TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-196a-5p
miRNA Sequence: UAGGUAGUUUCAUGUUGUUGGG

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1451 --
NM_000016chr11585 ------
NM_000021chr143671 362 244 ------
NM_000037chr82877 236 --22410 807 --
NM_000038chr552070 1854 1807 1499 689 --12003 --
NM_000044chrX3342 79 60 ------
NM_000052chrX42743 1115 748 65 11089 1967 13475
NM_000053chr1352035 1547 573 463 200 ------
NM_000055chr31344 1161 ----
NM_000061chrX129 ------
NM_000068chr1921521 443 --11339 --
NM_000074chrX2896 793 ----191
NM_000081chr131853 746 417 11235 21868 1294 --
NM_000084chrX116195 6161 5375 5360 5218 4811 4215 2394 2142 1708 1437 16764 ----
NM_000089chr71117 ------
NM_000092chr243574 3253 735 577 --24017 1183 --
NM_000103chr1521130 1111 --21282 350 --
NM_000108chr731677 1566 1451 1228 1763 --
NM_000109chrX52094 1939 1805 823 615 ------
NM_000111chr7----1285 --
NM_000125chr643746 1346 687 336 11148 ----
NM_000127chr81108 ------
NM_000134chr42575 426 --11420 --
NM_000138chr155842 343 221 168 145 ------
NM_000161chr1461476 1345 613 261 187 42 --11848 --
NM_000163chr512091 --12195 --
NM_000165chr61674 11304 ----
NM_000168chr733296 2702 859 --1778 --
NM_000176chr533859 918 65 13774 ----
NM_000202chrX83602 3312 2752 2689 2657 2573 570 86 ------
NM_000208chr1964373 4324 3261 3156 1336 1104 11321 ----
NM_000210chr221527 408 --12080 --
NM_000212chr173845 598 538 --1340 --
NM_000217chr1234272 3344 1269 --24582 4440 13284
NM_000223chr171429 ------
NM_000232chr493130 2789 2527 2398 2372 1145 597 416 286 33004 1131 977 1669 --
NM_000233chr24784 640 605 167 2652 139 159 --
NM_000248chr342659 2379 2341 69 --1489 --
NM_000252chrX31129 482 447 ------
NM_000253chr42177 104 ------
NM_000259chr1576036 5358 4902 4027 2508 2229 963 15483 11314 11345
NM_000264chr913106 ------
NM_000267chr1773376 2649 2350 371 334 211 185 ------
NM_000276chrX21809 789 1860 21850 378 --
NM_000284chrX31841 1528 39 1524 ----
NM_000314chr1043013 2912 1041 105 12105 ----
NM_000321chr1341220 672 664 476 1448 21313 342 --
NM_000332chr6146758 6695 6669 6484 5620 5003 4427 2319 1147 934 712 448 438 285 11655 21376 1111 --
NM_000333chr341034 955 412 269 ------
NM_000337chr586579 6125 5810 5272 1296 695 610 602 21460 797 14837 16343
NM_000345chr43843 761 285 ------
NM_000346chr1781960 1609 1503 734 544 474 364 219 ------
NM_000362chr22113174 3120 3024 2904 1368 921 828 775 749 330 171 13212 11288 --
NM_000367chr651823 1514 481 455 295 ------
NM_000368chr984169 3792 3759 3123 1694 1416 1079 228 --23052 725 --
NM_000380chr91479 ------
NM_000390chrX63181 3171 3048 2076 1261 61 ------
NM_000391chr1181661 1608 1492 1340 1259 647 514 205 ------
NM_000393chr222151 1727 11717 11761 --
NM_000399chr1051038 321 213 141 80 1968 ----
NM_000408chr253387 2597 2294 542 107 1483 --11352
NM_000421chr17195 ------
NM_000430chr1732942 1124 360 ------
NM_000449chr141310 991 229 165 1148 ----
NM_000451chrX41949 1376 1340 448 --11765 --
NM_000459chr92873 347 ------
NM_000461chr364532 3264 1678 1466 1309 39 11525 31476 1188 768 --
NM_000462chr1531757 464 404 ------
NM_000480chr1151518 1393 463 418 280 11318 ----
NM_000484chr214760 368 197 54 ------
NM_000488chr1----172 --
NM_000489chrX43301 2956 1034 605 --33263 3009 2558 --
NM_000495chrX194 ------
NM_000503chr841622 1540 611 145 1477 ----
NM_000525chr1131530 1028 422 --11427 --
NM_000531chrX------1342
NM_000533chrX41242 776 626 482 1545 ----
NM_000544chr6_cox_hap183130 2939 2864 2461 1357 1184 594 403 --12979 --
NM_000555chrX107475 5498 5291 5024 4820 2761 2328 1858 1111 840 ------
NM_000572chr11781 --1135 --
NM_000575chr23912 411 276 --1862 --
NM_000586chr4--195 ----
NM_000596chr71473 --1115 --
NM_000599chr243255 3130 1153 619 1125 ----
NM_000600chr71320 ------
NM_000601chr71109 ------
NM_000612chr1153585 3483 3167 2938 618 --13438 --
NM_000618chr12106355 5854 5403 5202 5079 4149 2567 2155 293 67 26104 1313 25809 5659 --
NM_000618chr12106355 5854 5403 5202 5079 4149 2567 2155 293 67 26104 1313 25809 5659 --
NM_000633chr1865039 4588 3394 988 728 208 11971 ----
NM_000684chr1041293 1244 1055 455 ------
NM_000702chr1--11646 --12225
NM_000719chr1266262 5938 5565 4453 4174 1746 ------
NM_000720chr31423 ------
NM_000723chr1751632 1401 1277 482 202 ------
NM_000726chr221327 408 ------
NM_000767chr1961419 1180 1116 370 331 93 ------
NM_000788chr441359 1171 1049 558 ------
NM_000800chr551365 1197 1071 653 379 11630 ----
NM_000801chr20--1218 ----
NM_000808chrX2778 227 --1729 1762
NM_000810chr15----199 --
NM_000811chr51555 ------
NM_000814chr1573992 3783 3316 3089 1236 643 60 --23838 1114 --
NM_000820chr131256 ------
NM_000826chr42927 405 ------
NM_000827chr541985 1846 1695 625 ------
NM_000829chr1142274 2235 2137 2050 ------
NM_000831chr1105898 5780 5524 5263 5109 5028 2286 1258 145 116 24027 3861 ----
NM_000838chr631682 1012 155 --12752 --
NM_000839chr31105 --1473 --
NM_000842chr112597 152 1711 ----
NM_000861chr352299 2233 2185 1820 634 11771 ----
NM_000865chr61195 ------
NM_000868chrX32112 1792 1735 --12499 --
NM_000875chr1596666 6021 4504 2624 2475 855 718 501 124 1582 ----
NM_000880chr82811 60 ------
NM_000885chr221749 855 1756 --1352
NM_000891chr1773479 3289 2827 2596 785 523 372 ----1706
NM_000901chr421975 536 --31952 1770 865 --
NM_000902chr352894 2665 2473 695 436 12101 ----
NM_000933chr201496 ------
NM_000944chr462163 1690 1515 758 642 154 21875 927 --11982
NM_000945chr251768 1480 785 720 586 --1655 --
NM_000949chr52875 100 --1852 --
NM_000950chrX73341 3134 3037 2876 2378 1163 514 1350 ----
NM_000965chr331269 1055 438 2453 178 ----
NM_000977chr161376 ------
NM_000990chr1173726 3191 2971 2720 2502 1485 540 12983 138 --
NM_001001132chr215423 178 168 70 57 --1132 --
NM_001001323chr1242488 1233 901 238 --12355 11070
NM_001001330chr102373 183 ------
NM_001001394chr2----1579 --
NM_001001395chr1222528 2261 12688 --1583
NM_001001481chr822607 1195 --23145 121 1925
NM_001001484chr103859 690 527 2583 93 1320 --
NM_001001485chr3130 1153 1415 --
NM_001001556chr15------132
NM_001001557chr842099 873 763 185 1618 ----
NM_001001664chr263921 3673 2852 507 457 413 ----14144
NM_001001701chr441882 1873 1491 623 --21846 1759 --
NM_001001890chr2183682 3651 3206 3109 2835 1557 1520 737 --12771 --
NM_001001928chr2288009 7626 7480 6683 6198 5652 5085 1673 27614 5787 ----
NM_001001933chr1----1403 --
NM_001001971chr1011316 11248 1507 --
NM_001001974chr1052091 864 833 429 24 --1114 --
NM_001002255chr61105 ------
NM_001002257chr253368 3279 1036 389 109 11418 --12407
NM_001002258chr221922 1271 ----11374
NM_001002762chr1052336 1123 1030 1009 49 12137 1464 --
NM_001002814chr853940 3659 3176 649 398 13779 ----
NM_001002838chrX71878 1759 1672 697 520 385 303 21717 1593 ----
NM_001002843chr151131 --1376 --
NM_001002906chrY1397 ------
NM_001002909chr1782107 1921 1904 1837 1814 1616 264 180 ------
NM_001002919chr2----174 --
NM_001003407chr1075041 4223 3516 3486 1926 1662 102 11873 1258 --
NM_001003408chr1075041 4223 3516 3486 1926 1662 102 11873 1258 --
NM_001003652chr18148650 8635 7483 7300 7154 5622 3252 3214 2412 2370 1828 1344 552 90 13490 --12273
NM_001003674chr1886931 6922 5465 4774 4572 4528 2519 1957 --22689 589 --
NM_001003675chr1886931 6922 5465 4774 4572 4528 2519 1957 --22689 589 --
NM_001003681chr222413 279 --1174 --
NM_001003682chr12575 482 --11058 --
NM_001003698chr621360 1302 11966 --1232
NM_001003699chr621360 1302 11966 --1232
NM_001003712chr1273872 3832 3436 3359 1549 498 306 12958 12932 --
NM_001003792chr31435 ------
NM_001003793chr31435 ------
NM_001003800chr933396 1274 1136 --13509 12506
NM_001003940chr15103739 3577 3245 3154 2943 2516 1454 1233 1170 761 ------
NM_001003942chr15103739 3577 3245 3154 2943 2516 1454 1233 1170 761 ------
NM_001003943chr15103743 3581 3249 3158 2947 2520 1458 1237 1174 765 ------
NM_001004023chr1------1174
NM_001004196chr35494 347 200 153 42 ------
NM_001004317chr673418 1635 967 669 488 109 49 --24281 4097 --
NM_001004323chr7144 ------
NM_001004329chr1231287 1109 398 ------
NM_001004342chr1136114 5017 4929 4798 4616 4190 2345 2208 1989 1841 1704 1610 805 15030 26050 1650 --
NM_001004354chr92989 780 --170 --
NM_001004419chr1263753 3695 3551 3262 1780 551 1564 3635 264 240 --
NM_001005207chr17--1226 ----
NM_001005353chr11181 1492 ----
NM_001005353chr11181 1492 ----
NM_001005366chr121899 ------
NM_001005375chrY1550 1105 --11835
NM_001005386chr231654 702 691 12231 ----
NM_001005404chr1754211 4068 2796 964 331 --14284 --
NM_001005463chr101189 ------
NM_001005473chr576300 6231 5970 5459 5421 4685 219 15440 35413 4940 64 --
NM_001005609chrX93557 3539 3000 2477 2426 2383 1131 918 850 ------
NM_001005611chrX2488 210 ------
NM_001005746chr221327 408 ------
NM_001005747chr221327 408 ------
NM_001005781chr2--1592 ----
NM_001005782chr21211 11041 ----
NM_001005849chr171102 ------
NM_001006118chrY2242 84 ------
NM_001006120chrY2242 84 ------
NM_001006600chr522096 375 --22146 441 --
NM_001006612chrX--191 ----
NM_001006613chrX--191 ----
NM_001006614chrX--191 ----
NM_001006618chr91221 ------
NM_001006623chr272032 1969 1962 1597 241 136 127 12039 ----
NM_001006636chr22778 76 ------
NM_001006684chrX----1586 --
NM_001006946chr221826 191 11208 21291 767 --
NM_001007024chr1783860 3841 3259 1511 1313 730 553 540 11726 1606 --
NM_001007025chr1783860 3841 3259 1511 1313 730 553 540 11726 1606 --
NM_001007027chr11162 ------
NM_001007098chr16824 246 158 127 106 85 --1240 --
NM_001007237chr142781 2149 1931 716 --1165 --
NM_001007246chr2131769 1740 1269 ------
NM_001007257chr121036 973 ------
NM_001007269chr191220 ------
NM_001007270chr191220 ------
NM_001007277chr113940 57 31 ------
NM_001007466chr654773 4460 3138 1600 424 --34171 1663 284 11462
NM_001007471chr9--1548 ----
NM_001007526chrY2242 84 ------
NM_001007794chr12517 152 ------
NM_001008215chr21324 1849 ----
NM_001008220chr552761 2721 2694 742 319 --140 --
NM_001008225chr71149 ----1691
NM_001008239chr1873127 2873 1437 1014 639 562 296 --32423 1189 404 13381
NM_001008388chr42116 71 ------
NM_001008392chr363325 2570 1001 839 140 63 ------
NM_001008405chr711164 --1623 --
NM_001008408chr7116224 4696 4319 4076 4062 3956 2198 1794 1720 1343 1269 ------
NM_001008495chr832237 616 365 144 ----
NM_001008541chr1052250 2238 2060 1677 1494 ------
NM_001008541chr1052250 2238 2060 1677 1494 ------
NM_001008566chr221187 1453 1323 --
NM_001008660chr1121544 351 ----11576
NM_001008707chr1441882 1636 134 58 1675 ----
NM_001008711chr8130 --11462 --
NM_001008738chr552804 2460 2201 2048 1913 --22405 772 --
NM_001008777chr172228 62 --1481 --
NM_001008783chr61905 1227 ----
NM_001008801chr1931681 1571 1436 ------
NM_001009554chr453926 1252 910 773 149 13555 ----
NM_001009554chr453926 1252 910 773 149 13555 ----
NM_001009555chr461775 1697 491 412 61 49 ------
NM_001009899chr386218 5235 5009 4835 2059 1830 1573 1439 1462 16111 --
NM_001009955chr11155 ------
NM_001009955chr11155 ------
NM_001009958chr72407 183 1559 178 --
NM_001009993chr223080 333 1798 1219 --
NM_001010000chr1831412 1083 613 --12804 --
NM_001010853chr683223 3030 2971 2791 754 619 593 114 --21041 156 --
NM_001010861chr132415 878 145 12499 ----
NM_001010867chr1126170 5870 5249 4882 4706 2600 2092 2066 1727 713 359 154 14870 ----
NM_001010888chrX94099 4010 3322 3262 2961 1394 1250 1223 369 --24571 475 --
NM_001010891chr5106735 6687 6420 5934 5714 5192 2746 2583 2283 861 --21188 270 --
NM_001010898chr193316 3043 3037 2452 1082 846 709 511 133 --11314 --
NM_001010908chr103699 213 136 ------
NM_001010922chr194005 3875 3435 3255 2719 1154 965 595 244 13379 23765 3353 --
NM_001010923chr641576 1233 1091 294 ------
NM_001010927chr6------1508
NM_001010932chr71109 ------
NM_001010934chr74927 889 407 305 1270 1225 --
NM_001010942chr121428 --11162 --
NM_001010986chrX--32248 2215 2137 1348 --
NM_001010989chr16----1419 --
NM_001010990chr16----1419 --
NM_001011537chr3--11898 ----
NM_001011553chr7--1860 ----
NM_001011645chrX3342 79 60 ------
NM_001011663chr1021015 90 1119 ----
NM_001011666chr7106028 5621 4442 4155 4123 1623 1569 1563 1323 1204 11035 ----
NM_001011708chr212802 22829 2312 12901 --
NM_001011713chr1451500 1433 630 115 26 ------
NM_001012264chr143704 665 178 ------
NM_001012393chr1174325 1951 1531 972 965 546 264 1808 15107 13966
NM_001012398chr1631121 736 116 1915 181 1336
NM_001012426chr653443 2652 2604 2160 2078 --1275 --
NM_001012427chr653443 2652 2604 2160 2078 --1275 --
NM_001012732chr4----11173 --
NM_001012751chr1051581 1573 1491 526 143 11193 ----
NM_001012755chrX64485 4442 3401 1294 521 144 --24752 480 --
NM_001012756chr1942447 2421 2205 1080 ----1265
NM_001012977chrX2451 279 --11336 --
NM_001012980chrX150 ------
NM_001013031chr1083502 2977 2533 1324 1099 1080 947 391 12786 23491 3198 --
NM_001013438chr32861 746 ------
NM_001013439chr32707 592 ------
NM_001013620chr1287870 7073 6415 5979 3071 2935 1598 998 11516 37270 1253 1038 --
NM_001013635chr122938 400 1367 2890 23 --
NM_001013690chr1272496 2421 2244 2222 1571 576 342 --11803 --
NM_001013693chr1102555 2092 1979 1827 902 785 750 615 392 231 ------
NM_001013693chr1102555 2092 1979 1827 902 785 750 615 392 231 ------
NM_001013843chr15------169
NM_001014283chr1341857 1433 735 542 ------
NM_001014286chr13171 ------
NM_001014380chr13105835 5820 5148 4944 4890 2357 2331 845 577 551 1383 13682 --
NM_001014443chr1167 ------
NM_001014797chr1077523 7509 5816 2785 1768 1338 285 37864 6289 2846 --11962
NM_001015877chrX82398 2010 1218 1209 1147 1018 107 53 --12041 1137
NM_001015880chr1031543 1159 508 --21547 45 --
NM_001015881chrX--148 ----
NM_001017369chr41166 1172 1142 --
NM_001017371chr221343 905 ------
NM_001017395chr353464 3278 2484 2451 395 32413 1407 74 12327 --
NM_001017424chr111495 2457 372 ----
NM_001017425chr111495 2457 372 ----
NM_001017440chr7168166 7967 7211 6483 6269 5113 2347 1937 1925 1912 1482 1367 1263 1068 1057 632 --31637 1471 616 16528
NM_001017923chr1431695 1225 442 11610 21662 619 --
NM_001017926chr821451 174 ------
NM_001017969chr91266 ------
NM_001017992chr531040 989 561 ------
NM_001018056chr92567 194 ------
NM_001018064chr941798 813 440 75 1730 ----
NM_001018074chr533859 918 65 13774 ----
NM_001018075chr533859 918 65 13774 ----
NM_001018076chr533859 918 65 13774 ----
NM_001018077chr533859 918 65 13774 ----
NM_001018100chr151808 ------
NM_001018108chr1562184 1926 1616 1504 1403 330 --11837 --
NM_001020658chr111454 ------
NM_001020658chr111454 ------
NM_001023587chr31467 --1952 --
NM_001024071chr141367 --1870 --
NM_001024094chr533859 918 65 13774 ----
NM_001024218chr14------1344
NM_001024226chr12987 92 ------
NM_001024227chr12987 92 ------
NM_001024228chr12987 92 ------
NM_001024372chr862250 2211 773 716 262 244 1294 --11607
NM_001024380chr862474 2102 1636 1614 1596 178 ------
NM_001024381chr862474 2102 1636 1614 1596 178 ------
NM_001024463chr152390 39 ----1801
NM_001024596chr19113522 3409 3143 3009 2983 2856 2766 2444 540 380 259 --32876 687 584 --
NM_001024680chr211726 --11162 --
NM_001024688chr861950 1526 1417 799 323 52 2761 550 22179 2067 --
NM_001024808chr1231930 1890 106 12738 ----
NM_001024847chr332518 2317 815 21852 602 ----
NM_001024924chr42381 168 ------
NM_001024947chr52895 190 ------
NM_001024948chr162877 2636 2207 2167 274 158 1522 32972 2921 915 --
NM_001025068chr351713 1623 1414 590 161 --11590 --
NM_001025069chr351713 1623 1414 590 161 --11590 --
NM_001025076chr1034840 2428 1456 1662 54207 1656 1647 1567 459 25254 728
NM_001025077chr1046198 2814 277 199 12020 75565 3014 3005 2925 1817 884 424 26612 2086
NM_001025079chr383950 3442 3337 3215 1253 1121 387 375 ----1367
NM_001025105chr521145 579 --1956 --
NM_001025108chr274178 3395 3219 3144 2829 1448 457 ----11002
NM_001025252chr871206 1107 1053 492 475 31 24 22732 2057 22873 2630 --
NM_001025253chr871206 1107 1053 492 475 31 24 22732 2057 22873 2630 --
NM_001025266chr3134177 3824 3798 3788 3684 3480 3289 1935 1691 1665 1497 1338 535 --14917 --
NM_001025389chr1151518 1393 463 418 280 11318 ----
NM_001025390chr1151518 1393 463 418 280 11318 ----
NM_001025580chrX74063 4012 3476 3191 1132 388 81 --54299 4084 3856 798 737 --
NM_001025595chr411414 --11613 --
NM_001025603chr141310 991 229 165 1148 ----
NM_001025777chr22395 385 ------
NM_001025780chr941024 998 637 161 --11252 --
NM_001029839chr321295 594 ----1280
NM_001029840chr321295 594 ----1280
NM_001029858chr643194 2127 1303 546 --2995 867 --
NM_001029863chr682507 2466 2226 2099 1133 806 148 76 22840 646 --12857
NM_001029875chr562893 2823 2371 2217 2024 134 ----12332
NM_001029989chr152689 362 1797 ----
NM_001030007chr1642859 1590 528 221 ------
NM_001031679chr1222340 622 ------
NM_001031695chr2284863 3715 3372 2013 1731 1457 405 203 --15414 --
NM_001031716chr23729 321 47 ------
NM_001031740chr121582 1192 11066 2259 177 --
NM_001031803chr17140 --2326 290 --
NM_001031804chr1632998 1384 905 13468 13163 --
NM_001032221chr931729 688 485 ------
NM_001032288chr2031465 484 375 ------
NM_001032380chr1021435 71 11560 ----
NM_001032730chr11547 1659 ----
NM_001032999chr2084998 3450 1604 1473 1447 686 424 229 25356 5279 24737 1319 --
NM_001033044chr131477 1200 595 ------
NM_001033045chr244148 1779 1385 625 --13658 --
NM_001033056chr131477 1200 595 ------
NM_001033057chr31568 185 --11313
NM_001033059chr641605 1269 507 455 ------
NM_001033081chr111500 1280 1537 --
NM_001033082chr111500 1280 1537 --
NM_001033085chr22225 119 ------
NM_001033117chr354808 3807 1475 884 518 13168 ----
NM_001033503chr51407 ------
NM_001033506chr111328 --147 --
NM_001033521chr201157 ------
NM_001033522chr201157 ------
NM_001033551chr1783717 2981 2961 2626 943 782 766 383 12884 --11392
NM_001033557chr22967 499 11095 ----
NM_001033566chr172764 726 ------
NM_001033568chr172764 726 ------
NM_001033578chr842224 1927 847 765 ------
NM_001033723chr842542 1869 1052 800 1335 ----
NM_001034025chr125931 763 176 58 45 1155 ----
NM_001034841chr1644641 4240 4128 4001 --13528 1870
NM_001034845chr411167 ----131
NM_001034954chr1062760 1131 806 631 523 483 --12239 --
NM_001034955chr1062760 1131 806 631 523 483 --12239 --
NM_001034956chr1062760 1131 806 631 523 483 --12239 --
NM_001034957chr1062760 1131 806 631 523 483 --12239 --
NM_001035003chr431075 985 70 ------
NM_001035004chr431075 985 70 ------
NM_001035260chr1031392 343 321 --21263 477 --
NM_001035511chr162131 2116 1867 1852 1728 1473 11742 1313 --
NM_001035512chr162238 2223 1974 1959 1835 1580 11849 1420 --
NM_001035513chr162238 2223 1974 1959 1835 1580 11849 1420 --
NM_001037132chr731404 679 383 11671 --1611
NM_001037133chr731404 679 383 11671 --1611
NM_001037164chr731602 605 228 21918 327 11614 --
NM_001037165chr7108851 7958 7091 6198 5823 5784 2248 1047 662 166 --12201 --
NM_001037174chr231949 821 55 --22045 1499 --
NM_001037317chr132415 878 145 12499 ----
NM_001037339chr161505 1479 1407 1222 1210 689 ------
NM_001037340chr161505 1479 1407 1222 1210 689 ------
NM_001037341chr161505 1479 1407 1222 1210 689 ------
NM_001037341chr161505 1479 1407 1222 1210 689 ------
NM_001037582chr451327 1106 619 314 292 ------
NM_001037872chr2----1526 --
NM_001037954chr11103477 2505 1372 1328 1283 1257 1242 1157 839 644 13100 ----
NM_001038640chr1511000 ------
NM_001038702chr572282 2020 1834 1792 931 296 284 ------
NM_001039111chr32445 177 ------
NM_001039348chr22995 55 --1258 --
NM_001039349chr22995 55 --1258 --
NM_001039468chr111296 ------
NM_001039469chr111336 ------
NM_001039479chr1442274 1520 797 165 --2568 420 --
NM_001039538chr283468 3250 2924 2586 2397 729 397 296 ------
NM_001039547chr377627 7181 7160 5829 3079 2980 2724 --27209 612 1734
NM_001039570chr2284243 4127 4110 4070 3947 3848 3366 111 ------
NM_001039571chr2284243 4127 4110 4070 3947 3848 3366 111 ------
NM_001039573chr17----1457 --
NM_001039580chr474537 3558 1975 1547 1342 1287 681 --1191 --
NM_001039590chrX43597 3509 1221 376 --13404 --
NM_001039591chrX43597 3509 1221 376 --13404 --
NM_001039618chr1175026 4451 1900 1694 956 339 68 --24499 4455 --
NM_001039649chr13----1278 --
NM_001039675chr151234 142 ----
NM_001039693chr264119 3649 2632 1509 401 138 --14105 --
NM_001039709chr2084998 3450 1604 1473 1447 686 424 229 25356 5279 24737 1319 --
NM_001039762chr10----11978 --
NM_001039771chr142878 245 --3997 943 297 --
NM_001039840chrX85997 4639 3870 2316 935 372 319 31 15252 22357 1690 --
NM_001039938chr1321402 1355 ----11514
NM_001039960chr1241725 1571 1065 561 --1511 --
NM_001040020chr731204 1093 1080 ------
NM_001040057chr741028 604 510 470 ------
NM_001040101chr431116 604 428 ------
NM_001040110chr72572 38 --21866 1329 11599
NM_001040142chr252300 2250 2046 896 373 --12401 --
NM_001040143chr252300 2250 2046 896 373 --12401 --
NM_001040151chr1174488 4418 3570 3200 2969 1083 161 --13456 --
NM_001040152chr773407 1467 1404 836 444 438 432 23724 861 ----
NM_001040153chr13--160 ----
NM_001040159chr4--1569 ----
NM_001040181chr311082 ------
NM_001040182chr311082 ------
NM_001040183chr311082 ------
NM_001040199chr311082 ------
NM_001040200chr311082 ------
NM_001040214chr622120 2082 1454 11577 --
NM_001040260chr421087 190 ------
NM_001040261chr421087 190 ------
NM_001040272chr942068 1545 863 420 ------
NM_001040284chr1655397 4686 3972 3600 1129 24400 2071 35414 5199 1437 --
NM_001040429chr1333423 2723 566 1406 22893 305 --
NM_001040432chr31134 ------
NM_001040441chr133738 3379 414 1319 11180 14259
NM_001040446chr562040 959 879 762 732 303 ------
NM_001040450chr1532816 874 555 --22302 890 --
NM_001040451chr51348 ----1459
NM_001040452chr51348 ----1459
NM_001040453chr1532816 874 555 --22302 890 --
NM_001040458chr541811 381 181 132 ------
NM_001040665chr7154954 4807 4583 4335 3953 3844 3521 3496 3366 2016 1820 1785 1772 1482 762 23058 807 34575 3313 1854 --
NM_001040666chr74656 509 285 37 --1277 --
NM_001040697chr11--3100 64 37 --1527
NM_001040709chr172484 2463 2221 878 814 798 561 --12234 --
NM_001040712chr943031 2766 2545 2271 22829 1140 13463 1116
NM_001040876chr461898 1384 1221 509 408 374 21654 1455 11827 --
NM_001042403chr1251004 790 384 234 218 --1180 --
NM_001042404chr11474 --21248 31 --
NM_001042406chr62806 450 ------
NM_001042413chr983109 2986 1626 1423 794 748 412 357 23813 2852 ----
NM_001042414chr13165 125 ----
NM_001042454chr16--1359 ----
NM_001042465chr102702 53 ------
NM_001042466chr102702 53 ------
NM_001042473chr1041754 1456 310 31 ------
NM_001042475chr61258 --1203 --
NM_001042478chr1122 ------
NM_001042486chr2021565 333 ------
NM_001042492chr1773376 2649 2350 371 334 211 185 ------
NM_001042493chr651475 1308 1274 387 228 11977 ----
NM_001042494chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_001042495chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_001042496chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_001042497chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_001042506chrX31149 451 279 ------
NM_001042510chr831566 640 543 11587 ----
NM_001042511chr831566 640 543 11587 ----
NM_001042517chr131983 --1927 --
NM_001042537chrX41963 1548 466 318 12478 11828 169
NM_001042555chr1243897 3549 1156 202 13509 13371 --
NM_001042599chr2107821 7187 7157 5699 5691 5255 1057 983 413 403 46137 2294 290 156 35411 911 792 --
NM_001042601chr352675 2445 2107 2046 1058 ----1189
NM_001042603chr1285368 4655 3504 3446 3388 3330 1171 472 --35021 3611 854 11966
NM_001042604chr353171 1725 868 393 46 --13987 11011
NM_001042724chr192707 133 1598 ----
NM_001042749chrX21263 662 11355 ----
NM_001042750chrX21263 662 11355 ----
NM_001042751chrX21263 662 11355 ----
NM_001043351chr171925 1642 1505 853 781 452 171 --1295 --
NM_001044385chr243871 3510 3353 2922 1585 21509 293 --
NM_001046chr562291 2265 1888 1166 969 262 ------
NM_001049chr1442349 1961 555 237 ------
NM_001076chr41122 ------
NM_001076chr41122 ------
NM_001076778chr372350 2304 2230 1546 474 438 28 ------
NM_001079874chr121957 1553 ------
NM_001083620chr42926 404 ------
NM_001095chr1251626 1201 273 169 70 1306 ----
NM_001099678chr3125569 5189 5011 4418 4273 4082 2472 2079 2065 1709 1300 1069 35687 4484 1967 11177 11796
NM_001106chr3219276 8875 8391 8175 7987 7743 7360 7290 7263 6764 6517 6058 3835 3175 2187 1614 1104 832 726 504 123 48996 2154 1476 420 12621 --
NM_001107chr141161 --1142 --
NM_001109977chr42604 96 ----1698
NM_001113490chrX63654 2231 1283 1085 587 443 12704 43126 1170 1022 148 --
NM_001117chr18------1457
NM_001121chr1031577 1267 273 ------
NM_001122679chr5----1451 --
NM_001124chr111449 --1659 --
NM_001126chr1----1775 --
NM_001128chr1642859 1590 528 221 ------
NM_001140chr171219 ------
NM_001144chr1651347 1008 329 303 26 ------
NM_001146chr831580 290 190 ------
NM_001153chr22281 124 ------
NM_001156chr101590 --1533 --
NM_001167chrX116355 5846 5593 4885 4847 4188 2199 837 601 107 40 21446 1224 11809 1958
NM_001172chr142744 168 --2260 101 --
NM_001177chr1252095 1852 1548 476 81 ------
NM_001179chr41199 ------
NM_001186chr211537 12167 22666 2286 12087
NM_001198chr642253 2158 1594 678 --12367 1330
NM_001201chr483904 3236 3037 2916 2403 1518 1442 93 ------
NM_001204chr277453 3118 1765 1269 1075 741 664 ------
NM_001206chr942544 2135 1974 491 12082 ----
NM_001219chr712280 --1577 --
NM_001222chr1021304 569 --11501 --
NM_001227chr103914 903 255 11299 ----
NM_001233chr721902 1701 --21947 425 --
NM_001237chr411192 ------
NM_001237chr411192 ------
NM_001241chr231711 776 609 ----11729
NM_001241chr231711 776 609 ----11729
NM_001256chr1722120 1016 --1528 --
NM_001257chr1631071 558 409 --21181 284 --
NM_001259chr7146244 5341 4839 4630 4580 4419 2199 2081 1652 1444 1316 1152 1124 100 35804 5212 1337 34173 1904 1095 11989
NM_001260chr131239 ------
NM_001270chr52463 282 ------
NM_001277chr1151089 904 826 118 82 ------
NM_001284chr51523 ------
NM_001304chr1763140 2549 1272 972 776 583 --23507 639 --
NM_001324chr201157 ------
NM_001329chr1011234 --11334 --
NM_001331chr1172707 2545 2033 1762 144 115 106 --22718 2699 --
NM_001332chr5----11038 --
NM_001343chr541390 317 283 154 ------
NM_001346chr362450 2380 2014 1905 1842 722 1400 12248 --
NM_001351chr311659 11814 ----
NM_001356chrX1106 1871 ----
NM_001364chr1193632 3594 3135 3094 3034 1871 929 517 398 13889 21438 70 --
NM_001378chr21391 1498 ----
NM_001382chr112193 25 --182 --
NM_001386chr842433 2120 395 241 ------
NM_001390chr1833412 2518 1381 12259 ----
NM_001391chr182169 163 ------
NM_001395chrX3730 630 190 ------
NM_001396chr2141910 1866 1750 648 ------
NM_001397chr1112517 2511 2304 2281 2101 2006 981 965 721 703 577 ------
NM_001399chrX93557 3539 3000 2477 2426 2383 1131 918 850 ------
NM_001407chr321502 131 --1639 --
NM_001408chr121678 1545 --1595 --
NM_001412chrX63748 3489 3170 2926 2841 2781 1406 ----
NM_001417chr1231786 396 123 --11904 --
NM_001418chr111484 1693 ----
NM_001418chr111484 1693 ----
NM_001426chr2--1277 ----
NM_001429chr221309 ----11093
NM_001430chr241905 1754 212 122 ------
NM_001431chr62977 954 --1312 --
NM_001438chr142356 1331 329 190 33316 1213 352 11392 --
NM_001448chrX1695 11164 11426 --
NM_001451chr1621160 968 ------
NM_001453chr621677 703 11691 ----
NM_001465chr541882 1646 1319 516 1452 11711 1815
NM_001482chr152686 308 ------
NM_001494chr101721 ------
NM_001498chr61952 --1384 --
NM_001518chr761107 353 222 146 126 64 ------
NM_001527chr644655 4493 4281 3009 13986 199 1876
NM_001530chr14--2842 147 --151
NM_001542chr142781 2149 1931 716 --1165 --
NM_001543chr564205 2937 1588 1236 853 563 23780 3440 34119 1823 658 --
NM_001546chr621203 359 ------
NM_001553chr4----159 1167
NM_001554chr12479 162 1662 ----
NM_001560chrX32063 99 22 ------
NM_001568chr8135 ------
NM_001587chrX21809 789 1860 21850 378 --
NM_001613chr10--1112 ----
NM_001616chr253392 3316 3255 2626 370 1886 12347 12864
NM_001621chr71933 2710 567 ----
NM_001621chr71933 2710 567 ----
NM_001634chr641605 1269 507 455 ------
NM_001642chr113887 148 74 ------
NM_001649chrX21992 888 12367 ----
NM_001650chr1824127 260 --22995 507 13692
NM_001658chr12987 92 ------
NM_001659chr1272214 2178 1066 822 646 564 151 12160 ----
NM_001661chr172606 267 ------
NM_001663chr142995 513 11097 ----
NM_001664chr331039 766 133 2355 103 1333 --
NM_001668chr12635 486 ----1898
NM_001677chr12401 316 ------
NM_001681chr121164 ------
NM_001682chr1232202 947 615 --12069 1784
NM_001689chr221922 1271 ----11374
NM_001690chr341824 731 344 261 --12565 --
NM_001693chr84971 328 289 196 ------
NM_001695chr884302 4067 3686 3312 3302 3024 1642 1410 --1525 --
NM_001699chr1941455 523 396 50 1124 ----
NM_001701chr931286 1135 1082 --1553 --
NM_001704chr6180 --197 --
NM_001706chr331024 986 197 ------
NM_001707chr76716 700 679 574 192 34 ------
NM_001722chr82551 47 ----1497
NM_001730chr1311125 1316 ----
NM_001730chr1311125 1316 ----
NM_001753chr761534 1430 1380 560 496 232 11547 --1369
NM_001754chr2183682 3651 3206 3109 2835 1557 1520 737 --12771 --
NM_001755chr1652245 772 325 293 198 --12131 --
NM_001759chr12105202 4715 3869 3821 3490 3474 3432 3279 1987 1596 2752 630 13784 --
NM_001777chr383950 3442 3337 3215 1253 1121 387 375 ----1367
NM_001788chr7--1860 ----
NM_001789chr331474 521 141 --1557 11672
NM_001792chr1811033 ------
NM_001797chr161569 ------
NM_001799chr52276 28 ------
NM_001802chr162793 22 21019 890 ----
NM_001806chr1932863 2231 1805 ------
NM_001830chrX53710 3626 2891 1573 955 13647 12905 1970
NM_001839chr11161 1568 ----
NM_001845chr1331226 171 40 ------
NM_001846chr133785 722 680 --153 --
NM_001851chr61147 --2121 96 --
NM_001858chr675159 5012 4702 4388 3754 649 428 1541 1496 --
NM_001861chr161124 ------
NM_001863chr191108 ------
NM_001873chr4--2217 34 --1632
NM_001892chr521145 579 --1956 --
NM_001893chr172358 346 ------
NM_001895chr202993 767 --21097 238 --
NM_001901chr62985 388 ------
NM_001903chr53860 795 200 ------
NM_001918chr1149093 9059 7229 6554 6545 6409 5962 2207 2035 1792 1428 1271 1080 465 --39126 3126 1756 --
NM_001920chr123794 661 651 ------
NM_001921chr4----11173 --
NM_001933chr1431330 373 276 ------
NM_001935chr22649 129 --1195 --
NM_001939chrX83510 3401 2501 1472 1043 940 395 321 1579 ----
NM_001946chr121813 --1937 --
NM_001949chr643070 2736 2124 89 1784 ----
NM_001964chr51222 11036 ----
NM_001968chr42293 211 1318 ----
NM_001977chr421592 428 --1501 --
NM_001981chr151574 862 351 314 271 1511 21550 83 12138
NM_001987chr1242913 1565 659 179 13137 12665 13643
NM_001995chr431083 375 357 --21357 173 --
NM_002009chr1551850 1799 823 358 123 1522 11980 --
NM_002015chr1333147 2882 831 1970 22291 476 --
NM_002017chr112942 177 ------
NM_002024chrX11377 --1834 1230
NM_002025chrX129280 9094 8730 7880 3652 3610 1506 1397 1124 912 307 44 36602 5786 2335 33189 2516 1532 11024
NM_002028chr1441267 935 860 506 --11309 --
NM_002039chr41711 --1369 --
NM_002040chr213954 865 66 --12848 --
NM_002044chr15------132
NM_002056chr21171 --1776 --
NM_002063chrX1999 ------
NM_002065chr131477 1200 595 ------
NM_002069chr72680 633 ------
NM_002071chr184605 567 142 52 --145 --
NM_002072chr94878 863 687 230 ------
NM_002077chr961781 1607 1514 768 424 228 ------
NM_002086chr173797 527 75 1198 11873 --
NM_002089chr41234 --1611 --
NM_002090chr4--1160 ----
NM_002092chr464635 4396 4047 3186 1297 1182 1679 11414 21524 1365
NM_002094chr162414 59 ------
NM_002095chr82145 89 ------
NM_002126chr1793503 3147 3130 2795 2694 1005 758 515 339 3796 633 371 ----
NM_002128chr1341996 941 851 157 ------
NM_002130chr541159 1132 685 151 11083 ----
NM_002131chr641143 1031 822 488 --1965 --
NM_002136chr121547 ------
NM_002137chr7----1210 --
NM_002139chrX284 73 ------
NM_002140chr91779 ------
NM_002141chr7137 --1276 --
NM_002146chr1741175 389 271 200 11412 ----
NM_002156chr22312 22 ------
NM_002158chr253662 3410 2963 1197 780 --22820 2392 --
NM_002196chr202946 730 ------
NM_002196chr202946 730 ------
NM_002202chr51711 ------
NM_002203chr533467 2916 1515 23365 3335 ----
NM_002207chr3--1302 ----
NM_002210chr242877 2575 2280 2184 13431 21169 290 12593
NM_002214chr7165577 5261 4961 4902 4823 4810 4770 3881 1921 1610 1273 1247 951 877 734 208 14165 ----
NM_002223chr1243792 3764 3415 46 13484 11350 --
NM_002224chr63612 239 68 1270 ----
NM_002228chr11501 2958 801 ----
NM_002232chr1--21008 63 ----
NM_002235chr1271657 1539 1269 385 318 154 75 --1125 --
NM_002239chr2--1716 ----
NM_002240chr211160 ------
NM_002250chr19130 ------
NM_002254chr261960 1908 865 700 331 153 1895 12391 --
NM_002264chr374879 4793 3821 3765 1483 1293 43 --24751 507 1424
NM_002266chr171209 ------
NM_002267chr1362092 801 642 243 172 59 --1607 --
NM_002268chr311704 ------
NM_002269chr61401 ------
NM_002270chr553971 3504 2182 1246 696 34062 1615 967 11396 --
NM_002285chr274178 3395 3219 3144 2829 1448 457 ----11002
NM_002290chr631378 1312 1288 11364 1411 --
NM_002294chrX2385 58 ------
NM_002312chr131937 ------
NM_002313chr1075041 4223 3516 3486 1926 1662 102 11873 1258 --
NM_002336chr1263519 3080 1554 742 734 681 23548 3431 21054 27 --
NM_002355chr12----2494 162 --
NM_002356chr662363 1941 1755 785 529 261 12388 --12567
NM_002374chr283468 3250 2924 2586 2397 729 397 296 ------
NM_002375chr352325 1997 1805 717 551 --22269 619 --
NM_002382chr1431278 1005 448 1847 ----
NM_002384chr182955 312 ------
NM_002390chr1781980 1974 1717 1607 1430 688 397 255 11333 ----
NM_002395chr61383 31463 1191 233 1453 --
NM_002399chr1531356 1235 571 ------
NM_002401chr1772291 1990 1733 976 641 623 593 ------
NM_002444chrX41877 1432 572 266 ------
NM_002445chr841603 1148 480 35 --11332 --
NM_002451chr983867 3469 3382 2849 2660 2615 334 322 ------
NM_002473chr221913 --11039 --
NM_002479chr12206 138 --162 --
NM_002480chr1211003 ------
NM_002481chr195608 5458 3002 2939 1677 1525 1408 973 319 16290 42467 1938 1558 850 --
NM_002485chr861950 1526 1417 799 323 52 2761 550 22179 2067 --
NM_002499chr1552100 2074 1762 407 171 --22354 2006 --
NM_002500chr23889 419 91 --2412 152 --
NM_002505chr631506 501 304 ------
NM_002506chr1159 ------
NM_002508chr1152 ------
NM_002514chr811189 ------
NM_002515chr1441845 1427 749 364 ------
NM_002519chr111565 1619 1430 --
NM_002524chr11129 1903 1191 1933
NM_002545chr1174325 1951 1531 972 965 546 264 1808 15107 13966
NM_002547chrX61648 1447 1196 456 417 304 12976 13678 --
NM_002553chr71339 169 ----
NM_002572chr111393 ------
NM_002576chr1141204 1093 836 430 1874 31208 1182 795 --
NM_002577chr343026 2870 801 630 --23099 889 --
NM_002581chr995166 4328 1178 929 843 801 602 455 131 24903 4653 13497 --
NM_002583chr12141 ------
NM_002586chr651425 1201 638 617 548 ------
NM_002594chr202818 635 12192 ----
NM_002595chr1221518 332 1776 ----
NM_002600chr161505 1479 1407 1222 1210 689 ------
NM_002605chr151453 ------
NM_002607chr711180 21245 850 11254 --
NM_002609chr561867 1541 1270 414 212 27 ------
NM_002613chr1674975 4560 3650 3578 1707 1694 1494 1738 ----
NM_002616chr172166 104 --1570 --
NM_002628chr3167 2101 22 11046 --
NM_002641chrX3750 255 120 11901 ----
NM_002645chr1142947 2436 1220 513 13023 22737 2154 --
NM_002646chr161631 1502 1476 803 632 263 --1558 --
NM_002648chr64845 524 501 168 11101 ----
NM_002649chr71133 --31308 1124 306 --
NM_002655chr895052 3255 1426 1296 758 357 222 197 79 --11285 --
NM_002656chr61865 ----1352
NM_002667chr61327 1857 --11162
NM_002687chr14191 --167 --
NM_002709chr233587 2687 794 1522 23531 3339 --
NM_002713chr141131 1041 407 240 --1269 --
NM_002717chr81694 ------
NM_002718chr382532 2419 1855 1847 577 566 540 482 ------
NM_002719chr1421729 747 ------
NM_002721chr92113 65 ------
NM_002729chr101611 ------
NM_002731chr153110 2912 2548 2173 1209 196 ----
NM_002734chr1782220 1743 758 697 619 505 320 79 1688 ----
NM_002737chr17105582 5135 5093 4918 4789 2630 1886 1567 851 511 21704 906 ----
NM_002740chr342767 2319 2270 188 ----1448
NM_002745chr2264399 3924 3051 1658 1458 946 13504 11600 1442
NM_002747chr1841896 1453 574 99 --1163 --
NM_002748chr151492 2910 786 ----
NM_002750chr10----1196 --
NM_002752chr51542 ------
NM_002753chr42540 145 ----1609
NM_002776chr1961853 1250 777 520 409 198 ------
NM_002778chr102702 53 ------
NM_002811chr162523 128 ------
NM_002815chr17198 ------
NM_002828chr182999 341 ------
NM_002829chr941232 1051 842 814 --11159 --
NM_002834chr1232761 1146 981 11244 1137 --
NM_002835chr74726 297 145 117 ------
NM_002836chr201510 ----1133
NM_002837chr12103949 3685 3591 3521 3154 2925 2837 947 376 318 --14359 1802
NM_002839chr943031 2766 2545 2271 22829 1140 13463 1116
NM_002840chr121538 1303 11395 ----
NM_002841chr3--1217 --1248
NM_002843chr1133227 2296 2131 1412 ----
NM_002847chr721566 1511 ------
NM_002849chr1241085 1012 292 54 1858 1816 --
NM_002851chr72557 498 1657 ----
NM_002855chr11113572 3403 3343 3264 3116 2655 2483 864 820 769 275 1925 ----
NM_002868chr1252260 2241 2230 246 126 --11842 --
NM_002869chr113422 372 135 1435 ----
NM_002871chr171976 1931 1673 467 410 257 91 --11637 --
NM_002874chr931812 1739 938 1389 11847 --
NM_002886chr341757 1699 1636 158 1782 21988 1331 --
NM_002890chr53854 791 188 1889 1919 --
NM_002906chr1132067 1919 1628 --1635 --
NM_002907chr12----1332 --
NM_002918chr1921117 760 ------
NM_002922chr11647 ------
NM_002940chr461898 1384 1221 509 408 374 21654 1455 11827 --
NM_002955chr621360 1302 11966 --1232
NM_002957chr942493 746 99 47 1143 1182 --
NM_002959chr154466 4169 3482 3046 1101 11011 ----
NM_002970chrX2343 121 ------
NM_002971chr31926 ------
NM_002977chr242722 2367 687 304 12973 ----
NM_002997chr221826 191 11208 21291 767 --
NM_002998chr821494 575 1688 1606 --
NM_003001chr162238 2223 1974 1959 1835 1580 11849 1420 --
NM_003010chr1731883 1813 1796 ------
NM_003011chr921197 468 11626 ----
NM_003013chr43765 742 134 1860 ----
NM_003016chr1741469 778 662 420 ------
NM_003017chr61566 ------
NM_003027chr151416 ------
NM_003028chr933278 609 578 --11074 --
NM_003032chr392703 2551 2121 1930 1836 1681 1081 956 296 ------
NM_003034chr1298106 7954 7715 7028 6945 6082 5583 1262 812 32116 1063 949 --11512
NM_003036chr11126 ------
NM_003042chr362052 1895 1434 768 370 98 ------
NM_003051chr141957 1599 1303 774 ------
NM_003059chr51322 ------
NM_003069chrX1303 ------
NM_003074chr31894 11865 1672 --
NM_003075chr121328 ------
NM_003076chr1241048 182 78 60 11661 ----
NM_003099chr15105988 4854 4105 2223 2143 1220 948 571 563 40 35029 193 95 16519 --
NM_003100chr51373 ------
NM_003107chr622413 2224 12149 12582 --
NM_003108chr246951 6565 1869 825 25752 5360 --27041 5735
NM_003111chr221343 905 ------
NM_003112chr722631 595 ------
NM_003113chr23756 153 50 1762 ----
NM_003128chr252603 2413 1907 1067 35 ------
NM_003131chr652202 1865 1503 589 172 --11585 --
NM_003140chrY--136 ----
NM_003144chr631706 399 110 --1280 11492
NM_003150chr1792386 2193 1885 1721 395 144 135 98 48 12243 --1494
NM_003154chr4196 ------
NM_003161chr1783513 3289 3248 2337 1409 1389 1139 794 ------
NM_003173chrX61190 1088 358 131 105 89 11154 11249 --
NM_003178chr322022 172 ------
NM_003184chr82458 398 --1422 --
NM_003185chr20--1355 ----
NM_003189chr162727 2644 2573 2229 2077 385 ------
NM_003199chr1845632 5293 5206 986 11170 24508 1378 --
NM_003201chr103937 259 218 ------
NM_003202chr561746 596 564 512 464 364 ------
NM_003206chr61423 ------
NM_003216chr2283174 2888 2496 2451 2061 1318 373 51 --132 --
NM_003217chr1241853 1616 1416 1324 ------
NM_003221chr644114 3839 3184 2839 --13414 --
NM_003222chr2031198 457 194 1112 ----
NM_003234chr362105 1778 1673 1558 235 130 32073 1907 1700 1270 --
NM_003238chr11233 ------
NM_003240chr1--1668 ----
NM_003242chr332518 2317 815 21852 602 ----
NM_003246chr153303 268 157 --21831 1522 --
NM_003253chr2141504 711 383 220 ------
NM_003257chr1521048 1009 ------
NM_003262chr374782 4655 4519 3633 2057 2023 66 1109 11605 --
NM_003269chr631236 303 296 ------
NM_003281chr175194 4821 3867 3327 1821 1669 77 --11058 --
NM_003289chr9--1183 ----
NM_003292chr122234 1600 11562 ----
NM_003298chr396222 5841 5802 4462 4267 2185 1042 848 399 15865 1743 16227
NM_003305chr42421 310 --2289 108 --
NM_003318chr61230 ------
NM_003320chr1163932 3731 3357 3266 1588 54 177 24098 4077 --
NM_003334chrX2158 130 --1151 --
NM_003337chr531447 1122 51 11506 ----
NM_003339chr521489 129 ----1255
NM_003340chr41132 ------
NM_003341chr31531 ----1656
NM_003342chr1753117 2103 989 774 579 21281 916 13104 --
NM_003344chr721680 652 ------
NM_003348chr121685 ----11242
NM_003349chr2031465 484 375 ------
NM_003352chr21211 11041 ----
NM_003359chr4168 ------
NM_003370chr19274 68 ------
NM_003373chr1051945 1254 1238 751 514 ------
NM_003379chr62847 753 ------
NM_003380chr10134 ------
NM_003383chr92567 194 ------
NM_003385chr2--1659 --1127
NM_003387chr242920 2880 1122 229 153 ----
NM_003390chr111399 ------
NM_003392chr311716 ----11165
NM_003403chr143725 570 203 ------
NM_003404chr2021629 764 11885 ----
NM_003405chr22199 ------
NM_003406chr841721 1429 615 25 11694 11479 1341
NM_003407chr191433 --1655 --
NM_003410chrX62262 2065 2016 1040 314 305 ------
NM_003413chrX--41308 1297 1285 1230 1239 --
NM_003439chr762413 748 592 413 393 156 ------
NM_003453chr131136 ------
NM_003455chr1131469 261 255 --1133 --
NM_003462chr161595 1483 1334 1239 410 289 --11759 1567
NM_003463chr623409 2097 12491 22416 2169 --
NM_003468chr263582 3320 1379 1205 300 88 --1220 --
NM_003469chr2125 ------
NM_003470chr1661666 713 597 554 351 173 ------
NM_003471chr332095 1455 156 --2653 301 --
NM_003473chr102857 449 --172 1214
NM_003474chr105858 803 393 175 138 --148 --
NM_003478chr1133016 2520 124 --12199 --
NM_003482chr1262377 768 742 679 468 308 1627 ----
NM_003483chr1242522 1111 792 26 --22526 535 --
NM_003489chr2153271 2271 1226 340 197 21361 644 43190 2969 2619 727 --
NM_003496chr73735 704 79 1836 ----
NM_003498chr1672689 2435 2019 896 719 709 303 ------
NM_003506chr8----11271 --
NM_003551chr5----2471 37 --
NM_003557chr151587 1384 1314 428 96 ------
NM_003558chr93683 504 194 ------
NM_003566chr1242674 2636 495 80 12170 33282 2614 555 --
NM_003574chr18105737 3881 3701 2157 1840 1652 1375 482 372 209 24714 68 11009 --
NM_003582chr1------1174
NM_003583chr1273949 3142 2717 1474 1060 592 304 1960 11550 --
NM_003590chr222676 1378 ------
NM_003595chr221187 1453 1323 --
NM_003603chr421802 222 ------
NM_003615chr363953 1202 1029 821 288 109 14037 1968 --
NM_003618chr2147 --11061 --
NM_003626chr1121404 1334 --128 --
NM_003633chr5173 --12203 --
NM_003635chr102412 108 ------
NM_003637chr141204 619 422 180 --1110 --
NM_003642chr22225 119 ------
NM_003653chr172252 38 ------
NM_003660chr191269 ------
NM_003663chr353308 3261 3081 1159 301 --22495 563 --
NM_003671chr943120 3105 2792 1360 12747 23243 3231 --
NM_003672chr151726 435 184 115 107 ------
NM_003681chr21114902 4734 4475 4049 3888 1866 1404 1238 684 358 79 --25449 2421 --
NM_003688chrX------1105
NM_003692chr9----2691 284 --
NM_003701chr13194 ------
NM_003704chr43631 623 126 ------
NM_003716chr33695 129 97 ------
NM_003749chr1352160 811 734 458 182 ------
NM_003754chr111137 ------
NM_003758chr1521121 262 --1383 --
NM_003758chr1521121 262 --1383 --
NM_003759chr443139 2984 1230 951 12710 13672 13530
NM_003766chr171452 ------
NM_003768chr141816 1495 1152 306 ------
NM_003787chr1831394 585 202 1273 ----
NM_003794chr31848 ----182
NM_003816chr81374 ------
NM_003822chr133034 2543 2012 --12893 --
NM_003825chr1531209 414 188 --164 --
NM_003831chr1821291 681 --1195 --
NM_003840chr852089 1961 763 114 40 --21814 587 --
NM_003842chr841806 708 700 42 ------
NM_003861chr1422869 2182 ------
NM_003872chr232695 191 23 --12739 --
NM_003877chr122951 192 ------
NM_003884chr31228 1667 ----
NM_003885chr172855 351 --12114 --
NM_003888chr1521671 1132 ------
NM_003895chr2121861 610 ------
NM_003899chr1352564 1977 1617 698 252 ------
NM_003902chr11168 ------
NM_003913chr673755 3544 3242 2670 1437 1102 477 ----13061
NM_003916chrX--11476 --1969
NM_003927chr18----1985 --
NM_003932chr2211908 ------
NM_003941chr721781 360 11719 2621 54 --
NM_003948chr452155 1847 1035 868 542 12682 2228 123 --
NM_003955chr1761440 1146 1116 645 349 304 --11265 --
NM_003958chr6113782 3539 3355 2935 2710 714 507 422 385 249 33 11145 53876 3646 3177 3096 444 --
NM_003966chr562700 2450 1225 1163 1136 65 --17412 24863 4843
NM_003980chr631149 517 385 ------
NM_003983chr1674040 3474 3359 3235 2925 698 444 --13450 --
NM_004004chr1321098 870 --1874 --
NM_004006chrX52094 1939 1805 823 615 ------
NM_004007chrX52094 1939 1805 823 615 ------
NM_004009chrX52094 1939 1805 823 615 ------
NM_004010chrX52094 1939 1805 823 615 ------
NM_004011chrX52094 1939 1805 823 615 ------
NM_004012chrX52094 1939 1805 823 615 ------
NM_004013chrX52094 1939 1805 823 615 ------
NM_004014chrX52094 1939 1805 823 615 ------
NM_004015chrX52094 1939 1805 823 615 ------
NM_004016chrX52008 1853 1719 737 529 ------
NM_004017chrX52094 1939 1805 823 615 ------
NM_004018chrX52008 1853 1719 737 529 ------
NM_004019chrX----1433 --
NM_004020chrX52094 1939 1805 823 615 ------
NM_004021chrX52008 1853 1719 737 529 ------
NM_004022chrX52008 1853 1719 737 529 ------
NM_004023chrX52008 1853 1719 737 529 ------
NM_004028chr1824127 260 --22995 507 13692
NM_004034chr101590 --1533 --
NM_004035chr1774973 4415 4390 4213 1288 542 310 11313 14947 --
NM_004040chr22955 114 ------
NM_004041chr111543 1659 ----
NM_004056chr8----1873 --
NM_004077chr1261247 1179 1061 546 202 28 --2840 290 --
NM_004079chr172617 2491 2318 2035 1945 976 313 ------
NM_004081chrY1550 1105 --11835
NM_004083chr12270 40 1197 ----
NM_004089chrX--148 ----
NM_004090chr1723381 3016 12395 32679 2510 2493 --
NM_004093chr1332010 773 401 1164 ----
NM_004096chr1031685 1606 556 --1376 --
NM_004099chr971976 1733 737 704 550 424 336 11386 ----
NM_004100chr61798 1414 ----
NM_004105chr22995 55 --1258 --
NM_004109chr1142274 1534 962 142 3769 312 39 --12252
NM_004112chr1751653 1427 1196 457 450 ------
NM_004114chrX3247 140 42 1476 ----
NM_004124chr141840 --2961 227 --
NM_004133chr842446 1663 563 246 11736 11961 --
NM_004136chr1552960 2490 2300 2135 373 ------
NM_004171chr1197404 7165 6342 5987 3301 2480 1802 1444 649 18889 16674 18459
NM_004183chr112304 271 --2555 164 --
NM_004209chr164923 859 834 237 ------
NM_004215chr81426 ------
NM_004225chr831466 1207 258 ------
NM_004229chrX31547 1421 1414 ------
NM_004232chr1853363 2927 2461 1480 1247 1877 ----
NM_004236chr15183 ------
NM_004255chr15263 45 ------
NM_004261chr12756 36 ------
NM_004263chr271787 1658 1632 1260 1187 717 287 ------
NM_004272chr531729 626 509 --1230 --
NM_004273chr1075047 4797 4400 3655 3333 1036 920 ------
NM_004274chr1453055 2939 2790 283 122 42926 2820 2611 492 12779 11128
NM_004277chr631535 1407 89 ------
NM_004279chr792383 2371 2157 1678 1663 563 316 220 136 ------
NM_004290chr521258 156 ------
NM_004293chr943665 3643 3084 113 11181 23456 1447 --
NM_004296chr1463077 2701 1403 1299 535 334 12520 13254 --
NM_004301chr33353 292 24 ----1341
NM_004302chr1272859 2710 2169 651 511 199 82 ------
NM_004316chr12----21095 828 --
NM_004323chr952290 2043 1776 186 76 --22316 1982 --
NM_004326chr12266 166 ------
NM_004329chr102437 408 ------
NM_004331chr831989 1647 383 ------
NM_004337chr841593 813 657 215 --12227 1868
NM_004338chr1886931 6922 5465 4774 4572 4528 2519 1957 --22689 589 --
NM_004354chr42255 120 ------
NM_004359chr193423 376 31 --2528 73 --
NM_004362chr41182 1501 ----
NM_004370chr632211 1837 315 --22162 745 --
NM_004374chr8------139
NM_004380chr1621697 527 1587 12655 --
NM_004385chr51575 1235 ----
NM_004391chr392021 1471 1414 801 607 581 295 138 127 ------
NM_004393chr332129 1747 1702 1515 ----
NM_004397chr1142878 2621 1695 1416 --13459 --
NM_004407chr4----1992 --
NM_004411chr72262 207 --1273 --
NM_004417chr51466 ------
NM_004419chr103850 265 232 --1963 --
NM_004423chr392748 2604 2063 1855 594 536 529 290 198 ----12378
NM_004426chr122775 207 ------
NM_004432chr922205 230 --1326 1125
NM_004434chr1441882 1636 134 58 1675 ----
NM_004438chr262665 2238 2212 838 189 43 11278 32073 738 291 --
NM_004440chr611407 --2734 243 --
NM_004441chr311281 11136 ----
NM_004450chr141296 ------
NM_004454chr342026 1480 530 369 ------
NM_004458chrX52278 2032 1919 1737 432 --11861 --
NM_004459chr1711974 ------
NM_004480chr142302 264 ------
NM_004482chr21153 --1735 --
NM_004483chr162125 104 --1452 --
NM_004487chr331074 923 204 ----11141
NM_004496chr141419 ------
NM_004500chr1451900 1703 1638 1360 815 146 ----
NM_004501chr113507 --13840 --
NM_004502chr17------1228
NM_004504chr252876 2332 2114 1144 772 12098 ----
NM_004505chr1761639 1404 1377 761 721 416 11501 ----
NM_004516chr191377 ------
NM_004520chr5142 --1553 --
NM_004524chr17----2298 262 --
NM_004525chr211422 ------
NM_004528chr1194 ------
NM_004537chr1231175 223 45 1525 1532 --
NM_004538chrX1753 1195 ----
NM_004543chr2--299 82 ----
NM_004569chr143669 548 214 ------
NM_004571chr2163211 2798 798 750 577 431 --12545 --
NM_004586chrX64437 4430 4349 3728 3659 1456 25076 1395 11374 --
NM_004588chr1183377 3185 2968 2458 1453 1075 831 70 13617 24071 1190 --
NM_004592chr121172 ------
NM_004593chr31350 --1136 --
NM_004598chr543031 2530 503 365 21060 926 12116 --
NM_004612chr974100 3893 3316 3237 1651 241 80 14470 13867 --
NM_004615chrX----1783 --
NM_004637chr341093 543 463 253 ------
NM_004643chr14----1657 --
NM_004646chr191443 1735 ----
NM_004654chrY----1567 --
NM_004655chr174938 349 281 264 11305 11117 --
NM_004656chr341193 871 380 289 1315 ----
NM_004660chrY1105 --1336 --
NM_004661chr531207 1087 54 --1149 --
NM_004663chr1521524 372 ------
NM_004664chr12121 ------
NM_004670chr1031543 1159 508 --21547 45 --
NM_004677chrY1397 ------
NM_004681chrY----1178 --
NM_004686chr81305 --2285 114 --
NM_004687chr1731845 1792 1468 11900 ----
NM_004690chr61704 ------
NM_004694chr172698 147 ------
NM_004697chr92429 107 --1217 --
NM_004703chr1752196 2185 2178 1993 584 --1895 --
NM_004705chr113309 181 135 --1755 --
NM_004711chr2293301 3185 3033 2991 2764 2424 2317 1389 108 11025 13390 --
NM_004715chr181195 ------
NM_004717chr761569 1374 1249 401 157 126 ------
NM_004723chr13818 769 363 ------
NM_004726chrX55279 3669 1690 816 615 --35675 775 78 --
NM_004734chr1343295 2599 2258 60 21264 203 ----
NM_004736chr131712 1681 537 ------
NM_004738chr2032323 977 130 --1335 --
NM_004744chr443768 1275 1185 730 ------
NM_004745chr896164 6021 5731 5723 5456 4271 2576 2501 1671 35662 2213 1972 15676 --
NM_004748chr1543363 732 612 233 1582 13261 --
NM_004755chr143877 847 113 ------
NM_004756chr1931277 494 232 --11334 --
NM_004760chr732171 849 423 ------
NM_004762chr1741597 616 589 326 ------
NM_004766chr3264 22 ------
NM_004768chr12949 799 2781 463 ----
NM_004774chr1732296 1032 860 12439 ----
NM_004775chr1832170 2159 751 11729 11496 2670 234
NM_004776chr2032596 2401 1169 1986 1522 --
NM_004779chr52909 344 ------
NM_004781chr141727 501 486 405 185 --1410
NM_004781chr141727 501 486 405 185 --1410
NM_004788chr1142019 1840 1041 322 11678 ----
NM_004798chr2073543 3415 3206 2276 1103 924 596 ------
NM_004801chr211050 1383 ----
NM_004805chr231248 901 560 21442 415 1286 --
NM_004820chr82378 40 ------
NM_004821chr51749 1641 --1691
NM_004822chr1793478 3365 2782 1514 1493 879 758 672 267 ------
NM_004824chr621378 1329 --11037 --
NM_004834chr232503 2155 966 --1847 --
NM_004836chr23615 212 51 --1123 --
NM_004841chr13424 98 52 167 1287 --
NM_004845chrX54088 3374 3074 959 380 --21656 735 --
NM_004850chr211678 ------
NM_004857chr1494086 4042 3913 3720 3361 1590 1031 804 471 ------
NM_004862chr1631603 1446 249 --11080 --
NM_004863chr1494525 4302 4127 3967 3803 1686 1192 407 278 --23722 1327 13553
NM_004865chr6----1287 --
NM_004866chr544447 4270 1539 27 21718 171 ----
NM_004867chrX2603 147 --1607 --
NM_004869chr1821515 254 ----11734
NM_004871chr1783860 3841 3259 1511 1313 730 553 540 11726 1606 --
NM_004872chr11330 ------
NM_004874chr8168 ------
NM_004883chr5----142 --
NM_004884chr154690 539 457 253 --1128 11295
NM_004896chr1031307 258 236 --21178 392 --
NM_004897chr101915 1270 ----
NM_004898chr432723 2012 395 1160 --12456
NM_004902chr202222 129 ------
NM_004904chr7106028 5621 4442 4155 4123 1623 1569 1563 1323 1204 11035 ----
NM_004906chr62664 445 ------
NM_004926chr1411762 128 1409 --
NM_004929chr841535 1514 1052 588 ----11303
NM_004932chr551799 1540 545 345 75 ------
NM_004947chr352435 1995 841 640 148 --21677 993 --
NM_004954chr111296 ------
NM_004969chr101448 ------
NM_004976chr1165012 4742 3305 1616 1438 1099 --34094 1726 1018 --
NM_004978chr141215 1161 282 104 --21279 188 --
NM_004985chr1264511 4254 3834 2809 1576 133 13357 23757 3272 194
NM_004992chrX117926 7480 6793 6431 5195 3194 2673 1364 1237 683 291 --11097 --
NM_004992chrX117926 7480 6793 6431 5195 3194 2673 1364 1237 683 291 --11097 --
NM_005006chr21354 ------
NM_005010chr731404 679 383 11671 --1611
NM_005011chr72572 38 --21866 1329 11599
NM_005014chr91741 --1703 --
NM_005017chr3----145 --
NM_005022chr17195 ------
NM_005036chr2288009 7626 7480 6683 6198 5652 5085 1673 27614 5787 ----
NM_005044chrX64337 2766 1825 641 616 47 23736 1546 ----
NM_005045chr73783 704 679 --1116 --
NM_005051chr3122 ------
NM_005056chr1295612 4899 3748 3690 3632 3574 1415 716 216 --35265 3855 1098 12210
NM_005057chr141571 1538 769 367 --21790 1639 --
NM_005058chrY2242 84 ------
NM_005063chr1063467 2398 1536 170 85 72 1630 11505 --
NM_005065chr1464787 3315 1958 1024 493 307 1187 15138 --
NM_005068chr631241 335 68 ----11361
NM_005069chr2121716 1203 ------
NM_005076chr1123635 3615 3498 1475 1209 1082 999 930 765 562 269 123 ------
NM_005077chr9----2335 135 --
NM_005079chr871206 1107 1053 492 475 31 24 22732 2057 22873 2630 --
NM_005087chr32707 592 ------
NM_005093chr2084998 3450 1604 1473 1447 686 424 229 25356 5279 24737 1319 --
NM_005095chr141765 1587 548 390 ------
NM_005096chrX2412 139 --2853 810 11003
NM_005109chr362185 1817 979 972 373 81 11861 11985 --
NM_005112chr42854 398 --1347 --
NM_005116chr2054391 3898 2912 1172 185 ------
NM_005121chr1733013 2932 2578 --1527 12922
NM_005126chr351837 1543 600 411 128 ------
NM_005135chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_005137chr2252186 1005 970 828 111 11706 ----
NM_005155chr62485 214 --1675 --
NM_005156chr933829 3342 637 1841 1851 14805
NM_005160chr22156605 5923 5861 4441 1541 1533 1463 1308 886 638 580 574 189 160 93 34388 4351 265 21578 1158 26167 1614
NM_005161chr1162187 2167 2124 1742 493 427 ------
NM_005164chr1222449 974 11800 12562 1759
NM_005171chr1221025 378 ------
NM_005180chr102618 97 ------
NM_005181chr82695 587 --1764 --
NM_005187chr1651491 1313 397 211 158 1221 21663 769 --
NM_005188chr11157885 7267 6101 5639 5349 5342 5204 3188 3059 3027 2864 1303 562 382 275 36795 6132 1007 46077 5808 2774 2681 27551 6869
NM_005189chr1762340 2264 2164 842 688 229 147 1203 --
NM_005197chr14175933 5651 5382 4736 4673 4210 4116 4069 3874 3817 2449 2158 2056 1848 1147 912 295 14914 11679 15643
NM_005206chr175898 523 299 253 191 ------
NM_005207chr2273404 2824 2719 1170 684 165 40 ------
NM_005215chr18159 ------
NM_005219chr541675 272 247 175 ------
NM_005221chr7138 ------
NM_005229chrX1247 ------
NM_005230chr12169 ------
NM_005233chr332011 993 308 --2491 474 --
NM_005235chr2107821 7187 7157 5699 5691 5255 1057 983 413 403 46137 2294 290 156 35411 911 792 --
NM_005238chr1121099 118 33104 3007 502 13198 --
NM_005245chr42755 172 ------
NM_005252chr143702 193 46 ------
NM_005254chr1531342 1317 1080 ------
NM_005257chr1811352 ----1981
NM_005259chr221365 598 ----11088
NM_005261chr82992 981 11019 ----
NM_005264chr102853 751 1772 ----
NM_005271chr10128 --11204 --
NM_005274chr12154 131 ------
NM_005277chr421531 757 ------
NM_005296chrX1392 ------
NM_005302chr71128 ------
NM_005324chr17----11861 --
NM_005328chr81709 ------
NM_005339chr454037 1161 799 400 280 13859 ----
NM_005347chr941673 1656 1511 1396 ------
NM_005358chr1321860 228 1513 ----
NM_005359chr1895322 4827 4320 4179 2394 2190 2164 677 137 21276 888 11717 14397
NM_005375chr611191 1215 21157 1092 --
NM_005381chr2165 ------
NM_005382chr81357 ------
NM_005385chr392355 2095 1857 1785 1740 1100 1039 740 311 12337 ----
NM_005387chr111604 ------
NM_005399chr161572 1321 451 395 270 74 24029 441 24214 1730 12860
NM_005400chr252238 2215 1050 901 255 --42865 2137 1881 92 --
NM_005402chr731817 1318 433 --2541 395 --
NM_005406chr1841218 383 277 42 --11108 --
NM_005409chr441088 270 227 71 ------
NM_005410chr52562 72 ------
NM_005415chr22764 271 ------
NM_005417chr2041739 1640 455 81 11701 --11818
NM_005433chr1842786 1984 1973 790 ------
NM_005436chr1053564 3300 2737 2695 130 22771 730 ----
NM_005437chr1021022 526 1124 11160 --
NM_005443chr42369 150 ------
NM_005445chr10----1293 --
NM_005455chr111609 --134 1446
NM_005458chr922389 1926 12271 1418 --
NM_005460chr53583 524 142 ------
NM_005465chr122059 21 ------
NM_005475chr1232878 2825 577 31265 1196 697 ----
NM_005479chr101413 ------
NM_005487chr222413 279 --1174 --
NM_005493chr61305 1561 --1283
NM_005497chr1755873 5632 2207 1696 1039 ------
NM_005502chr932690 2394 1137 1249 ----
NM_005504chr12115870 5205 4701 4389 4113 1082 1064 846 429 216 98 26023 227 46429 5713 4365 4139 14308
NM_005506chr432322 2089 2063 1960 ----
NM_005522chr71123 ------
NM_005542chr731261 349 204 ------
NM_005544chr2----1719 --
NM_005563chr12787 253 ------
NM_005566chr112521 476 ------
NM_005569chr2231103 618 392 --1141 --
NM_005573chr5149 ------
NM_005575chr51261 ------
NM_005578chr394933 4829 4726 4199 3931 1329 1011 935 501 24842 1276 2820 794 --
NM_005581chr193434 327 168 ------
NM_005584chr133328 248 33 1322 ----
NM_005585chr15--1123 ----
NM_005587chr152378 194 --2872 285 --
NM_005593chr12----1134 1485
NM_005595chr13613 268 43 ------
NM_005596chr934910 3963 2564 24584 2157 12578 --
NM_005599chr131524 421 146 --11307 --
NM_005604chr672349 2310 2122 1793 733 358 184 ------
NM_005610chr11712 ------
NM_005613chr141616 695 323 125 --11620 --
NM_005614chr75969 426 331 58 42 ------
NM_005627chr61231 ------
NM_005638chrX11431 1335 --11710
NM_005660chrX----1213 --
NM_005665chr174835 3857 1291 796 606 475 164 14779 ----
NM_005668chr554202 3499 3481 768 145 ----13052
NM_005698chr1132 ------
NM_005700chr11----1121 --
NM_005704chr151065 1056 705 279 138 ------
NM_005715chr672730 2329 2138 1974 1863 1789 694 --1354 --
NM_005717chr141035 869 845 26 ------
NM_005721chr2----161 --
NM_005722chr231654 702 691 12231 ----
NM_005724chr152637 309 1155 1165 --
NM_005725chr141922 1831 1688 832 ------
NM_005731chr21431 ------
NM_005734chr11------1586
NM_005736chr1041000 441 433 309 --2182 88 --
NM_005737chr212530 11929 2645 450 --
NM_005738chr731602 605 228 21918 327 11614 --
NM_005746chr762567 2142 2002 602 333 122 ------
NM_005748chr1232441 2425 1124 21285 370 12641 --
NM_005754chr5----1486 --
NM_005756chrX41281 975 302 59 11294 ----
NM_005760chr2--136 ----
NM_005765chrX1820 ------
NM_005766chr1321115 511 ------
NM_005776chr14----1242 --
NM_005779chr552529 1418 1275 1262 396 196 --22299 1198
NM_005780chr132673 75 ------
NM_005786chr182273 245 ------
NM_005789chr1782144 2049 1972 1924 1911 1567 170 75 22133 1834 ----
NM_005795chr22702 528 12401 --12014
NM_005797chr1111448 ----1297
NM_005808chr363325 2570 1001 839 140 63 ------
NM_005828chr1774933 4566 4234 3877 3507 3125 49 --1649 --
NM_005832chr321267 548 ------
NM_005834chrX256 29 ------
NM_005840chrX147405 7092 6863 5260 5067 3012 2643 2458 1643 1466 667 637 625 474 17686 26452 6216 --
NM_005843chr2----11347 --
NM_005857chr121039 952 --21434 1211 --
NM_005859chr521585 306 ------
NM_005860chr1961655 1572 1425 1310 1221 340 ------
NM_005862chr31172 ------
NM_005871chr10147 1299 ----
NM_005880chr1611510 ------
NM_005895chr1263230 2970 2732 995 940 659 1898 13468 --
NM_005896chr22849 678 --2800 616 --
NM_005898chr1142021 1027 1007 560 --22619 169 1822
NM_005899chr17--11373 128 --
NM_005901chr18148650 8635 7483 7300 7154 5622 3252 3214 2412 2370 1828 1344 552 90 13490 --12273
NM_005904chr18----154 --
NM_005909chr562930 1657 1624 1571 1288 1192 --1114 1232
NM_005911chr211505 ----1253
NM_005920chr173503 3289 2873 2844 1497 1228 427 --11057 --
NM_005922chr62408 44 ------
NM_005923chr61607 ------
NM_005924chr73883 841 785 1820 11126 --
NM_005933chr1162950 2673 2075 1928 604 511 --2794 671 --
NM_005935chr445103 4767 4230 1942 25051 4356 ----
NM_005941chr844114 4001 3298 1025 ----34128 4077 1464
NM_005944chr35494 347 200 153 42 ------
NM_005955chr1104859 4780 3721 1954 1765 1706 1682 1472 1314 882 --14253 --
NM_005962chr1052250 2238 2060 1677 1494 ------
NM_005962chr1052250 2238 2060 1677 1494 ------
NM_005966chr232277 452 409 1743 12053 --
NM_006011chr1574181 3688 3408 3272 3012 2969 1584 --23770 338 1597
NM_006016chr632205 1880 1711 --168 --
NM_006023chr101174 ------
NM_006024chr72210 137 --1643 --
NM_006029chr14146 ------
NM_006036chr242377 786 500 336 11699 22389 888 --
NM_006037chr264620 4017 3040 1680 1411 430 14511 14039 13915
NM_006047chr2032643 2502 206 --23491 2210 --
NM_006048chr11445 11089 ----
NM_006054chr114544 510 483 276 --1204 --
NM_006079chr61757 ------
NM_006080chr71597 12678 ----
NM_006085chr12899 187 ------
NM_006089chrX21367 218 ------
NM_006090chr12517 152 ------
NM_006095chr463805 3780 1332 1075 50 33 --24149 4134 --
NM_006096chr841535 1362 295 80 --11366 --
NM_006106chr1143350 2241 1331 254 22855 2164 ----
NM_006107chr17140 1427 ----
NM_006113chr121957 1553 ------
NM_006133chr118762 750 739 698 679 344 287 160 --1357 --
NM_006135chr131419 1054 185 11257 11438 --
NM_006136chr71459 ------
NM_006147chr11413 --1432 --
NM_006148chr1772645 1935 818 737 548 498 383 --12585 --
NM_006154chr1562466 534 371 331 82 34 2589 236 --22363 552
NM_006158chr821400 552 --11388 --
NM_006159chr122651 208 ------
NM_006160chr1731571 1033 158 ------
NM_006166chr121892 ------
NM_006180chr941798 813 440 75 1730 ----
NM_006191chr122306 36 --1221 --
NM_006194chr1421129 110 ------
NM_006195chr9----1918 --
NM_006201chrX81088 1024 775 456 443 431 336 141 197 ----
NM_006203chr584771 4080 3724 1966 1888 1612 1352 138 34911 4593 1114 23715 1701 --
NM_006206chr462675 2477 1050 946 666 550 --22706 402 12052
NM_006216chr22638 257 1270 139 --
NM_006224chr1732439 681 355 --12479 --
NM_006226chr221200 444 ------
NM_006237chr1372140 2086 2048 1501 583 168 109 2868 388 11937 --
NM_006241chr332276 858 775 --11753 --
NM_006243chr11703 --1862 --
NM_006246chr1411170 ------
NM_006251chr5--33024 2955 1084 11131 --
NM_006252chr1146897 6622 6423 6336 6297 6265 6072 5632 1761 1570 1422 1414 787 506 12190 32094 1944 1465 1559
NM_006255chr143829 734 111 1877 ----
NM_006258chr102590 26 --11358 11491
NM_006264chr42184 124 ------
NM_006267chr2----21208 705 --
NM_006275chr201486 32443 574 47 ----
NM_006282chr2053145 2967 1810 1531 792 --11891 1770
NM_006283chr894827 4426 4043 3358 1493 1045 999 898 139 ------
NM_006289chr92388 55 1451 1369 --
NM_006306chrX145893 4929 4687 4585 4460 3972 2330 2118 1757 1507 1440 1153 510 89 11881 1520 1940
NM_006309chr3--146 ----
NM_006312chr121232 --1358 --
NM_006313chr122640 444 --21320 1272 --
NM_006315chr474334 3433 3157 3044 1784 974 164 11696 11776 --
NM_006317chr54343 111 86 74 2659 650 ----
NM_006321chr361871 898 858 737 621 83 1451 ----
NM_006327chr10--191 ----
NM_006328chr113245 177 79 ------
NM_006330chr831538 1069 289 ------
NM_006338chr11193 --144 --
NM_006345chr41178 --11298 2917 183
NM_006348chr72377 144 ----189
NM_006357chr22440 433 ------
NM_006359chrX41963 1548 466 318 12478 11828 169
NM_006362chr113233 133 54 ------
NM_006364chr1421028 284 ------
NM_006366chr61397 ------
NM_006371chr3105206 4873 4439 4214 1374 611 456 208 176 167 ------
NM_006372chr61491 ------
NM_006378chr931415 1396 1099 --11058 --
NM_006379chr732092 927 792 ------
NM_006380chr1794062 4022 3551 3333 3263 2947 1354 528 148 --127 --
NM_006390chr1251812 1741 1735 1384 683 ------
NM_006410chr112226 108 --1492 --
NM_006415chr91988 ------
NM_006420chr2033242 2304 425 ------
NM_006421chr82499 76 --1813 --
NM_006430chr22408 344 ------
NM_006434chr1062760 1131 806 631 523 483 --12239 --
NM_006449chr241517 1476 197 141 ------
NM_006451chr51320 1897 2681 153 --
NM_006454chr492855 1991 986 844 459 179 148 139 29 --12894 --
NM_006459chr1062036 1996 1687 1289 788 619 --1275 --
NM_006465chr1552347 2306 2048 388 72 ------
NM_006469chr111512 ------
NM_006476chr11178 --1641 --
NM_006482chr1273949 3142 2717 1474 1060 592 304 1960 11550 --
NM_006489chr1441845 1427 749 364 ------
NM_006496chr11740 ------
NM_006497chr171778 ------
NM_006504chr1062948 2812 2142 1174 809 767 --22564 651 --
NM_006516chr131443 1302 565 ------
NM_006520chrX31691 1675 1308 21275 1049 ----
NM_006526chr2011996 ------
NM_006534chr2062710 2601 2549 2482 1108 326 12911 ----
NM_006538chr232717 838 469 13415 23891 162 --
NM_006544chr1485567 5399 4554 4248 4027 1669 1088 157 15309 1751 --
NM_006546chr17105573 4144 2631 2488 2056 1655 1471 1100 504 429 --45671 4928 4274 1637 --
NM_006547chr71841 2486 113 21581 565 --
NM_006555chr751821 1711 1612 1526 599 11954 ----
NM_006557chr931563 494 374 ------
NM_006558chr8----1138 --
NM_006561chr1034840 2428 1456 1662 54207 1656 1647 1567 459 25254 728
NM_006572chr173961 894 306 1491 11366 --
NM_006577chr221169 339 ------
NM_006591chr1121844 204 --1736 --
NM_006595chr1141458 205 156 114 2640 544 21465 1383 --
NM_006599chr16138189 7980 7840 7201 5709 3095 2818 2603 2529 1580 1398 1221 912 15516 18048 16502
NM_006601chr121118 ------
NM_006602chr201572 ------
NM_006603chrX21263 662 11355 ----
NM_006608chr1--149 ----
NM_006609chr252758 2558 2317 2232 2216 22078 31 12562 --
NM_006614chr363691 2780 2277 2251 842 347 1809 13540 --
NM_006618chr151451 1306 1168 1078 330 129 ----
NM_006621chr111844 ------
NM_006624chr1011505 --2797 412 --
NM_006626chr92887 752 --32699 2248 416 --
NM_006628chr1554211 3545 3519 398 68 14689 23043 225 1249
NM_006646chr1342956 2087 353 232 --1591 --
NM_006650chr552761 2721 2694 742 319 --140 --
NM_006654chr1243897 3549 1156 202 13509 13371 --
NM_006660chr15197 ------
NM_006662chr16----178 --
NM_006667chrX31153 447 250 ------
NM_006677chr33241 61 37 ------
NM_006682chr742724 1091 1078 497 12570 ----
NM_006690chr2032203 702 239 1248 ----
NM_006699chr182639 2304 2191 2168 2087 1078 560 279 --11873 --
NM_006704chr131119 ------
NM_006706chr5----1739 --
NM_006717chr933379 2542 780 21147 402 ----
NM_006718chr61865 ----1352
NM_006720chr1075041 4223 3516 3486 1926 1662 102 11873 1258 --
NM_006722chr342659 2379 2341 69 --1489 --
NM_006724chr62408 44 ------
NM_006726chr43977 901 852 ------
NM_006727chr51499 ------
NM_006729chrX135601 5044 4973 4923 4917 4689 4510 4381 3495 1586 1188 1130 763 15649 15403 --
NM_006731chr9135335 4829 4802 4663 4470 4003 2236 1901 1232 1145 1067 455 239 14556 25768 1456 --
NM_006734chr611328 ------
NM_006738chr15114290 4232 3339 3223 3096 3049 1683 1267 998 220 30 --13921 --
NM_006745chr41166 1172 1142 --
NM_006750chr16117336 5356 2924 2193 2090 1256 916 677 585 178 164 ----17660
NM_006751chr21105 ------
NM_006754chr71383 ------
NM_006761chr173799 718 619 ------
NM_006766chr81472 ------
NM_006769chr11677 ------
NM_006772chr631621 507 310 ------
NM_006775chr632792 360 58 --12052 --
NM_006777chrX52895 2388 2079 783 541 --22510 2484 --
NM_006791chr15162 ------
NM_006802chr141201 1092 922 412 ------
NM_006805chr51448 ------
NM_006807chr17169 ------
NM_006826chr2----11081 --
NM_006827chr1483056 2726 2595 2397 1319 1291 811 754 1273 12547 --
NM_006832chr1431027 769 423 ------
NM_006835chr4----145 --
NM_006837chr8125 ------
NM_006846chr5160 --2323 266 --
NM_006851chr1242575 1950 1798 865 --22746 402 --
NM_006856chr1241061 458 391 86 --11088 --
NM_006874chr421247 1228 --1207 1151
NM_006875chrX3889 362 105 ------
NM_006885chr1653818 2735 1286 1144 440 1169 ----
NM_006888chr1452590 2581 1374 476 63 --42320 1259 1242 243 --
NM_006889chr331524 1469 103 --2440 370 --
NM_006892chr2021424 955 ------
NM_006892chr2021424 955 ------
NM_006895chr221553 1387 1467 ----
NM_006896chr72456 237 ----3461 346 309
NM_006899chr202295 262 ------
NM_006902chr11883 132 13141 --
NM_006908chr721255 1218 ------
NM_006912chr132126 747 383 ----12313
NM_006913chr6----1431 --
NM_006914chr951512 1015 615 596 93 1400 ----
NM_006915chrX41995 1821 1001 401 --1642 --
NM_006920chr22370 224 ----11975
NM_006922chr232357 632 218 1255 --11836
NM_006924chr1752882 1527 1499 318 266 ------
NM_006930chr521318 623 --11448 --
NM_006937chr171102 ------
NM_006939chr141838 --1889 --
NM_006940chr1221858 576 11283 ----
NM_006943chr2042618 2112 816 693 1830 ----
NM_006948chr212817 523 1108 166 1871
NM_006951chr103757 704 639 ------
NM_006980chr7--1601 1224 --
NM_006981chr932223 2149 28 ----1556
NM_006987chr1771184 916 359 270 243 217 141 ------
NM_006990chr172423 2145 1787 1755 769 535 45 --22299 500 --
NM_006991chr32956 858 134 ----
NM_006996chr121157 454 1359 153 --
NM_006997chr102169 113 ------
NM_006999chr571956 1490 1293 784 434 227 45 11325 ----
NM_007002chr20196 ------
NM_007005chr921061 216 ------
NM_007007chr1253983 1615 1603 1226 179 1704 11347 --
NM_007008chr23691 585 176 1250 1164 --
NM_007011chr15116759 5782 5269 4554 4426 4416 4361 4314 2054 1500 1031 16910 12058 --
NM_007013chr82363 172 ------
NM_007017chr5127 ------
NM_007018chr9----149 --
NM_007023chr22234 73 1161 ----
NM_007027chr32435 203 ------
NM_007030chr5104833 4649 4464 3539 1531 1307 1236 1118 238 28 1765 14137 --
NM_007033chr12860 579 1885 ----
NM_007034chr12901 309 --1978 --
NM_007035chr121603 ------
NM_007038chr2145792 4493 4086 314 25345 80 2904 727 15517
NM_007040chr194445 271 123 59 --2917 141 --
NM_007042chr372522 2259 2105 1759 1665 839 282 ------
NM_007043chr1222061 1850 --21668 31 --
NM_007050chr2065827 5260 5243 2860 2339 108 16219 15316 --
NM_007051chr11121 1165 ----
NM_007054chr574001 3513 2751 2725 1337 326 222 ------
NM_007067chr1711243 ----11382
NM_007076chr121112 ------
NM_007078chr1033056 2697 540 ----11987
NM_007084chr1311536 ------
NM_007099chr22366 134 ------
NM_007106chr1372702 2418 2071 2010 1718 126 102 22555 2524 12380 --
NM_007107chr321737 1664 --31934 1741 1690 --
NM_007114chr332398 2172 808 12832 21165 868 --
NM_007124chr651980 1838 1810 1605 160 ------
NM_007137chrX115569 5415 4498 4395 4169 3506 1833 1811 878 441 131 11633 21937 787 --
NM_007146chr1742844 2120 1990 526 ------
NM_007157chrX3704 359 207 --11949 --
NM_007159chr32384 94 ------
NM_007166chr1121544 351 ----11576
NM_007167chr13848 626 600 1348 ----
NM_007172chr2232829 2288 2073 --12790 1204
NM_007173chr1122100 688 1139 ----
NM_007174chr1232122 1516 365 --12331 --
NM_007175chr873560 3357 3316 1360 856 396 337 --23351 87 --
NM_007177chr372350 2304 2230 1546 474 438 28 ------
NM_007178chr121165 --1448 --
NM_007185chr13700 286 170 --1876 --
NM_007191chr12--1666 ----
NM_007195chr1873410 3263 3154 2731 2669 1276 425 --1202 --
NM_007200chr15114290 4232 3339 3223 3096 3049 1683 1267 998 220 30 --13921 --
NM_007214chr621342 972 ------
NM_007219chr204972 960 803 197 191 1810 --
NM_007222chr821451 174 ------
NM_007236chr15101874 1720 1559 794 593 515 433 370 159 111 ------
NM_007249chr13117949 6617 6598 6477 5901 3379 2202 2138 1865 1606 801 --1530 13088
NM_007286chr582129 2069 2019 1932 1822 743 689 448 ------
NM_007287chr352894 2665 2473 695 436 12101 ----
NM_007288chr352894 2665 2473 695 436 12101 ----
NM_007289chr352894 2665 2473 695 436 12101 ----
NM_007292chr1774973 4415 4390 4213 1288 542 310 11313 14947 --
NM_007322chr192534 404 --2538 174 --
NM_007345chr1832028 310 234 --12334 --
NM_007358chr111634 --186 --
NM_007361chr142498 183 ------
NM_007363chrX5959 723 430 126 118 ------
NM_007372chr173915 730 141 ------
NM_007375chr1--22252 2239 ----
NM_012081chr553521 2970 2580 2290 913 --23391 3341 11112
NM_012082chr81923 ------
NM_012089chr111400 1424 ----
NM_012090chr13389 130 29 --11229 --
NM_012092chr241447 1259 415 191 --2424 181 --
NM_012097chr231949 821 55 --22045 1499 --
NM_012100chr2--1747 ----
NM_012104chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_012104chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_012120chr632408 2045 263 11074 1423 --
NM_012129chr72609 555 1630 1911 --
NM_012153chr1122057 1780 --2132 89 --
NM_012158chr1321444 1315 --11645 --
NM_012161chr43924 820 27 ------
NM_012164chr9127285 7016 6884 6025 6018 4819 2930 2570 2452 2317 2071 1891 16585 26331 2902 --
NM_012189chr181579 1160 ----
NM_012193chr1175033 4090 4076 4011 3433 1561 872 21187 298 21247 142 --
NM_012197chr91184 11508 ----
NM_012199chr154413 3308 3163 2998 1090 13031 ----
NM_012200chr112380 22 ------
NM_012214chr2106146 5957 5458 2280 1712 1428 1200 1181 607 83 --194 --
NM_012234chr373140 3128 3103 2948 2538 457 265 ------
NM_012242chr101227 --1816 1278
NM_012243chr12925 266 ------
NM_012247chr101328 ------
NM_012249chr243192 3171 2325 1389 --22749 2588 23147 1352
NM_012250chr1131093 427 22 ----1372
NM_012252chr724819 323 14321 14800 --
NM_012257chr71196 ------
NM_012262chr194101 3891 3840 1325 885 868 662 392 239 --24449 4282 --
NM_012266chr92294 178 ------
NM_012287chr3104350 4265 3688 3606 3427 3250 2958 1345 1158 410 23521 93 14114 --
NM_012288chr6105275 4869 4168 4105 3947 1967 1947 945 91 77 15255 11007 --
NM_012297chr452631 2506 1688 760 357 --12043 1254
NM_012300chr531681 62 47 ----1911
NM_012301chr71613 --11960 --
NM_012307chr181433 ------
NM_012308chr1182483 1994 953 905 857 831 764 184 ------
NM_012309chr1184447 4275 4074 3615 3547 1913 912 832 ------
NM_012316chr1104781 4418 3946 3626 3550 2250 1563 1073 679 645 14411 ----
NM_012317chrX1192 2570 116 1784 --
NM_012319chr183833 224 185 ------
NM_012325chr2041639 1333 1056 191 ------
NM_012328chr73314 293 257 ------
NM_012329chr1741546 1040 221 170 --1433 --
NM_012333chr131318 1099 1044 --1248 --
NM_012334chr583411 3162 1743 1704 1587 1561 229 32 --23953 354 --
NM_012338chr71799 ----1505
NM_012382chr554160 3581 3202 1327 944 11732 34258 3305 2840 --
NM_012383chr91332 ------
NM_012399chr2231603 1514 326 ------
NM_012412chr71793 ------
NM_012417chr171628 ------
NM_012419chr62622 241 ------
NM_012426chr162312 66 ------
NM_012431chr773566 3158 2872 2476 1208 1184 744 13206 11300 --
NM_012433chr2137 ------
NM_012444chr201325 ------
NM_012446chr5157 ------
NM_012454chr6------1508
NM_012461chr145656 502 294 123 46 --1133 --
NM_012463chr1221783 740 --1109 --
NM_012474chr12219 30 ------
NM_012475chr1167 ------
NM_012482chr13565 506 65 1607 ----
NM_013231chr1464001 2929 1685 1451 1021 178 13203 ----
NM_013236chr222787 475 1924 ----
NM_013248chr201242 ------
NM_013255chr7118779 8076 7842 5746 3312 3099 2835 1296 925 675 425 --17099 12489
NM_013257chr842224 1927 847 765 ------
NM_013261chr423580 105 ------
NM_013262chr611347 ------
NM_013269chr1263680 3622 3478 3189 1707 478 1491 3562 191 167 --
NM_013279chr1162194 1763 1659 665 270 233 --1850 --
NM_013293chr7--1284 --1645
NM_013309chr1562352 2249 957 917 465 27 11983 ----
NM_013316chr71170 ------
NM_013341chr212802 22829 2312 12901 --
NM_013346chrX129 ------
NM_013354chr82161 132 11296 11107 --
NM_013357chr81711 1718 --1549
NM_013358chr171728 1346 1254 691 668 529 434 ------
NM_013372chr1542319 1178 1127 118 ------
NM_013381chr1252446 2066 942 878 369 ----185
NM_013390chr941730 1487 1474 1420 11604 ----
NM_013392chr22437 89 ------
NM_013396chr2111090 1436 11036 --
NM_013399chr1651799 1165 638 562 150 --11386 --
NM_013410chr11181 1492 ----
NM_013433chr1911358 ------
NM_013436chr23666 77 53 ------
NM_013444chrX2206 168 1978 ----
NM_013446chr71570 --1923 --
NM_013449chr1252906 2274 878 611 319 12850 ----
NM_013943chr143330 1122 545 208 ------
NM_013960chr82566 190 ------
NM_013981chr5----142 --
NM_013982chr5----142 --
NM_013983chr5----142 --
NM_013995chrX42468 2027 491 150 ------
NM_014000chr1051945 1254 1238 751 514 ------
NM_014002chr13512 264 112 --3247 161 151 --
NM_014007chr931175 1099 86 1457 ----
NM_014011chr232058 1782 139 --1477 --
NM_014016chr331170 627 601 --31325 1308 169 --
NM_014021chr153069 3024 2749 1314 715 --1449 12642
NM_014023chr1042134 470 422 396 --1913 --
NM_014028chr663149 3041 2586 2244 2059 435 --1797 12980
NM_014039chr1121309 1132 ----1257
NM_014043chr31602 ----11107
NM_014044chr2183 ------
NM_014048chr1654459 4243 3283 1299 855 13298 14512 13385
NM_014057chr921051 253 11325 11491 --
NM_014106chr1552625 2204 1072 952 680 ------
NM_014110chr141131 1041 407 240 --1269 --
NM_014112chr845111 1204 643 110 21796 1613 ----
NM_014117chr1621817 1739 --1745 --
NM_014139chr34872 857 195 22 ------
NM_014141chr784209 3933 3487 2009 1428 1132 1113 776 24609 4287 1284 11710
NM_014155chr1166140 5176 2761 2231 1358 1023 --16216 --
NM_014159chr31540 ----1188
NM_014165chr6189 ------
NM_014171chr22776 48 ------
NM_014176chr1164 ------
NM_014181chr212584 22558 2123 146 --
NM_014182chr121758 ------
NM_014212chr122713 175 ------
NM_014216chr1451685 1516 533 450 84 ------
NM_014217chr111495 2457 372 ----
NM_014220chr32843 117 ------
NM_014231chr1241899 1365 241 208 --1454 --
NM_014235chrX71743 1712 1648 1475 1196 414 40 ------
NM_014240chr354001 3842 3231 2676 1594 --22697 172 --
NM_014241chr10----148 --
NM_014243chr432113 1846 1444 1756 ----
NM_014245chr331122 815 230 ------
NM_014250chr222413 279 --1174 --
NM_014251chr72797 611 ----1751
NM_014253chrX52553 1771 993 437 335 11674 42484 2355 129 38 --
NM_014263chr103980 231 69 ------
NM_014271chrX1618 ------
NM_014279chr91966 --1150 --
NM_014280chr13877 258 41 ------
NM_014283chr11132 ------
NM_014289chrX1511 21347 226 11435 --
NM_014294chr821359 207 ------
NM_014296chr3----21012 593 1184
NM_014299chr1952159 1672 1552 1350 202 --32072 429 243 --
NM_014309chr2284853 3705 3362 2003 1721 1447 395 193 --15404 --
NM_014317chr10131 ------
NM_014319chr1221850 1496 ------
NM_014325chr124682 461 284 102 ------
NM_014329chr162286 90 ------
NM_014332chrX1324 ------
NM_014335chr1531281 364 59 11169 31114 970 32 --
NM_014342chr112547 141 11469 11435 --
NM_014344chr111835 ------
NM_014345chr63942 158 22 ------
NM_014368chr921967 1888 --1396 --
NM_014372chr12758 690 11844 ----
NM_014382chr311125 11522 --1326
NM_014392chr431116 604 428 ------
NM_014393chr872073 1604 627 416 332 297 209 1191 21923 502 --
NM_014399chr72672 283 --1101 --
NM_014400chr19135 --1409 --
NM_014405chr1772339 2022 1828 1499 725 392 293 ------
NM_014411chr731999 769 326 ------
NM_014423chr564718 4675 1433 1149 524 68 24965 365 --1444
NM_014431chr1031587 1389 482 11632 11408 --
NM_014437chr11155 ------
NM_014445chr32738 105 1261 1637 --
NM_014447chr411413 --11612 --
NM_014456chr1041601 1246 312 251 --11274 --
NM_014469chr113784 111 77 ----1674
NM_014470chr122241 35 ------
NM_014491chr73792 767 380 --1934 --
NM_014494chr162864 517 ------
NM_014498chr31322 170 ----
NM_014504chr711707 ----1187
NM_014505chr12--1337 ----
NM_014517chr33371 260 177 --11475 --
NM_014547chr151194 ------
NM_014547chr151194 ------
NM_014548chr1531499 1250 386 ----1155
NM_014554chr1252012 1690 801 722 159 --11618 --
NM_014570chr222868 111 ------
NM_014572chr132686 33 --11785 --
NM_014587chr1661516 1374 1365 1290 518 208 ------
NM_014600chr231636 1296 433 ------
NM_014612chr921054 557 ------
NM_014615chr1673386 3113 2639 2351 1188 1150 1132 1611 33323 2746 59 --
NM_014636chr974273 3578 3434 3175 1489 1031 442 13357 ----
NM_014646chr1863032 2622 2397 1077 873 471 ------
NM_014655chr161576 1559 1478 360 129 40 --1920 --
NM_014659chr152390 39 ----1801
NM_014661chr10113335 3278 2932 2827 2769 2559 2398 1283 290 248 154 12522 ----
NM_014666chr52427 85 --11254 --
NM_014667chr332329 2199 255 --1891 --
NM_014670chr241227 1198 256 89 ------
NM_014671chr73622 504 242 ------
NM_014676chr111454 ------
NM_014677chr821027 215 ------
NM_014678chr224713 523 176 43 --2573 64 --
NM_014679chr111282 ------
NM_014682chr832118 1811 1618 --11432 --
NM_014683chr1751759 1479 1389 185 117 ------
NM_014685chr16----1419 --
NM_014686chr1942080 1900 841 22 1509 --1571
NM_014689chr21122 ------
NM_014701chr152733 25 --155 --
NM_014702chr643232 2801 2442 1112 --13005 --
NM_014705chr732151 1343 648 ------
NM_014707chr7--195 22112 612 --
NM_014709chr2123 ------
NM_014717chr192211 26 ------
NM_014720chr1041325 361 279 105 --1574 --
NM_014721chr687383 7115 5304 2980 2575 2297 1011 887 ------
NM_014725chrX51405 1046 935 456 133 ------
NM_014726chr1771420 1190 1022 909 450 293 129 ------
NM_014729chr862056 1636 1551 801 789 365 --1288 --
NM_014731chr2061591 1407 1248 560 542 177 ------
NM_014733chr531922 1475 530 --12212 --
NM_014735chrX31995 1643 506 --22037 706 1376
NM_014736chr152714 387 1822 ----
NM_014739chr634089 230 57 ------
NM_014747chr1125724 5080 3973 3963 3828 3516 1947 1941 1658 1288 381 210 ------
NM_014751chr81825 ----11499
NM_014752chr1141273 1231 651 541 ----11596
NM_014755chr263838 3825 3693 1465 492 225 ------
NM_014757chr532322 1640 940 --177 --
NM_014760chr351637 1466 637 490 387 11830 1229 --
NM_014766chr741463 1302 141 55 ------
NM_014774chr173145 3109 2527 2271 2148 1149 101 21046 49 12615 134
NM_014776chr1272747 2574 1143 1137 872 635 457 1330 ----
NM_014779chr34886 789 321 263 ------
NM_014781chr81373 --1265 --
NM_014783chr1561822 1541 1107 536 344 259 --11764 --
NM_014795chr22385 53 1313 ----
NM_014803chr1022901 89 --140 --
NM_014810chr182700 2558 1380 1266 299 190 126 57 12908 33166 2325 1299 --
NM_014812chr11474 --21248 31 --
NM_014813chr11388 --2375 60 --
NM_014822chr41642 ------
NM_014827chr141354 450 425 76 11521 1394 --
NM_014828chr1422011 997 --1670 11841
NM_014829chr53408 105 25 --2822 658 --
NM_014830chr1252826 2658 1528 1412 204 --11360 13802
NM_014835chr20----22188 611 --
NM_014836chr1021435 71 11560 ----
NM_014839chr12548 57 ------
NM_014840chr1241033 849 577 78 12178 11103 --
NM_014841chr6----1181 11311
NM_014847chr11555 ------
NM_014850chr354808 3807 1475 884 518 13168 ----
NM_014857chr1185 ------
NM_014860chr23619 555 343 --1956 --
NM_014862chr1543676 3033 1417 1319 --14193 --
NM_014872chr972214 2077 2038 1974 1877 876 542 ------
NM_014875chr111077 1771 ----
NM_014877chr17117652 6396 6014 5682 5002 4945 3022 2875 1703 1126 394 12406 25038 1347 16521
NM_014888chr731204 1093 1080 ------
NM_014897chr1723134 2573 --22759 169 --
NM_014898chr1952138 2042 1882 1764 1609 1260 ----
NM_014900chr241139 1126 1048 407 ------
NM_014902chr2021565 333 ------
NM_014904chr1073331 2650 583 433 162 140 94 13190 12705 --
NM_014905chr241893 1573 705 80 135 1217 11586
NM_014906chr1741300 992 951 52 23468 3073 ----
NM_014912chr101304 12401 22600 67 --
NM_014913chr1811291 11487 ----
NM_014917chr11729 ------
NM_014918chr151398 ------
NM_014920chr672992 2948 2688 2681 1499 1357 74 ------
NM_014923chr1352239 2062 2006 470 372 ------
NM_014932chr3----11666 --
NM_014933chr41378 ------
NM_014935chr153483 2590 1058 402 232 11132 43309 1018 513 442 --
NM_014938chr1242511 2011 1858 435 ------
NM_014942chr622406 1682 --32054 1963 778 11878
NM_014946chr262260 1133 993 646 621 423 --32762 2344 639 --
NM_014947chr162574 2065 1154 1023 840 38 1569 ----
NM_014950chr1411506 11763 ----
NM_014953chr1364258 3162 3118 3058 1016 174 --23988 865 --
NM_014956chr115891 859 313 186 69 ------
NM_014961chr431747 752 441 1785 ----
NM_014962chr2022178 1070 --1192 11800
NM_014969chr12127 52 ------
NM_014977chr141183 ------
NM_014982chr1474859 4510 4335 4241 3620 848 412 13832 --13361
NM_014988chr42583 501 1105 ----
NM_014989chr62778 38 --11809 --
NM_014991chr432619 2569 1146 --1469 23167 515
NM_014999chr1251472 1211 552 344 69 1616 ----
NM_015000chr1263075 3013 2198 2135 305 156 32455 2292 2073 --1279
NM_015002chr1241962 840 514 41 --21802 813 --
NM_015008chr353464 3278 2484 2451 395 32413 1407 74 12327 --
NM_015009chr33254 62 40 --1196 --
NM_015011chr1341099 449 257 72 ----139
NM_015017chr12333 285 ------
NM_015020chr1673118 3088 1156 638 505 359 73 23357 2396 11128 --
NM_015025chr222158 1721 ------
NM_015026chr1244580 4242 3699 261 1135 ----
NM_015035chr20106303 5094 4868 4747 4094 2412 1708 1275 253 165 ------
NM_015039chr141518 972 110 68 13864 ----
NM_015040chr273327 2933 2430 2402 2279 1047 360 23441 391 33378 2950 1241 --
NM_015042chr15134292 4257 4133 4044 4001 3631 3463 2847 1499 695 464 191 154 13975 33759 2801 181 --
NM_015044chr1683089 2604 2454 2279 2146 1128 494 329 ------
NM_015045chr1062279 2096 1854 1421 561 203 ------
NM_015046chr92701 419 12433 ----
NM_015049chr223284 1153 12459 ----
NM_015051chr962977 2216 1032 754 316 233 ------
NM_015052chr71502 --2910 166 --
NM_015056chr213893 672 405 --1850 --
NM_015057chr131254 ------
NM_015060chr7----1218 --
NM_015068chr751590 1552 1068 319 256 12576 21501 1468 --
NM_015069chr16----1424 --
NM_015071chr5136183 5633 4915 4833 4632 4206 2507 2438 1245 1114 1037 866 120 12021 11424 --
NM_015074chr164011 3824 1700 1590 1347 54 14558 1116 14937
NM_015076chr673627 3601 3531 3122 2847 1582 788 13589 --24236 628
NM_015077chr17104321 3856 3746 3720 3256 3024 2881 1830 1182 845 --13236 --
NM_015079chr1583257 2852 2182 1986 1117 593 560 338 --21304 1223 --
NM_015087chr1332245 2027 585 --1572 12217
NM_015091chr141544 ------
NM_015092chr1624631 1052 1686 --24117 3298
NM_015093chr621527 335 --11841 1240
NM_015094chr2274159 1162 843 834 548 216 137 ------
NM_015097chr361963 1780 1529 726 432 164 12255 ----
NM_015100chr121991 371 21820 445 ----
NM_015107chrX91626 1562 1513 1507 733 634 293 200 83 --11761 --
NM_015116chr1331650 526 65 --1562 --
NM_015132chr731772 242 179 21539 1395 ----
NM_015141chr332236 1731 36 --32468 501 477 --
NM_015149chr172178 2022 663 641 576 247 76 ------
NM_015153chr61573 ------
NM_015155chr1011017 --12630 12506
NM_015156chr1473531 3522 722 397 155 115 36 ------
NM_015161chr1631540 1465 1431 --21506 70 --
NM_015163chr1461970 574 504 478 38 28 --11285 --
NM_015170chr831443 885 802 --11938 --
NM_015176chr12592 401 --1419 --
NM_015185chrX42892 1183 1026 1006 --1400 --
NM_015187chr42997 940 --1953 --
NM_015191chr1122689 2581 --21695 911 --
NM_015192chr2082916 2589 2393 2379 1998 462 451 78 ------
NM_015199chr312117 --12872 1514
NM_015205chr1344785 3875 1522 22 11695 ----
NM_015210chr181862 --2130 27 --
NM_015216chr511532 ------
NM_015225chr982891 2482 2305 2094 1198 764 88 63 --1108 --
NM_015231chr112278 58 --1892 --
NM_015245chr682118 905 800 779 571 341 184 62 --1826 --
NM_015250chr911698 --11811 1808
NM_015251chr163905 642 520 --12014 --
NM_015252chr22983 131 --1120 --
NM_015265chr252328 1029 726 670 310 --12614 --
NM_015270chr1212231 1189 12077 --
NM_015271chr453176 2769 891 775 756 13291 --14151
NM_015275chr1242115 1805 292 179 ------
NM_015282chr252610 2500 2407 2321 608 1948 1333 --
NM_015293chr62504 72 ------
NM_015299chr1444007 3689 1589 691 22800 590 11341 --
NM_015305chr1461972 725 497 392 306 179 ----11761
NM_015310chr8108146 7776 7641 7370 5469 2440 1990 1842 1222 825 12027 15649 --
NM_015313chr1162957 1677 1274 1064 238 112 --23720 1366 --
NM_015315chr522807 328 ----12298
NM_015317chr252606 2235 653 556 315 ----12683
NM_015326chr162781 2157 2009 867 373 190 ------
NM_015328chr7112712 2680 2591 2552 2336 2258 2069 495 195 107 61 12382 2830 502 --
NM_015335chr122431 172 ------
NM_015336chr1241899 1745 778 187 12595 ----
NM_015338chr2051577 1510 426 396 364 --1297 --
NM_015345chr652717 981 767 245 170 ----12659
NM_015346chr1461751 1640 1532 570 244 142 1471 ----
NM_015347chr1282223 2072 1912 973 853 529 523 68 1985 12792 --
NM_015349chr621154 425 ------
NM_015355chr172355 158 ------
NM_015358chr2121096 414 ------
NM_015365chrX74063 4012 3476 3191 1132 388 81 --54299 4084 3856 798 737 --
NM_015367chr2221056 643 11591 ----
NM_015375chr1114864 4546 4102 3720 3177 2010 1904 1435 1146 1122 569 21774 1049 ----
NM_015381chr2221758 497 ----11597
NM_015382chr142495 187 ------
NM_015385chr1062760 1131 806 631 523 483 --12239 --
NM_015387chr262135 2041 1705 1536 448 398 --21578 743 --
NM_015397chr92730 650 --2504 220 --
NM_015424chr11165 ------
NM_015429chr321071 739 1420 ----
NM_015435chr841263 1239 549 27 --11162 174
NM_015442chr3127 ------
NM_015443chr172529 136 ------
NM_015449chr12567 510 ------
NM_015453chr362001 1545 835 738 644 343 ------
NM_015455chr534062 1207 931 1947 2972 654 1760
NM_015458chr855270 4311 3857 882 171 --14656 --
NM_015463chr2148 ------
NM_015475chr21392 ------
NM_015483chr71106 1136 1784 --
NM_015497chr152769 34 --2455 398 --
NM_015508chr31437 ----11042
NM_015520chr311865 1783 --12011
NM_015525chr6----1854 --
NM_015530chr23847 267 70 ------
NM_015542chr101293 ------
NM_015548chr6--1916 ----
NM_015550chr773567 3264 2563 1212 1057 1007 432 --12218 --
NM_015553chr6115153 5016 4526 4270 4260 4145 4119 3621 3439 1282 730 11563 13708 --
NM_015554chr1552474 2254 2244 2158 349 --11987 --
NM_015564chr553551 3129 2881 997 565 --1415 --
NM_015567chr1311092 ------
NM_015568chr2073673 3217 2997 1563 1173 490 484 --11652 --
NM_015570chr721469 228 ------
NM_015571chr662365 1746 760 646 90 28 --1540 --
NM_015576chr362850 2655 2197 1830 200 175 --11981 --
NM_015599chr62323 203 ------
NM_015602chr121549 1318 21739 467 ----
NM_015609chr1112637 2631 2517 2426 2017 1842 1826 1055 1032 668 73 1591 1914 --
NM_015626chr1721173 928 ------
NM_015630chr2----1180 --
NM_015646chr121428 --11162 --
NM_015651chr972165 2017 1916 1619 628 548 137 ------
NM_015684chr14----1224 --
NM_015691chrX102967 2569 2375 2367 2349 2117 1939 1846 1034 247 ------
NM_015695chr641818 1429 337 35 12119 ----
NM_015719chr192552 91 ------
NM_015726chr131317 1133 50 --21210 741 --
NM_015844chr182955 312 ------
NM_015846chr182955 312 ------
NM_015847chr182955 312 ------
NM_015850chr872422 2390 2304 2293 1953 820 148 1121 1289 --
NM_015859chr14------1172
NM_015866chr121036 973 ------
NM_015878chr842232 1774 1724 1454 ------
NM_015879chr18138581 7674 6901 6150 6087 3257 3207 1950 1724 1708 1688 514 473 1462 25870 297 13325
NM_015886chr8115037 4377 3921 1910 1884 1878 1806 1687 1243 1129 880 23671 1280 --15617
NM_015888chr132164 537 84 ------
NM_015902chr81326 --1887 --
NM_015904chr23744 627 256 --1756 --
NM_015906chr1114736 4562 4530 3772 3315 1643 1502 1131 936 638 494 1106 24091 3194 --
NM_015912chr841027 714 316 226 ------
NM_015915chr141305 ------
NM_015916chr10----138 --
NM_015927chr16--1359 ----
NM_015975chrX2274 91 11740 1373 --
NM_015982chr172359 295 ------
NM_015984chr12419 166 ------
NM_015995chr15125079 4967 4562 4414 4368 4250 3777 3540 1810 1287 853 669 14009 14598 --
NM_016009chr1104899 4430 4251 3761 3265 3118 947 602 519 258 ------
NM_016022chr13953 47 37 --1124 --
NM_016023chr831520 848 340 --1103 --
NM_016025chr1612028 --11233 --
NM_016037chr131090 890 768 ------
NM_016039chr14--132 ----
NM_016040chr141982 1944 911 357 12028 11768 1441
NM_016059chr6------1247
NM_016061chr211538 21642 61 11250 --
NM_016072chr1232425 1824 1642 --12079 --
NM_016075chr1353178 2804 2554 1265 789 23140 557 21018 941 --
NM_016076chr133171 1290 926 ----12141
NM_016083chr683977 3950 3519 3071 2939 2683 1548 672 23393 3103 ----
NM_016096chr831566 640 543 11587 ----
NM_016097chr184994 837 805 328 ------
NM_016098chr62437 172 ------
NM_016103chr51407 ------
NM_016106chr14131 ------
NM_016107chr511169 --11364 --
NM_016120chrX41187 1121 380 308 ----11192
NM_016125chr17290 57 ----1396
NM_016129chr4----165 --
NM_016131chr252138 1850 1482 119 35 12362 --1916
NM_016132chr1532343 2251 2199 ------
NM_016133chr231526 1506 1395 ------
NM_016141chr32524 59 ----1649
NM_016152chr331269 1055 438 2453 178 ----
NM_016156chr1142304 2122 734 501 --12246 --
NM_016166chr15183 --1209 --
NM_016206chr387626 7536 7497 6107 5590 2812 1651 588 38818 7776 1851 23049 2617 --
NM_016211chr41378 ------
NM_016213chr151178 159 ----
NM_016226chr12----1373 --
NM_016227chr11132 ------
NM_016230chr62398 195 ------
NM_016231chr1741666 1152 1121 22 --1131 --
NM_016248chr1323680 1410 13199 1199 --
NM_016252chr22391 163 --1287 --
NM_016255chr663000 2848 2651 2641 565 130 12775 1968 --
NM_016260chr265665 2395 2021 1813 1272 850 22358 168 15301 --
NM_016272chr2242195 1931 1764 1728 12446 1473 --
NM_016274chr1180 ------
NM_016275chr342771 1812 622 611 --2974 301 --
NM_016281chr121366 ------
NM_016284chr163958 804 134 ------
NM_016287chr141870 1405 451 271 ----11709
NM_016289chr212151 ----1859
NM_016303chrX--191 ----
NM_016316chr2----1526 --
NM_016320chr1141110 990 443 61 ------
NM_016322chr932549 2288 955 --32924 2794 71 --
NM_016351chr72212 88 ------
NM_016352chr751339 1166 1078 315 83 11445 ----
NM_016357chr122486 55 11231 ----
NM_016376chr1744316 2908 2819 554 --13288 11618
NM_016395chr153267 123 62 ------
NM_016396chr1572495 2003 1208 946 654 618 172 ------
NM_016410chr91522 ------
NM_016422chr1132366 596 317 ----22329 459
NM_016424chr1721545 622 11932 1466 --
NM_016436chr2032496 2318 2143 --22515 875 12472
NM_016441chr221576 511 ------
NM_016448chr151903 1853 453 180 121 11526 ----
NM_016456chr1177 ------
NM_016467chr21453 --21363 1156 --
NM_016485chr641728 1531 654 63 --1905 --
NM_016488chr1231546 750 646 ------
NM_016505chr15691 668 655 289 182 ------
NM_016507chr171236 ------
NM_016513chr672992 2948 2688 2681 1499 1357 74 ------
NM_016525chr93972 655 286 ------
NM_016526chr1161884 1697 1538 325 223 146 22443 252 ----
NM_016530chr1543933 3765 2791 1539 1673 3666 476 258 --
NM_016531chr464098 3931 3038 2691 412 62 --1896 --
NM_016548chr92618 444 ----11069
NM_016562chrX31588 1031 632 ----127
NM_016598chr351068 589 423 103 53 ------
NM_016603chr51346 1724 ----
NM_016604chr53963 855 155 ------
NM_016607chrX--1227 1187 11610
NM_016613chr462785 2638 2446 1894 943 464 1776 1200 --
NM_016623chr8----189 --
NM_016628chr101729 ------
NM_016631chr212991 36 --1210 --
NM_016641chr1641344 1321 141 37 ------
NM_016653chr221036 236 ------
NM_016654chr1531342 1317 1080 ------
NM_016733chr2231103 618 392 --1141 --
NM_016823chr174393 169 123 61 ------
NM_016824chr1031577 1267 273 ------
NM_016929chr684566 3565 1662 1501 1305 1132 450 154 --2541 89 --
NM_016937chrX1305 ------
NM_016946chr183422 2705 2336 2203 963 343 127 52 --12796 --
NM_016950chr4--1569 ----
NM_017409chr121528 ------
NM_017415chr5113511 1664 1590 1277 940 727 581 474 397 175 47 1914 ----
NM_017420chr1423727 994 22923 2512 --11065
NM_017423chr451518 808 640 465 207 2773 30 ----
NM_017426chr41249 ----1611
NM_017440chr121105 --1631 --
NM_017447chr2143057 892 576 336 ----1254
NM_017456chr1741597 616 589 326 ------
NM_017490chr111296 ------
NM_017491chr42854 398 --1347 --
NM_017563chr3105170 5153 5043 3902 1680 844 765 457 385 42 --21586 1219 --
NM_017582chr131284 1169 83 2330 129 31432 518 52 --
NM_017586chr982009 1968 1699 1622 1379 505 295 237 1477 ----
NM_017594chr931070 578 382 22874 604 ----
NM_017596chr193780 3515 3466 1453 1017 759 448 163 141 ------
NM_017599chr1241804 771 320 167 --11776 11393
NM_017610chr1521302 83 --32062 1899 1659 --
NM_017613chr211350 ------
NM_017629chr141680 735 432 244 --21236 565 --
NM_017632chr4----1313 --
NM_017633chr633707 3136 1383 11476 21522 899 --
NM_017634chr82269 243 1724 ----
NM_017635chr1111618 --21332 35 --
NM_017637chr978763 6359 2632 1735 1259 992 60 16044 57958 5956 5735 3120 723 29349 8431
NM_017640chr63849 312 151 ------
NM_017641chr122303 171 1272 1968 --
NM_017644chr374859 4737 4538 3773 3633 1194 898 --14029 --
NM_017650chr745590 2430 1875 186 55796 3801 966 870 575 25463 700 15231
NM_017651chr61278 --1122 --
NM_017658chr1444509 3931 1763 1345 ----1718
NM_017661chr151131 --1376 --
NM_017662chr952076 1514 568 394 39 ------
NM_017666chrX31751 1412 610 11840 ----
NM_017676chr531773 737 257 --21415 373 --
NM_017693chr1321664 1150 ------
NM_017709chr164037 2947 1690 850 653 366 13857 ----
NM_017719chr312345 1766 1121 12191
NM_017737chr131586 876 418 --31681 1630 386 --
NM_017738chr931006 841 100 ------
NM_017742chr1811861 123 ----
NM_017744chr12577 81 1264 1908 --
NM_017748chr171318 --1344 --
NM_017753chr92379 366 ------
NM_017763chr173367 259 57 ------
NM_017779chr122572 845 12640 22453 2067 --
NM_017780chr8----1791 --
NM_017798chr201991 --21204 1116 --
NM_017799chr1421859 217 --11479 --
NM_017801chr321974 531 31946 390 26 --11768
NM_017811chr953157 2053 1933 912 28 --11966 --
NM_017812chr71742 ------
NM_017813chr8105737 5660 5441 5361 5201 4971 4892 2051 1307 448 --1941 13718
NM_017824chr1022536 2076 --32715 2659 213 --
NM_017830chr4----166 --
NM_017847chr121632 164 --1529 --
NM_017848chrX84480 4185 1638 1437 708 645 489 157 1515 14395 --
NM_017869chr162587 133 ------
NM_017887chr11387 ------
NM_017893chr1041304 1154 95 43 --165 --
NM_017902chr1095690 4463 4196 2233 1887 1014 573 523 414 24495 991 45378 4390 1256 1059 15587
NM_017910chr21351 ------
NM_017913chr91434 ------
NM_017919chr9115209 5057 3915 3538 2068 1555 1294 1168 1073 621 244 --14998 --
NM_017923chr41266 ------
NM_017925chr921658 239 --41915 1805 255 160 --
NM_017938chrX82208 2157 1945 1441 1389 533 407 270 ------
NM_017943chr1411025 --1259 --
NM_017944chr1132859 129 60 --2787 441 --
NM_017966chr111318 --11296 --
NM_017974chr221167 265 1977 ----
NM_017987chr1022140 644 11468 --137
NM_017988chr122808 673 --1812 --
NM_017990chr1673772 3340 3174 1568 1394 559 151 --33857 3294 3132 --
NM_017998chr941463 1368 341 162 11380 ----
NM_018014chr2--11309 1312 11333
NM_018017chr1042885 2834 2219 2211 --32284 2006 1058 11987
NM_018030chr1811099 186 ----
NM_018036chr1443838 3721 1454 320 --12980 11145
NM_018043chr1131424 1003 498 ------
NM_018045chr162571 2530 2480 2061 1192 332 1902 2932 640 --
NM_018048chr1232051 1905 1372 --11313 11847
NM_018053chr14783 565 543 343 --1283 --
NM_018061chr141075 665 580 337 ------
NM_018070chr11155 ------
NM_018078chr41933 ------
NM_018084chr241301 1060 222 209 ------
NM_018086chr231758 1407 741 ------
NM_018098chr31167 ------
NM_018107chr141868 --2281 23 --
NM_018110chr1651035 1018 425 206 41 ------
NM_018112chr9150 --1706 --
NM_018115chr42804 745 --1693 --
NM_018117chr101507 ------
NM_018121chr1022612 2423 ------
NM_018126chr411220 ------
NM_018128chr171112 1598 --1183
NM_018144chr101260 ------
NM_018145chr153498 134 127 1426 ----
NM_018155chr342955 2644 1322 352 1872 ----
NM_018157chr12--12110 11228 --
NM_018182chr1772152 2013 1431 1424 821 411 402 --1244 --
NM_018184chr341881 1628 1488 632 1373 11544 --
NM_018195chr1132014 1454 826 --11579 --
NM_018199chr14----11248 --
NM_018203chr13560 286 89 ------
NM_018206chr161122 ------
NM_018207chr141681 561 167 40 --1311 --
NM_018211chr13740 590 64 ----11758
NM_018214chr641086 1065 252 23 ------
NM_018221chr2166 --155 --
NM_018222chr1131794 1228 26 --31644 1633 72 --
NM_018227chr443137 3131 3125 2442 --22341 556 --
NM_018241chr45903 408 382 135 31 1724 148 11023
NM_018243chr473861 2967 2878 2742 1437 644 330 ------
NM_018247chr642881 2344 821 595 ------
NM_018257chr2042027 1765 1025 63 --12098 --
NM_018261chr42381 168 ------
NM_018263chr252278 2244 1741 1731 547 --22508 336 --
NM_018287chr10--11205 ----
NM_018299chr822607 1195 --23145 121 1925
NM_018307chr172764 726 ------
NM_018312chr1142108 1722 875 849 ------
NM_018314chr111509 3252 216 189 --1679
NM_018318chr123934 276 154 ------
NM_018348chr16--1284 ----
NM_018351chr1293748 3593 3582 3325 1636 1272 537 340 97 13631 21152 284 13620
NM_018360chrX1129 ------
NM_018362chr1123957 3279 12614 ----
NM_018364chr133763 956 229 ------
NM_018368chr62218 188 ------
NM_018369chr52647 113 1621 1768 --
NM_018373chr14106135 6114 5697 5527 5230 4659 4639 2462 1182 578 --21411 1221 15064
NM_018374chr764635 4167 1753 1504 1177 321 --13939 14973
NM_018387chr91134 --1392 --
NM_018388chrX31174 394 221 ------
NM_018400chr1174488 4418 3570 3200 2969 1083 161 --13456 --
NM_018403chr343289 3194 972 653 22919 1602 ----
NM_018416chr124730 481 384 181 --12322 12413
NM_018424chr931831 1744 705 ----11339
NM_018429chr522554 2081 --12818 1650
NM_018433chr22489 86 ------
NM_018440chr8148262 7889 7688 7384 6605 6309 6223 3387 3189 3099 3030 1017 371 208 --26984 6645 11310
NM_018445chr151206 ------
NM_018448chr12----11135 --
NM_018452chr6_random43699 2925 1075 572 --11359 --
NM_018453chr14125 ------
NM_018462chr33323 253 226 ------
NM_018464chr103383 69 45 ------
NM_018465chr91224 ------
NM_018469chr1731422 1343 134 --11131 --
NM_018475chr41624 ------
NM_018476chrX192 1191 ----
NM_018477chr141687 --11075 --
NM_018482chr872574 827 816 770 511 171 52 --22261 680 --
NM_018489chr142307 609 461 59 ------
NM_018490chr1131473 1310 721 1424 1104 --
NM_018509chr1741415 231 99 24 ------
NM_018553chr1731358 185 136 ------
NM_018557chr2----199 11512
NM_018566chr155019 4565 4277 2066 1389 23237 1569 134 --
NM_018571chr2--1608 ----
NM_018590chr1031750 271 67 11419 ----
NM_018638chr1265422 4404 2250 1999 1936 1687 24831 959 ----
NM_018640chr1222528 2261 12688 --1583
NM_018649chr101494 ------
NM_018650chr13845 396 90 --11783 --
NM_018671chr151234 142 ----
NM_018686chr121139 ------
NM_018689chr1581974 1861 1648 984 552 271 194 106 ------
NM_018695chr522096 375 --22146 441 --
NM_018698chrX21923 496 ------
NM_018700chr52595 179 11179 11275 --
NM_018704chr131904 1611 404 1296 ----
NM_018710chr821117 1027 ----1929
NM_018712chr1121470 405 --21106 41 11536
NM_018715chr131644 676 580 --21989 171 --
NM_018717chr462774 1097 957 903 824 353 --22255 1981 --
NM_018728chr1531577 1189 1011 ------
NM_018834chr5--1262 ----
NM_018836chr1122 21153 136 2944 251 --
NM_018840chr201371 ------
NM_018841chr1103945 3320 2979 2878 2541 1495 1225 1190 1023 73 --11078 --
NM_018847chr931639 1459 393 ------
NM_018890chr721255 1218 ------
NM_018898chr532043 615 421 192 --11499
NM_018899chr532043 615 421 192 --11499
NM_018900chr532043 615 421 192 --11499
NM_018901chr532043 615 421 192 --11499
NM_018902chr532043 615 421 192 --11499
NM_018903chr532043 615 421 192 --11499
NM_018904chr532043 615 421 192 --11499
NM_018905chr532043 615 421 192 --11499
NM_018906chr532043 615 421 192 --11499
NM_018907chr532043 615 421 192 --11499
NM_018908chr532043 615 421 192 --11499
NM_018909chr532043 615 421 192 --11499
NM_018910chr532043 615 421 192 --11499
NM_018911chr532043 615 421 192 --11499
NM_018945chr673261 2630 2543 2249 854 378 146 --23646 1035 --
NM_018952chr171196 ----1479
NM_018962chr2121434 141 1358 11249 --
NM_018963chr212515 260 ------
NM_018970chr752372 1019 440 232 193 ------
NM_018976chr1232191 2182 62 ------
NM_018979chr1232607 1925 92 ------
NM_018999chr1024515 3262 --11819 --
NM_019001chr353171 1725 868 393 46 --13987 11011
NM_019005chr71102 ------
NM_019008chr22113514 3258 2840 2790 2784 1232 844 341 332 326 100 2437 71 11505 --
NM_019022chr1873122 3025 2204 2061 1086 277 228 13190 12681 --
NM_019024chr2--181 ----
NM_019027chr422403 2355 ------
NM_019035chr431978 1946 509 1752 21830 616 --
NM_019036chr62806 450 ------
NM_019044chr264465 3861 3165 3104 1546 1507 1972 13006 --
NM_019050chr432229 2023 796 11567 ----
NM_019058chr101534 ------
NM_019060chr11317 ------
NM_019063chr242135 2092 625 579 --2865 414 --
NM_019072chr583645 3518 3339 2780 1603 1577 864 853 13708 12895 12951
NM_019080chr1331443 1263 87 ------
NM_019083chr111297 11231 ----
NM_019084chr1022490 1865 --31977 790 734 --
NM_019087chr51203 --11551 --
NM_019098chr8--21869 744 ----
NM_019102chr7------1448
NM_019102chr7------1448
NM_019106chr2293154 3148 2527 2352 1366 875 834 654 227 13006 2898 717 --
NM_019116chr1653102 3073 1125 666 194 ------
NM_019555chr34314 205 165 42 ------
NM_019556chrX21376 1096 --161 --
NM_019558chr22110 95 ------
NM_019590chr10--1189 21283 1193 --
NM_019592chr9168 --2641 117 --
NM_019593chr2033044 2793 2114 ----1925
NM_019600chr152714 567 ------
NM_019604chr112960 306 --1241 --
NM_019610chr171759 1549 1361 300 111 89 78 1389 ----
NM_019842chr61138 ------
NM_019845chr22617 73 1272 ----
NM_019857chrX31330 1117 427 --31334 79 35 --
NM_019887chr123570 543 266 ------
NM_019895chr311082 ------
NM_019903chr1031577 1267 273 ------
NM_020039chr1251626 1201 273 169 70 1306 ----
NM_020066chr12893 82 ------
NM_020116chr421234 610 11668 ----
NM_020120chr22395 385 ------
NM_020122chr255897 5432 527 368 360 --25996 68 --
NM_020131chr141624 1495 272 24 1237 11304 --
NM_020144chr71468 --22008 1945 --
NM_020148chr1852985 2159 1026 705 277 1827 ----
NM_020152chr213708 110 42 1907 ----
NM_020154chr152272 85 ------
NM_020157chr202820 115 11040 ----
NM_020159chr441570 1170 669 335 --11516 --
NM_020168chr1561263 1116 1031 970 845 82 11222 ----
NM_020177chr532784 1126 413 --12927 --
NM_020186chr72515 50 ------
NM_020198chr1711286 ----11598
NM_020199chr51295 --2938 223 --
NM_020214chr151173 ------
NM_020235chr31304 136 --1372
NM_020240chr572282 2020 1834 1792 931 296 284 ------
NM_020244chr12125 ------
NM_020245chr644679 4366 1506 330 --34077 1569 190 11368
NM_020251chr111543 1659 ----
NM_020307chr3--147 ----
NM_020310chr1752765 2387 2346 2328 686 ----1644
NM_020336chr2062927 2886 2634 1150 1005 377 1176 22558 1139 --
NM_020337chr442358 802 169 133 1885 ----
NM_020338chr1031324 1300 402 13260 12667 --
NM_020341chr2021294 558 ------
NM_020342chr221821 635 11849 --1111
NM_020346chr1141614 1223 500 352 1678 11358 --
NM_020357chr321527 650 --184 1383
NM_020381chr641422 1387 776 642 ----11459
NM_020382chr122429 211 11448 ----
NM_020384chrX41349 476 326 86 --11889 --
NM_020390chr374706 4111 1736 1166 1082 1029 1003 --11653 --
NM_020403chr131642 ------
NM_020420chrY1550 1105 --11835
NM_020423chr1----1491 --
NM_020425chr651475 1308 1274 387 228 11977 ----
NM_020440chr123067 1113 --12978 11151
NM_020443chr1116413 4590 4371 2543 1858 1463 1445 816 759 474 54 11909 45281 2588 2305 1036 --
NM_020444chr53975 273 60 --11531 1561
NM_020449chrX2286 133 ------
NM_020456chr1352347 2232 2039 632 70 ------
NM_020463chr21482 1956 ----
NM_020473chrX3750 255 120 11901 ----
NM_020475chr82814 173 --22347 744 --
NM_020476chr82814 173 --22347 744 --
NM_020477chr82814 173 --22347 744 --
NM_020478chr82877 236 --22410 807 --
NM_020480chr82814 173 --22347 744 --
NM_020532chr23691 585 176 1250 1164 --
NM_020630chr102187 24 ------
NM_020640chr33835 699 633 ------
NM_020644chr112286 260 ------
NM_020647chr872253 1865 1816 1568 526 465 414 11453 ----
NM_020654chr3----11356 --
NM_020682chr1021072 876 ------
NM_020696chr3128 ------
NM_020699chr184621 1560 1323 831 637 355 269 22 --13859 --
NM_020703chr11386 ------
NM_020704chr7--21805 63 ----
NM_020713chr2092873 2746 2592 2346 623 603 534 503 374 13007 ----
NM_020715chr1472289 1779 1677 749 428 257 78 ------
NM_020717chrX84791 4141 1899 1041 611 452 391 139 --14588 --
NM_020718chr16115899 5561 5134 5033 2552 2173 1977 1148 717 665 365 15879 24139 1620 14257
NM_020727chr2153419 1500 1230 1114 1020 23958 1259 1473 --
NM_020738chr22259 236 ------
NM_020739chr1543363 732 612 233 1582 13261 --
NM_020742chrX21885 1760 12538 ----
NM_020747chr51937 1374 ----
NM_020748chr1741617 1607 323 202 1818 ----
NM_020750chr62249 87 11361 1413 --
NM_020752chr10--41027 910 660 430 12755 --
NM_020766chrX54279 1574 818 534 332 1885 ----
NM_020768chr553077 3019 971 355 138 1152 1263 1143
NM_020769chrX3929 320 143 ------
NM_020772chr17108305 7829 7590 7221 6348 6224 5991 5941 1996 1961 --37249 1696 1555 --
NM_020774chr18115634 4317 2315 1978 1880 1819 1564 1230 1144 664 242 15735 ----
NM_020778chr15124849 4626 4457 3587 3531 3206 1946 1788 1673 1662 727 519 ------
NM_020781chr773160 3055 2842 1217 1099 732 505 --1585 --
NM_020792chr342126 606 316 108 12779 ----
NM_020801chr51531 ----1821
NM_020805chr183486 361 101 ------
NM_020806chr14------1344
NM_020808chr11307 ------
NM_020809chr1132179 1815 1660 21585 781 21986 162 --
NM_020810chr14103600 2355 2308 1098 955 373 362 351 166 137 ------
NM_020819chr611237 1251 134 --
NM_020824chr10139 ------
NM_020834chr143767 449 432 --21250 91 --
NM_020841chr1273872 3832 3436 3359 1549 498 306 12958 12932 --
NM_020845chr1292355 2282 2211 1893 1754 788 661 497 162 ------
NM_020850chr1693099 3051 2579 2360 2246 2134 1210 908 122 11071 32908 971 870 1844
NM_020854chr1821531 993 11450 ----
NM_020858chr1542014 471 351 271 ------
NM_020861chr6----147 --
NM_020866chr13--1125 ----
NM_020870chr431981 1956 492 ------
NM_020871chrX42567 2411 1020 969 ------
NM_020872chr331295 648 115 ----1275
NM_020892chr72356 150 ------
NM_020897chr191230 1188 1077 496 401 392 277 235 141 ------
NM_020899chr1751547 910 826 753 61 11939 ----
NM_020909chr294027 3369 2636 1668 795 703 615 421 348 1454 12965 --
NM_020920chr141376 ------
NM_020921chr1453322 2984 935 597 98 --13215 1194
NM_020922chrX71878 1759 1672 697 520 385 303 21717 1593 ----
NM_020927chr1632249 844 206 11493 11733 --
NM_020935chr264448 4255 1842 1225 874 95 ------
NM_020940chr1032939 2193 37 --11875 --
NM_020946chr951703 1146 649 526 154 ------
NM_020948chr142517 247 154 73 1950 12916 --
NM_020951chr1952059 1873 1744 928 541 ------
NM_020952chr9--1548 ----
NM_020956chr19114035 4026 3790 3166 3070 1116 1099 778 569 412 207 23008 1141 ----
NM_020962chr1551935 1546 923 808 767 12128 1849 --
NM_020964chr1894487 4144 3900 3478 3088 1440 1083 754 656 11271 24148 1860 14734
NM_020975chr1021355 797 --21367 343 --
NM_020981chr21149 1664 ----
NM_020983chr1212231 1189 12077 --
NM_020988chr1651315 1306 1072 889 486 ------
NM_020993chr1231930 1890 106 12738 ----
NM_021003chr143775 342 29 --1541 --
NM_021005chr15--1246 ----
NM_021007chr252300 2250 2046 896 373 --12401 --
NM_021033chr1332987 2359 1163 ----1826
NM_021035chr2031212 1009 273 1423 121 --
NM_021061chr884508 4057 3784 3549 3458 1586 1553 1547 13976 21269 185 14367
NM_021064chr661425 1318 1265 1217 464 150 ------
NM_021069chr421802 222 ------
NM_021072chr531822 297 76 12009 1556 --
NM_021083chrX53007 953 842 800 338 ------
NM_021090chr22104924 3996 3532 3478 3058 515 309 300 214 192 ------
NM_021097chr243062 599 553 101 ------
NM_021101chr332119 662 62 1918 1948 --
NM_021109chrX1147 ------
NM_021109chrX1147 ------
NM_021110chr8189 --1483 --
NM_021127chr181329 --31374 1315 480 --
NM_021132chr101181 1902 ----
NM_021133chr121166 483 --11430 134
NM_021140chrX4761 719 274 84 ------
NM_021145chr72806 158 1758 ----
NM_021155chr1953020 2939 2048 680 654 --1937 --
NM_021158chr202840 72 ------
NM_021168chr1651566 1376 1184 260 110 ------
NM_021177chr61242 --1254 --
NM_021183chrX1572 --1452 22480 375
NM_021189chr121072 799 --2974 879 --
NM_021190chr111069 --1546 --
NM_021202chr2092715 2504 2257 1997 1909 590 410 319 171 12107 12860 --
NM_021204chr4--1298 --1753
NM_021220chr202370 35 ------
NM_021229chr1221022 404 1362 ----
NM_021237chr3----1226 --
NM_021238chr1241913 1573 774 188 --11501 --
NM_021239chr1431157 414 266 --11258 --
NM_021249chr1451664 1629 1101 335 35 --11216 --
NM_021252chr1021500 1414 1296 ----
NM_021253chr621390 957 ------
NM_021255chr1433401 846 74 1718 13514 --
NM_021614chr51275 ------
NM_021619chr921165 266 ------
NM_021622chr1052091 864 833 429 24 --1114 --
NM_021629chr331511 145 81 14884 ----
NM_021633chr151224 1120 1026 1015 943 --1866 --
NM_021639chr13931 723 341 ------
NM_021647chr453926 1252 910 773 149 13555 ----
NM_021648chr682758 1955 796 551 529 466 321 168 --31685 811 295 --
NM_021705chr631506 501 304 ------
NM_021722chr71171 ------
NM_021723chr72212 88 ------
NM_021728chr14----1746 --
NM_021813chr6105702 5456 4071 3796 3790 2219 1460 344 202 186 14105 14472 --
NM_021814chr611532 --11726 --
NM_021818chr1431444 1105 434 --11081 --
NM_021912chr1573992 3783 3316 3089 1236 643 60 --23838 1114 --
NM_021913chr1941455 523 396 50 1124 ----
NM_021914chr143675 609 451 ------
NM_021935chr32894 44 1827 ----
NM_021943chr621900 604 ------
NM_021945chr663029 1242 1072 874 424 99 --1858 --
NM_021947chr171844 --11330 --
NM_021951chr92719 185 1909 195 --
NM_021956chr631376 489 109 ------
NM_021959chr66828 707 369 270 93 62 --1279 --
NM_021960chr132114 2108 361 12163 12585 --
NM_021961chr11106973 6441 6277 5984 5876 4599 4552 2995 1983 189 11414 16623 --
NM_021964chr342559 2479 1758 1247 14146 1188 --
NM_021976chr61802 ------
NM_021977chr633169 2959 2855 ----13686
NM_021979chr14----1367 --
NM_021980chr101963 21038 532 ----
NM_021988chr2031465 484 375 ------
NM_021992chrX----140 --
NM_021999chr13----2159 125 --
NM_022037chr2----1217 --
NM_022041chr162998 794 --1196 --
NM_022048chr15106201 6188 4970 4342 1670 1410 1370 1300 834 257 1199 --12259
NM_022060chr1461369 1356 1288 1040 481 49 ------
NM_022068chr183495 226 161 --1603 --
NM_022073chr1451230 625 284 263 113 --11189 --
NM_022075chr12609 51 --1653 --
NM_022085chr641420 1253 1179 392 ------
NM_022114chr1103929 3501 3374 3315 1401 990 659 596 338 277 ------
NM_022118chr13140 --1150 --
NM_022124chr101199 ------
NM_022129chr104952 581 305 76 1104 ----
NM_022130chr541314 277 255 213 1376 11450 --
NM_022132chr51133 ------
NM_022133chr82763 317 1729 2584 388 11340
NM_022145chr53633 595 265 ------
NM_022160chr91441 ------
NM_022166chr16165806 5608 5538 4795 4657 4630 4597 4588 4386 4103 2349 1671 1653 786 536 182 14967 46363 6120 6035 4960 --
NM_022167chr172855 166 ------
NM_022170chr7--21601 196 ----
NM_022173chr2----1217 --
NM_022343chr92845 411 1220 ----
NM_022351chr843271 2973 2857 509 23501 2542 21004 513 21023 989
NM_022373chr71169 1767 ----
NM_022374chr22331 28 ------
NM_022442chr2031465 484 375 ------
NM_022459chr1396199 6153 5500 5242 4654 4538 4137 2319 1512 26062 1479 ----
NM_022462chr19143322 2840 2607 1347 1268 1129 994 695 624 303 283 165 145 24 --12984 --
NM_022465chr1283043 2442 1120 1080 788 502 107 39 ------
NM_022475chr41567 ------
NM_022476chr1631121 736 116 1915 181 1336
NM_022477chr2051752 1566 1340 1205 156 --194 --
NM_022482chr202394 213 11729 1432 1297
NM_022484chr761313 894 573 408 107 42 ----11382
NM_022494chr102445 150 ------
NM_022497chr383135 2933 2914 2667 1496 1418 649 544 --23860 2514 --
NM_022553chr61131 --1417 --
NM_022566chr152593 414 ------
NM_022650chr53854 791 188 1889 1919 --
NM_022652chr121813 --1937 --
NM_022658chr12----2166 134 31109 1011 871
NM_022659chr8------135
NM_022731chr11222 176 ----
NM_022735chr13732 346 102 ------
NM_022737chr1941243 1135 469 283 1978 ----
NM_022749chr841199 71 62 55 1486 11041 --
NM_022754chr531301 716 148 ------
NM_022756chr121466 1083 ------
NM_022763chr3103108 2999 2843 2776 2437 1245 636 511 461 287 --1812 --
NM_022776chr331292 435 243 21258 594 ----
NM_022781chr933049 369 61 --22891 462 --
NM_022802chr1011234 --11334 --
NM_022823chr21446 ------
NM_022824chr51601 ----1566
NM_022826chr21272 --21115 959 --
NM_022828chr521389 136 ------
NM_022836chr171626 1487 1429 627 570 107 99 ----11344
NM_022841chr1521711 260 ------
NM_022843chr1321072 994 --1547 --
NM_022845chr1652199 726 279 247 152 --12085 --
NM_022893chr242683 1164 958 767 1866 ----
NM_022894chr211678 --1276 --
NM_022898chr1474235 3948 3871 1580 1312 1283 887 --14513 --
NM_022901chr931791 1585 233 ------
NM_022912chr222015 110 ------
NM_022977chrX52278 2032 1919 1737 432 --11861 --
NM_023012chr122494 249 ------
NM_023016chr232614 695 504 22522 1845 12465 1941
NM_023033chr124543 371 193 169 ------
NM_023037chr131120 ------
NM_023039chr5185 ------
NM_023079chr1731426 1167 507 1635 ----
NM_023105chr872422 2390 2304 2293 1953 820 148 1121 1289 --
NM_023106chr872422 2390 2304 2293 1953 820 148 1121 1289 --
NM_023110chr872422 2390 2304 2293 1953 820 148 1121 1289 --
NM_023111chr872422 2390 2304 2293 1953 820 148 1121 1289 --
NM_023927chr541289 1043 360 300 ------
NM_023929chr832633 2535 332 --22581 698 22547 2166
NM_024007chr543091 2676 2253 999 --11061 --
NM_024015chr1731117 873 114 --1443 --
NM_024017chr1721465 173 ------
NM_024045chr10--2168 47 ----
NM_024061chr72407 183 1559 178 --
NM_024089chr13--1140 ----
NM_024111chr152645 143 1619 2733 188 --
NM_024329chr161555 1027 297 283 275 106 --11008 --
NM_024345chr975010 4751 1709 1260 1198 1095 681 ------
NM_024348chr92282 82 ------
NM_024411chr202255 141 ------
NM_024416chr921051 253 11325 11491 --
NM_024421chr183995 879 814 ------
NM_024423chr1842790 1459 1224 703 14148 14254 --
NM_024501chr22530 272 165 ----
NM_024511chr493557 3463 2202 2176 823 788 426 400 74 12529 ----
NM_024524chr32953 355 --2679 640 1911
NM_024529chr111067 ------
NM_024539chrX148 --1377 --
NM_024546chr132497 65 ------
NM_024548chr3----1346 1111
NM_024551chr1222563 2246 ------
NM_024551chr1222563 2246 ------
NM_024561chr1311194 --1188 --
NM_024563chr541836 1611 1245 574 11217 155 --
NM_024574chr4175 ----1310
NM_024575chr11489 ------
NM_024582chr421124 711 ------
NM_024586chr11120 2556 469 ----
NM_024594chr531862 1453 491 --11778 --
NM_024595chr11920 ------
NM_024602chr12668 292 ------
NM_024607chr883911 3715 3152 3120 3051 2895 1120 811 --23113 2862 11372
NM_024612chr17285 59 --11000 --
NM_024613chr841354 530 168 38 11556 ----
NM_024617chr91629 ------
NM_024626chr161404 1183 1039 502 324 202 --11578 --
NM_024631chr11162 ------
NM_024636chr752494 2467 2225 1998 523 ------
NM_024639chr642826 2500 2160 700 ----1989
NM_024646chr172680 2531 1062 731 636 442 144 --11170 --
NM_024659chr22778 76 ------
NM_024663chr20140 ------
NM_024665chr374069 3699 3432 1409 1204 1179 888 14374 ----
NM_024670chr102510 148 21289 101 --11318
NM_024674chr172739 2513 2198 2172 2073 971 103 --1910 --
NM_024692chr221445 640 ------
NM_024699chr81854 ----2838 641
NM_024702chr173599 559 206 ------
NM_024705chr1321105 228 ------
NM_024707chr191220 ------
NM_024713chr1521374 301 --11088 --
NM_024721chr82754 740 ------
NM_024744chr232265 506 167 --11967 --
NM_024749chr132241 2103 853 1287 1451 --
NM_024751chr431672 833 748 22036 1511 ----
NM_024755chr15------169
NM_024757chr91837 ------
NM_024763chr1----11021 --
NM_024770chr266445 5327 4873 2157 1490 55 36737 5603 1381 --12325
NM_024779chr121392 ------
NM_024786chr53595 87 74 ------
NM_024787chr83396 364 189 ----1268
NM_024811chr1141371 751 582 525 --1567 --
NM_024812chr862144 2105 667 610 156 138 1188 --11501
NM_024824chr142600 574 1137 1412 --
NM_024828chr91381 --2171 139 --
NM_024830chr541635 589 495 436 ------
NM_024835chr17148 ------
NM_024874chr141364 1356 60 42 ------
NM_024884chr1494510 4406 4091 4056 3106 1542 1169 1007 715 23985 1356 ----
NM_024887chr14426 284 171 40 ----1657
NM_024913chr721274 1245 ------
NM_024915chr851916 698 673 624 413 ------
NM_024930chr552727 1753 1104 988 965 22542 68 ----
NM_024944chr2121067 405 ------
NM_024948chr101565 ------
NM_024953chr1252794 2439 2402 504 267 12724 11060 --
NM_024956chr153446 161 154 ------
NM_024960chr20----197 --
NM_024971chr9--1548 ----
NM_024989chr288078 7550 3132 2889 2748 2427 2288 252 21528 426 21513 1486 28041 7560
NM_024991chr1062760 1131 806 631 523 483 --12239 --
NM_024993chr221221 635 ------
NM_025054chr884129 3996 3944 3423 3032 2998 1495 1380 23120 1262 13132 --
NM_025057chr142943 124 ------
NM_025073chr164491 3972 3796 3719 3125 1568 11030 1229 --
NM_025074chr452470 2454 637 582 155 12009 12773 --
NM_025076chr23605 538 29 ------
NM_025090chr1721038 524 ----11328
NM_025099chr172165 77 ------
NM_025114chr12----1107 --
NM_025134chr1642602 588 580 203 ------
NM_025135chr181438 ------
NM_025138chr1331326 976 422 ------
NM_025146chr322029 899 --11941 11974
NM_025147chr22939 325 ------
NM_025158chr51348 ----1459
NM_025179chr1104687 3681 3625 3258 3210 1890 1375 1363 986 294 --21636 1356 --
NM_025182chr95913 861 752 258 182 ------
NM_025184chrX--1628 ----
NM_025191chr173395 3069 2542 2381 1055 819 469 12729 1900 --
NM_025195chr821556 1491 --21690 240 --
NM_025211chr91216 ------
NM_025221chr431075 985 70 ------
NM_025222chr342902 2598 2422 877 12126 ----
NM_025224chr2072125 1996 1833 875 637 566 31 --1477 --
NM_025234chr15165 ------
NM_025244chr2----1276 --
NM_025246chr3150 167 ----
NM_025248chr1742496 2102 1215 602 --1830 --
NM_030576chr1772565 2231 2204 2122 533 406 367 1304 1834 --
NM_030579chr1693640 3181 2825 2793 2766 2347 990 650 557 13450 23307 3234 --
NM_030594chr1511293 --11162 --
NM_030621chr1443289 2922 1480 1210 --14207 13612
NM_030625chr1042489 2458 2192 1963 --190 --
NM_030627chr542764 781 424 415 11589 13874 --
NM_030629chr1631894 1551 1210 ------
NM_030640chr123865 634 583 ------
NM_030647chr775558 4903 4068 1986 936 116 83 25238 4935 1694 --
NM_030648chr475068 4650 4636 3859 1188 1130 1048 14151 --14548
NM_030650chr233902 3379 909 33956 3037 2895 44118 3870 1673 415 --
NM_030664chr103859 690 527 2583 93 1320 --
NM_030674chr12115697 4769 4095 4079 3643 2123 1762 1328 899 705 543 15161 1402 --
NM_030751chr1021628 112 11241 1560 --
NM_030751chr1021628 112 11241 1560 --
NM_030759chr104634 563 539 273 ------
NM_030762chr1221986 503 --11700 11743
NM_030786chr151903 1786 1418 659 505 ------
NM_030791chr1431485 1333 561 --2568 547 --
NM_030792chr111645 ------
NM_030797chr21194 ------
NM_030803chr221167 265 1977 ----
NM_030806chr1129264 8755 8617 8319 5944 3622 3543 2996 1639 1507 984 35 12789 ----
NM_030809chr1292357 2248 1829 1803 1667 897 547 194 21 ------
NM_030810chr641420 1253 1179 392 ------
NM_030816chr153496 3234 3102 2943 711 ------
NM_030820chr61389 ------
NM_030884chr352325 1997 1805 717 551 --22269 619 --
NM_030915chr262308 2186 2010 1942 1718 634 --12362 --
NM_030923chr21157 ------
NM_030927chr1031622 1420 189 ------
NM_030939chr611043 ------
NM_030962chr114463 432 315 307 1157 ----
NM_031157chr121547 ------
NM_031216chr1842185 1787 1727 134 --11535 --
NM_031226chr1521130 1111 --21282 350 --
NM_031243chr7----1210 --
NM_031244chr63922 353 286 3971 947 391 ----
NM_031262chr91722 ------
NM_031263chr91779 ------
NM_031268chr1674975 4560 3650 3578 1707 1694 1494 1738 ----
NM_031271chr831541 1111 460 11672 ----
NM_031296chr442632 1850 933 894 22481 153 ----
NM_031314chr1451900 1703 1638 1360 815 146 ----
NM_031372chr421417 192 ------
NM_031411chr532043 615 421 192 --11499
NM_031412chr1221270 907 ------
NM_031418chr1152592 1999 689 285 122 12023 ----
NM_031426chr942681 2258 2126 160 --12202 --
NM_031442chrX1488 1670 --13062
NM_031450chr112580 24 1481 1129 --
NM_031453chr101572 --1329 --
NM_031459chr131642 1039 459 --1452 --
NM_031461chr832038 835 451 11987 ----
NM_031468chr7168166 7967 7211 6483 6269 5113 2347 1937 1925 1912 1482 1367 1263 1068 1057 632 --31637 1471 616 16528
NM_031469chr644023 1239 586 385 31610 1373 72 13389 13572
NM_031476chr1662702 2491 2279 2201 2132 836 ------
NM_031483chr2043275 2997 2510 63 ------
NM_031844chr113507 --13840 --
NM_031845chr283468 3250 2924 2586 2397 729 397 296 ------
NM_031847chr283468 3250 2924 2586 2397 729 397 296 ------
NM_031849chr532043 615 421 192 --11499
NM_031857chr532043 615 421 192 --11499
NM_031858chr17--11373 128 --
NM_031860chr532043 615 421 192 --11499
NM_031862chr17--11373 128 --
NM_031890chr2242138 783 593 62 12279 ----
NM_031935chr1----1958 --
NM_031940chr862474 2102 1636 1614 1596 178 ------
NM_031953chr41115 ------
NM_031992chr7--21601 196 ----
NM_032013chr2051752 1566 1340 1205 156 --194 --
NM_032042chr552793 2276 2201 492 272 ------
NM_032047chr342303 2238 2202 176 ------
NM_032102chr1132418 470 130 1100 ----
NM_032104chr12452 42 ------
NM_032105chr1105741 5591 3135 3072 1810 1658 1541 1106 452 42 16423 42600 2071 1691 983 --
NM_032116chr13105835 5820 5148 4944 4890 2357 2331 845 577 551 1383 13682 --
NM_032121chrX82489 2388 2191 2176 1115 926 725 291 --3327 295 102 --
NM_032128chr4----1818 --
NM_032143chr2----1336 --
NM_032147chr1251004 790 384 234 218 --1180 --
NM_032154chr1021015 90 1119 ----
NM_032160chr1864145 2656 1675 1642 1493 1050 1348 22798 1010 --
NM_032174chr151454 981 547 469 210 --11476 --
NM_032182chr1081575 1458 1427 1383 648 378 367 169 11523 21211 1075 --
NM_032189chr1334587 3677 1324 11497 ----
NM_032193chr1152036 830 818 354 273 11284 ----
NM_032199chr1033737 3505 999 --23909 556 --
NM_032217chr441301 456 201 174 ------
NM_032221chr20--1201 ----
NM_032229chr1311168 ------
NM_032236chr1------1820
NM_032246chr1521335 83 ------
NM_032256chr121710 1367 ----
NM_032268chr1682629 2589 2458 2183 1981 1094 802 511 ------
NM_032288chr3--11898 ----
NM_032289chr531902 1699 513 --1616 --
NM_032291chr131647 543 162 ------
NM_032312chr21635 ------
NM_032321chr282818 2786 2749 2716 1071 561 491 320 --43193 2905 826 95 --
NM_032325chr1151911 1506 1370 814 473 --11250 --
NM_032329chr273801 3732 2894 2764 858 773 454 --186 --
NM_032352chr1421238 30 11180 11270 --
NM_032353chr17130 ------
NM_032373chr1085638 4724 4340 2331 1652 1277 1034 135 ----11837
NM_032379chr11136 199 ----
NM_032380chr5144 ------
NM_032424chr111220 --11631 11100
NM_032435chr1166 --1274 1578
NM_032439chr1031598 523 133 --1196 --
NM_032440chr102250 47 --2725 688 --
NM_032449chr161942 799 634 435 400 60 --1886 1203
NM_032452chr1451336 607 582 102 61 ------
NM_032457chr463737 3340 3257 2946 135 102 13639 ----
NM_032458chrX72728 2340 2153 1348 437 383 206 --12371 1467
NM_032466chr831464 1121 298 ------
NM_032468chr831464 1121 298 ------
NM_032482chr1982563 2189 1995 1847 1697 1070 399 376 ------
NM_032491chr1211151 --1262 --
NM_032499chr1531570 1131 470 1578 1138 --
NM_032505chr362783 1765 1062 983 824 784 1860 ----
NM_032521chr2063121 2328 983 957 729 650 --22637 2582 --
NM_032557chr43314 192 84 1660 ----
NM_032558chr94969 566 440 393 ------
NM_032576chrY1129 ------
NM_032582chr1741427 1400 744 427 11524 ----
NM_032590chr1211071 ------
NM_032601chr2156 ------
NM_032622chr431511 1422 188 --11572 --
NM_032632chr1431751 1618 1328 --1241 --
NM_032682chr343495 3197 1336 198 --23483 472 --
NM_032689chr1931437 1382 1006 ------
NM_032717chr431027 841 129 ------
NM_032727chr1061593 1184 1141 413 366 355 ------
NM_032765chr51852 ------
NM_032772chr10--1149 ----
NM_032784chr6142 --2927 662 --
NM_032786chr121554 --1595 --
NM_032796chrX2261 154 ------
NM_032801chr1132471 1959 147 12378 ----
NM_032804chr101221 1532 22407 262 --
NM_032810chr1021121 475 ------
NM_032826chr7115303 4608 4087 3771 2138 1881 1021 915 480 322 93 14890 ----
NM_032828chr19134785 3066 1884 1858 1745 1483 1389 1107 965 859 833 807 244 11076 ----
NM_032833chr172527 2176 1705 651 528 393 44 1631 2683 37 --
NM_032837chr1742066 1602 488 342 --1497 --
NM_032839chr31161 ------
NM_032842chr741057 491 465 352 ------
NM_032846chr1461515 1325 550 531 500 410 --11393 2621 374
NM_032858chr11100 ----1114
NM_032866chr1573161 2624 2576 2067 761 627 601 --12811 --
NM_032873chr1174419 4173 3457 3339 3144 1123 610 --11319 13408
NM_032884chr11366 ------
NM_032932chr17106000 5918 5329 5258 5104 5082 5035 1234 937 349 22528 706 15457 --
NM_032943chr11136 199 ----
NM_032961chr42901 21 ----2911 269
NM_032967chrX1414 ------
NM_032968chrX94021 3776 3534 3288 3088 947 730 592 399 1411 ----
NM_032969chrX94021 3776 3534 3288 3088 947 730 592 399 1411 ----
NM_032973chrY94013 3768 3530 3283 3083 947 730 592 399 1411 ----
NM_032975chr1833412 2518 1381 12259 ----
NM_032978chr182169 163 ------
NM_032979chr182169 163 ------
NM_032980chr1833412 2518 1381 12259 ----
NM_032981chr182169 163 ------
NM_032982chr792573 2516 2283 2115 2047 1791 944 410 153 ------
NM_032983chr7153387 3330 3097 2929 2861 2605 2115 1224 967 789 580 567 531 371 241 ------
NM_032999chr761107 353 222 146 126 64 ------
NM_033000chr761107 353 222 146 126 64 ------
NM_033001chr761107 353 222 146 126 64 ------
NM_033012chr13194 ------
NM_033014chr921051 253 11325 11491 --
NM_033017chr731377 1210 592 1648 ----
NM_033018chrX81088 1024 775 456 443 431 336 141 197 ----
NM_033020chr1114736 4562 4530 3772 3315 1643 1502 1131 936 638 494 1106 24091 3194 --
NM_033023chr711156 21221 826 11230 --
NM_033030chr231567 1234 1219 ------
NM_033044chr13389 130 29 --11229 --
NM_033058chr82807 145 ------
NM_033071chr62504 72 ------
NM_033087chr931334 1190 973 ------
NM_033103chr191945 2335 89 ----
NM_033121chr1251416 545 497 289 122 ------
NM_033133chr1783583 3338 2594 1188 1116 690 300 119 23275 2349 ----
NM_033136chr541546 1378 1252 560 11811 ----
NM_033137chr541546 1378 1252 560 11811 ----
NM_033161chr971475 1416 1331 1272 424 78 23 ------
NM_033181chr683977 3950 3519 3071 2939 2683 1548 672 23393 3103 ----
NM_033211chr521868 325 22055 1881 ----
NM_033224chr7117222 6704 6229 5897 5244 5019 2658 1730 1157 938 529 22836 2183 27830 5687 11062
NM_033225chr82727 271 12494 --11002
NM_033251chr161376 ------
NM_033255chr133423 115 101 ------
NM_033259chr31779 ------
NM_033272chr2182 ------
NM_033281chr52319 277 1194 ----
NM_033285chr853536 3519 3184 1422 1192 13576 24458 142 --
NM_033290chrX93735 3296 3139 2555 1452 1051 848 633 405 ------
NM_033315chr173700 427 178 ------
NM_033331chr943120 3105 2792 1360 12747 23243 3231 --
NM_033338chr103914 903 255 11299 ----
NM_033339chr103914 903 255 11299 ----
NM_033340chr1041030 1019 371 106 11415 ----
NM_033360chr1264632 4375 3955 2930 1697 254 13478 23878 3393 1215
NM_033375chr1771456 1138 598 517 505 252 179 ------
NM_033380chrX194 ------
NM_033381chrX194 ------
NM_033389chr1744632 4064 3336 413 11027 ----
NM_033393chr42225 23 --12788 --
NM_033394chr221611 1539 11162 ----
NM_033402chr81215 ------
NM_033425chr11103477 2505 1372 1328 1283 1257 1242 1157 839 644 13100 ----
NM_033429chr1562402 2210 717 371 218 117 ------
NM_033430chr484079 3481 3401 2668 1410 699 671 363 ------
NM_033437chr484079 3481 3401 2668 1410 699 671 363 ------
NM_033449chr541816 1674 1444 45 1242 1218 --
NM_033495chrX298 36 ------
NM_033503chr15103739 3577 3245 3154 2943 2516 1454 1233 1170 761 ------
NM_033505chr222461 481 24313 4280 ----
NM_033506chr71175 ------
NM_033512chr882994 2609 1206 1129 738 303 70 24 --22559 813 --
NM_033535chr43924 820 27 ------
NM_033551chr522807 328 ----12298
NM_033624chr1241962 840 514 41 --21802 813 --
NM_033631chr1123847 3688 3371 3323 2853 1348 1298 1074 969 879 580 559 1488 ----
NM_033642chrX3247 140 42 1476 ----
NM_033644chr531681 62 47 ----1911
NM_033645chr531681 62 47 ----1911
NM_033656chr2175137 4867 4449 4276 4121 2138 532 --14569 --
NM_044472chr12735 47 ------
NM_048368chr181314 ------
NM_052818chr1361777 1469 1440 773 454 48 21634 434 1703 --
NM_052832chr81162 11155 42606 2364 2339 43 --
NM_052837chr1132 ------
NM_052877chr12445 54 ------
NM_052880chr2231378 1260 76 ------
NM_052885chr1244058 3685 1620 74 --1639 --
NM_052886chr851429 1323 808 791 47 --11713 --
NM_052898chr841680 1637 293 246 ------
NM_052900chr841483 678 472 306 ------
NM_052905chr231920 1573 49 11527 2580 302 --
NM_052906chr2274990 4263 4230 3356 3319 1133 1074 ------
NM_052907chr1223188 986 13774 1248 --
NM_052910chr131608 11578 ----
NM_052911chr181944 ------
NM_052913chr621047 981 --1997 --
NM_052917chr263382 3003 2868 2830 2510 220 --12568 --
NM_052918chr1073701 3176 2732 1298 1279 1146 590 22985 186 23690 3397 --
NM_052937chr841841 639 593 452 11033 ----
NM_052953chr3----1232 --
NM_053002chr31422 ------
NM_053016chr9167965 7198 7131 6760 6411 6231 5770 5434 2800 2752 2588 2037 1186 543 391 109 --18037 --
NM_053023chr1143192 2990 2683 2454 --12573 --
NM_053024chr31389 2423 344 11368 --
NM_053043chr7116224 4696 4319 4076 4062 3956 2198 1794 1720 1343 1269 ------
NM_053046chr192558 119 ------
NM_053056chr1162877 2263 2081 1969 970 194 ------
NM_054033chr21522 --1435 --
NM_054035chr172615 266 --1701 1826
NM_054110chr321033 703 ------
NM_054111chr6--1111 ----
NM_054114chr6138 --167 --
NM_057169chr1272747 2574 1143 1137 872 635 457 1330 ----
NM_057170chr1272747 2574 1143 1137 872 635 457 1330 ----
NM_057175chr421943 896 --12311 --
NM_057180chr12----1373 --
NM_058172chr431632 1145 146 11856 ----
NM_058179chr92864 274 ------
NM_058191chr211853 ------
NM_058241chr231611 676 509 1935 --11629
NM_058241chr231611 676 509 1935 --11629
NM_078473chr862474 2102 1636 1614 1596 178 ------
NM_078483chr563546 1459 522 289 128 57 22984 29 11275 --
NM_078485chr61147 --2121 96 --
NM_078487chr933307 3052 1214 --13332 --
NM_079837chr162587 133 ------
NM_080391chr1----185 --
NM_080552chr201678 ------
NM_080597chr1811099 186 ----
NM_080599chr101293 ------
NM_080645chr632211 1837 315 --22162 745 --
NM_080654chr113365 100 79 ------
NM_080661chr113858 725 286 --1335 --
NM_080672chr203160 100 94 ----1567
NM_080678chr21239 1483 ----
NM_080679chr62693 632 --1686 199
NM_080680chr62693 632 --1686 199
NM_080681chr62693 632 --1686 199
NM_080683chr42184 124 ------
NM_080684chr42184 124 ------
NM_080685chr42184 124 ------
NM_080732chr192558 119 ------
NM_080738chr131940 1377 452 --11534 --
NM_080764chr2252898 2794 2443 581 544 22611 1000 ----
NM_080840chr201510 ----1133
NM_080841chr201510 ----1133
NM_080867chr14114222 4108 4098 3673 3647 1817 1651 1556 1317 1239 1121 35098 1466 907 11848 --
NM_080872chr823564 3543 11519 1215 --
NM_080927chr363236 2175 438 311 231 147 --22210 987 --
NM_100264chr101729 ------
NM_100486chr101729 ------
NM_130385chr1162987 2597 2535 202 95 48 --21199 478 --
NM_130391chr943031 2766 2545 2271 22829 1140 13463 1116
NM_130392chr943031 2766 2545 2271 22829 1140 13463 1116
NM_130393chr943031 2766 2545 2271 22829 1140 13463 1116
NM_130435chr1062948 2812 2142 1174 809 767 --22564 651 --
NM_130436chr2141910 1866 1750 648 ------
NM_130438chr2152487 2443 2327 2193 1225 ------
NM_130439chr1052250 2238 2060 1677 1494 ------
NM_130439chr1052250 2238 2060 1677 1494 ------
NM_130440chr121538 1303 11395 ----
NM_130443chr11----1121 --
NM_130798chr1531209 414 188 --164 --
NM_130808chr3173 --1143 --
NM_130830chr353847 3836 1106 136 68 13473 ----
NM_130838chr1531757 464 404 ------
NM_130839chr1531757 464 404 ------
NM_130846chr1241085 1012 292 54 1858 1816 --
NM_133170chr2065827 5260 5243 2860 2339 108 16219 15316 --
NM_133171chr2021077 397 11160 1446 --
NM_133177chr151065 1056 705 279 138 ------
NM_133178chr151065 1056 705 279 138 ------
NM_133264chr17103824 3774 3428 3285 3090 2692 2538 1094 942 285 ------
NM_133265chrX63654 2231 1283 1085 587 443 12704 43126 1170 1022 148 --
NM_133367chr653342 3216 2943 2707 634 23465 871 ----
NM_133372chr552804 2460 2201 2048 1913 --22405 772 --
NM_133445chr983520 2984 2917 2813 2596 2420 341 82 12480 43471 3375 2535 785 13480
NM_133468chr741959 1880 1707 379 ------
NM_133478chr252439 2398 1956 1828 671 1317 ----
NM_133486chrX1423 ------
NM_133493chr634249 1033 459 13114 13913 --
NM_133496chr153786 3646 3147 2833 786 23495 1658 24354 2876 --
NM_133499chrX2716 318 ------
NM_133503chr123794 661 651 ------
NM_133504chr123794 661 651 ------
NM_133505chr123794 661 651 ------
NM_133506chr123794 661 651 ------
NM_133507chr123972 839 829 ------
NM_133638chr531430 1184 310 --11230 --
NM_133647chr1563347 3261 2617 2591 579 78 43361 3294 2857 1115 ----
NM_133650chr62504 72 ------
NM_134265chr1721173 928 ------
NM_134424chr1231245 409 367 --2502 57 --
NM_134428chr91104 ------
NM_138270chrX43301 2956 1034 605 --33263 3009 2558 --
NM_138316chr1021315 404 ------
NM_138328chr1753281 3253 2189 2183 1251 --1847 --
NM_138353chr19----136 --
NM_138357chr102541 109 ------
NM_138375chr18167 1950 ----
NM_138391chr12669 174 ------
NM_138395chr231049 817 430 --1313 --
NM_138396chr123775 290 165 ------
NM_138423chr1532237 520 57 1774 11994 --
NM_138444chr1353418 3234 1182 734 286 11527 ----
NM_138453chr51203 ------
NM_138457chr653443 2652 2604 2160 2078 --1275 --
NM_138459chr642317 1167 564 329 ------
NM_138468chr2145868 5747 4788 4709 4586 4509 4271 3889 1855 1832 1216 1073 920 730 --26317 6092 --
NM_138471chr11172 --2448 388 --
NM_138473chr1295086 4374 4364 4068 3699 3594 1951 1796 891 14661 1773 11940
NM_138479chr152074 2036 1521 557 284 ------
NM_138554chr931117 441 271 --22135 1833 --
NM_138558chr141131 1041 407 240 --1269 --
NM_138559chr2--11299 1302 11323
NM_138569chr6--2250 206 ----
NM_138576chr1474235 3948 3871 1580 1312 1283 887 --14513 --
NM_138621chr232717 838 469 13415 23891 162 --
NM_138638chr143675 609 451 ------
NM_138713chr16138189 7980 7840 7201 5709 3095 2818 2603 2529 1580 1398 1221 912 15516 18048 16502
NM_138714chr16138189 7980 7840 7201 5709 3095 2818 2603 2529 1580 1398 1221 912 15516 18048 16502
NM_138717chr62485 214 --1675 --
NM_138727chr12577 81 1264 1908 --
NM_138728chr12577 81 1264 1908 --
NM_138735chr211050 1383 ----
NM_138771chr741592 1457 1352 564 --11121 --
NM_138773chr52902 367 ------
NM_138775chr113810 687 542 ------
NM_138782chr512240 --12308 12006
NM_138798chr2133 ------
NM_138927chr211347 ------
NM_138929chr123570 543 266 ------
NM_138930chr123570 543 266 ------
NM_138931chr331024 986 197 ------
NM_138967chr1582448 2130 2107 984 927 649 460 116 32080 1532 971 ----
NM_138971chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138971chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138972chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138972chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138973chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138973chr1163295 1350 1149 884 380 137 11089 43530 3336 1517 1332 --
NM_138980chr4------1478
NM_138981chr42540 145 ----1609
NM_138982chr4------1478
NM_139015chr1251571 1440 1246 293 117 11426 11080 --
NM_139035chrX1303 ------
NM_139046chr10----1196 --
NM_139048chr331184 187 28 --11264 --
NM_139062chr172440 428 ------
NM_139067chr121328 ------
NM_139068chr51673 ------
NM_139069chr51673 ------
NM_139070chr51542 ------
NM_139071chr1241048 182 78 60 11661 ----
NM_139072chr21268 ------
NM_139076chr421168 86 ------
NM_139126chr62842 764 ------
NM_139131chr111604 ------
NM_139132chr1141110 990 443 61 ------
NM_139136chr12----1705 --
NM_139168chr531527 730 328 ------
NM_139207chr1231849 897 719 1161 ----
NM_139244chr61143 ------
NM_139276chr1792386 2193 1885 1721 395 144 135 98 48 12243 --1494
NM_139279chr283186 3088 2902 2854 2650 1213 459 95 --22372 504 --
NM_139283chr1252437 2253 1790 171 21 1954 ----
NM_139312chr103980 231 69 ------
NM_139319chr1211436 ------
NM_139321chr2073333 3247 1701 1614 888 718 457 23791 3675 ----
NM_139323chr2021629 764 11885 ----
NM_144498chr20----22188 611 --
NM_144567chr142612 2546 858 832 ------
NM_144571chr476882 6831 6134 5660 2653 1316 286 --46188 5884 2104 2046 16267
NM_144574chr141177 ------
NM_144578chr1485410 5265 4329 3715 3536 1647 1619 1248 14309 44513 3695 742 145 14679
NM_144582chr242156 2056 1679 1014 12532 1863 --
NM_144595chr13--160 ----
NM_144600chr1631511 330 304 --1577 --
NM_144609chr1751337 1280 1082 944 471 --11207 --
NM_144610chr172456 392 ------
NM_144628chr204869 774 673 178 1583 22215 1004 --
NM_144633chr321201 226 ------
NM_144636chr33808 740 306 ------
NM_144664chr111657 --11880 --
NM_144665chr11----1231 --
NM_144723chr53759 209 157 ------
NM_144732chr194445 271 123 59 --2917 141 --
NM_144767chr15114290 4232 3339 3223 3096 3049 1683 1267 998 220 30 --13921 --
NM_144775chr17114501 4140 4040 3880 3508 3483 3339 3111 1155 1130 655 11773 11017 --
NM_144778chr132170 72 11734 22676 231 11699
NM_144949chr232058 1782 139 --1477 --
NM_144963chr841092 920 223 36 1382 ----
NM_144973chr1274972 4676 4558 1862 897 529 233 1502 13742 --
NM_144979chr42271 237 ------
NM_144982chr122577 522 --1775 --
NM_145025chr62910 56 123 ----
NM_145037chr32528 91 21089 182 1312 --
NM_145055chr1873127 2873 1437 1014 639 562 296 --32423 1189 404 13381
NM_145056chr192681 80 ------
NM_145112chr1431278 1005 448 1847 ----
NM_145113chr1441550 1277 189 135 11119 ----
NM_145117chr1172920 2736 2442 2025 876 859 180 13200 1218 --
NM_145176chr642856 861 485 276 2500 419 2938 433 --
NM_145206chr1073145 2975 2924 2582 828 517 252 --11317 12193
NM_145235chr10--1153 ----
NM_145251chr141566 ------
NM_145259chr2156529 5660 5645 5408 5183 4460 4348 1791 1653 1570 1267 775 609 422 95 17013 11604 --
NM_145263chr422117 82 2845 674 1753 1898
NM_145284chrX51930 1804 1552 816 716 ------
NM_145285chr10--1715 ----
NM_145303chr6123 1476 ----
NM_145305chrX21030 106 11281 ----
NM_145307chr1044624 3674 3091 1445 --14433 --
NM_145313chr1041566 1543 367 299 ------
NM_145320chr773567 3264 2563 1212 1057 1007 432 --12218 --
NM_145321chr773567 3264 2563 1212 1057 1007 432 --12218 --
NM_145322chr773567 3264 2563 1212 1057 1007 432 --12218 --
NM_145332chr6--178 --1271
NM_145333chr6--178 --1271
NM_145341chr1041601 1246 312 251 --11274 --
NM_145658chr15129 ------
NM_145686chr232503 2155 966 --1847 --
NM_145687chr232503 2155 966 --1847 --
NM_145690chr841721 1429 615 25 11694 11479 1341
NM_145698chr1041754 1456 310 31 ------
NM_145716chr11155 ------
NM_145727chr661185 1072 982 555 354 213 ------
NM_145733chr224943 937 316 141 1795 ----
NM_145735chr1362708 2377 1990 1965 854 157 ------
NM_145793chr102853 751 1772 ----
NM_145808chr752529 464 152 82 60 1515 ----
NM_145861chr131940 1377 452 --11534 --
NM_145888chr1961853 1250 777 520 409 198 ------
NM_145899chr641143 1031 822 488 --1965 --
NM_145901chr641143 1031 822 488 --1965 --
NM_145902chr641143 1031 822 488 --1965 --
NM_145903chr641143 1031 822 488 --1965 --
NM_145904chr641143 1031 822 488 --1965 --
NM_145905chr641143 1031 822 488 --1965 --
NM_145912chr2243780 3111 992 160 1488 1329 --
NM_147156chr1041024 487 135 112 21488 1085 ----
NM_147181chr431075 985 70 ------
NM_147182chr431075 985 70 ------
NM_147183chr431075 985 70 ------
NM_147202chr972299 2214 2021 1962 732 254 88 --22581 598 --
NM_148174chr842232 1774 1724 1454 ------
NM_148898chr73792 767 380 --1934 --
NM_148899chr73792 767 380 --1934 --
NM_148904chr11120 2556 469 ----
NM_148905chr11120 2556 469 ----
NM_148906chr11120 2556 469 ----
NM_148907chr11120 2556 469 ----
NM_148908chr11120 2556 469 ----
NM_148909chr11120 2556 469 ----
NM_148923chr181211 --173 --
NM_148955chr15105988 4854 4105 2223 2143 1220 948 571 563 40 35029 193 95 16519 --
NM_148957chr1342492 1044 954 840 22185 570 1455 12522
NM_148977chr1021315 404 ------
NM_148978chr1021315 404 ------
NM_152133chr6138 --167 --
NM_152233chr1451664 1629 1101 335 35 --11216 --
NM_152253chr2253614 3395 2865 1433 1198 --23154 1238 --
NM_152263chr195911 5670 5528 5000 4723 2220 1812 751 480 --24178 1419 --
NM_152265chr141427 1245 1140 519 1635 ----
NM_152272chr861225 1197 1165 1071 843 213 ----1142
NM_152277chr52842 136 1868 11644 --
NM_152278chrX1397 --1575 --
NM_152280chr133482 2955 651 11242 22895 719 --
NM_152289chr1961679 1658 1426 545 468 222 --11471 --
NM_152291chr461053 997 916 809 123 63 --1347 11058
NM_152305chr352061 2053 1693 688 261 ------
NM_152380chr121294 225 1377 ----
NM_152388chr243871 3510 3353 2922 1585 21509 293 --
NM_152409chr532744 2468 153 22514 2224 23293 286 --
NM_152417chr821088 905 ------
NM_152418chr82395 65 ------
NM_152437chr1211741 1332 ----
NM_152442chr1241398 1082 1000 214 ------
NM_152450chr152611 152 ------
NM_152451chr151808 ------
NM_152470chr1844071 1456 718 493 --23950 1080 --
NM_152478chr191493 ------
NM_152487chr141358 1123 497 35 ------
NM_152493chr121429 154 ------
NM_152519chr272166 1886 1616 821 754 731 535 12024 ----
NM_152520chr21230 --2778 496 --
NM_152522chr21251 ------
NM_152529chr244148 1779 1385 625 --13658 --
NM_152542chr422161 1903 11945 ----
NM_152556chr752116 739 247 223 146 11026 ----
NM_152588chr121134 --31507 1261 1247 --
NM_152589chr121205 ------
NM_152594chr1511529 --11662 --
NM_152605chr1951330 1186 1111 896 499 ------
NM_152608chr152037 708 590 564 127 12383 ----
NM_152622chr551127 1106 744 717 321 --12370 --
NM_152624chr5127446 7148 6902 6855 5950 2332 1294 780 754 350 204 77 --27127 2940 --
NM_152629chr983109 2986 1626 1423 794 748 412 357 23813 2852 ----
NM_152636chr1142468 1934 926 801 ------
NM_152638chr1231228 880 244 ----11003
NM_152641chr1222066 1162 --11153 --
NM_152660chr12989 745 ------
NM_152667chr2041313 1077 1010 552 ------
NM_152678chr352726 1913 945 596 404 --12145 --
NM_152699chr383033 2968 2935 2793 2767 1483 166 127 13508 ----
NM_152704chr131264 ------
NM_152716chr1161516 634 608 324 250 221 11463 21067 558 --
NM_152723chr1131090 394 132 ------
NM_152734chr684044 3903 2122 787 764 724 453 113 14770 14146 11014
NM_152739chr721088 313 --1348 1911
NM_152740chr72476 104 ------
NM_152744chr72682 419 1138 11259 --
NM_152745chr72353 64 ------
NM_152753chr651984 1817 621 295 188 ----1226
NM_152754chr722747 434 137 11162 --
NM_152756chr533856 466 226 --33512 3288 549 --
NM_152774chr7--12306 12463 11019
NM_152778chr4----129 --
NM_152787chrX53504 3423 1512 410 48 1736 ----
NM_152789chr741028 604 510 470 ------
NM_152793chr775182 4846 1732 1716 793 604 61 --14688 --
NM_152826chr15105988 4854 4105 2223 2143 1220 948 571 563 40 35029 193 95 16519 --
NM_152835chr132076 2029 197 ------
NM_152836chr82763 317 1729 2584 388 11340
NM_152837chr82763 317 1729 2584 388 11340
NM_152838chr2032643 2502 206 --23491 2210 --
NM_152862chr21431 ------
NM_152890chr1--11290 1490 --
NM_152896chr91583 --1284 --
NM_152903chr1342703 2108 693 309 --22641 2207 --
NM_152924chr15116759 5782 5269 4554 4426 4416 4361 4314 2054 1500 1031 16910 12058 --
NM_152989chr1221858 576 11283 ----
NM_152996chr121353 708 2797 325 1634 1497
NM_152999chr7154954 4807 4583 4335 3953 3844 3521 3496 3366 2016 1820 1785 1772 1482 762 23058 807 34575 3313 1854 --
NM_153013chr552450 2262 1896 1766 64 ------
NM_153020chr6----2533 342 --
NM_153035chr183163 2103 1993 1153 1106 511 391 352 1212 ----
NM_153038chr2----1643 --
NM_153040chr15--1152 ----
NM_153050chr22104924 3996 3532 3478 3058 515 309 300 214 192 ------
NM_153051chr22104924 3996 3532 3478 3058 515 309 300 214 192 ------
NM_153184chr3296 31 11268 --1215
NM_153188chr553971 3504 2182 1246 696 34062 1615 967 11396 --
NM_153207chr1243193 2484 1295 506 23448 743 12847 --
NM_153208chr164809 738 336 44 --1617 --
NM_153235chr632383 1590 34 ------
NM_153251chr131239 ------
NM_153260chr1521087 324 ----11464
NM_153261chr1631326 333 141 --1196 --
NM_153262chr162812 2758 2355 2222 1064 225 ------
NM_153267chr91633 --1659 1918
NM_153280chrX2158 130 --1151 --
NM_153332chr873154 2898 2530 2509 1163 1138 1131 33183 2573 540 12808 --
NM_153333chrX----1586 --
NM_153335chr1731135 380 25 ------
NM_153350chr1611301 ------
NM_153354chr51285 2392 262 1817 --
NM_153365chr442119 1070 555 245 ------
NM_153367chr1032498 1327 768 --1727 --
NM_153371chr1332081 1519 412 1263 ----
NM_153374chr151136 ------
NM_153437chr9----129 --
NM_153456chr13105625 4867 4440 4383 3977 2397 1630 1210 1151 961 32365 1955 1551 24299 2077 --
NM_153607chr533206 2035 944 ----12556
NM_153616chr1542014 471 351 271 ------
NM_153617chr1542014 471 351 271 ------
NM_153618chr1542014 471 351 271 ------
NM_153619chr1543252 2513 518 262 ------
NM_153620chr74514 365 97 59 --1383 --
NM_153634chr1211095 11323 1394 11618
NM_153640chr20----197 --
NM_153645chr2232829 2288 2073 --12790 1204
NM_153649chr171925 1642 1505 853 781 452 171 --1295 --
NM_153686chr41780 --2400 24 --
NM_153706chr52179 84 ------
NM_153708chr321294 316 --1411 --
NM_153712chr262483 1534 1367 1301 1052 22 --12638 --
NM_153748chr12----1705 --
NM_153809chr91628 ------
NM_153810chr1094189 3724 3385 3260 3223 3093 1411 1330 944 ------
NM_153812chr142348 1937 526 510 1492 ----
NM_153828chr23691 585 176 1250 1164 --
NM_170606chr71730 ------
NM_170607chr1741044 1010 532 122 ------
NM_170609chr62335 79 11132 ----
NM_170665chr1284269 3999 3643 3557 1372 889 523 494 21697 1545 ----
NM_170674chr1531356 1235 571 ------
NM_170675chr1531032 911 247 ------
NM_170676chr1531032 911 247 ------
NM_170677chr1531356 1235 571 ------
NM_170686chr773160 3055 2842 1217 1099 732 505 --1585 --
NM_170692chr13424 98 52 167 1287 --
NM_170696chr1521671 1132 ------
NM_170697chr1521671 1132 ------
NM_170706chr141518 972 110 68 13864 ----
NM_170707chr14726 288 230 221 ------
NM_170708chr14726 288 230 221 ------
NM_170709chr842224 1927 847 765 ------
NM_170710chr422565 2141 --166 12384
NM_170719chr1331326 976 422 ------
NM_170743chr172921 2825 2323 902 674 57 43 --1925 --
NM_170751chr621378 1329 --11037 --
NM_170752chr621378 1329 --11037 --
NM_170768chr1131589 327 36 ------
NM_170775chr51275 ------
NM_171998chrX3693 658 36 2937 454 1847 --
NM_172016chr621390 957 ------
NM_172020chr761853 1800 817 788 773 231 ------
NM_172037chr811350 1997 ----
NM_172058chr841622 1540 611 145 1477 ----
NM_172059chr841622 1540 611 145 1477 ----
NM_172060chr841622 1540 611 145 1477 ----
NM_172070chr221618 849 ----21833 1486
NM_172071chr1136787 5996 5436 5311 5001 4960 4945 4735 4655 2305 1355 708 151 24860 2916 17317 --
NM_172103chr61798 1414 ----
NM_172105chr61798 1414 ----
NM_172159chr332095 1455 156 --2653 301 --
NM_172160chr332095 1455 156 --2653 301 --
NM_172169chr1021304 569 --11501 --
NM_172170chr1021304 569 --11501 --
NM_172171chr1021304 569 --11501 --
NM_172173chr1021304 569 --11501 --
NM_172315chr1531356 1235 571 ------
NM_172316chr1531356 1235 571 ------
NM_172337chr14----1746 --
NM_172365chr14----133 --
NM_173054chr73783 704 679 --1116 --
NM_173064chr172921 2825 2323 902 674 57 43 --1925 --
NM_173075chr421692 32 11855 ----
NM_173082chr611548 --1436 --
NM_173172chr231032 302 238 --11508 --
NM_173198chr932223 2149 28 ----1556
NM_173200chr932223 2149 28 ----1556
NM_173214chr16138189 7980 7840 7201 5709 3095 2818 2603 2529 1580 1398 1221 912 15516 18048 16502
NM_173216chr392703 2551 2121 1930 1836 1681 1081 956 296 ------
NM_173217chr392703 2551 2121 1930 1836 1681 1081 956 296 ------
NM_173354chr2121399 423 --1335 --
NM_173359chr311428 ------
NM_173454chr151453 ------
NM_173460chr203178 78 48 --1160 --
NM_173468chr4125774 4708 4587 4463 4210 4119 3776 2102 1373 871 461 309 1519 34017 4003 1697 --
NM_173469chr1511027 ------
NM_173470chrX32352 694 116 ----12199
NM_173475chr1641652 1432 122 105 11344 ----
NM_173491chr521459 1108 ------
NM_173492chr91197 ------
NM_173495chrX51633 915 780 399 337 11670 ----
NM_173496chr1052948 2246 1135 587 263 ------
NM_173500chr151282 --11135 1169
NM_173502chr16146 ------
NM_173503chr17----139 --
NM_173508chr111024 --11230 --
NM_173510chr2252268 2194 2026 1921 929 ------
NM_173511chr283944 3561 2742 1512 1333 979 760 249 ------
NM_173552chr372294 2140 2118 2101 975 359 248 1958 ----
NM_173560chr62453 415 ------
NM_173576chr1022308 241 --12257 --
NM_173582chr1164630 4622 4143 4081 1690 97 --26244 5926 --
NM_173595chr12114977 4321 3914 3748 3641 3206 1225 1074 1036 631 380 --1417 --
NM_173602chr1253105 3009 2387 643 445 1777 ----
NM_173630chr182100 86 ------
NM_173642chr1108722 7828 2854 2592 1725 1704 1098 1027 884 728 17431 49080 6231 1688 1375 --
NM_173645chr22550 209 ------
NM_173667chr531729 800 266 11517 ----
NM_173683chr841793 1550 636 370 --1465 --
NM_173694chrX--42314 2281 2203 1594 1414 125
NM_173797chr5175 ------
NM_173808chr134001 3256 3089 13432 2728 190 --
NM_173814chr151459 ----1414
NM_173824chr3148 1218 ----
NM_173825chr382989 2666 1901 1063 411 203 115 77 --12489 --
NM_173829chr555246 4393 3857 661 327 25978 349 36008 2414 296 --
NM_173849chr14288 69 134 ----
NM_174856chr202295 262 ------
NM_174890chr103808 738 537 --1670 --
NM_174911chr863651 3113 1459 819 726 659 11559 23463 1433 --
NM_174916chr1541971 1836 1468 705 ------
NM_174937chr101628 ------
NM_175052chr511026 --1938 --
NM_175056chr321691 501 ------
NM_175069chr91138 --11035 1726
NM_175573chr20196 ------
NM_175607chr331184 689 529 ------
NM_175610chr1521048 1009 ------
NM_175612chr331184 689 529 ------
NM_175733chr1152180 2069 1522 1388 717 21646 1499 2623 471 --
NM_175736chr12197593 7116 6742 6541 6535 6349 6030 5908 5681 5619 5463 3136 2950 2419 2300 1860 754 539 146 56809 6580 6088 5138 2999 15018 --
NM_175748chr1421946 1779 1804 ----
NM_175767chr551868 757 262 182 175 1118 ----
NM_175848chr2021424 955 ------
NM_175848chr2021424 955 ------
NM_175849chr2021424 955 ------
NM_175849chr2021424 955 ------
NM_175850chr2021424 955 ------
NM_175850chr2021424 955 ------
NM_175852chr192931 2784 2288 2099 1227 1208 1112 1026 562 ------
NM_175854chr13--12377 11903 --
NM_175856chr53623 136 44 ------
NM_175859chrX31330 1117 427 --31334 79 35 --
NM_175862chr331524 1469 103 --2440 370 --
NM_175866chr1176 31032 578 487 ----
NM_175871chr192827 58 ------
NM_175876chr11679 12683 --12636
NM_175907chr1832860 2083 1005 ----1519
NM_175920chr51261 ------
NM_175921chr574043 2856 2611 1273 1003 836 586 11662 1379 13494
NM_175931chr1651491 1313 397 211 158 1221 21663 769 --
NM_176814chr721311 1060 ----1194
NM_176823chr161514 1120 876 252 227 112 --13847 --
NM_176824chr4----1390 --
NM_176863chr1782144 2049 1972 1924 1911 1567 170 75 22133 1834 ----
NM_176871chr883168 2700 2582 2283 926 643 410 219 ------
NM_177424chr151578 1281 577 360 134 1495 ----
NM_177438chr1443289 2922 1480 1210 --14207 13612
NM_177559chr202993 767 --21097 238 --
NM_177560chr202993 767 --21097 238 --
NM_177937chr92618 444 ----11069
NM_177947chrX--1227 1187 11610
NM_177948chrX--1227 1187 11610
NM_177952chr143775 342 29 --1541 --
NM_177966chr331950 1790 437 ----11231
NM_177968chr242006 1891 547 539 11694 ----
NM_177972chr1163932 3731 3357 3266 1588 54 177 24098 4077 --
NM_177974chr1532237 520 57 1774 11994 --
NM_177985chr231949 821 55 --22045 1499 --
NM_177989chr33353 292 24 ----1341
NM_177990chr2021294 558 ------
NM_178010chr1221858 576 11283 ----
NM_178011chr1032734 576 31 21039 279 ----
NM_178014chr65805 635 99 93 58 ------
NM_178042chr33353 292 24 ----1341
NM_178123chr23878 261 160 ------
NM_178140chr531845 710 249 --12795 --
NM_178151chrX107475 5498 5291 5024 4820 2761 2328 1858 1111 840 ------
NM_178152chrX107475 5498 5291 5024 4820 2761 2328 1858 1111 840 ------
NM_178153chrX107475 5498 5291 5024 4820 2761 2328 1858 1111 840 ------
NM_178154chr142302 264 ------
NM_178155chr142302 264 ------
NM_178156chr142302 264 ------
NM_178157chr142302 264 ------
NM_178169chr121121 --1414 --
NM_178229chr18993 818 429 377 351 317 158 36 ------
NM_178423chr731005 964 91 ------
NM_178425chr731005 964 91 ------
NM_178426chr12735 586 ------
NM_178427chr12635 486 ----1898
NM_178460chr201166 ------
NM_178496chr33440 188 71 --1475 --
NM_178500chr172202 82 1177 ----
NM_178539chr1221738 1608 --1346 --
NM_178565chr841622 1181 1127 457 --11470 --
NM_178585chr432619 2569 1146 --1469 23167 515
NM_178586chr1421729 747 ------
NM_178812chr81312 ------
NM_178815chr1062692 2118 2062 1010 796 670 21859 512 42673 1988 422 272 --
NM_178818chr1642096 827 756 374 1110 1302 --
NM_178830chr191278 ------
NM_180989chr1342409 2298 2115 908 ------
NM_181054chr14143 2988 293 --1197
NM_181077chr1512080