728 687 152 ------
NM_201593chr1011421 --1138 1290
NM_201596chr1011421 --1138 1290
NM_201597chr1011421 --1138 1290
NM_201599chrX11219 ----11237
NM_201999chr411065 ------
NM_203301chr1431706 1302 267 ------
NM_203303chrX----1215 --
NM_203304chr19------1616
NM_203327chr2064536 3903 2820 1312 1095 1063 34201 1396 1348 1509 --
NM_203329chr1145791 4751 1933 1916 --14850 1451
NM_203330chr1145791 4751 1933 1916 --14850 1451
NM_203331chr1145791 4751 1933 1916 --14850 1451
NM_203350chr12706 480 ------
NM_203351chr1732497 713 76 --12130 --
NM_203372chr211290 --1505 --
NM_203403chr9----2378 149 --
NM_203434chr911085 21160 435 ----
NM_203437chr2----1251 --
NM_203446chr2132733 2510 164 --1689 --
NM_203459chr12736 668 --1360 1129
NM_203463chr234830 3560 3509 13987 --13282
NM_203487chr1361187 1137 663 651 619 592 ------
NM_205768chr1----11664 --
NM_205842chr21597 --2601 41 --
NM_205846chr51330 ------
NM_205848chr122766 199 --12587 --
NM_205860chr122971 2687 --22500 839 --
NM_206594chr143179 2310 2289 1160 12705 ----
NM_206595chr143179 2310 2289 1160 12705 ----
NM_206839chr151478 ------
NM_206852chr141590 ----1246
NM_206853chr614123 --24061 1116 --
NM_206854chr635384 507 457 --15322 --
NM_206855chr656349 1472 1422 671 217 --26287 4179 --
NM_206857chr141590 ----1246
NM_206866chr2112113 --2946 85 --
NM_206876chr221135 956 --23079 362 --
NM_206907chr543046 2612 2342 196 --1697 --
NM_206909chr8118299 8161 6186 5759 5170 2899 2511 1778 1068 564 523 --12700 --
NM_206927chr111827 ------
NM_206928chr111827 ------
NM_206929chr111827 ------
NM_206930chr111827 ------
NM_206943chr21297 ------
NM_207009chr101395 ------
NM_207012chr1023460 1011 --12168 --
NM_207043chr121968 748 --1656 --
NM_207044chr121968 748 --1656 --
NM_207047chr121968 748 --1656 --
NM_207171chr111975 ------
NM_207292chr343286 3189 736 647 --22622 198 12103
NM_207293chr343286 3189 736 647 --22622 198 12103
NM_207294chr343286 3189 736 647 --22622 198 12103
NM_207295chr343286 3189 736 647 --22622 198 12103
NM_207296chr343286 3189 736 647 --22622 198 12103
NM_207297chr343311 3214 761 672 --22647 223 12128
NM_207299chr92375 71 ------
NM_207306chr11263 --21786 176 --
NM_207325chr1921633 266 21376 514 --21916 149
NM_207359chr311878 --11779 1194
NM_207371chr1021527 50 ------
NM_207372chr1022397 2238 --21616 880 --
NM_207406chr476137 5871 5424 1958 602 435 21 --24034 4020 --
NM_207422chrX21461 278 --11073 --
NM_207491chr411114 ------
NM_207518chr1921377 518 ------
NM_207520chr23815 297 149 ------
NM_207521chr23815 297 149 ------
NM_207577chr1132752 1171 236 --22486 2156 --
NM_207647chr952420 2078 2056 1924 1875 --2784 699 12150
NM_212460chr7----1153 1776
NM_212471chr172600 139 ------
NM_212472chr172600 139 ------
NM_212474chr21988 1839 ----
NM_212475chr21988 1839 ----
NM_212476chr21988 1839 ----
NM_212478chr21988 1839 ----
NM_212482chr21988 1839 ----
NM_213589chr224710 423 --24096 318 15291
NM_213590chr1375272 4957 4796 4306 3525 3491 1313 --12107 --
NM_213662chr1742331 2235 440 394 ------