TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-197-3p
miRNA Sequence: UUCACCACCUUCUCCACCCAGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001039199chr2013610 54928 4319 3565 1996 1358 54364 3613 1402 1269 298 14999
NM_024947chr348811 7357 6144 5848 26843 3838 16176 26148 103
NM_031427chr1465723 4562 1982 1668 888 465 35340 1624 541 44278 4182 1671 1533 14233
NM_182503chr634344 3914 850 15430 35264 4122 853 11254
NM_182515chr1966641 5084 4496 2538 2143 491 34646 4099 894 86283 5394 5292 4555 4222 4145 941 805 --