TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-197-5p
miRNA Sequence: CGGGUAGAGAGGGCAGUGGGAGG

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542069 1970 1807 688 --11847 1507
NM_000044chrX3343 80 59 ------
NM_000053chr1342034 1616 462 140 --11547 --
NM_000081chr11747 11633 ----
NM_000084chrX86684 5374 5359 5218 4810 2715 2143 1436 26764 913 26597 1819 26168 1884
NM_000089chr71116 ------
NM_000090chr21217 ------
NM_000092chr254532 3989 3790 1703 1159 12856 13030 --
NM_000109chrX1596 --11939 12166
NM_000111chr71285 ------
NM_000125chr61686 21348 1148 22892 50 --
NM_000127chr8--1110 ----
NM_000138chr154843 344 222 169 11743 22452 920 --
NM_000142chr451381 1006 566 521 369 ------
NM_000153chr1431484 1113 610 --1157 --
NM_000165chr621477 376 ------
NM_000168chr733051 2379 778 --23296 2735 --
NM_000202chrX63547 2942 2689 2683 1215 569 188 --12474
NM_000208chr1984372 4323 3258 3216 3185 3157 1103 96 11321 1833 --
NM_000210chr2--2483 181 1900 --
NM_000230chr732643 1771 718 ------
NM_000232chr452526 2371 1129 415 287 ----23004 777
NM_000233chr23784 650 604 ----1139
NM_000252chrX11308 1484 ----
NM_000253chr41103 1179 ----
NM_000259chr1576035 5481 5359 5218 4233 1213 1158 ----16097
NM_000267chr1742349 2208 370 210 13378 22817 2649 --
NM_000275chr152108 72 ------
NM_000276chrX3790 575 157 1304 ----
NM_000284chrX51840 1527 522 344 288 --21911 1546 --
NM_000297chr421618 647 ----21894 164
NM_000298chr13464 134 32 ------
NM_000304chr171694 ----1355
NM_000314chr1032911 2786 409 --23013 150 --
NM_000332chr686485 6395 2320 1714 1376 935 447 437 16697 24952 2114 --
NM_000337chr586126 5272 4427 2169 1297 1009 952 602 16343 ----
NM_000346chr1741610 1484 545 363 2221 208 ----
NM_000362chr2293661 3175 3121 2903 2781 748 331 191 172 33212 2810 923 13002 --
NM_000367chr641766 1513 454 277 12136 --1614
NM_000368chr973506 1415 1240 921 841 725 227 11696 13737 --
NM_000378chr1131098 377 280 --1186 --
NM_000391chr1171660 1608 515 393 369 199 37 --169 1674
NM_000393chr231715 1682 757 11729 11767 --
NM_000396chr1----1448 --
NM_000408chr222596 2293 --22693 542 --
NM_000411chr2123029 996 --22226 353 --
NM_000421chr171272 ------
NM_000427chr12191 84 ------
NM_000430chr1733025 2943 67 ------
NM_000439chr521767 49 ------
NM_000449chr12247 146 --1991 --
NM_000459chr93872 346 82 1935 ----
NM_000461chr341715 1523 1466 580 24534 1301 ----
NM_000462chr1521758 405 ------
NM_000484chr211196 156 ----
NM_000489chrX33342 3196 708 --23318 1118 --
NM_000503chr851541 610 475 259 144 ------
NM_000522chr711241 ------
NM_000525chr1131530 1027 421 --11327 --
NM_000530chr15698 416 405 290 250 --1716 --
NM_000544chr6_cox_hap163131 2433 2403 1342 1183 987 --12585 --
NM_000555chrX67503 6160 5760 2761 1054 839 --46796 5498 3029 3021 25164 2604
NM_000572chr11726 ------
NM_000586chr4--195 ----
NM_000598chr721488 1385 11391 11310 --
NM_000612chr1153684 3482 3166 2527 164 13443 12413 13058
NM_000615chr1152922 2372 1165 705 387 12874 --12399
NM_000618chr12106102 5853 5488 5201 4327 4168 4148 2566 1692 1208 25588 1510 25164 1368 11313
NM_000618chr12106102 5853 5488 5201 4327 4168 4148 2566 1692 1208 25588 1510 25164 1368 11313
NM_000627chr22780 90 --1826 --
NM_000633chr1845038 4785 4589 3759 34461 1971 929 ----
NM_000684chr1031262 1243 1054 ------
NM_000693chr151125 --21749 723 --
NM_000702chr132071 1582 293 32225 1376 304 1454 --
NM_000719chr1295119 4660 4454 4197 4174 1745 1219 958 246 24063 565 --12268
NM_000723chr1761278 1165 1157 1094 486 201 --2610 323 --
NM_000750chr151829 --1667 --
NM_000758chr51284 ------
NM_000788chr421358 576 ------
NM_000795chr1171013 953 868 818 283 179 161 21081 47 ----
NM_000800chr531628 1076 364 11607 21197 175 --
NM_000806chr51728 21801 1579 ----
NM_000811chr53554 325 172 ------
NM_000813chr574816 4356 3609 2174 1637 1402 131 1285 14335 --
NM_000814chr1593991 3846 3317 1522 1237 1157 1040 281 59 33785 3091 2913 --11685
NM_000818chr101213 ------
NM_000826chr422024 404 --1345 --
NM_000827chr532013 1688 566 1456 --11702
NM_000829chr1132273 2099 2049 12123 --11953
NM_000831chr1125897 5779 5728 5523 5494 5108 4025 3859 569 317 284 139 ------
NM_000861chr352232 2184 1765 633 553 --11820 --
NM_000865chr6----1195 --
NM_000868chrX32430 2353 1665 --11792 --
NM_000872chr1011412 11088 ----
NM_000875chr15106469 5378 1592 1493 1424 850 719 500 134 125 2872 216 36666 2624 2395 --
NM_000880chr82810 59 ------
NM_000885chr22854 742 21751 1741 ----
NM_000891chr1722826 371 23485 706 23134 988 --
NM_000901chr42985 394 ------
NM_000902chr382765 2664 2539 2391 2030 694 286 201 ------
NM_000914chr61404 ------
NM_000935chr3----11074 --
NM_000943chr5----1124 --
NM_000944chr452164 1877 925 757 507 11517 ----
NM_000945chr221297 585 ------
NM_000950chrX73340 3038 2894 2875 2377 917 68 --1514 1350
NM_000961chr2093839 3323 3174 2868 2636 2556 1362 57 47 12823 23024 333 139
NM_000964chr1781388 1233 1191 1043 101 91 62 54 --11302 1311
NM_000965chr331268 1054 924 --1306 1453
NM_001001132chr213177 167 58 172 ----
NM_001001323chr1242674 900 460 239 --22332 1941 --
NM_001001395chr1252262 1038 608 521 433 12530 --1954
NM_001001415chr19123 ------
NM_001001433chr2062798 2652 2610 1193 728 80 22242 1199 --13122
NM_001001436chr161199 ------
NM_001001484chr1051997 1719 858 597 307 --11539 --
NM_001001557chr82762 688 --32099 698 185 --
NM_001001701chr421658 1491 --12167 --
NM_001001790chr91348 ----1363
NM_001001890chr2193871 3650 3372 3205 2834 2701 1519 1496 1077 ----11197
NM_001001924chr831300 792 600 1773 ----
NM_001001925chr831300 792 600 1773 ----
NM_001001931chr831300 792 600 1773 ----
NM_001001971chr1041315 1246 507 63 ------
NM_001001974chr1042092 863 834 33 ------
NM_001002027chr17179 ------
NM_001002033chr171331 ------
NM_001002233chr83695 646 146 21454 532 11615 --
NM_001002814chr883765 3319 2372 1181 1126 695 646 146 21454 532 13384 --
NM_001002838chrX51877 1736 1715 1641 519 11761 1236 --
NM_001002860chr1464650 3821 3580 3389 407 396 ------
NM_001002909chr1721921 1905 1266 --11551
NM_001003406chr2252698 2333 1265 970 54 --12870 --
NM_001003652chr18138726 8634 8031 7357 5608 5467 5377 3488 3214 2981 2782 558 551 37485 2372 92 46216 5944 2812 2447 --
NM_001003674chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_001003675chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_001003688chr411196 ------
NM_001003712chr1243358 2956 306 180 --13436 --
NM_001003760chr643099 2261 855 704 12705 23445 177 --
NM_001003792chr3--1148 ----
NM_001003793chr3--1148 ----
NM_001003940chr1593738 3718 3578 3246 2942 2565 2515 580 303 11456 13641 --
NM_001003942chr1593738 3718 3578 3246 2942 2565 2515 580 303 11456 13641 --
NM_001003943chr1593742 3722 3582 3250 2946 2569 2519 584 307 11460 13645 --
NM_001004065chr933325 2949 942 ----13800
NM_001004196chr34385 346 199 41 1167 --11113
NM_001004304chr1243201 3068 2246 857 11155 ----
NM_001004317chr654114 4097 3417 3049 1634 --249 32 1932
NM_001004342chr1136072 5016 4930 4616 4155 3828 3757 2346 2176 1988 1780 1704 1609 --11172 13819
NM_001004354chr941007 695 244 70 --1780 --
NM_001004360chr22370 173 ------
NM_001004419chr1253552 3261 1814 1781 550 1564 22789 1014 --
NM_001004722chr22219 53 --2805 150 --
NM_001005207chr171224 ------
NM_001005366chr121898 ------
NM_001005375chrY21344 549 11835 ----
NM_001005386chr231653 701 690 --1106 --
NM_001005473chr566301 5971 5420 4268 1361 218 --25459 5045 15405
NM_001005505chr341656 589 512 68 11640 21703 382 --
NM_001005609chrX63265 2928 2384 1130 850 697 --11376 --
NM_001005732chr21------1213
NM_001005733chr21------1213
NM_001005910chr3--1491 ----
NM_001005911chr3--1491 ----
NM_001006118chrY----1242 --
NM_001006120chrY----1242 --
NM_001006600chr552362 2302 2150 2095 797 ------
NM_001006612chrX189 ------
NM_001006613chrX189 ------
NM_001006614chrX189 ------
NM_001006618chr91222 ------
NM_001006623chr242033 135 128 40 11932 1241 --
NM_001006636chr23779 151 75 ------
NM_001006935chrX121 ------
NM_001006936chrX121 ------
NM_001006937chrX121 ------
NM_001007027chr11----162 --
NM_001007072chr15293 61 ----1176
NM_001007075chr431017 894 66 ------
NM_001007237chr112549 12783 1370 1285
NM_001007246chr2131769 1684 700 ------
NM_001007257chr12514 94 --1973 --
NM_001007267chr21719 --2232 164 --
NM_001007269chr191400 --1220 --
NM_001007270chr191400 --1220 --
NM_001007277chr112225 56 --2442 31 --
NM_001007466chr674688 4231 3761 3179 1227 423 395 13140 21060 1051 13155
NM_001007471chr9------1548
NM_001007526chrY----1242 --
NM_001007794chr11153 ------
NM_001008215chr221182 851 2380 326 ----
NM_001008220chr563765 2693 2583 2506 861 25 31369 874 374 1116 --
NM_001008239chr1841470 1189 561 295 --11014 1409
NM_001008392chr32293 140 --1348 --
NM_001008405chr731758 422 31 ------
NM_001008408chr786224 5740 5534 4259 4063 1344 1270 953 11796 ----
NM_001008495chr842086 1494 1402 616 --1749 --
NM_001008539chr875362 4778 3867 3390 3345 1314 451 ------
NM_001008541chr1062251 2239 1678 1495 1452 720 --1762 --
NM_001008541chr1062251 2239 1678 1495 1452 720 --1762 --
NM_001008564chr132676 126 ------
NM_001008566chr221186 ----1453
NM_001008701chr1962747 2411 1211 661 653 636 12485 1336 --
NM_001008707chr1431841 135 59 --1607 --
NM_001008738chr5--11842 ----
NM_001008783chr61904 ------
NM_001009185chr51163 ------
NM_001009554chr474072 3978 3925 3553 909 772 268 --34029 3812 3162 --
NM_001009554chr474072 3978 3925 3553 909 772 268 --34029 3812 3162 --
NM_001009955chr11155 ------
NM_001009955chr11155 ------
NM_001009958chr74557 415 407 182 ------
NM_001010000chr1843388 2804 2533 1411 --1456 1956
NM_001010854chr143706 585 93 ------
NM_001010861chr182727 2497 2249 2059 1864 1828 1802 49 --12700 --
NM_001010862chrX32966 1309 1256 --22596 138 12677
NM_001010867chr1104868 4707 4535 4480 2585 2175 2065 1726 712 358 ----14148
NM_001010888chrX34098 4009 1222 --14508 13766
NM_001010908chr102700 137 ------
NM_001010922chr193955 3876 3765 3333 3254 2718 1154 923 243 14064 14005 --
NM_001010923chr621232 291 ------
NM_001010934chr71302 ------
NM_001010986chrX22246 138 ----22137 513
NM_001011553chr7------1860
NM_001011645chrX3343 80 59 ------
NM_001011666chr776027 4441 4122 1737 1564 1432 204 15989 ----
NM_001011713chr1451500 1432 1166 571 405 ------
NM_001012329chr132209 1982 124 2151 115 12276 --
NM_001012393chr1195107 4731 1946 922 810 547 324 265 208 41533 1162 967 832 --3877 840 618
NM_001012420chr1532835 1166 1149 12622 ----
NM_001012423chr1532835 1166 1149 12622 ----
NM_001012426chr652459 2077 1235 1071 515 23445 1257 23340 3081 --
NM_001012427chr652459 2077 1235 1071 515 23445 1257 23340 3081 --
NM_001012732chr41932 --11298 --
NM_001012751chr1041580 1574 1191 525 --1143 --
NM_001012968chrX32362 968 321 1785 ----
NM_001012977chrX31336 450 428 ------
NM_001013031chr1053491 939 708 702 392 32786 949 745 33502 2977 2949 --
NM_001013398chr721488 1385 11391 11310 --
NM_001013438chr3----1746 --
NM_001013439chr3----1592 --
NM_001013615chr131190 797 164 1253 ----
NM_001013635chr124937 399 278 23 --1450 1194
NM_001013690chr12102244 2223 2172 1799 1778 898 650 468 178 136 1438 22496 2421 22376 659
NM_001013693chr162283 2092 1856 784 522 391 42557 1981 752 601 --11836
NM_001013693chr162283 2092 1856 784 522 391 42557 1981 752 601 --11836
NM_001013843chr151368 ------
NM_001014283chr1351617 1475 1433 559 141 11521 11857 --
NM_001014286chr13170 ------
NM_001014380chr1375076 4889 3682 2330 844 552 258 --15148 --
NM_001014797chr1065948 5272 2911 2844 1116 284 11984 17712 18142
NM_001014812chr151429 ------
NM_001014839chr11945 ------
NM_001014841chr11945 ------
NM_001015508chr8------1202
NM_001015877chrX42041 2009 1983 1208 22768 109 ----
NM_001015881chrX2792 46 ------
NM_001015887chr321267 517 --11183 --
NM_001017369chr41165 --11008 --
NM_001017371chr221344 238 ------
NM_001017395chr3103018 2483 2411 1405 1016 1010 587 423 77 30 12645 ----
NM_001017405chr4--1783 ----
NM_001017424chr141496 535 455 141 --1569 1372
NM_001017425chr141496 535 455 141 --1569 1372
NM_001017440chr798240 8175 7966 7212 5947 5941 2346 1956 1929 26308 3060 27350 2075 --
NM_001017523chr1221249 124 --11382 --
NM_001017923chr1431662 1613 442 21275 39 11695 --
NM_001017926chr81676 ------
NM_001017969chr91265 ------
NM_001017992chr511039 1161 ----
NM_001017995chr5114800 4188 3773 3433 3173 2977 1813 1682 1652 1198 657 34618 4148 794 54673 4442 4241 1775 1633 151
NM_001017999chr151837 1563 831 491 26 21529 932 --11672
NM_001017999chr151837 1563 831 491 26 21529 932 --11672
NM_001018000chr151837 1563 831 491 26 21529 932 --11672
NM_001018000chr151837 1563 831 491 26 21529 932 --11672
NM_001018001chr151837 1563 831 491 26 21529 932 --11672
NM_001018004chr15294 67 ------
NM_001018006chr15294 67 ------
NM_001018007chr15294 67 ------
NM_001018020chr15294 67 ------
NM_001018054chr121248 988 2439 249 ----
NM_001018056chr91193 ------
NM_001018064chr921799 303 ------
NM_001018067chr134770 4073 1369 44839 4747 1924 1748 11451 14280
NM_001018068chr134770 4073 1369 44839 4747 1924 1748 11451 14280
NM_001018069chr134770 4073 1369 44839 4747 1924 1748 11451 14280
NM_001018072chr1221249 124 --11382 --
NM_001018100chr152864 807 ------
NM_001018108chr1572184 1925 1884 1837 1404 331 210 --11504 --
NM_001018676chr8--1164 ----
NM_001018677chr8--1164 ----
NM_001020658chr111453 ------
NM_001020658chr111453 ------
NM_001023567chr1522227 954 1110 ----
NM_001023587chr32995 468 --1885 --
NM_001024071chr141368 ------
NM_001024226chr11986 ------
NM_001024227chr11986 ------
NM_001024228chr11986 ------
NM_001024372chr862251 1760 772 292 218 196 2718 496 11610 --
NM_001024455chrX72246 1748 927 702 458 227 78 --21030 433 --
NM_001024660chr32670 584 ------
NM_001024666chrX1654 --2254 61 --
NM_001024680chr231671 1281 672 ----11529
NM_001024688chr821527 51 --21950 799 --
NM_001024808chr1252393 1890 1027 545 123 1527 ----
NM_001024809chr1781388 1233 1191 1043 101 91 62 54 --11302 1311
NM_001024912chr192295 253 --2701 38 --
NM_001024947chr51189 --1895 --
NM_001024948chr142878 2321 1237 273 --1331 --
NM_001025068chr351856 1712 1624 1415 589 --1375 --
NM_001025069chr351856 1712 1624 1415 589 --1375 --
NM_001025076chr1034839 2327 1245 25699 662 34807 1541 639 24295 1447
NM_001025077chr1046197 2603 276 111 37057 2020 170 36165 2899 1997 25653 2805
NM_001025079chr383951 3441 3214 2987 1252 1175 495 376 1389 ----
NM_001025107chr122432 448 ----22370 261
NM_001025107chr122432 448 ----22370 261
NM_001025205chr31395 ------
NM_001025252chr852730 2087 1052 474 91 22635 26 12103 12057
NM_001025253chr852730 2087 1052 474 91 22635 26 12103 12057
NM_001025266chr343797 3683 1664 1337 31937 1619 1499 11344 21406 98
NM_001025580chrX34013 3192 798 ----24316 3793
NM_001025603chr12247 146 --1991 --
NM_001029839chr31593 ------
NM_001029840chr31593 ------
NM_001029858chr622128 2088 --23210 945 --
NM_001029863chr672838 2648 2506 2467 2098 1132 157 1646 1806 11002
NM_001029875chr562824 2645 2583 469 144 133 --12030 --
NM_001029989chr154877 821 361 207 ------
NM_001030055chr1444694 4262 3217 1861 ------
NM_001031677chr52543 98 ------
NM_001031679chr1242855 2339 1022 788 1845 ----
NM_001031695chr2264863 4480 1380 1272 319 202 12015 --11249
NM_001031700chr442445 2001 844 465 1945 ----
NM_001031711chr541436 1213 432 164 2594 478 2624 578 1698
NM_001031716chr221011 320 ------
NM_001031732chr443565 2379 1109 99 --11027 --
NM_001031740chr141525 1370 1064 259 ------
NM_001031804chr1664397 3349 3163 3033 1385 858 --23103 2998 --
NM_001032280chr63309 173 143 ----11409
NM_001032394chr632805 947 933 11829 --22165 2100
NM_001032395chr632672 814 800 11696 --22032 1967
NM_001032999chr2075354 4998 4737 4092 1446 1124 871 34923 4646 2108 --23290 962
NM_001033002chr171236 ------
NM_001033044chr151347 1200 595 315 200 11479 ----
NM_001033045chr263227 3171 2716 1778 624 462 1520 --11565
NM_001033047chr432226 958 471 11745 141 --
NM_001033056chr151347 1200 595 315 200 11479 ----
NM_001033057chr3128 ------
NM_001033059chr631604 506 226 11271 ----
NM_001033081chr11278 --21590 1257 11406
NM_001033082chr11278 --21590 1257 11406
NM_001033085chr21118 ------
NM_001033087chr2033012 2162 1013 --11220 --
NM_001033117chr3114897 4465 4418 3806 3462 3166 1564 1474 1095 809 517 14350 24808 704 14593
NM_001033521chr201156 --2488 40 --
NM_001033522chr201156 --2488 40 --
NM_001033557chr221093 382 ------
NM_001033578chr81711 ----1326
NM_001033583chrX------136
NM_001033602chr1372676 2546 2416 2202 497 217 160 22567 782 --1523
NM_001033723chr842541 1052 333 46 12521 31976 800 793 --
NM_001033925chr1042084 1849 1497 173 ------
NM_001034025chr121932 2765 47 158 1155
NM_001034850chr511372 ------
NM_001034954chr1042760 1125 632 342 21295 525 11024 --
NM_001034955chr1042760 1125 632 342 21295 525 11024 --
NM_001034956chr1042760 1125 632 342 21295 525 11024 --
NM_001034957chr1042760 1125 632 342 21295 525 11024 --
NM_001035003chr441335 997 986 49 1350 ----
NM_001035004chr441335 997 986 49 1350 ----
NM_001035254chr942368 2339 1818 1731 1983 2966 397 1900
NM_001037132chr761669 1391 1369 678 614 384 ------
NM_001037133chr761669 1391 1369 678 614 384 ------
NM_001037164chr741891 525 325 207 --2605 95 11918
NM_001037165chr7118850 7903 7550 7013 6739 6628 6388 6199 3493 2566 661 27303 5457 --37224 6603 1558
NM_001037171chrX------136
NM_001037174chr232045 1499 54 --12144 11829
NM_001037317chr182727 2497 2249 2059 1864 1828 1802 49 --12700 --
NM_001037334chr1832369 1776 202 ------
NM_001037339chr11390 --21199 34 21363 1352
NM_001037340chr11390 --21199 34 21363 1352
NM_001037341chr11390 --21199 34 21363 1352
NM_001037341chr11390 --21199 34 21363 1352
NM_001037442chr42512 494 ------
NM_001037553chr2175105 4641 4373 4163 3574 3563 1151 14481 33660 3297 586 --
NM_001037872chr21648 ------
NM_001037954chr1143274 3098 1373 1256 32838 841 592 2971 256 --
NM_001038707chr1142238 1973 1870 1627 831 825 627 528 512 445 437 126 70 24 --2726 169 --
NM_001038707chr1142238 1973 1870 1627 831 825 627 528 512 445 437 126 70 24 --2726 169 --
NM_001039111chr31177 ------
NM_001039348chr21996 11005 ----
NM_001039349chr21996 11005 ----
NM_001039479chr1452275 1754 905 190 164 1182 ----
NM_001039538chr243467 2923 2701 295 43252 1360 399 319 ----
NM_001039547chr3107545 7489 7159 6183 5594 3078 3015 2808 2222 338 17285 --1999
NM_001039569chr233004 1247 993 23060 2087 ----
NM_001039570chr2284242 4109 4070 3847 1466 875 558 110 1931 24127 1673 --
NM_001039571chr2284242 4109 4070 3847 1466 875 558 110 1931 24127 1673 --
NM_001039618chr1155025 3967 1691 957 338 --25313 34 --
NM_001039690chr1642050 1787 666 406 ----22206 1852
NM_001039709chr2075354 4998 4737 4092 1446 1124 871 34923 4646 2108 --23290 962
NM_001039711chr11242 --2218 82 --
NM_001039712chr11242 --2218 82 --
NM_001039840chrX65828 4639 4143 2064 936 45 24441 2318 1883 15002
NM_001039916chr122343 332 ------
NM_001039917chr122343 332 ------
NM_001039918chr122343 332 ------
NM_001039919chr122343 332 ------
NM_001039920chr122343 332 ------
NM_001039937chr1343465 2756 2608 748 --13130 --
NM_001040001chr641929 1512 1506 182 --2487 32 --
NM_001040002chr17153 31155 142 46 ----
NM_001040020chr711079 ------
NM_001040057chr721293 469 ------
NM_001040100chr35876 429 228 144 136 ------
NM_001040108chr1452265 1145 534 432 418 12255 43182 2472 1319 259 --
NM_001040142chr232299 2281 2249 1265 ----
NM_001040143chr232299 2281 2249 1265 ----
NM_001040144chr1642050 1787 666 406 ----22206 1852
NM_001040146chr1642050 1787 666 406 ----22206 1852
NM_001040152chr775049 4771 3406 3207 1466 531 410 2968 838 35003 4757 1179 1593
NM_001040159chr41567 ------
NM_001040214chr641868 895 878 755 ------
NM_001040284chr1665712 4687 4398 3973 2114 486 13677 ----
NM_001040409chr22659 93 ------
NM_001040429chr1353424 2722 1267 479 404 --12308 --
NM_001040432chr31133 ------
NM_001040441chr185178 5123 3739 3380 1747 947 892 317 11802 ----
NM_001040446chr542041 958 922 878 --12100 --
NM_001040450chr1552761 2634 1148 890 554 --1874 --
NM_001040453chr1552761 2634 1148 890 554 --1874 --
NM_001040653chr321743 699 ------
NM_001040665chr7114953 4936 4334 3952 3844 3365 3313 2015 1821 1314 844 24354 1759 24659 1556 141
NM_001040708chr81784 ------
NM_001040709chr141923 797 560 184 1566 1739 --
NM_001040712chr943032 2827 2760 2272 22547 1140 11148 13318
NM_001040876chr441652 1385 540 409 ------
NM_001042368chr93864 532 289 ------
NM_001042399chr121485 ------
NM_001042403chr124789 383 291 217 ------
NM_001042406chr6--2927 452 1806 --
NM_001042413chr953894 2850 1130 747 607 12988 21626 357 1921
NM_001042414chr13164 ------
NM_001042424chr432844 1160 834 12477 ----
NM_001042425chr63309 173 143 ----11409
NM_001042454chr16------1359
NM_001042473chr1041751 1455 309 222 1543 22008 252 --
NM_001042478chr1121 ------
NM_001042486chr2051565 1555 1229 424 332 ----11167
NM_001042492chr1742349 2208 370 210 13378 22817 2649 --
NM_001042494chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_001042495chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_001042496chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_001042497chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_001042506chrX31150 450 428 --11327 --
NM_001042510chr821585 43 ------
NM_001042511chr821585 43 ------
NM_001042533chr332815 896 110 --12387 12673
NM_001042537chrX31962 1828 1547 21779 69 --12478
NM_001042543chr421354 63 --11528 --
NM_001042555chr1233511 1605 203 --24139 3932 33492 1265 734
NM_001042599chr267820 6135 5520 4751 2697 1975 12532 46904 1758 1057 87 17605
NM_001042601chr312674 12048 12445 --
NM_001042603chr1275367 3503 3445 3387 3329 806 178 11966 ----
NM_001042604chr334699 3005 1319 --146 --
NM_001042724chr19----2721 133 --
NM_001042749chrX21353 445 ------
NM_001042750chrX21353 445 ------
NM_001042751chrX21353 445 ------
NM_001044305chr61616 ----1105
NM_001044385chr263870 3770 3352 3337 1046 583 ------
NM_001046chr521887 970 ------
NM_001048183chr1103438 3429 3379 3352 3019 2702 2356 1281 841 372 22974 2412 1487 13174
NM_001049chr1462350 636 608 555 314 238 --1328 --
NM_001066chr142014 1353 727 294 1783 1389 11974
NM_001071775chr1331544 1481 312 --1575 --
NM_001076778chr332304 1803 437 2653 30 12230 1338
NM_001079874chr141552 1441 622 466 --1553 --
NM_001083620chr422022 403 --1344 --
NM_001095chr1271659 1287 1200 316 304 253 168 --31374 175 84 11303
NM_001099678chr3125967 5685 5568 5294 5010 4850 4482 4272 2472 2198 1708 1068 14906 15128 1155
NM_001106chr3199358 8867 8858 8244 7988 7874 7583 7262 6936 6057 3174 2621 2451 2188 1474 1093 217 201 122 27745 6519 68104 7290 7073 899 491 484 22154 420
NM_001109977chr43607 285 95 1698 ----
NM_001111chr122432 448 ----22370 261
NM_001113490chrX83019 3009 2719 2269 1325 1170 588 444 12704 11343 12239
NM_001116chr1642772 1950 1118 21 --1895 --
NM_001117chr18------196
NM_001126chr1----1361 --
NM_001146chr831814 1579 189 1597 11853 --
NM_001167chrX146401 6354 5845 5592 5346 4886 4848 4389 4134 2253 2200 1392 836 41 ----11446
NM_001173chr1444694 4262 3217 1861 ------
NM_001179chr41200 ------
NM_001186chr2152286 957 729 711 119 13233 --12167
NM_001189chr431001 986 315 --3947 940 175 1868
NM_001191chr2061343 950 491 348 319 299 1117 21393 26 --
NM_001198chr682448 2252 2159 1878 1593 840 792 767 1680 --12310
NM_001201chr423235 1441 --12748 --
NM_001204chr285997 4992 4936 3117 1764 1269 1076 665 --21137 600 15249
NM_001206chr9----21974 621 --
NM_001222chr1031662 1501 485 --11304 --
NM_001241chr2----11711 --
NM_001241chr2----11711 --
NM_001254chr1731017 309 239 ----1191
NM_001256chr171207 ------
NM_001257chr1621235 410 ----167
NM_001259chr7105802 4629 4579 2198 2080 1651 1491 1443 1123 1084 25979 4322 23844 1316 12169
NM_001284chr53522 73 58 ------
NM_001293chr111401 ------
NM_001304chr1773839 3507 2548 1525 939 775 639 12673 1583 --
NM_001310chr1241026 980 651 137 198 ----
NM_001319chr1931038 309 298 ------
NM_001324chr201156 --2488 40 --
NM_001329chr1011233 --11490 --
NM_001343chr521531 153 11544 2324 98 --
NM_001356chrX2869 250 --1629 --
NM_001364chr1153593 3134 3093 1870 1710 23456 400 23285 1634 1272
NM_001386chr842119 1628 908 747 1243 ----
NM_001387chr582970 2683 2539 2495 2150 1108 569 281 ------
NM_001390chr1833021 2907 1380 12259 ----
NM_001391chr18--1174 11098 --
NM_001396chr2111865 --11910 --
NM_001397chr192518 2443 2280 2100 2051 1898 1693 964 704 ------
NM_001399chrX63265 2928 2384 1130 850 697 --11376 --
NM_001402chr611852 ------
NM_001406chr1781481 1285 590 394 369 190 178 23 ------
NM_001407chr311501 --1131 --
NM_001412chrX22840 246 --33170 2917 1421 --
NM_001417chr1211786 --21738 396 21557 76
NM_001418chr113741 691 187 --1484 --
NM_001418chr113741 691 187 --1484 --
NM_001419chr1943625 1234 755 537 13416 13569 --
NM_001430chr241905 1755 211 32 --11850 --
NM_001431chr62816 312 ------
NM_001438chr183310 2427 1330 1211 1068 350 328 189 ------
NM_001448chrX21583 65 ------
NM_001451chr1621161 967 ------
NM_001465chr521645 450 1815 ----
NM_001482chr15----2308 201 --
NM_001494chr101720 ------
NM_001497chr942709 1785 94 62 --12165 --
NM_001498chr62951 384 ------
NM_001518chr741106 145 125 65 ------
NM_001542chr112549 12783 1370 1285
NM_001543chr5104404 3778 3187 1849 1523 1423 1382 1237 767 563 24764 4351 13704 --
NM_001552chr1761022 970 940 897 104 41 ------
NM_001554chr11660 ------
NM_001555chrX174 ------
NM_001565chr42245 168 --1221 --
NM_001587chrX3790 575 157 1304 ----
NM_001614chr171648 ------
NM_001614chr171648 ------
NM_001616chr253510 3254 2866 2625 2347 11114 ----
NM_001621chr722088 932 12144 --1567
NM_001621chr722088 932 12144 --1567
NM_001626chr1973483 3349 2621 2247 1362 1285 361 23549 1291 12481 --
NM_001634chr631604 506 226 11271 ----
NM_001642chr111886 ----11263
NM_001649chrX42365 1991 1924 1836 ------
NM_001650chr1852963 882 507 356 337 13692 ----
NM_001656chr5--1661 ----
NM_001658chr11986 ------
NM_001659chr1272355 2177 821 667 647 73 62 21847 566 32673 586 385 12494
NM_001660chr31150 ------
NM_001661chr17----1267 --
NM_001663chr1431793 1095 994 ------
NM_001664chr32767 101 ------
NM_001668chr11634 ------
NM_001677chr12400 197 ----1764
NM_001678chr1711809 21132 298 11345 --
NM_001682chr1232388 614 174 --12046 --
NM_001690chr312565 12048 ----
NM_001693chr861144 1082 851 196 108 99 --1971 --
NM_001698chr91349 1498 ----
NM_001701chr9145 ------
NM_001706chr31987 ----151
NM_001707chr74717 632 574 191 --1679 --
NM_001709chr1121910 934 ----22478 1869
NM_001717chr151565 11455 ----
NM_001722chr81551 1497 ----
NM_001729chr41364 ------
NM_001740chr163517 356 53 2572 199 --168
NM_001742chr71483 ----11751
NM_001743chr2----1610 --
NM_001754chr2193871 3650 3372 3205 2834 2701 1519 1496 1077 ----11197
NM_001759chr1263868 3489 3278 1986 1595 1067 1630 23474 113 --
NM_001769chr121366 ----136
NM_001777chr383951 3441 3214 2987 1252 1175 495 376 1389 ----
NM_001788chr7------1860
NM_001789chr331387 557 141 11378 154 --
NM_001792chr18197 ------
NM_001797chr161568 ------
NM_001800chr19--193 --1571
NM_001806chr1922862 2230 --12400 11824
NM_001812chr4------1307
NM_001819chr20------190
NM_001830chrX43878 3758 3645 1572 1957 ----
NM_001833chr9--149 ----
NM_001834chr5--199 --1216
NM_001845chr131170 --1381 --
NM_001854chr111549 11141 ----
NM_001859chr953733 3678 3522 1165 626 1682 ----
NM_001861chr161123 ------
NM_001872chr13--1343 ----
NM_001873chr4132 1217 ----
NM_001881chr101373 --1380 --
NM_001893chr171357 --150 --
NM_001901chr62984 174 ------
NM_001903chr51794 ------
NM_001918chr1159060 8605 6865 6591 5961 5627 2714 2526 2257 2206 2036 1427 1270 1079 410 11963 17143 --
NM_001920chr12----2767 651 1114
NM_001921chr41932 --11298 --
NM_001923chr114660 212 117 55 ------
NM_001924chr11472 ------
NM_001933chr1411327 ------
NM_001939chrX62629 2500 1471 1400 442 396 1579 1436 --
NM_001945chr541148 930 462 41 ----1545
NM_001949chr63932 680 89 ----12679
NM_001950chr162612 312 --1649 --
NM_001951chr8----132 1413
NM_001955chr62988 745 ------
NM_001964chr52390 140 ----2257 179
NM_001968chr42316 212 1322 ----
NM_001980chr1232293 1717 562 ------
NM_001981chr15861 509 352 313 83 --11574 --
NM_001987chr1223602 3315 2181 52 --11608
NM_002006chr485574 5036 4723 3608 1818 1628 1508 938 21724 224 11079 --
NM_002009chr1531800 822 520 --22508 303 --
NM_002015chr1353148 2049 1144 830 476 ------
NM_002017chr11----1177 --
NM_002025chrX129093 7879 6600 5784 3653 2524 2333 2104 1398 1123 911 589 43612 1508 1024 309 46680 6304 422 44 --
NM_002027chr8--1164 ----
NM_002035chr1833240 902 886 13305 ----
NM_002040chr212953 866 ------
NM_002063chrX11032 1906 ----
NM_002065chr151347 1200 595 315 200 11479 ----
NM_002071chr181143 ------
NM_002072chr95864 812 686 229 28 1880 ----
NM_002074chr121656 1340 180 ----
NM_002076chr1243127 2963 1004 718 --23191 1086 1191
NM_002084chr5------3838 259 88
NM_002126chr1773504 2694 656 635 516 374 100 1796 23743 3581 --
NM_002128chr1311888 ----1741
NM_002131chr671172 1144 965 922 890 489 481 ----11071
NM_002136chr12--1549 ----
NM_002137chr711684 ------
NM_002139chrX164 2426 75 ----
NM_002141chr7----130 --
NM_002156chr2121 ------
NM_002158chr223793 1198 ------
NM_002160chr9159 ------
NM_002199chr4--1236 ----
NM_002203chr543466 2917 1514 613 --11035 13335
NM_002210chr223358 1078 23431 2879 23304 2575 --
NM_002214chr775054 4811 4163 3882 1611 1246 950 --44823 2128 2015 1404 --
NM_002221chr172303 2198 2172 877 776 421 370 12331 ----
NM_002222chr32151 29 ------
NM_002223chr1213234 13484 12901 --
NM_002224chr63238 124 69 1270 ----
NM_002227chr12956 822 ------
NM_002232chr13468 222 61 ------
NM_002235chr1231657 565 125 21286 77 11175 21617 1278
NM_002240chr211449 --1160 --
NM_002241chr183051 2303 2296 2177 507 345 338 73 22204 2036 2720 209 --
NM_002249chr11206 2500 31 ----
NM_002254chr231959 152 74 123 1935 2667 381
NM_002264chr364878 4792 3871 3764 3739 1292 145 --13310
NM_002265chr171830 ------
NM_002266chr17167 ------
NM_002267chr1362134 1624 800 641 615 244 1335 ----
NM_002269chr61400 ------
NM_002270chr594940 4060 3970 2181 1613 996 965 695 91 ----23750 303
NM_002271chr1341817 828 185 51 1446 ----
NM_002290chr631379 496 411 21364 22 ----
NM_002293chr142177 2113 490 233 1239 ----
NM_002296chr111105 ------
NM_002298chr1351341 1062 484 415 48 11115 ----
NM_002334chr113225 175 155 --1380 --
NM_002356chr642882 1940 1075 260 1873 11755 --
NM_002374chr243467 2923 2701 295 43252 1360 399 319 ----
NM_002381chr22674 293 ------
NM_002382chr1441180 1004 447 382 2388 330 ----
NM_002387chr564953 4611 3486 3362 1778 1259 24037 1567 13191 33672 960 29
NM_002390chr1781979 1942 1921 1431 1386 256 164 63 21609 1333 ----
NM_002395chr631461 382 231 ------
NM_002397chr51855 ------
NM_002398chr211388 --1413 --
NM_002399chr1511234 2230 143 ----
NM_002430chr2261755 947 446 231 75 27 ------
NM_002444chrX51896 1500 1431 1407 744 --2801 572 --
NM_002445chr841603 1439 1147 316 ------
NM_002455chr1----136 --
NM_002473chr2251276 947 912 427 122 --2885 499 --
NM_002485chr821527 51 --21950 799 --
NM_002487chr151245 1698 ----
NM_002499chr1552006 1641 589 406 56 ------
NM_002501chr1983249 2514 1012 996 990 663 599 491 --13933 --
NM_002505chr61500 11193 199 1576
NM_002508chr13614 230 51 --11609 --
NM_002514chr811188 ------
NM_002515chr1441844 1428 276 166 --144 --
NM_002519chr112617 566 ------
NM_002522chr1743887 2588 824 713 11479 42450 2398 869 808 --
NM_002524chr14901 757 285 191 1933 1252 --
NM_002537chr152996 279 ----124
NM_002545chr1195107 4731 1946 922 810 547 324 265 208 41533 1162 967 832 --3877 840 618
NM_002552chr21132 --1454 --
NM_002553chr72340 192 ------
NM_002558chr1731080 215 104 ------
NM_002572chr112392 52 ------
NM_002576chr1151182 1094 872 835 495 1432 ----
NM_002577chr343026 889 800 629 --12818 12730
NM_002578chrX2152 110 1403 ----
NM_002581chr9114901 4651 4584 4578 4328 3932 1854 928 602 456 130 --2860 689 1144
NM_002599chr1141231 813 253 137 2933 27 1341 --
NM_002600chr11390 --21199 34 21363 1352
NM_002605chr151801 --1959 --
NM_002607chr741243 1179 974 896 1850 ----
NM_002609chr571866 1496 1232 415 211 100 22 21543 1272 ----
NM_002613chr1694214 3649 1785 1531 1366 846 376 45 23 34060 1483 1424 24975 3669 11966
NM_002628chr3199 --1780 122
NM_002634chr174854 360 204 167 --2726 605 --
NM_002641chrX2640 121 --11892 --
NM_002645chr1132692 854 389 ------
NM_002646chr151630 1502 1475 740 262 --1837 --
NM_002648chr64959 844 523 500 11105 ----
NM_002649chr71133 ------
NM_002655chr841776 1285 1194 196 --1357 --
NM_002657chr2053251 3172 2885 2593 844 --12500 12797
NM_002670chr341338 1237 193 22 11377 ----
NM_002687chr141146 ------
NM_002698chr1962802 2796 2535 2458 518 97 ----12752
NM_002709chr243586 3531 3138 520 22689 796 ----
NM_002713chr141040 408 269 241 ------
NM_002717chr81505 ------
NM_002719chr1421714 298 11518 1747 --
NM_002721chr93190 66 47 --136 --
NM_002737chr1774917 2334 2089 1702 1047 909 510 34126 2517 853 11567 --
NM_002745chr2234400 3502 1657 33053 1489 442 --11225
NM_002748chr151908 1786 1492 --
NM_002752chr51541 1136 ----
NM_002753chr41647 --1540 --
NM_002760chrY75973 4494 3855 3739 2217 229 118 44832 3751 1247 780 --15217
NM_002776chr1981854 1249 776 409 318 197 185 133 --11656 --
NM_002814chrX1214 ------
NM_002815chr17197 ------
NM_002816chr171262 1246 ----
NM_002819chr1931347 1122 131 --1554 --
NM_002828chr182998 674 ------
NM_002833chr1531184 48 22 11313 ----
NM_002834chr1282760 1242 1145 980 907 858 480 137 --13780 --
NM_002835chr71298 --1145 --
NM_002839chr943032 2827 2760 2272 22547 1140 11148 13318
NM_002840chr121537 1314 ------
NM_002841chr31215 ------
NM_002843chr1141169 1147 707 410 ----22965 2286
NM_002849chr1221013 291 156 1861 1729
NM_002852chr31584 ------
NM_002855chr1193573 3115 3068 992 923 849 819 768 279 53405 3345 866 116 66 ----
NM_002858chr121324 350 ------
NM_002859chr1251469 1249 623 575 546 1230 123 --
NM_002868chr1272455 2259 2240 1822 210 203 68 --11849 --
NM_002869chr113489 423 407 ------
NM_002874chr9--1389 --12011
NM_002886chr364837 4359 1756 1637 780 588 24164 194 ----
NM_002887chr5134 ------
NM_002890chr51855 1769 ----
NM_002892chr14--1370 ----
NM_002924chr11212 ------
NM_002928chr131487 1439 68 11265 11498 --
NM_002938chr461863 1569 530 394 378 68 1763 21629 1410 1737
NM_002940chr441652 1385 540 409 ------
NM_002941chr31515 ------
NM_002942chr3----1473 --
NM_002959chr163661 3616 3045 522 380 367 ----1876
NM_002968chr16167 ------
NM_002970chrX1344 ------
NM_002973chr12257 48 ------
NM_002998chr851955 1731 1520 1493 686 1577 1413 --
NM_003010chr1751882 1795 746 709 633 11505 12429 --
NM_003011chr931196 467 449 --2209 142 --
NM_003016chr1721468 421 ------
NM_003026chr91345 --31108 1003 967 11118
NM_003028chr933279 2535 577 22959 1228 --13326
NM_003030chr341741 233 221 83 --11417 --
NM_003032chr332201 1080 295 22705 1000 2956 672 --
NM_003034chr12107953 6944 6081 5094 4908 2144 1554 1358 1344 947 11264 58106 6900 6597 5124 3054 26217 1398
NM_003036chr131235 1029 179 --21199 465 --
NM_003042chr342051 1895 1435 98 1867 ----
NM_003043chr343290 1418 1255 365 ----13921
NM_003046chr875362 4778 3867 3390 3345 1314 451 ------
NM_003051chr13775 78 63 --11261 --
NM_003053chr82714 109 --1607 --
NM_003059chr5--1324 ----
NM_003069chrX----1303 --
NM_003070chr91598 ----163
NM_003074chr331863 895 327 ------
NM_003079chr171722 --1309 --
NM_003100chr5----1353 --
NM_003107chr632412 2223 2147 11600 --1233
NM_003108chr266952 6564 5998 5363 2799 824 15735 22075 1811 --
NM_003110chr176923 882 867 343 187 99 1225 ----
NM_003111chr221344 238 ------
NM_003112chr742764 2630 2288 1049 ------
NM_003128chr22425 24 --12470 --
NM_003131chr632201 1503 584 31867 808 307 21486 469 --
NM_003140chrY--136 ----
NM_003144chr642251 680 280 42 1790 --1376
NM_003150chr17102385 2194 2176 1653 759 703 394 315 58 48 12247 11550 --
NM_003153chr1271148 1065 754 195 124 114 41 1208 ----
NM_003155chr872435 1830 1063 568 263 250 220 --1119 --
NM_003161chr1753488 3467 1388 1122 793 --23248 1139 --
NM_003173chrX61249 399 357 131 115 69 ------
NM_003178chr31171 ------
NM_003179chrX51378 1278 235 176 60 --1276 --
NM_003188chr61633 ------
NM_003189chr133171 2643 384 42852 2729 2231 467 ----
NM_003199chr1865631 5292 4159 3883 1173 528 ------
NM_003202chr571565 1510 565 511 363 256 53 1754 --1575
NM_003214chr621214 143 --21035 99 1263
NM_003216chr2273173 2691 2495 2450 2060 1130 50 1789 22961 2888 --
NM_003217chr1231897 1512 1325 1559 --1257
NM_003220chr63309 173 143 ----11409
NM_003221chr673840 3246 2840 2661 1566 880 516 13115 ----
NM_003222chr2031197 456 115 ------
NM_003234chr321905 1698 22107 1911 ----
NM_003246chr1531719 302 267 --21411 1277 --
NM_003253chr2141503 710 382 46 ----158
NM_003257chr1531049 1008 69 ------
NM_003259chr19------1134
NM_003262chr335117 1601 107 --15070 --
NM_003270chrX----2260 34 --
NM_003281chr195281 5025 4822 3866 1822 1058 978 654 76 14176 24442 1669 51845 1645 1438 564 226
NM_003289chr91181 ------
NM_003291chr13--1108 ----
NM_003292chr142235 2154 1560 264 11415 --1232
NM_003298chr345863 5801 4686 4462 16227 14932 --
NM_003305chr42289 108 ------
NM_003318chr61229 ------
NM_003320chr1164098 4077 3732 3587 3356 80 11483 22707 1670 --
NM_003334chrX1130 --1158 --
NM_003336chrX3795 147 70 --1156 --
NM_003337chr531446 1123 50 ------
NM_003338chr1011778 ----1122
NM_003339chr52631 128 ----1519
NM_003340chr41131 ------
NM_003341chr31530 ------
NM_003342chr1752486 1279 988 914 775 --13043 183
NM_003347chr2282340 2285 2213 1919 1905 458 365 246 11818 ----
NM_003350chr8----1848 2367 46
NM_003369chr1162287 2257 1768 694 534 41 --22011 302 --
NM_003373chr1071944 1254 1239 698 606 515 38 177 31293 330 245 --
NM_003374chr52155 52 ------
NM_003383chr91193 ------
NM_003385chr21657 1127 1861 --
NM_003387chr232921 1865 1121 ----124
NM_003390chr11--1401 ----
NM_003392chr333597 2912 1715 ------
NM_003400chr21828 ------
NM_003405chr22--1121 ----
NM_003407chr191434 ------
NM_003410chrX32064 438 304 11042 ----
NM_003439chr753103 2358 688 591 155 --23155 888 --
NM_003442chr11----1866 --
NM_003445chr191103 ------
NM_003455chr1111468 11690 1261 --
NM_003458chr373750 3699 3429 2960 1209 571 442 13458 11027 11263
NM_003463chr653100 2849 943 572 129 12491 ----
NM_003466chr23981 521 357 12384 --11742
NM_003468chr273949 3321 1380 1307 1206 299 87 ------
NM_003469chr2----184 --
NM_003470chr1621868 174 --11265 --
NM_003478chr1121200 123 --13191 11221
NM_003482chr1262095 1060 769 743 679 482 2310 40 1232 --
NM_003483chr1232708 2526 791 --126 --
NM_003489chr2111359 ------
NM_003496chr72834 734 ------
NM_003507chr241672 1651 578 113 --12021 --
NM_003557chr151586 1137 428 95 37 --21304 1293 --
NM_003558chr93503 204 195 ------
NM_003559chr1773502 3289 3271 3209 3183 2563 232 1409 12490 --
NM_003566chr1262635 2614 2168 1133 805 494 ------
NM_003574chr1844967 3880 481 66 35176 4714 1619 21375 912 --
NM_003575chr751345 1121 1087 631 511 1611 1484 --
NM_003580chr82411 109 ------
NM_003583chr1233949 3141 1473 1594 --1109
NM_003590chr232955 958 552 13344 ----
NM_003595chr221186 ----1453
NM_003603chr421802 1740 --11975 --
NM_003607chr143920 3433 3072 277 --23118 271 1900
NM_003615chr354035 3926 2956 820 287 ------
NM_003618chr211061 ------
NM_003632chr171292 1718 2674 250 1788
NM_003635chr10----2412 108 --
NM_003642chr21118 ------
NM_003644chr17106481 4385 4181 2579 1913 1360 941 767 638 209 --25166 2153 --
NM_003659chr21770 ------
NM_003660chr192268 70 --1316 --
NM_003663chr373307 3232 3073 1372 1201 1160 302 --1315 --
NM_003671chr923106 2793 22747 774 --13140
NM_003681chr21145323 4735 4480 4229 3889 2454 1815 1405 943 936 882 685 461 78 --24360 2054 --
NM_003688chrX--1105 ----
NM_003692chr91678 ----1250
NM_003714chr543042 2641 2089 76 1938 22487 2054 --
NM_003718chr71450 ------
NM_003741chr32345 142 --1127 --
NM_003749chr1331495 810 458 --22021 1922 --
NM_003754chr111137 ------
NM_003758chr1531020 336 85 ------
NM_003758chr1531020 336 85 ------
NM_003759chr433076 2983 2708 --1951 12749
NM_003763chr2062798 2652 2610 1193 728 80 22242 1199 --13122
NM_003766chr171451 ------
NM_003769chr121277 ------
NM_003773chr32249 39 ------
NM_003787chr1821393 1128 --11142 --
NM_003794chr3--182 ----
NM_003796chr192456 140 --1134 --
NM_003797chr111186 ------
NM_003800chr632339 823 469 ------
NM_003816chr8--11330 1374 --
NM_003825chr1531399 1208 187 ------
NM_003831chr181195 1683 ----
NM_003840chr83725 486 39 1116 ----
NM_003842chr82707 41 --12421 1642
NM_003870chr1532067 2032 175 21570 717 ----
NM_003872chr232011 572 192 ------
NM_003877chr122899 191 --1782 --
NM_003895chr212700 394 ------
NM_003902chr11162 ------
NM_003913chr673951 3754 3558 3245 2927 1211 1101 13061 ----
NM_003930chr761998 1567 828 711 665 316 ----1263
NM_003941chr752254 2217 1717 198 97 ------
NM_003958chr683783 3539 3467 3354 2709 713 506 248 --12935 11333
NM_003966chr566639 5599 2988 2407 1137 1115 25457 67 37658 5052 1640 --
NM_003971chr171157 --165 --
NM_003972chr101949 ------
NM_003980chr621134 384 ------
NM_003982chr14147 1279 ----
NM_004006chrX1596 --11939 12166
NM_004007chrX1596 --11939 12166
NM_004009chrX1596 --11939 12166
NM_004010chrX1596 --11939 12166
NM_004011chrX1596 --11939 12166
NM_004012chrX1596 --11939 12166
NM_004013chrX1596 --11939 12166
NM_004014chrX1596 --11939 12166
NM_004015chrX1596 --11939 12166
NM_004016chrX1510 --11853 12080
NM_004017chrX1596 --11939 12166
NM_004018chrX1510 --11853 12080
NM_004019chrX------1404
NM_004020chrX1596 --11939 12166
NM_004021chrX1510 --11853 12080
NM_004022chrX1510 --11853 12080
NM_004023chrX1510 --11853 12080
NM_004028chr1852963 882 507 356 337 13692 ----
NM_004035chr17104974 4414 4389 4214 1883 1822 1311 541 439 429 15048 21461 1316 --
NM_004055chr1152009 1996 633 622 303 --1146 2801 269
NM_004067chr731052 612 496 ----1439
NM_004068chr31395 ------
NM_004079chr152490 2212 668 652 257 1978 1716 12965
NM_004081chrY21344 549 11835 ----
NM_004083chr12171 142 ----
NM_004089chrX2792 46 ------
NM_004090chr1732717 2675 2197 11074 ----
NM_004093chr1322633 400 22866 516 ----
NM_004096chr1071980 1685 1605 784 613 555 441 ------
NM_004100chr61306 1414 11990 --
NM_004105chr21996 11005 ----
NM_004109chr1151644 1533 767 310 37 ------
NM_004112chr1741652 1426 1197 445 --3457 450 136 --
NM_004114chrX3474 139 109 ------
NM_004119chr132668 42 --1564 --
NM_004132chr1051131 1028 197 121 115 1260 1850 --
NM_004133chr832646 911 247 ------
NM_004134chr51608 1657 1615 --
NM_004136chr1553126 3054 2570 2299 575 --12135 11142
NM_004171chr11109090 7861 3827 3300 2526 2479 1441 1114 654 648 ----18889
NM_004186chr32349 114 1904 2659 294 --
NM_004187chrX41317 443 408 123 ------
NM_004200chr1172952 2835 2742 2694 2622 2119 1049 --32060 1242 1019 --
NM_004202chrY3545 126 26 ------
NM_004209chr163833 335 167 3925 362 239 ----
NM_004225chr831467 1372 1206 ------
NM_004232chr1862926 2460 1479 1235 1111 880 21554 313 ----
NM_004242chr62104 67 ------
NM_004261chr12755 25 ------
NM_004263chr241787 1631 1188 718 11660 1490 --
NM_004272chr51627 11546 ----
NM_004273chr10134969 4943 4618 4399 3746 3332 3130 3097 921 898 525 56 44 11837 ----
NM_004274chr14123056 2940 2924 2818 2791 2779 2180 1042 1030 665 490 284 ----12611
NM_004277chr611534 --189 --
NM_004279chr74501 358 315 137 ------
NM_004293chr933751 3664 114 --13084 --
NM_004296chr1463254 2998 2676 2537 1404 678 33679 3542 2524 ----
NM_004301chr31352 --124 --
NM_004302chr12152858 2711 2626 2551 2491 2403 2226 2190 2168 1879 829 530 376 198 82 --22545 2382 2835 96
NM_004319chr13327 306 202 32313 1206 1126 22462 775 --
NM_004323chr982358 2316 2042 1973 128 75 54 28 --12189 2882 258
NM_004326chr11165 21101 1017 ----
NM_004327chr2272026 1972 853 847 832 337 125 12207 --1818
NM_004329chr101407 --1437 152
NM_004330chr151974 ------
NM_004338chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_004344chrX2202 23 ------
NM_004354chr41120 ------
NM_004359chr193184 73 30 ------
NM_004362chr41499 --1704 --
NM_004379chr221626 383 11682 ----
NM_004380chr1631814 585 528 ------
NM_004392chr13--1403 ----
NM_004395chr52589 25 1153 ----
NM_004397chr1132879 1280 815 --21587 1416 23856 610
NM_004405chr2159 ------
NM_004417chr51467 --1418 --
NM_004423chr372748 2665 2603 1816 691 680 291 11872 4797 674 508 469 22426 225
NM_004432chr931673 775 229 ------
NM_004434chr1431841 135 59 --1607 --
NM_004438chr222666 42 ----11310
NM_004440chr621408 243 --11230 --
NM_004441chr321280 1134 ------
NM_004447chr121237 ------
NM_004450chr141295 ------
NM_004454chr342027 1941 609 531 --11874 --
NM_004458chrX22033 1758 1434 11892 --
NM_004459chr1741974 1395 431 95 ------
NM_004480chr141263 ------
NM_004497chr191666 ------
NM_004499chr5--1509 ----
NM_004500chr1441899 1639 219 44 31705 1535 817 11265 --
NM_004501chr133991 3840 3506 --13920 --
NM_004503chr121790 1674 1519 --
NM_004504chr252969 2875 2333 836 665 22116 2098 11898 --
NM_004505chr1751719 1639 1378 417 325 11501 ----
NM_004514chr1742331 929 621 486 12061 11057 22862 250
NM_004516chr19----1377 --
NM_004521chr101283 --192 --
NM_004527chr17153 31155 142 46 ----
NM_004532chr3126 ------
NM_004537chr124532 523 478 223 11146 145 --
NM_004538chrX2648 193 --1753 --
NM_004540chr211699 2640 153 1780 --
NM_004569chr141218 ------
NM_004571chr2163010 2409 2374 2368 1024 576 22800 738 23277 1116 --
NM_004575chr441391 1046 569 65 ------
NM_004580chr1521903 1632 --11680 --
NM_004586chrX75119 4856 4437 4364 3727 3658 1597 11654 ----
NM_004588chr1174053 3186 3062 1624 1230 1076 830 22510 349 33381 3222 2805 --
NM_004598chr552862 1183 1036 924 492 32946 1064 367 ----
NM_004612chr934099 3892 3317 --2241 80 --
NM_004631chr121248 988 2439 249 ----
NM_004637chr351092 1044 542 464 252 1258 21251 433 --
NM_004654chrY11348 ------
NM_004655chr1731303 946 939 ------
NM_004656chr361104 946 380 313 288 67 ------
NM_004660chrY----1625 --
NM_004661chr521086 379 1524 1388 --
NM_004687chr1741898 1844 838 185 ------
NM_004694chr17----197 --
NM_004697chr94980 428 100 88 ------
NM_004703chr1752196 2177 1890 533 327 --1791 --
NM_004705chr112308 181 --1135 --
NM_004713chr141652 ------
NM_004715chr181194 ------
NM_004717chr731568 1373 392 1403 2126 49 --
NM_004719chr1232847 1921 885 --21116 663 --
NM_004726chrX45318 815 543 41 1936 ----
NM_004729chrX51727 1683 1606 280 71 --11968 --
NM_004730chr52782 600 ------
NM_004734chr1343224 2258 201 61 ----1929
NM_004737chr2231267 827 141 --1188 11201
NM_004738chr2032324 2037 131 11898 ----
NM_004744chr423767 2436 12491 ----
NM_004745chr875935 5722 5455 2634 2211 1831 933 15811 16008 11972
NM_004748chr1544006 3769 3449 611 13997 ----
NM_004760chr732220 410 205 ------
NM_004762chr1751597 1230 715 325 99 --1496 12038
NM_004766chr3265 21 ------
NM_004768chr13948 798 461 ----1785
NM_004772chr5------11204
NM_004774chr1722866 1986 --12883 12439
NM_004775chr1832169 1727 1496 ------
NM_004776chr2043074 2212 338 285 ----129
NM_004781chr131726 485 317 11752 ----
NM_004781chr131726 485 317 11752 ----
NM_004796chr1432314 1759 860 --11886 148
NM_004805chr241440 1350 413 286 ------
NM_004815chr174747 4110 4103 3849 3226 1880 1203 --24906 936 13023
NM_004820chr8241 31 ------
NM_004821chr51639 1691 1749 --
NM_004822chr17103364 2643 1515 1284 780 774 673 349 268 176 32792 2478 787 33744 1359 768 13217
NM_004824chr641378 1328 1037 444 ------
NM_004834chr273374 3239 2155 1184 966 900 249 ------
NM_004836chr21614 ------
NM_004841chr12423 65 ----11087
NM_004845chrX64139 4125 3073 1656 960 430 11665 ----
NM_004846chr2175 ------
NM_004849chr631321 1134 1050 ------
NM_004859chr1732737 2244 2219 ----22487 57
NM_004862chr1631076 319 297 --187 1415
NM_004863chr1474772 3966 3715 1630 1191 656 277 ------
NM_004865chr61287 ------
NM_004866chr534210 1282 169 11541 --11718
NM_004869chr1821514 100 1256 ----
NM_004874chr8169 ------
NM_004884chr155539 513 457 252 71 --2690 119 --
NM_004898chr442795 2778 2527 2077 --12012 --
NM_004904chr776027 4441 4122 1737 1564 1432 204 15989 ----
NM_004925chr92196 33 --1126 1827
NM_004926chr143610 43 31 178 --1455
NM_004929chr831051 565 546 ------
NM_004932chr541099 535 346 76 11801 1100 --
NM_004947chr382564 1996 993 842 833 670 545 145 21017 538 ----
NM_004948chr1811307 11364 ----
NM_004956chr774142 3896 3446 3129 1648 489 160 11803 ----
NM_004960chr162252 56 1258 ----
NM_004961chrX71521 1388 973 564 176 163 119 11232 ----
NM_004969chr101447 ------
NM_004976chr1183304 3290 1894 1726 1439 638 607 534 64459 3972 3349 3332 3178 551 21411 1099 11106
NM_004985chr1234512 4253 132 11578 ----
NM_004992chrX107927 7080 6694 6432 5195 3188 2643 1363 1236 1097 27318 5263 38059 5385 1571 --
NM_004992chrX107927 7080 6694 6432 5195 3188 2643 1363 1236 1097 27318 5263 38059 5385 1571 --
NM_004993chr1431350 575 455 ------
NM_005010chr761669 1391 1369 678 614 384 ------
NM_005017chr3----1237 --
NM_005022chr171243 1170 ----
NM_005028chr1041954 1457 173 158 --1600 --
NM_005044chrX43013 1824 1580 46 1963 1616 13736
NM_005045chr71678 ------
NM_005051chr3122 ------
NM_005056chr1275611 3747 3689 3631 3573 1050 422 12210 ----
NM_005057chr131570 1539 768 ------
NM_005058chrY----1242 --
NM_005063chr1063467 2979 2588 1537 968 169 1634 ----
NM_005065chr1473314 2149 1981 1733 1467 762 293 ------
NM_005066chr1----1714 --
NM_005067chr34976 655 634 113 ------
NM_005069chr21----11716 --
NM_005073chr132826 788 --156 --
NM_005076chr154032 3614 1550 1474 169 1567 12823 22690 1399
NM_005079chr852730 2087 1052 474 91 22635 26 12103 12057
NM_005087chr3----1592 --
NM_005093chr2075354 4998 4737 4092 1446 1124 871 34923 4646 2108 --23290 962
NM_005095chr131754 1586 327 11767 ----
NM_005096chrX1853 192 2444 421 --
NM_005099chr151237 239 175 162 126 --2248 139 --
NM_005109chr331859 978 422 12187 ----
NM_005110chr5------1149
NM_005112chr41853 ------
NM_005116chr201852 12889 24136 3962 34031 3484 3367
NM_005121chr1723012 2933 ------
NM_005126chr351836 1542 599 482 284 ------
NM_005135chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_005139chr4--1240 1286 --
NM_005144chr83932 417 397 --31030 974 478 --
NM_005151chr1832369 1776 202 ------
NM_005155chr62675 214 1487 ----
NM_005156chr974788 3848 3710 2021 910 206 173 --11685 --
NM_005164chr1232567 2450 1681 ----12174
NM_005168chr211543 11102 ----
NM_005171chr122422 377 --1345 --
NM_005175chr17179 ------
NM_005181chr81694 ------
NM_005187chr1651602 1490 1428 769 159 41636 1542 492 221 21313 377 1329
NM_005188chr11137652 6976 5896 5343 5203 3120 3026 2423 1814 1005 498 381 275 25641 1908 47863 7267 6655 3059 26795 5324
NM_005189chr1762497 2332 2263 2165 899 229 ------
NM_005197chr1474912 3873 3825 2377 2057 1148 994 34428 4212 914 15382 --
NM_005206chr1731354 897 479 --11094 11033
NM_005230chr12168 ------
NM_005233chr322223 491 ------
NM_005235chr267820 6135 5520 4751 2697 1975 12532 46904 1758 1057 87 17605
NM_005238chr1131100 500 117 ------
NM_005241chr3----1305 --
NM_005254chr1521318 1079 ------
NM_005257chr1811353 1981 ----
NM_005261chr821017 991 ------
NM_005271chr10129 1983 ----
NM_005274chr11130 --1154 --
NM_005276chr1241534 1260 649 507 11575 137 11771
NM_005276chr1241534 1260 649 507 11575 137 11771
NM_005277chr4124 1219 ----
NM_005308chr101350 ------
NM_005327chr42706 141 ------
NM_005329chr1632307 2042 428 ------
NM_005334chrX21521 182 --31644 1421 575 --
NM_005339chr444034 3069 1160 401 ------
NM_005358chr1331859 586 227 --1479 1513
NM_005359chr18135971 5323 5192 4902 2498 2393 2163 1837 1713 1457 1397 1274 488 ----1888
NM_005375chr611190 ------
NM_005382chr81356 ------
NM_005385chr362335 1858 1814 974 739 310 12357 --12385
NM_005387chr11----1604 --
NM_005398chr1031443 1414 92 1189 ----
NM_005399chr173482 2840 1573 435 396 386 269 13507 ----
NM_005402chr731818 672 391 ------
NM_005406chr1821108 43 ------
NM_005410chr51127 ------
NM_005414chr3------1118
NM_005415chr21270 --2764 496 --
NM_005430chr1291048 1036 649 374 345 270 232 221 156 ------
NM_005433chr1832153 1983 34 --11741 --
NM_005436chr1041261 728 436 411 32561 774 132 --157
NM_005439chr124512 366 203 176 1474 ----
NM_005445chr101293 ------
NM_005455chr1----11609 140
NM_005460chr52523 143 ------
NM_005465chr121756 717 --12059 --
NM_005475chr1292877 2642 1263 1194 733 576 440 256 33 1697 2865 507 1192
NM_005479chr1041471 1024 489 412 11043 11216 175
NM_005493chr61750 ------
NM_005497chr17105581 5296 5241 4337 1695 1588 1576 1128 1094 942 24394 1824 25873 455 1931
NM_005502chr962909 2455 1138 1068 579 247 ------
NM_005504chr1286429 5869 5720 5118 4135 4114 845 99 16023 ----
NM_005506chr432323 2062 958 --12929 12219
NM_005520chr51523 ------
NM_005522chr71995 159 ----
NM_005523chr71357 21573 370 ----
NM_005529chr141066 921 411 283 1301 ----
NM_005530chr1551257 1026 1020 1000 988 --1227 --
NM_005542chr741868 1260 205 183 ----1243
NM_005561chr131234 ------
NM_005573chr5148 ------
NM_005578chr364514 3765 1943 1274 820 376 24842 503 13931 --
NM_005585chr15------1123
NM_005595chr11269 ----1346
NM_005596chr985897 5657 4582 3963 2563 2516 2155 1598 --14884 --
NM_005599chr121523 147 11429 ----
NM_005604chr621593 185 22312 2064 1848 --
NM_005607chr82365 29 ------
NM_005610chr12711 99 ------
NM_005630chr32145 21 21459 409 1371 1633
NM_005638chrX41432 337 173 100 --11229 11410
NM_005639chr1221557 195 11567 1208 --
NM_005665chr194777 4700 4297 1348 796 474 199 188 163 14024 24208 1613 --
NM_005668chr534201 3498 3054 1326 13034 --
NM_005669chr562340 2273 591 385 267 27 ----12294
NM_005670chr611964 --288 21 1587
NM_005686chr151239 1224 496 432 325 --11415 1305
NM_005688chr321145 408 ----1834
NM_005700chr112257 121 ------
NM_005715chr652328 1973 1788 1106 693 --1674 --
NM_005722chr231653 701 690 --1106 --
NM_005724chr151165 ------
NM_005736chr1031135 1001 182 ------
NM_005737chr252866 415 228 217 208 --12695 --
NM_005738chr741891 525 325 207 --2605 95 11918
NM_005744chr15138 ------
NM_005751chr71392 ------
NM_005754chr51486 ------
NM_005756chrX41280 467 303 58 11294 ----
NM_005759chr253623 3451 1506 966 190 --14135 11461
NM_005760chr2134 ------
NM_005765chrX2848 819 ------
NM_005776chr14------169
NM_005779chr541339 1261 395 94 12299 ----
NM_005780chr13175 ------
NM_005786chr1811214 1275 ----
NM_005789chr1772143 2048 1832 1617 1568 683 169 12033 --1767
NM_005796chr161279 ------
NM_005808chr32293 140 --1348 --
NM_005828chr1794802 4567 4435 3876 3840 3508 1730 1522 495 1365 31793 786 55 35064 1297 344
NM_005832chr321266 508 ------
NM_005840chrX126862 6455 5781 5068 3011 2664 2457 1483 1320 636 624 475 17407 77658 7092 6869 2383 1590 667 193 12399
NM_005853chr161107 ------
NM_005857chr141038 951 548 242 ------
NM_005859chr521429 1356 ------
NM_005862chr32889 825 1174 ----
NM_005871chr10146 ------
NM_005880chr1631249 594 444 11502 11510 --
NM_005882chr4--1783 ----
NM_005895chr1251604 1372 994 939 33 13656 13230 1791
NM_005896chr22679 616 ------
NM_005898chr1122267 824 ----12305
NM_005900chr411196 ------
NM_005901chr18138726 8634 8031 7357 5608 5467 5377 3488 3214 2981 2782 558 551 37485 2372 92 46216 5944 2812 2447 --
NM_005906chr641377 1363 540 92 ------
NM_005909chr553969 3138 2818 1287 235 14174 14168 --
NM_005910chr1773907 3629 2804 2700 1481 1287 1173 --193 --
NM_005911chr2--1551 11505 --
NM_005920chr153289 2843 1229 1057 72 ----12748
NM_005924chr7--161 ----
NM_005933chr1172717 2674 2080 2074 1927 1205 512 --12199 22402 1959
NM_005934chr1962363 2268 1620 356 89 67 1163 --1863
NM_005938chrX31074 351 165 21369 288 269 62 --
NM_005944chr34385 346 199 41 1167 --11113
NM_005955chr194858 4781 4253 1953 1681 1471 1313 881 104 1355 11048 11169
NM_005962chr1062251 2239 1678 1495 1452 720 --1762 --
NM_005962chr1062251 2239 1678 1495 1452 720 --1762 --
NM_006011chr1594180 4018 3445 3439 3013 2969 2705 1214 400 --12813 --
NM_006015chr13924 267 238 --1108 --
NM_006016chr642204 2187 1879 1710 ------
NM_006030chr341656 589 512 68 11640 21703 382 --
NM_006033chr1822318 341 151 ----
NM_006034chr1172418 2076 812 365 231 115 99 31859 1773 28 22434 819 --
NM_006037chr264620 4509 3039 1679 1412 154 24019 432 13229 --
NM_006047chr202757 397 12504 ----
NM_006080chr731190 594 456 12678 --12381
NM_006089chrX2533 217 ------
NM_006090chr11153 ------
NM_006091chr1511521 11599 11286 150
NM_006095chr454532 3805 3794 3779 1076 ------
NM_006106chr1132853 1330 886 --12511 12164
NM_006107chr171425 ------
NM_006113chr141552 1441 622 466 --1553 --
NM_006133chr1161941 734 678 288 160 69 22120 1703 1769 1708
NM_006135chr13389 262 184 21421 1257 1294 --
NM_006136chr721100 1055 184 1459 --
NM_006147chr11412 ------
NM_006148chr1772644 2369 548 465 303 162 122 2652 335 22262 498 1526
NM_006154chr1552593 2540 504 348 330 ------
NM_006160chr1741570 1308 1034 90 ----11473
NM_006180chr921799 303 ------
NM_006187chr1252078 1295 754 576 497 --21029 284 1351
NM_006191chr123685 303 124 ------
NM_006195chr92918 482 ------
NM_006203chr594914 4591 4081 3573 1965 1887 1613 657 103 1140 1272 --
NM_006206chr432873 2568 947 22052 1052 --11887
NM_006212chr155253 5033 4846 4489 67 --13646 14083
NM_006237chr1332161 2139 1933 --12086 --
NM_006241chr32826 207 --1858 --
NM_006245chr64671 290 269 54 1119 ----
NM_006251chr543022 2953 2874 1240 ------
NM_006252chr1136622 6424 6296 6264 6025 5031 4976 2636 2188 1569 1505 1423 1413 --1787 --
NM_006255chr143880 733 725 ------
NM_006256chr131021 872 844 11729 ----
NM_006258chr1021291 25 11491 ----
NM_006266chr93864 532 289 ------
NM_006267chr221398 701 ------
NM_006275chr2032177 572 545 11863 1673 --
NM_006277chr2----1484 --
NM_006278chr112483 36 ----1367
NM_006282chr2054435 2966 1530 1429 823 24312 794 ----
NM_006283chr884998 4425 3359 3256 1897 1666 998 897 23270 3032 1873 --
NM_006287chr292596 2482 2314 2095 1872 951 668 242 32 ------
NM_006292chr11----1180 --
NM_006306chrX84930 4585 4461 4343 2330 1879 943 89 24689 1442 34817 1153 638 --
NM_006309chr3--146 ----
NM_006310chr1721169 310 ------
NM_006312chr121231 1736 ----
NM_006313chr1211320 171 ----
NM_006315chr464508 3753 3432 3134 3089 975 --11784 --
NM_006317chr53277 85 73 1659 ----
NM_006320chr4--1374 ----
NM_006321chr362166 897 857 736 185 82 1455 22120 413 --
NM_006327chr10------191
NM_006328chr112123 80 --1240 --
NM_006330chr841662 1537 1118 218 ------
NM_006348chr72143 91 ------
NM_006353chr6142 ------
NM_006357chr22439 432 --2475 114 --
NM_006359chrX31962 1828 1547 21779 69 --12478
NM_006361chr1761697 1628 1441 1279 673 321 ------
NM_006366chr62396 43 ------
NM_006367chr12313 133 1689 187 11037
NM_006371chr385205 4874 4775 4615 4380 3462 1375 455 ------
NM_006378chr921414 1395 31094 1063 1052 11465 11076
NM_006379chr72655 87 1794 ----
NM_006380chr1734021 2786 1564 13012 23709 528 12759
NM_006382chr17--1222 ----
NM_006403chr611585 --11288 --
NM_006407chr31498 11401 ----
NM_006415chr91987 ------
NM_006420chr2033241 3153 239 --11340 --
NM_006421chr82813 76 1316 ----
NM_006434chr1042760 1125 632 342 21295 525 11024 --
NM_006449chr241629 1477 1383 140 ------
NM_006451chr54895 319 231 156 ------
NM_006459chr1021997 1686 2621 241 ----
NM_006464chr263898 1474 1238 1050 1041 493 ------
NM_006465chr1542305 2049 394 71 1689 12347 --
NM_006467chr552055 1810 504 454 216 ------
NM_006482chr1233949 3141 1473 1594 --1109
NM_006489chr1441844 1428 276 166 --144 --
NM_006497chr171778 ------
NM_006516chr151536 1393 1303 1105 564 21060 538 1439 --
NM_006520chrX21674 512 ------
NM_006534chr2042548 2481 1287 325 13072 12601 --
NM_006538chr253730 2716 2612 837 162 --23832 3142 --
NM_006544chr14116025 5954 5812 5568 4553 4384 4260 3909 1668 1397 751 --14027 --
NM_006546chr17136482 6200 4928 4668 4274 4242 4122 2489 2056 1919 1637 1472 1338 --35887 5573 213 --
NM_006547chr73565 484 111 187 ----
NM_006548chr361712 1323 1309 1239 308 148 ------
NM_006559chr111178 ----185
NM_006561chr1034839 2327 1245 25699 662 34807 1541 639 24295 1447
NM_006565chr1621267 112 ------
NM_006572chr1762821 2484 960 699 489 305 --12782 --
NM_006575chr141179 ----11398
NM_006595chr1121797 53 2544 116 --1456
NM_006599chr16107988 7458 6980 6776 5514 3157 2817 2117 1873 682 12605 35709 5500 1611 --
NM_006601chr121932 ------
NM_006603chrX21353 445 ------
NM_006609chr242316 1990 549 345 12078 --131
NM_006614chr363690 3126 2978 2570 841 807 --22551 1199 --
NM_006618chr131305 346 329 ------
NM_006620chr654842 1513 1276 693 322 ------
NM_006621chr141823 1811 440 271 ----11623
NM_006624chr102797 412 ------
NM_006626chr932244 775 473 --1752 --
NM_006628chr1553518 1158 916 397 67 --14017 14689
NM_006636chr22659 93 ------
NM_006650chr563765 2693 2583 2506 861 25 31369 874 374 1116 --
NM_006654chr1233511 1605 203 --24139 3932 33492 1265 734
NM_006667chrX21152 249 --1447 11209
NM_006675chr1293278 3255 3212 2898 444 315 136 122 38 13022 1309 --
NM_006690chr2041577 1548 469 240 ----124
NM_006699chr152086 1716 1077 891 554 12193 ----
NM_006704chr131118 ------
NM_006713chr51638 ----2713 210
NM_006717chr963378 2541 1150 781 331 123 ----2553 402
NM_006727chr51498 ----146
NM_006729chrX75403 4690 4544 3495 1698 1129 762 14975 25342 4917 34576 3882 1446
NM_006734chr611290 ------
NM_006738chr1554332 4289 4232 4136 3917 52846 1685 852 251 222 23081 1241 1814
NM_006745chr41165 --11008 --
NM_006750chr16137335 7233 6318 6227 5905 5849 4883 1257 938 676 584 277 164 37660 2092 1110 47489 4986 2924 178 17033
NM_006754chr71905 ------
NM_006763chr131706 1671 257 11689 21592 621 --
NM_006764chr32496 383 ------
NM_006766chr81903 --12482 --
NM_006769chr12580 505 ------
NM_006772chr691621 1424 568 508 462 309 297 265 220 11226 21677 1282 --
NM_006775chr612791 1362 ----
NM_006777chrX42894 1935 542 102 12081 11081 --
NM_006802chr161200 1091 1027 429 413 202 --1922 --
NM_006805chr531098 447 145 ------
NM_006807chr17168 ------
NM_006813chr62828 733 1256 ----
NM_006818chr12159 127 1678 1168 --
NM_006822chr172154 56 ------
NM_006827chr1482895 2814 2725 2396 1318 1292 755 389 --1475 --
NM_006832chr142859 175 2771 331 ----
NM_006837chr8124 ------
NM_006846chr5160 --1368 --
NM_006851chr1262473 2244 1972 1019 864 161 11800 11950 --
NM_006856chr124986 459 292 85 --11148 --
NM_006857chr2----2636 358 --
NM_006874chr421246 154 ------
NM_006876chr113252 219 161 ------
NM_006884chr341741 233 221 83 --11417 --
NM_006885chr1622864 2734 13820 12812 --
NM_006888chr1452591 2320 698 475 243 --23172 3065 --
NM_006889chr31440 --31513 554 41 21388 382
NM_006892chr2041423 956 917 316 --1560 --
NM_006892chr2041423 956 917 316 --1560 --
NM_006896chr72236 173 3461 346 309 --1157
NM_006897chr12------1220
NM_006902chr153144 598 561 214 39 ------
NM_006912chr142487 746 384 232 ------
NM_006913chr61431 ------
NM_006914chr921511 595 --11353 --
NM_006915chrX31018 608 400 --11001 12245
NM_006922chr241651 1598 631 353 1255 ----
NM_006924chr1764293 3478 2898 2851 1553 265 --23689 270 --
NM_006930chr511763 21320 625 ----
NM_006940chr122575 289 1645 ----
NM_006951chr101638 ------
NM_006965chr1841214 1045 464 284 --1449 --
NM_006981chr962222 2148 886 828 811 305 ------
NM_006982chr121198 ------
NM_006990chr162422 2146 1786 1754 770 45 11670 21572 512 1619
NM_006991chr33956 858 256 1311 ----
NM_006996chr141209 521 453 357 ------
NM_007002chr20195 ------
NM_007005chr921060 215 ------
NM_007007chr1244450 4022 702 178 11605 ----
NM_007008chr22584 252 ------
NM_007011chr15116908 6830 6758 6614 5783 5551 5496 4427 4417 2058 1875 --36251 4361 1956 --
NM_007013chr83885 362 171 ------
NM_007017chr5--129 ----
NM_007018chr9149 ------
NM_007024chr32166 65 2429 151 ----
NM_007026chr172463 448 ------
NM_007033chr13883 859 846 11859 22081 549 22119 1397
NM_007034chr1--1311 ----
NM_007036chr5--1829 --1746
NM_007038chr2155793 4624 2178 978 314 ----25345 80
NM_007039chr1431752 362 240 11759 --22354 616
NM_007042chr362521 1665 999 838 701 283 --22105 1759 12695
NM_007050chr20107677 7641 7607 6926 5826 2859 2499 1316 467 376 36945 6087 5262 17417 --
NM_007054chr564000 2724 1483 1160 742 226 ----13694
NM_007064chr32670 584 ------
NM_007076chr121111 ------
NM_007078chr1043055 2641 1073 541 ------
NM_007087chr164753 592 289 192 1808 --1304
NM_007096chr9--149 ----
NM_007097chr5--199 --1216
NM_007106chr1362674 2553 2435 1717 539 101 ------
NM_007107chr311609 12362 12318 --
NM_007111chr132824 94 ------
NM_007114chr352830 2809 2173 1316 809 1683 --12598
NM_007124chr641837 1809 464 137 1162 11605 --
NM_007129chr131134 ------
NM_007137chrX125386 4837 4170 4066 3872 3818 1937 938 890 783 586 557 24397 1813 12174 --
NM_007144chr172823 83 11115 ----
NM_007146chr1752843 2238 2119 525 44 ------
NM_007159chr32200 93 1386 ----
NM_007167chr12599 351 1850 ----
NM_007173chr1132267 687 137 --1904 --
NM_007175chr883559 3356 3315 2706 2438 2421 395 87 --23674 2224 --
NM_007177chr332304 1803 437 2653 30 12230 1338
NM_007192chr143423 379 294 --1155 --
NM_007200chr1554332 4289 4232 4136 3917 52846 1685 852 251 222 23081 1241 1814
NM_007203chr933325 2949 942 ----13800
NM_007212chr122230 1494 ------
NM_007219chr202971 198 1751 --191
NM_007221chr12395 81 --1283 --
NM_007222chr81676 ------
NM_007232chr207999 980 809 365 224 79 72 1280 --1765
NM_007236chr1582048 2003 1558 793 592 514 389 66 --12090 --
NM_007249chr1386616 3378 2049 1866 854 805 609 270 22140 934 33260 738 202 --
NM_007271chr641449 399 222 199 ----1540
NM_007286chr572128 2020 1822 1809 1305 690 449 --11932 --
NM_007287chr382765 2664 2539 2391 2030 694 286 201 ------
NM_007288chr382765 2664 2539 2391 2030 694 286 201 ------
NM_007289chr382765 2664 2539 2391 2030 694 286 201 ------
NM_007292chr17104974 4414 4389 4214 1883 1822 1311 541 439 429 15048 21461 1316 --
NM_007320chr19------150
NM_007347chr1552932 2922 2558 2310 63 --12470 11964
NM_007350chr1234318 4154 3925 --12911 --
NM_007358chr111633 ------
NM_007361chr141497 ------
NM_007363chrX3724 429 127 --2113 71 --
NM_007371chr93700 166 54 ------
NM_007372chr173729 142 109 ------
NM_007373chr1011750 --11846 --
NM_007375chr142237 1087 703 604 --22700 375 --
NM_012074chr14----1115 --
NM_012081chr573278 2970 2859 2814 2363 901 817 12582 ----
NM_012082chr82922 209 ------
NM_012089chr121399 388 ----1424
NM_012090chr121247 1134 131 ----
NM_012092chr231446 580 424 --11259 --
NM_012095chr1043408 3112 2791 1233 1903 12839 --
NM_012096chr332331 2307 1238 12295 22572 1111 --
NM_012097chr232045 1499 54 --12144 11829
NM_012104chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_012104chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_012117chr12----187 --
NM_012120chr622044 1072 --12734 --
NM_012123chr61339 1313 ----
NM_012129chr731972 946 488 --1555 --
NM_012137chr1122623 2030 1984 1819 1168 963 607 591 575 551 500 91 --1992 1944
NM_012141chr1343465 2756 2608 748 --13130 --
NM_012157chr3--2933 290 2390 308 --
NM_012158chr1341719 1443 1316 86 ------
NM_012161chr44923 821 152 26 ------
NM_012164chr987286 6698 6024 2570 2353 2070 771 384 16886 25226 4825 37478 5719 2588
NM_012193chr1144010 1185 403 69 --25033 4165 --
NM_012199chr184414 3307 3164 3029 1825 1793 1090 627 23201 2836 1656 14126
NM_012207chr10148 ----1832
NM_012210chr921015 536 1217 --11169
NM_012214chr266246 2513 1372 109 94 82 11743 12435 --
NM_012234chr333127 1150 264 22412 64 --1967
NM_012245chr142339 164 136 ----
NM_012247chr101329 ------
NM_012249chr253246 3193 3170 2433 1388 ----1350
NM_012250chr11--11095 ----
NM_012255chr201138 ------
NM_012259chr611298 ------
NM_012262chr194449 4413 4304 4100 3841 1325 884 423 391 --13804 --
NM_012282chrX1225 1178 ----
NM_012287chr344351 3605 3428 91 13690 ----
NM_012288chr695253 4901 4081 3946 1968 1948 1525 1473 1007 24477 4107 25533 4098 --
NM_012290chr21597 ------
NM_012293chr212036 ------
NM_012294chr733909 1222 201 13261 --13785
NM_012296chr1173931 3408 3237 3108 2842 415 317 12895 1106 22416 198
NM_012297chr442468 2383 1687 356 --22435 760 --
NM_012300chr521678 644 1438 ----
NM_012301chr7----12067 --
NM_012302chr111100 ----1785
NM_012307chr181434 ------
NM_012308chr1162455 2223 856 832 656 183 1766 1737 21828 609
NM_012309chr11134589 4448 4274 4073 3614 3546 3497 1912 1751 911 870 487 212 1834 ----
NM_012316chr143947 2251 1452 117 1853 33550 1857 414 --
NM_012325chr2031638 1067 190 ------
NM_012327chr18----2621 108 --
NM_012329chr1741039 677 439 169 ----11638
NM_012333chr131545 1099 1045 ------
NM_012334chr573161 2889 1560 1016 835 230 33 33413 1515 105 14746 11295
NM_012338chr71368 1505 ----
NM_012382chr533372 3201 1730 33583 3366 946 ----
NM_012383chr91331 ------
NM_012402chr1151307 1242 512 202 194 1962 ----
NM_012406chr122907 68 ------
NM_012412chr72792 639 ------
NM_012413chr2----1107 --
NM_012417chr171627 ------
NM_012444chr201324 ------
NM_012448chr1782476 2154 1832 1724 1698 1679 699 459 2903 879 ----
NM_012463chr1231234 1176 179 11799 11615 --
NM_012471chrX41365 455 98 92 2494 461 1683 --
NM_012479chr722392 415 ----11738
NM_012482chr11505 1607 ----
NM_013230chrY2321 111 --1672 --
NM_013233chr2154 ----2381 80
NM_013248chr201241 ------
NM_013255chr788778 8459 8317 7907 6099 3098 2835 1954 22489 1700 38453 315 147 --
NM_013257chr81711 ----1326
NM_013262chr631346 154 106 ------
NM_013267chr12----1441 --
NM_013269chr1253479 3188 1741 1708 477 1491 1941 --
NM_013279chr1152020 1980 1764 269 124 22146 414 --1703
NM_013281chr202304 78 11132 ----
NM_013282chr1911131 ------
NM_013293chr72282 97 ------
NM_013302chr1664081 3513 3162 1661 1069 903 24642 585 12910 --
NM_013309chr1511981 1467 ----
NM_013323chr1731131 913 474 --11069 --
NM_013354chr83507 293 131 --11258 --
NM_013357chr82716 710 ------
NM_013358chr131239 669 165 1188 130 --
NM_013372chr1532320 2159 1179 ------
NM_013381chr1252445 2338 1953 877 202 185 ----
NM_013382chr142778 556 22104 1463 --12015
NM_013386chr141806 1496 1361 614 --1261 --
NM_013390chr911475 --11420 --
NM_013396chr2131476 1440 973 1436 ----
NM_013400chr71254 --11055 11007
NM_013423chrX41288 1235 1082 29 ------
NM_013427chrX41288 1235 1082 29 ------
NM_013433chr1911357 21885 1726 ----
NM_013436chr2276 52 ------
NM_013438chr9--11575 ----
NM_013444chrX2976 206 ------
NM_013446chr741422 1335 923 499 --1425 1133
NM_013450chr221111 847 ------
NM_013943chr141121 218 209 68 --2520 200 --
NM_013951chr23981 521 357 12384 --11742
NM_013952chr22598 434 12461 --11819
NM_013953chr22598 434 12461 --11819
NM_013992chr22598 434 12461 --11819
NM_013999chr17190 31192 179 83 ----
NM_014000chr1071944 1254 1239 698 606 515 38 177 31293 330 245 --
NM_014002chr12263 112 ------
NM_014010chr93563 242 208 ----1576
NM_014023chr1042052 913 469 395 --1514 --
NM_014043chr331535 1516 1092 ------
NM_014048chr1684588 4307 3767 3518 1856 1368 1171 1105 13385 14243 11042
NM_014089chr132676 126 ------
NM_014106chr1532624 1071 1005 ------
NM_014110chr141040 408 269 241 ------
NM_014112chr865515 4658 4255 3967 3920 1611 11206 --25425 634
NM_014117chr1652113 1830 1738 993 908 ----12732
NM_014154chr3------11345
NM_014155chr1166212 5034 2543 2230 1080 1022 22885 2763 26871 6747 22255 2193
NM_014176chr1164 ------
NM_014181chr222583 2556 ----12123
NM_014184chr11146 ------
NM_014217chr141496 535 455 141 --1569 1372
NM_014220chr31116 ------
NM_014231chr1242182 1945 1898 209 21625 346 156 --
NM_014240chr393843 3789 3230 2788 2670 1593 1546 931 172 32831 2631 1058 --13504
NM_014243chr422076 195 ------
NM_014245chr331057 738 230 ----1314
NM_014253chrX31770 623 334 11674 ----
NM_014263chr1041334 603 315 68 ------
NM_014268chr182208 110 ----1573
NM_014271chrX2200 188 --1618 --
NM_014278chr41302 ------
NM_014279chr9--1968 ----
NM_014283chr1----1132 --
NM_014284chr11945 ------
NM_014286chr972547 2417 1224 515 444 380 127 1775 12750 --
NM_014294chr82208 50 ------
NM_014296chr331012 593 460 ------
NM_014309chr2264853 4470 1370 1262 309 192 12005 --11239
NM_014319chr1211849 ------
NM_014325chr1212054 ------
NM_014329chr163285 219 89 ------
NM_014331chr467005 6519 5981 1460 853 839 1252 --25126 33
NM_014333chr1111993 1633 21982 367 --
NM_014342chr1131472 548 140 --1574 --
NM_014345chr62352 157 1419 1942 --
NM_014368chr941968 1887 780 47 31865 621 129 126 11442
NM_014372chr131842 759 691 ------
NM_014374chr71254 --11055 11007
NM_014379chr81145 ------
NM_014381chr1452265 1145 534 432 418 12255 43182 2472 1319 259 --
NM_014382chr341605 1520 1124 328 ------
NM_014391chr101577 --1534 --
NM_014393chr862072 1923 415 331 296 189 ------
NM_014399chr72671 282 ------
NM_014405chr1772022 1984 1970 1500 724 700 420 ------
NM_014415chr3--11173 ----
NM_014418chr1421838 429 --11421 --
NM_014423chr555579 4963 3882 525 363 --14675 --
NM_014431chr1041586 1408 483 447 31632 625 473 ----
NM_014445chr32637 613 ------
NM_014456chr1021245 252 ------
NM_014458chr111435 1462 ----
NM_014469chr111110 179 ----
NM_014480chr19--1600 ----
NM_014488chr11140 ----1567
NM_014489chr113789 612 215 140 ----
NM_014491chr72934 766 --1792 --
NM_014494chr163863 517 496 --1200 --
NM_014547chr151193 ------
NM_014547chr151193 ------
NM_014548chr1521498 439 11252 ----
NM_014554chr1251689 1513 639 272 158 ------
NM_014575chr31482 ------
NM_014585chr22107 22 ------
NM_014587chr1641364 207 176 141 --1497 --
NM_014607chr232050 247 67 --12035 --
NM_014612chr931391 1256 1055 ------
NM_014614chr2--1277 ----
NM_014615chr1633385 3155 1154 11190 22374 2304 12233
NM_014622chr112879 714 --1954 --
NM_014630chr1583041 2829 2562 846 825 746 488 58 --2133 89 --
NM_014633chr113635 459 125 1607 ----
NM_014636chr943579 3389 1490 328 --13007 --
NM_014647chr1642219 659 264 137 ------
NM_014653chr1271778 1721 1634 1525 709 286 76 ----1720
NM_014655chr141728 1479 920 110 21578 470 11559 11673
NM_014660chr71459 ------
NM_014661chr1083334 2826 2560 2446 1191 1185 787 289 --13832 --
NM_014665chr853273 2366 1366 852 470 12539 1125 --
NM_014666chr5186 --11196 --
NM_014670chr231050 271 89 11229 1256 --
NM_014676chr111453 ------
NM_014677chr811026 ------
NM_014683chr1741758 1700 1388 184 --21882 1479 --
NM_014689chr22394 121 ------
NM_014702chr632903 2441 1293 12803 --13300
NM_014705chr731612 668 649 ------
NM_014707chr732186 2112 687 --1469 195
NM_014713chr21355 ------
NM_014717chr192212 25 ------
NM_014721chr665282 5246 4624 2575 2401 685 44789 2299 710 219 16233 --
NM_014730chr1255218 3763 3317 2032 900 14888 25041 3595 11334
NM_014730chr1255218 3763 3317 2032 900 14888 25041 3595 11334
NM_014732chr1672320 2070 1430 1358 1018 177 127 ----13692
NM_014733chr552032 1923 1618 831 530 ------
NM_014735chrX22130 1996 ------
NM_014736chr154902 846 386 232 --142 --
NM_014739chr644088 3918 823 56 --1888 --
NM_014743chr432651 447 174 ------
NM_014747chr1114834 4052 3973 1946 1659 1252 1213 1179 842 494 209 23666 1878 ----
NM_014755chr273839 3712 3692 3510 3463 493 226 1539 11490 --
NM_014757chr562319 1826 1640 939 920 379 11969 --1275
NM_014758chr1141820 1680 781 460 --12013 12060
NM_014760chr311832 ------
NM_014765chr132525 970 119 ------
NM_014766chr711380 13786 ----
NM_014767chr1073627 3029 2851 2736 1383 1030 569 11194 3483 458 436 --
NM_014774chr163144 3109 2526 2148 1044 47 175 --11180
NM_014776chr1242746 2149 1144 903 --22574 589 --
NM_014779chr32788 262 1323 2334 46 --
NM_014783chr1551764 1540 1106 535 258 ------
NM_014795chr21311 ------
NM_014810chr183166 2906 2842 2557 1265 782 489 56 22770 192 1737 --
NM_014813chr12387 60 ------
NM_014819chr511845 1763 11540 --
NM_014820chr3--11314 21898 43 --
NM_014822chr4----1642 --
NM_014826chr143920 3433 3072 277 --23118 271 1900
NM_014827chr131519 1431 75 21356 1189 ----
NM_014829chr52104 24 ------
NM_014830chr1252827 2657 1413 1360 203 11530 ----
NM_014832chr131529 11576 11706 1717
NM_014838chr222160 40 --12527 22072 83
NM_014839chr12107 30 --157 12070
NM_014840chr1252783 2504 2106 848 184 22178 727 12286 --
NM_014841chr62199 181 ------
NM_014849chr171231 1216 982 965 360 239 72 --11182 --
NM_014850chr3114897 4465 4418 3806 3462 3166 1564 1474 1095 809 517 14350 24808 704 14593
NM_014857chr1184 ------
NM_014860chr241799 860 618 343 ------
NM_014864chr184276 4260 3256 2940 2885 1566 978 428 14214 ----
NM_014868chr122678 21 ------
NM_014872chr972334 2321 1966 926 875 541 474 198 22214 2077 --
NM_014873chr173226 1584 1285 1126 869 234 162 ----11444
NM_014875chr121076 264 1771 1825 --
NM_014877chr1756444 6397 6321 1218 1127 --46144 4945 1703 1273 --
NM_014888chr711079 ------
NM_014893chrY41819 1782 571 25 --133 --
NM_014897chr172169 109 13136 ----
NM_014902chr2051565 1555 1229 424 332 ----11167
NM_014903chr1221841 672 1700 ----
NM_014904chr1033330 285 139 ------
NM_014905chr241701 1574 708 79 --12029 --
NM_014906chr1733071 1365 486 ------
NM_014912chr1013082 ----12401
NM_014913chr1821485 1290 ------
NM_014917chr11347 --1692 --
NM_014918chr1511185 1618 1398 --
NM_014920chr642949 2402 1498 1358 --174 --
NM_014921chr1962747 2411 1211 661 653 636 12485 1336 --
NM_014923chr1322240 2005 --1470 --
NM_014924chr1451274 1219 1056 475 282 --12748 1235
NM_014926chr33838 759 122 ------
NM_014932chr311350 ------
NM_014938chr1262011 1857 804 434 306 120 153 2464 257 --
NM_014946chr241132 620 435 281 ------
NM_014947chr151153 841 567 217 106 ------
NM_014950chr1421761 1358 ------
NM_014952chr1531824 809 421 129 ----
NM_014961chr421746 409 --1752 --
NM_014964chr1752220 1994 1920 1767 722 ----11621
NM_014978chr1051805 1311 258 107 96 ------
NM_014982chr1475235 4858 4636 4509 4334 3619 411 --11444 --
NM_014989chr631937 191 37 --11679 11861
NM_014990chr1431361 431 255 134 --147
NM_014991chr453314 2539 1246 1128 1012 22739 337 32569 2170 1146 --
NM_014994chr1572158 2115 1750 1695 1501 909 292 --32165 457 64 --
NM_014997chr732585 595 99 ------
NM_014999chr1221473 94 ------
NM_015000chr1232071 931 304 --12318 --
NM_015001chr11186 ------
NM_015005chr1451781 1505 638 291 48 21470 182 ----
NM_015008chr3103018 2483 2411 1405 1016 1010 587 423 77 30 12645 ----
NM_015009chr3----1254 --
NM_015020chr1653355 3273 1157 358 72 ----23361 2782
NM_015023chr181700 1259 716 672 645 360 312 204 11731 150 --
NM_015024chr811495 --11341 11100
NM_015026chr1254671 4579 3933 942 133 ------
NM_015033chr973077 2777 2707 2552 299 165 83 ----12827
NM_015035chr20156418 6304 5841 5381 5093 4867 4748 4145 4093 2416 1707 1274 714 252 166 85748 5437 4638 4127 2451 1636 644 178 26453 1770 14275
NM_015039chr154225 3982 2967 2903 971 24018 3864 33696 3106 1518 --
NM_015040chr263439 3326 1185 997 389 361 12432 --12906
NM_015042chr1594291 4134 4045 3973 3759 3287 988 191 181 22676 57 34257 3118 674 13782
NM_015044chr1673216 2858 2604 2455 2279 493 107 ------
NM_015045chr1021853 45 11530 --11514
NM_015049chr211152 ----12459
NM_015051chr932978 2215 957 --22869 2353 --
NM_015052chr72501 358 ------
NM_015056chr212672 647 1730 ----
NM_015068chr753901 3623 1501 1067 318 --33855 3609 31 11057
NM_015071chr5124929 4882 4866 4834 4508 4104 1424 1149 865 729 679 121 12440 24494 463 --
NM_015075chrX81771 1723 732 608 592 333 320 175 1799 ----
NM_015076chr643587 3532 3121 1204 --31810 1582 788 --
NM_015077chr1753257 3236 3135 1831 764 24323 847 11182 --
NM_015082chr542568 2390 2141 1859 ------
NM_015086chr1251491 1399 1207 1193 519 ----1109
NM_015090chr1115842 5661 4982 4640 2502 2320 1417 765 739 617 129 14343 25715 1235 15467
NM_015092chr1671684 1051 866 684 670 653 269 --24431 3275 --
NM_015094chr2294159 4139 3757 3630 1861 1515 1163 548 29 34600 4085 139 44328 4302 3159 216 --
NM_015097chr331550 725 165 --11529 --
NM_015100chr141990 1836 1818 370 ------
NM_015101chr142619 2334 962 829 1282 ----
NM_015107chrX52156 1653 1627 1512 583 1433 62019 1562 525 267 87 34 11675
NM_015130chr42909 221 ------
NM_015149chr152177 2021 664 650 640 ------
NM_015153chr61675 ------
NM_015154chr1573048 2682 2642 2594 1375 307 131 23096 1147 12615 23324 2897
NM_015155chr1032477 2284 1016 --12771 --
NM_015163chr1451751 1697 1458 555 496 1576 1160 --
NM_015170chr841997 1442 886 807 ------
NM_015176chr121171 232 1609 --11624
NM_015185chrX62893 2393 1184 1025 1005 832 --1303 12343
NM_015193chr861501 1445 1258 1092 1048 962 21099 29 11173 --
NM_015199chr322362 2279 --32558 2440 2117 --
NM_015209chr151837 1563 831 491 26 21529 932 --11672
NM_015215chr112848 12878 ----
NM_015225chr953042 2892 543 311 108 32307 2063 803 163 --
NM_015233chr1372676 2546 2416 2202 497 217 160 22567 782 --1523
NM_015239chr91535 ------
NM_015250chr911697 ------
NM_015256chr51163 ------
NM_015265chr242230 1028 309 153 ------
NM_015268chr31549 ------
NM_015270chr121345 1189 42026 1665 882 162 --
NM_015271chr464307 1587 890 776 757 210 ----11579
NM_015272chr162590 30 ------
NM_015277chr1821162 535 --11706 11254
NM_015282chr272418 2406 1001 946 873 694 609 186 ----
NM_015284chr171349 824 791 477 353 341 160 ------
NM_015285chr1842489 895 863 494 1102 ----
NM_015288chr552734 2637 398 256 31 33158 622 262 1656 1501
NM_015291chr132937 1056 819 --12556 --
NM_015294chr174728 375 290 35 ------
NM_015305chr1431971 726 178 ----1557
NM_015310chr888147 7775 7369 7184 2025 1841 1757 866 11224 26069 1990 11278
NM_015313chr1134459 4381 111 --1227 --
NM_015315chr562678 2129 1242 697 575 351 22656 2114 ----
NM_015317chr252605 2577 2239 654 314 12683 ----
NM_015328chr742707 2257 2068 196 22149 607 32680 2675 2292 --
NM_015336chr1231746 593 521 1780 ----
NM_015338chr2031806 397 364 31919 1221 216 ----
NM_015347chr1242222 2072 987 69 --32106 929 529 --
NM_015349chr642357 2263 2039 23 ------
NM_015355chr172354 157 ------
NM_015358chr2111095 ------
NM_015359chr862779 1820 994 924 183 48 ----1347
NM_015365chrX34013 3192 798 ----24316 3793
NM_015367chr2211589 ------
NM_015375chr1114865 3308 3176 2009 1772 1434 1145 1121 1047 805 217 14287 ----
NM_015381chr2271904 1871 1757 1359 496 384 104 11597 11635 --
NM_015385chr1042760 1125 632 342 21295 525 11024 --
NM_015396chr331479 925 235 ------
NM_015424chr11166 ------
NM_015435chr811238 ------
NM_015446chr111187 --1564 --
NM_015453chr381739 1539 1471 834 827 737 645 289 1345 ----
NM_015455chr543719 3506 2817 762 13737 --1270
NM_015457chr111997 --1432 --
NM_015458chr835269 4018 883 24075 3880 14311 --
NM_015461chr181782 ------
NM_015463chr22717 47 ------
NM_015464chr71348 ------
NM_015465chr5--1161 1495 --
NM_015477chr154938 698 244 173 --1715 --
NM_015483chr71105 ------
NM_015488chr271612 1529 1336 1291 625 540 306 --31367 1186 518 --
NM_015520chr321864 726 150 ----
NM_015548chr61914 ------
NM_015550chr763566 3012 2564 1132 1056 183 1434 11007 --
NM_015553chr6125017 4527 4269 4259 4213 4118 3292 1566 1281 791 729 347 24533 750 --13398
NM_015557chr1142738 2376 1300 1143 1041 1009 988 901 724 572 523 455 418 70 11015 13039 --
NM_015564chr552775 2219 564 322 81 12883 ----
NM_015568chr2073792 3673 3586 3216 1652 842 207 21565 154 --1695
NM_015570chr711400 ------
NM_015571chr6127 192 ----
NM_015575chr252295 1121 898 303 39 ------
NM_015576chr322654 199 12694 1615 22163 814
NM_015609chr192680 2518 2425 2414 2018 1843 1054 1031 589 22916 2686 22705 2665 --
NM_015626chr1711010 --1959 --
NM_015630chr22846 180 ------
NM_015640chr134770 4073 1369 44839 4747 1924 1748 11451 14280
NM_015641chr7158 138 ----
NM_015660chr71295 ------
NM_015676chr141296 ------
NM_015686chrX72427 2246 2240 2194 1807 1794 147 22391 451 12415 --
NM_015690chr2158 ------
NM_015691chrX52652 2348 1853 810 526 21941 1036 ----
NM_015695chr642117 1817 654 356 --170 --
NM_015713chr833607 2301 1033 --21365 278 --
NM_015840chr122432 448 ----22370 261
NM_015841chr122432 448 ----22370 261
NM_015850chr832304 2292 1885 12424 21607 478 1711
NM_015866chr12514 94 --1973 --
NM_015878chr832231 1774 233 --11454 --
NM_015886chr8105215 5036 4144 2237 1879 1805 1278 1242 1157 879 ------
NM_015888chr112163 --22147 537 11033
NM_015904chr22756 255 ------
NM_015905chr71438 ------
NM_015906chr174563 4348 3771 1356 1130 673 493 23317 1645 --1613
NM_015915chr141302 ------
NM_015927chr16------1359
NM_015955chr2171 1480 ----
NM_015975chrX71743 1734 1665 430 280 273 90 ------
NM_015980chr511436 ------
NM_015981chr582770 2635 2362 2277 2016 1214 1041 780 21988 672 --12760
NM_015984chr12418 166 ------
NM_015990chr431017 894 66 ------
NM_015999chr12526 244 --1292 --
NM_016002chr11160 1714 ----
NM_016009chr1104250 3525 3470 3314 3264 1580 518 293 257 140 --13761 33657 3350 3061
NM_016022chr12173 124 2301 49 2369 116 --
NM_016023chr861519 887 847 339 103 59 ----1400
NM_016038chr74421 259 112 78 ------
NM_016039chr141133 ------
NM_016057chr123958 948 920 --21171 388 1834
NM_016061chr221539 59 --1234 11242
NM_016070chr17------142
NM_016072chr1221899 1642 --21824 716 1186
NM_016076chr153172 2875 1289 927 202 12674 21229 967 --
NM_016078chr1721135 749 ------
NM_016083chr663391 3198 3070 2831 1167 101 ------
NM_016094chr32582 273 ------
NM_016096chr821585 43 ------
NM_016097chr182836 327 1807 1717 --
NM_016106chr14130 ------
NM_016107chr5----1450 --
NM_016120chrX1307 11192 11121 --
NM_016121chr11464 ------
NM_016122chr121485 ------
NM_016131chr232360 2139 36 2923 121 ----
NM_016132chr1522342 2250 --1514 --
NM_016152chr331268 1054 924 --1306 1453
NM_016166chr15182 ------
NM_016179chr13124 ------
NM_016185chr171331 ------
NM_016206chr3148816 7811 7625 6972 6737 6108 5497 3052 2653 2590 1884 1781 1650 1127 --18579 17776
NM_016213chr15161 ------
NM_016216chr31866 --1597 --
NM_016223chr11------133
NM_016224chr6--1385 ----
NM_016227chr1----1132 --
NM_016230chr61397 ------
NM_016231chr1711151 1675 11121 1217
NM_016248chr1363681 3197 2977 2648 1024 199 ------
NM_016252chr22287 162 ------
NM_016255chr632773 2652 131 ----12800
NM_016257chr143058 2498 1349 954 12617 33076 457 452 22583 131
NM_016258chr11781 1520 ----
NM_016260chr297636 7262 5664 2022 1979 1273 849 271 166 --22395 1367 --
NM_016261chr172181 124 ------
NM_016269chr41215 1115 1151 --
NM_016272chr2232444 2194 490 --22449 1764 --
NM_016274chr1179 ------
NM_016275chr322356 886 ------
NM_016284chr162805 712 --1126 --
NM_016289chr211738 1487 1132 --
NM_016300chr31524 ------
NM_016303chrX189 ------
NM_016315chr231739 1186 232 --11180 --
NM_016316chr21648 ------
NM_016319chr121820 ------
NM_016320chr113371 365 218 1445 2850 113 --
NM_016322chr922385 2289 --1318 --
NM_016339chr1741717 1561 664 588 21737 735 3603 598 140 11344
NM_016357chr123485 298 56 ------
NM_016376chr1753993 3288 1335 1131 555 --12908 --
NM_016396chr155718 653 617 290 171 --12495 12964
NM_016424chr1711930 ----1733
NM_016433chr12191 21357 583 ----
NM_016436chr2032263 526 383 22498 2472 --1760
NM_016448chr171902 1770 1599 1524 452 382 177 11703 ----
NM_016467chr211363 ------
NM_016485chr641728 905 653 62 ------
NM_016499chr11----1522 --
NM_016505chr14690 654 534 290 ------
NM_016507chr17--141 1236 1744
NM_016513chr642949 2402 1498 1358 --174 --
NM_016526chr1132446 1696 1538 ----1907
NM_016530chr1533934 3764 671 --12791 --
NM_016531chr4--12799 23639 418 11020
NM_016544chr243900 3058 1205 693 33001 2811 847 ----
NM_016562chrX31587 1030 34 --1349 --
NM_016574chr1171013 953 868 818 283 179 161 21081 47 ----
NM_016575chr1275010 4894 4579 4105 1335 941 32 --23836 1492 --
NM_016604chr51239 ------
NM_016605chr552712 2575 2043 999 301 22557 2398 1946 --
NM_016613chr472784 2762 2639 2445 2001 844 465 1945 ----
NM_016621chr1154316 4193 4046 3100 1630 23239 707 --13908
NM_016623chr81261 ------
NM_016626chr1821142 221 1680 ----
NM_016641chr1661343 1328 1322 1218 249 140 11256 11307 --
NM_016644chr5------177
NM_016654chr1521318 1079 ------
NM_016823chr1721224 349 --1964 1903
NM_016830chr121544 ------
NM_016834chr1773907 3629 2804 2700 1481 1287 1173 --193 --
NM_016835chr1773907 3629 2804 2700 1481 1287 1173 --193 --
NM_016841chr1773907 3629 2804 2700 1481 1287 1173 --193 --
NM_016950chr41567 ------
NM_017409chr121527 ------
NM_017420chr1463471 3256 2934 1060 993 838 13729 ----
NM_017423chr422013 206 2642 30 ----
NM_017440chr121104 --1201 --
NM_017447chr2184403 3908 3621 3056 2859 1418 891 31 ------
NM_017456chr1751597 1230 715 325 99 --1496 12038
NM_017491chr41853 ------
NM_017519chr61135 --1120 --
NM_017520chr131600 ------
NM_017522chr121248 988 2439 249 ----
NM_017544chrX----1281 --
NM_017548chr33545 438 336 11399 ----
NM_017551chr1032111 595 432 31975 692 24 22498 661 --
NM_017563chr3125862 5808 5171 5073 4620 2321 1681 1219 764 456 386 164 21668 846 12184 --
NM_017569chr131107 ------
NM_017582chr141830 1515 1152 127 --1628 11603
NM_017586chr951790 1698 1380 648 248 31669 1371 239 31718 1647 1622 1687
NM_017594chr962872 2284 1342 1069 579 198 --22778 1309 --
NM_017596chr1124592 4475 4319 4246 4060 3467 3143 1454 1341 702 556 447 24513 4481 21641 887 22922 349
NM_017599chr1241803 1500 770 321 ------
NM_017610chr1532062 1829 1301 ------
NM_017612chr121390 ----1117
NM_017613chr212349 294 ------
NM_017626chr1031263 540 159 11639 11661 --
NM_017628chr434437 1896 1200 14208 --13765
NM_017629chr13431 243 110 ----11555
NM_017633chr653706 3305 2575 2542 2515 1223 1237 --
NM_017634chr821575 268 --11304 --
NM_017637chr958762 8487 7056 1260 723 13428 28355 7995 17789
NM_017640chr62850 698 ------
NM_017641chr121172 ------
NM_017643chr1763035 2053 1256 855 842 84 --1986 --
NM_017644chr374858 4736 4162 3772 3632 3418 1152 1900 11859 --
NM_017650chr734987 482 60 1870 11687 11003
NM_017651chr62650 596 21243 321 ----
NM_017658chr1434508 3930 1344 ------
NM_017666chrX21750 610 ------
NM_017670chr115211 187 42 33 25 --1253 --
NM_017679chr174454 197 146 77 --1610 --
NM_017686chr141026 963 848 61 ------
NM_017693chr1321663 655 11152 1423 --
NM_017709chr153979 3855 3294 1689 654 1245 ----
NM_017719chr322344 764 ------
NM_017728chr17122660 2318 2041 1893 1145 909 768 759 500 408 334 224 ----12309
NM_017730chr31572 ------
NM_017741chr442182 550 341 286 1666 ----
NM_017742chr1811883 ------
NM_017747chr51403 1157 ----
NM_017752chrX22173 608 ------
NM_017763chr17157 ------
NM_017769chr1422569 2482 ------
NM_017787chr1092771 2601 2514 2389 2030 1834 957 507 290 12179 1966 11942
NM_017799chr1411858 11728 ----
NM_017811chr953121 2784 2052 1966 29 --1229 13111
NM_017813chr895738 5440 5024 4891 4485 4414 1421 713 447 33718 1309 1085 15802 --
NM_017824chr1012591 ------
NM_017848chrX54185 3640 3187 518 95 --1489 11747
NM_017893chr1061305 1154 1143 451 280 96 ----1337
NM_017902chr10114196 3819 2234 1886 1410 1318 1256 1129 1068 522 41 11176 25690 235 13773
NM_017919chr9104494 3927 2096 2069 1556 1469 1293 1074 1002 620 15211 22046 40 1789
NM_017921chr1782100 910 899 834 571 432 398 89 22172 650 ----
NM_017938chrX72209 1640 1390 749 534 417 271 --11441 --
NM_017943chr1411024 ------
NM_017946chr721360 1305 1897 ----
NM_017958chr261155 1126 917 861 607 517 12777 ----
NM_017966chr1151481 1424 1367 1296 317 1489 ----
NM_017969chr2----131 --
NM_017990chr1643771 3173 1567 1395 --1559 11602
NM_017998chr9--11380 11463 --
NM_018003chr1511648 ------
NM_018014chr2--11309 ----
NM_018018chr1231605 1490 126 11461 --1228
NM_018027chr102895 371 1178 --145
NM_018028chr193443 382 135 --1127 --
NM_018030chr18184 --11099 --
NM_018045chr182664 2201 2160 2060 1964 932 900 640 22532 906 ----
NM_018048chr1222050 1849 --21837 582 --
NM_018053chr13783 344 283 ------
NM_018061chr11520 --1665 --
NM_018063chr101453 ------
NM_018064chr61208 ------
NM_018070chr11155 ------
NM_018071chr141781 --1663 --
NM_018078chr41932 ------
NM_018086chr221572 740 21760 1589 11407 --
NM_018092chr163613 452 120 ------
NM_018098chr31166 ------
NM_018107chr143855 824 800 1170 160 --
NM_018112chr91212 --150 --
NM_018113chr121431 ------
NM_018121chr1042611 2529 2424 288 ------
NM_018126chr41424 ----1988
NM_018128chr1731498 596 113 11307 ----
NM_018133chr332205 1795 25 ------
NM_018144chr10----1260 --
NM_018145chr15--1129 1498 --
NM_018155chr333216 870 262 1354 --23148 2982
NM_018157chr1222437 961 --13113 12769
NM_018171chr122735 47 ------
NM_018182chr1772153 2076 2014 2004 1778 791 412 11426 2821 402 12184
NM_018184chr341629 672 631 371 ------
NM_018195chr1131579 1455 1431 ------
NM_018202chr12768 751 1172 1762 --
NM_018206chr16------1139
NM_018207chr191665 1618 1427 1365 1200 1161 1100 427 311 41447 662 273 60 31440 457 125 --
NM_018214chr62885 22 ------
NM_018221chr22132 26 ------
NM_018222chr1131793 1633 77 128 --11216
NM_018227chr433132 2573 2024 --11253 --
NM_018243chr473860 3133 2977 1438 1372 331 63 --2538 109 14096
NM_018247chr632882 820 308 ------
NM_018254chr1----11997 --
NM_018257chr2032325 2026 1024 ----1859
NM_018263chr282279 2243 2107 834 734 646 546 332 21743 1733 ----
NM_018287chr1011203 ------
NM_018312chr1132107 874 848 11919 ----
NM_018314chr112510 214 ----1189
NM_018332chr1661334 1142 1084 496 450 40 1122 ----
NM_018340chr1664586 3792 1700 1645 1033 340 13965 ----
NM_018351chr1273747 3594 3326 1635 1152 1015 758 24038 3620 24236 537 --
NM_018353chr143870 608 35 ------
NM_018364chr123595 953 ------
NM_018373chr1476134 5500 4658 1392 1195 1020 70 24641 1448 15230 --
NM_018374chr754513 4166 1503 1176 246 ------
NM_018375chr14--173 ----
NM_018383chr232024 2011 467 ------
NM_018403chr362863 1112 1027 973 625 410 ----11602
NM_018406chr3126 ------
NM_018409chr452921 2706 573 229 106 12955 ----
NM_018425chr1032222 2160 1688 --1657 11828
NM_018429chr532778 2553 1844 --11082 --
NM_018440chr8118538 8262 7973 7888 7691 7631 7385 6252 3188 3029 1018 26311 980 13431 25733 562
NM_018445chr152550 205 ------
NM_018448chr12--1883 1309 --
NM_018453chr14--127 ----
NM_018462chr35838 322 252 225 154 ------
NM_018469chr1721342 133 --2356 127 1296
NM_018476chrX2189 91 ------
NM_018477chr1411075 ----1345
NM_018489chr14609 598 462 430 --2698 615 --
NM_018490chr1121474 422 ------
NM_018509chr1731416 329 99 ------
NM_018553chr1741654 1181 184 27 --1248 --
NM_018557chr2--21512 1069 ----
NM_018566chr175020 4564 4278 3235 1567 492 34 --11389 --
NM_018584chr111108 1111 ----
NM_018638chr1255620 1935 957 688 194 24534 963 21999 1687 --
NM_018639chr1241207 980 415 403 ------
NM_018640chr1252262 1038 608 521 433 12530 --1954
NM_018652chr152211 46 ------
NM_018660chr832936 766 283 --121 --
NM_018667chr16102472 2210 1812 1123 1071 969 941 581 410 27 --21874 1795 --
NM_018682chr71468 ------
NM_018686chr121138 ------
NM_018689chr1551938 1860 1649 528 176 1183 1194 --
NM_018691chr52791 65 --11167 --
NM_018695chr552362 2302 2150 2095 797 ------
NM_018698chrX21924 497 ----11684
NM_018700chr521177 178 --11432 --
NM_018704chr131891 1882 768 11906 --12001
NM_018710chr8159 21119 1029 ----
NM_018712chr1131574 1428 601 ------
NM_018717chr462251 1096 873 823 631 383 2959 355 --1294
NM_018718chr722256 1521 --1383 1551
NM_018836chr1121 11153 ----
NM_018841chr152877 1190 1022 865 72 11227 ----
NM_018844chr732000 664 273 ------
NM_018898chr532042 1806 616 --1318 --
NM_018899chr532042 1806 616 --1318 --
NM_018900chr532042 1806 616 --1318 --
NM_018901chr532042 1806 616 --1318 --
NM_018902chr532042 1806 616 --1318 --
NM_018903chr532042 1806 616 --1318 --
NM_018904chr532042 1806 616 --1318 --
NM_018905chr532042 1806 616 --1318 --
NM_018906chr532042 1806 616 --1318 --
NM_018907chr532042 1806 616 --1318 --
NM_018908chr532042 1806 616 --1318 --
NM_018909chr532042 1806 616 --1318 --
NM_018910chr532042 1806 616 --1318 --
NM_018911chr532042 1806 616 --1318 --
NM_018945chr633646 2888 855 43345 2944 1000 691 ----
NM_018952chr171197 1479 ----
NM_018959chr191545 ------
NM_018962chr2161433 1279 949 895 433 40 1143 ----
NM_018970chr752482 1140 1020 646 233 ------
NM_018976chr12----12191 1628
NM_018979chr122929 451 --1475 11880
NM_018999chr1044516 3461 1987 866 34731 4429 954 13262 --
NM_019000chr511372 ------
NM_019001chr334699 3005 1319 --146 --
NM_019008chr22133598 3513 3281 2839 2785 2738 1505 1371 1110 435 340 331 218 2178 71 13349 21451 1030
NM_019022chr1873188 3121 2203 2062 766 276 227 --1920 --
NM_019024chr2--181 ----
NM_019035chr441945 750 515 508 ------
NM_019036chr6--2927 452 1806 --
NM_019042chr721245 1062 --11076 --
NM_019049chr11188 ------
NM_019060chr1----1317 --
NM_019083chr111297 21527 1231 ----
NM_019084chr1032466 1977 790 12492 ----
NM_019087chr51229 ------
NM_019091chr21425 ------
NM_019098chr821867 1669 ----1744
NM_019106chr22103155 3015 3000 2586 2420 2198 1365 874 833 228 23006 2566 12504 --
NM_019114chr922074 1650 --22106 1009 --
NM_019116chr1663535 3517 3101 3072 2764 316 ------
NM_019556chrX41375 1095 490 445 ------
NM_019558chr22111 21 ------
NM_019590chr101187 ------
NM_019592chr92637 117 --168 --
NM_019593chr2052794 2734 2313 2151 2113 1925 33183 2628 1278 --
NM_019595chr2----1484 --
NM_019596chr2152947 1143 985 594 540 ------
NM_019605chr11207 ------
NM_019610chr151548 1360 851 387 69 2434 80 ----
NM_019857chrX11334 --11628 11746
NM_019859chr1011443 11119 ----
NM_019885chr231001 756 226 22570 151 --1447
NM_019887chr123569 265 116 2254 67 1490 --
NM_020039chr1271659 1287 1200 316 304 253 168 --31374 175 84 11303
NM_020066chr11372 ------
NM_020116chr411666 ------
NM_020122chr2105694 5431 5401 5244 4866 4811 3660 2186 526 359 ------
NM_020123chr1011384 ------
NM_020132chr2175105 4641 4373 4163 3574 3563 1151 14481 33660 3297 586 --
NM_020137chrX2345 39 ------
NM_020147chr154841 833 375 204 1183 ----
NM_020148chr1832207 1025 704 --1434 --
NM_020152chr212707 43 1112 --1907
NM_020155chr11187 ------
NM_020157chr2021038 819 ----1205
NM_020159chr451569 1516 1475 1169 669 --1335 --
NM_020168chr1541263 1220 1155 173 --31107 845 142 --
NM_020177chr572954 2927 2783 2380 439 412 247 ------
NM_020178chr17--11268 --1390
NM_020193chr1121028 345 11280 ----
NM_020198chr17--11598 1140 --
NM_020214chr153174 87 34 --150 --
NM_020235chr34335 58 42 34 ------
NM_020239chr1142238 1973 1870 1627 831 825 627 528 512 445 437 126 70 24 --2726 169 --
NM_020245chr674594 4137 3667 3085 1133 329 301 --2966 957 --
NM_020248chr132209 1982 124 2151 115 12276 --
NM_020310chr1752345 2027 659 347 291 22767 1958 ----
NM_020311chr21575 ------
NM_020336chr2032633 2554 376 --13311 23031 488
NM_020337chr421092 883 --11181 --
NM_020338chr1083258 2757 1319 1301 1289 1204 691 45 155 ----
NM_020341chr2021986 1611 ------
NM_020346chr1131613 1222 676 1268 ----
NM_020348chr102698 114 11804 ----
NM_020357chr32649 553 ------
NM_020390chr364705 4499 4249 3528 1002 565 ------
NM_020403chr131641 ------
NM_020416chr442127 782 333 164 22650 2017 ----
NM_020418chr33231 136 66 ------
NM_020420chrY21344 549 11835 ----
NM_020429chr792928 2659 2475 2392 2055 1982 1152 572 200 --12182 12484
NM_020440chr142314 526 400 176 22926 2334 2635 466 --
NM_020443chr1116745 6365 5345 5281 2523 2418 2116 1857 1463 664 654 24373 2507 22727 777 --
NM_020444chr541063 976 218 59 --1580 --
NM_020452chr14793 660 367 315 11668 2800 309 --
NM_020455chr632805 947 933 11829 --22165 2100
NM_020456chr1322290 69 --12232 --
NM_020465chr1621999 674 --11450 21441 603
NM_020466chr634895 1863 412 --34582 1799 790 --
NM_020473chrX2640 121 --11892 --
NM_020526chr161845 1788 1460 1432 1250 645 31825 1676 1423 1107 --
NM_020532chr22584 252 ------
NM_020640chr331683 834 633 1705 ----
NM_020647chr8112253 2186 1866 1815 1569 1501 1451 685 466 426 329 ------
NM_020651chr231660 639 297 ------
NM_020673chr20107082 6823 6531 2069 1983 1559 1231 1096 724 534 11005 14772 11110
NM_020696chr3127 ------
NM_020699chr1135008 4639 3904 3881 3408 1897 1808 1324 637 268 218 172 23 13892 21820 982 1757
NM_020704chr742521 1803 685 61 --11603 --
NM_020713chr20123005 2617 2557 2394 2162 1061 993 678 624 563 504 375 1618 32592 2384 603 12463
NM_020715chr1431676 258 107 --11779 21904 560
NM_020717chrX164852 4796 4588 4230 4142 3738 3582 3516 1898 1516 1229 788 752 646 390 140 33497 3457 34 53235 605 409 404 121 44528 4154 3710 201
NM_020718chr1675898 5732 4082 1057 529 194 60 14257 ----
NM_020727chr2123956 2838 ------
NM_020728chr742930 2780 2183 2029 --22456 50 1561
NM_020732chr61135 --1120 --
NM_020734chr1242992 879 471 249 ------
NM_020738chr21260 --11310 --
NM_020739chr1544006 3769 3449 611 13997 ----
NM_020742chrX2274 25 --133 --
NM_020748chr1721617 201 ----11422
NM_020749chr831300 792 600 1773 ----
NM_020752chr102662 428 --1279 --
NM_020760chr21345 ------
NM_020761chr1731947 463 153 11715 ----
NM_020766chrX44525 4278 3855 1573 --13447 1834
NM_020768chr522282 150 1973 2922 355 13014
NM_020772chr1767589 7268 6126 5990 5938 1960 17834 35546 1717 1566 --
NM_020774chr1865733 2364 2316 1977 1388 241 21882 546 14317 --
NM_020778chr1574625 4587 4456 3532 3153 1255 731 33589 3343 783 31822 1788 415 11069
NM_020783chr18199 ------
NM_020792chr342777 2127 652 107 ------
NM_020794chr1----11100 --
NM_020796chr542532 2050 956 313 ------
NM_020801chr53785 560 530 --11734 --
NM_020804chr662516 2498 2300 2264 418 374 12145 2530 510 --
NM_020805chr18----3648 583 361 --
NM_020819chr6--1251 ----
NM_020825chr1663738 3235 2496 1397 439 298 ------
NM_020841chr1243358 2956 306 180 --13436 --
NM_020845chr1241988 787 660 157 42357 1898 949 650 11010 --
NM_020850chr1682359 2247 2135 1301 1163 971 846 58 22759 393 1855 1169
NM_020854chr1821532 1448 ------
NM_020858chr151272 12016 12201 --
NM_020860chr43378 257 163 ------
NM_020868chr22370 173 ------
NM_020870chr431980 903 150 ------
NM_020871chrX22511 1010 ------
NM_020872chr321294 114 ------
NM_020873chr31354 ------
NM_020888chr131279 805 703 21573 529 32012 1769 1634 --
NM_020897chr151246 1229 1215 1187 1076 --1452 1896
NM_020899chr1751937 1612 909 825 82 --1695 1312
NM_020909chr244081 4026 2748 794 1197 ----
NM_020919chr251206 477 422 269 34 ------
NM_020922chrX51877 1736 1715 1641 519 11761 1236 --
NM_020924chr91351 ------
NM_020925chr11547 ------
NM_020935chr294254 3830 3428 1871 1752 1224 875 858 94 153 13780 --
NM_020946chr941145 525 446 133 2325 156 --21308 91
NM_020947chr1652105 1749 1702 1503 303 ----11918
NM_020948chr163416 3400 2943 2728 948 153 --1247 --
NM_020952chr9------1548
NM_020956chr19114207 4132 4036 4025 3789 3214 3170 2932 977 758 752 44520 1697 1460 1118 34638 90 76 11127
NM_020964chr1884296 4141 3899 3477 1439 1269 1189 1023 --23880 3099 --
NM_020975chr1041891 798 343 65 ------
NM_020983chr121345 1189 42026 1665 882 162 --
NM_020993chr1252393 1890 1027 545 123 1527 ----
NM_021003chr14128 ------
NM_021007chr232299 2281 2249 1265 ----
NM_021012chr1772395 2031 1169 1140 721 523 273 --43090 2812 2713 2246 --
NM_021033chr1321162 67 ------
NM_021035chr2041092 1041 1008 218 --1469 --
NM_021045chr1032638 2021 1997 11634 ----
NM_021061chr854507 4056 3783 1552 185 --13979 --
NM_021069chr421802 1740 --11975 --
NM_021072chr52688 75 ----12009
NM_021079chr1732591 2548 132 13030 --12281
NM_021081chr20127 ------
NM_021083chrX43007 1342 1224 279 ------
NM_021096chr2252698 2333 1265 970 54 --12870 --
NM_021097chr223061 2177 12107 ----
NM_021105chr3----1732 --
NM_021110chr81483 ------
NM_021116chr789053 7204 6865 6353 5911 5582 2531 1845 33176 2636 1221 26669 2446 17004
NM_021120chrX22045 848 --1683 13190
NM_021140chrX41050 762 718 174 ------
NM_021145chr73761 157 99 ------
NM_021155chr1942940 2047 933 653 --22960 812 --
NM_021158chr201839 ------
NM_021168chr1621567 1118 21160 499 11184 11109
NM_021174chr8--1675 ----
NM_021183chrX2571 216 1379 ----
NM_021190chr121068 546 ------
NM_021202chr2082856 2105 1988 589 411 330 243 170 22259 1230 3909 830 319 --
NM_021218chr91860 1917 ----
NM_021238chr1231912 647 334 1116 ----
NM_021239chr1421447 1156 ------
NM_021249chr1441664 1628 1234 334 ------
NM_021252chr1021413 294 ------
NM_021255chr1433970 716 73 ------
NM_021260chr1411383 ------
NM_021574chr2272026 1972 853 847 832 337 125 12207 --1818
NM_021619chr941164 1075 1010 910 ----1989
NM_021622chr1042092 863 834 33 ------
NM_021626chr171431 ------
NM_021627chr3------1998
NM_021629chr354882 3352 3302 1885 1510 24799 1806 24743 81 --
NM_021638chr474978 3527 3331 1032 593 413 175 --11235 23763 85
NM_021644chr10148 ----1832
NM_021647chr474072 3978 3925 3553 909 772 268 --34029 3812 3162 --
NM_021649chr511156 21828 1732 11194 --
NM_021705chr61500 11193 199 1576
NM_021813chr675701 5051 4685 3797 1681 1582 203 24105 1397 15456 --
NM_021814chr621531 1426 ------
NM_021818chr1431445 387 181 ------
NM_021911chr574816 4356 3609 2174 1637 1402 131 1285 14335 --
NM_021912chr1593991 3846 3317 1522 1237 1157 1040 281 59 33785 3091 2913 --11685
NM_021914chr1421571 703 ------
NM_021940chr61616 ----1105
NM_021943chr641899 1753 770 603 ----21744 1475
NM_021949chrX32785 674 236 --1207 --
NM_021951chr92907 716 ------
NM_021956chr6--1491 ----
NM_021960chr142290 2161 2109 362 12119 ----
NM_021961chr1156554 6440 5180 5105 1722 11414 35876 2787 1966 12240
NM_021963chrX2735 34 ------
NM_021964chr396538 6344 5051 2558 2488 2362 1958 1534 673 24146 1760 --15410
NM_021965chr9176 ------
NM_021973chr4--1518 ----
NM_021984chrX71521 1388 973 564 176 163 119 11232 ----
NM_021987chrX71521 1388 973 564 176 163 119 11232 ----
NM_021990chrX71521 1388 973 564 176 163 119 11232 ----
NM_021998chrX11402 ------
NM_022048chr152833 643 --21374 359 --
NM_022054chr141775 ------
NM_022075chr14263 243 180 52 ------
NM_022085chr641419 1241 1178 391 2397 31 ----
NM_022103chr192811 345 ------
NM_022114chr1124190 3600 3500 3140 3065 1640 1400 1107 820 792 658 595 23623 3376 ----
NM_022118chr133526 258 150 --140 --
NM_022121chr621134 947 ----1256
NM_022124chr10----1199 --
NM_022129chr102250 102 ------
NM_022130chr52374 276 ----11029
NM_022132chr5----1133 --
NM_022140chr551964 1879 1554 1497 549 ------
NM_022166chr16156124 5608 5455 4965 4794 4656 4631 4618 4587 4385 4357 2547 2348 1466 571 43909 3889 1961 538 65628 5028 4865 2336 1756 1408 --
NM_022169chr1161318 1224 575 328 249 111 21033 304 21449 1064 --
NM_022346chr431389 985 70 11355 ----
NM_022351chr832972 1322 95 --1475 2993 583
NM_022362chr10----1340 --
NM_022374chr23435 330 27 ------
NM_022459chr1376154 6060 4935 4653 4419 4138 1978 --34161 1512 1109 11087
NM_022462chr19123536 3505 3481 3209 2608 1267 625 608 302 164 145 23 33636 3164 131 33585 3333 422 --
NM_022465chr124789 502 490 40 --22881 165 --
NM_022477chr2041696 1495 155 90 21133 161 11179 --
NM_022484chr72943 893 --11313 --
NM_022488chr3----123 --
NM_022497chr373899 3856 2914 2670 2514 1504 545 --21418 389 --
NM_022557chr172200 53 ------
NM_022566chr153592 415 106 --162 --
NM_022572chr271612 1529 1336 1291 625 540 306 --31367 1186 518 --
NM_022648chr263765 3548 1759 1398 1046 622 21428 1365 13823 11168
NM_022650chr51855 1769 ----
NM_022658chr122280 134 21011 871 ----
NM_022716chr142988 442 405 58 ------
NM_022726chr631755 1078 407 ------
NM_022735chr12320 101 ------
NM_022737chr1981257 1244 1136 1118 468 406 104 98 1204 1247 1340
NM_022748chr742774 2596 1004 87 12668 --12067
NM_022751chr18--1286 ----
NM_022763chr372998 2842 2777 1244 696 512 286 ----1900
NM_022771chr1221001 185 1412 ----
NM_022776chr331293 436 196 --148 --
NM_022777chr751621 1316 1097 266 125 31677 1415 1153 1179 --
NM_022781chr932955 2689 102 163 1369 --
NM_022802chr1011233 --11490 --
NM_022823chr22447 392 --185 --
NM_022826chr22959 273 ------
NM_022831chr151813 292 286 279 39 ------
NM_022836chr131429 569 106 --1627 --
NM_022841chr15--1262 ----
NM_022893chr242659 1163 766 704 1866 ----
NM_022897chr54984 814 749 234 1830 ----
NM_022898chr1454779 3948 3172 1577 888 ------
NM_022900chr74776 257 73 41 1877 ----
NM_022901chr921584 1395 --11211 --
NM_022910chr1621999 674 --11450 21441 603
NM_022912chr222014 109 12780 ----
NM_022965chr451381 1006 566 521 369 ------
NM_022977chrX22033 1758 1434 11892 --
NM_023000chr14--1370 ----
NM_023001chr14--1370 ----
NM_023008chr191676 1251 ----
NM_023039chr5184 --2309 26 --
NM_023079chr1751650 1425 1399 1166 633 ------
NM_023105chr832304 2292 1885 12424 21607 478 1711
NM_023106chr832304 2292 1885 12424 21607 478 1711
NM_023110chr832304 2292 1885 12424 21607 478 1711
NM_023111chr832304 2292 1885 12424 21607 478 1711
NM_023923chr1103438 3429 3379 3352 3019 2702 2356 1281 841 372 22974 2412 1487 13174
NM_023927chr531286 1042 962 ------
NM_023929chr822534 2506 --11041 --
NM_024007chr523015 1066 12678 2911 720 --
NM_024015chr1741117 874 408 113 --1118 --
NM_024034chr203714 274 204 --1729 --
NM_024045chr103166 45 21 ------
NM_024052chr171251 11068 --22303 2197
NM_024061chr74557 415 407 182 ------
NM_024085chr26995 934 695 307 66 50 1332 ----
NM_024089chr131138 ------
NM_024095chr1221477 522 1578 --11331
NM_024297chr172166 76 ------
NM_024345chr975363 4070 2381 2080 1655 1197 904 11711 11537 11855
NM_024408chr152695 1266 832 414 354 11005 12259 --
NM_024424chr1131098 377 280 --1186 --
NM_024425chr1131098 377 280 --1186 --
NM_024426chr1131098 377 280 --1186 --
NM_024501chr2----1530 --
NM_024524chr32952 354 ----12192
NM_024529chr111066 ------
NM_024541chr1031225 86 33 2760 40 ----
NM_024561chr1321193 525 --1150 --
NM_024563chr551887 1835 1629 575 55 --1584 --
NM_024574chr4176 ------
NM_024582chr431123 313 273 ------
NM_024602chr16864 855 665 590 205 81 --1726 --
NM_024607chr8123714 3632 3153 3134 3119 3050 2896 1750 1384 1063 810 439 13913 1852 --
NM_024612chr172829 58 ------
NM_024627chr2294970 4869 4820 3986 3835 1280 400 241 29 --1410 14591
NM_024631chr11163 ----150
NM_024632chr52281 59 ------
NM_024639chr642161 1939 316 162 1493 12826 --
NM_024645chr871458 1409 1347 1191 1146 555 49 ----1406
NM_024646chr152847 2634 637 441 71 22903 146 33677 3583 1118 --
NM_024659chr23779 151 75 ------
NM_024663chr20139 ------
NM_024665chr334068 1205 848 14374 ----
NM_024666chr1521360 678 ----2539 63
NM_024670chr1041630 1287 509 429 11686 --1101
NM_024674chr172544 2514 2171 1035 970 942 910 ----12327
NM_024692chr211307 ------
NM_024698chr1181306 1255 1152 944 540 500 267 256 ------
NM_024700chr11963 ------
NM_024702chr173598 558 205 ------
NM_024705chr131228 ------
NM_024707chr191400 --1220 --
NM_024713chr1511088 ------
NM_024721chr82753 608 --2740 647 --
NM_024744chr22505 166 ------
NM_024749chr131511 852 285 ----158
NM_024750chr31472 1529 ----
NM_024755chr151368 ------
NM_024757chr91739 1452 --1818
NM_024761chr973965 3268 1657 1088 591 308 99 1571 21122 670 --
NM_024763chr121021 240 ------
NM_024770chr296405 5601 5326 5137 4661 2158 2084 2026 1379 21274 814 24590 4158 --
NM_024779chr1231326 1025 393 ------
NM_024785chr21519 ------
NM_024786chr5--1111 287 43 --
NM_024787chr81214 1640 2271 147 --
NM_024811chr112524 447 1667 21790 149 --
NM_024812chr872145 1654 838 666 186 112 90 2612 390 11504 --
NM_024824chr1421334 139 ------
NM_024828chr921306 1120 ------
NM_024863chrX121 ------
NM_024875chr10166 --1169 --
NM_024887chr162120 1913 1592 867 39 33 --41758 564 426 377 --
NM_024909chr631482 567 556 11562 --11117
NM_024915chr852202 2154 672 623 412 12726 ----
NM_024930chr552728 1752 1103 966 66 1990 ----
NM_024939chr162503 168 11398 1450 --
NM_024944chr211404 ------
NM_024947chr338750 5809 1301 26506 2816 1397 17259
NM_024948chr10----1199 --
NM_024949chr4104529 3676 3561 3222 3170 3118 1282 1236 1070 673 11725 --13100
NM_024960chr20197 ------
NM_024971chr9------1548
NM_024989chr268077 7549 2890 2426 1443 424 17560 --16229
NM_024991chr1042760 1125 632 342 21295 525 11024 --
NM_024993chr22406 29 ------
NM_025027chr1921013 253 11064 ----
NM_025054chr844128 3682 1496 1379 1183 ----
NM_025074chr482838 2469 2453 1159 893 636 581 156 ------
NM_025076chr21537 ------
NM_025099chr171122 --11256 --
NM_025114chr121107 ------
NM_025134chr1642453 1891 1571 581 12604 --11945
NM_025135chr181437 ------
NM_025138chr1321049 423 ------
NM_025140chr121554 ------
NM_025151chr83695 646 146 21454 532 11615 --
NM_025160chr143797 3751 3376 3253 1273 ----
NM_025179chr1124490 3909 3678 3429 3258 1889 1751 1374 1362 1356 772 293 --14656 13072
NM_025182chr95914 861 752 259 177 141 ----
NM_025194chr1941169 1106 301 277 11264 ----
NM_025195chr861823 1555 1211 527 422 200 ------
NM_025203chr211273 ------
NM_025211chr9--1218 ----
NM_025221chr441335 997 986 49 1350 ----
NM_025222chr322570 2368 22126 934 1371 --
NM_025244chr2------1213
NM_025246chr3165 ------
NM_025248chr1773037 2937 2496 1219 601 94 21 1159 ----
NM_030576chr1762566 2204 2121 1882 834 558 --2412 406 1217
NM_030579chr1673639 3453 3244 3180 2794 1435 1037 12874 1981 --
NM_030594chr1521256 236 --11293 --
NM_030621chr1434104 2921 1479 --11096 --
NM_030623chr221371 568 1134 ----
NM_030627chr543549 3483 2821 423 21589 1511 14006 --
NM_030629chr1631552 1457 1211 ------
NM_030640chr12----2865 583 --
NM_030647chr765557 4933 4067 1986 1633 117 --11310 --
NM_030650chr234123 1673 910 14178 --12895
NM_030660chr1431350 575 455 ------
NM_030664chr1051997 1719 858 597 307 --11539 --
NM_030674chr1254311 3644 1377 1329 899 --12162 1275
NM_030755chr1432549 2207 542 12045 12118 11002
NM_030759chr101274 1541 ----
NM_030761chr192647 2275 2119 1705 680 670 303 251 81 32551 2371 2076 ----
NM_030786chr121786 504 --11418 1694
NM_030791chr1421765 1577 --21621 1333 --
NM_030799chr52507 189 1566 11969 --
NM_030802chr17126 ------
NM_030809chr1242249 1829 1666 194 21805 29 ----
NM_030810chr641419 1241 1178 391 2397 31 ----
NM_030816chr133495 3103 710 12945 ----
NM_030821chr41331 1743 ----
NM_030885chr321971 1934 1550 1918 --
NM_030915chr262307 2009 1943 1717 890 832 --1688 --
NM_030920chr1185 ------
NM_030923chr21487 --1157 1140
NM_030939chr611137 ------
NM_030949chr611488 ------
NM_030952chr121320 1061 2403 392 --11336
NM_030954chr82822 766 ------
NM_030962chr1141397 535 462 155 1124 1432 --
NM_030964chr583672 2931 2414 2298 2281 643 129 30 1781 --2808 119
NM_031157chr12--1549 ----
NM_031217chr11------1122
NM_031243chr711684 ------
NM_031266chr5--1509 ----
NM_031267chr71450 ------
NM_031268chr1694214 3649 1785 1531 1366 846 376 45 23 34060 1483 1424 24975 3669 11966
NM_031296chr432633 1850 151 ------
NM_031306chr13953 859 306 1361 ----
NM_031314chr1441899 1639 219 44 31705 1535 817 11265 --
NM_031372chr421416 492 ------
NM_031411chr532042 1806 616 --1318 --
NM_031418chr1122591 284 --22116 705 12023
NM_031422chr182453 134 ------
NM_031426chr952143 946 526 159 60 22260 952 12132 --
NM_031427chr14114797 4491 4303 4247 3813 3800 1693 1638 1330 1277 277 15559 34591 1904 869 --
NM_031433chr117544 482 475 405 197 32 21 ----1102
NM_031442chrX42471 2381 975 489 1431 ----
NM_031468chr798240 8175 7966 7212 5947 5941 2346 1956 1929 26308 3060 27350 2075 --
NM_031483chr2043167 2499 2365 62 --12213 1166
NM_031492chr11----1523 --
NM_031844chr133991 3840 3506 --13920 --
NM_031845chr243467 2923 2701 295 43252 1360 399 319 ----
NM_031847chr243467 2923 2701 295 43252 1360 399 319 ----
NM_031849chr532042 1806 616 --1318 --
NM_031857chr532042 1806 616 --1318 --
NM_031860chr532042 1806 616 --1318 --
NM_031866chr102674 428 ------
NM_031890chr2272639 2151 2137 592 554 228 208 22279 645 32349 783 62 --
NM_031892chrX2730 654 --2254 61 --
NM_031953chr41451 ------
NM_031990chr1931347 1122 131 --1554 --
NM_031991chr1931347 1122 131 --1554 --
NM_032012chr974058 3879 3733 1372 1346 853 359 33484 1600 1265 2503 77 --
NM_032013chr2041696 1495 155 90 21133 161 11179 --
NM_032017chr151847 1554 620 566 176 11501 2842 264 --
NM_032042chr522792 2275 1494 ----
NM_032047chr322302 175 ------
NM_032102chr1142418 2186 2131 469 --22424 130 --
NM_032104chr13256 181 43 --1494 --
NM_032105chr1157371 6664 5590 3211 3134 3073 2294 2071 1687 1657 1105 331 256 181 43 12351 2830 494 --
NM_032116chr1375076 4889 3682 2330 844 552 258 --15148 --
NM_032138chr132179 32 ------
NM_032147chr124789 383 291 217 ------
NM_032153chr322284 2009 ----12554
NM_032182chr1031428 582 168 11523 ----
NM_032189chr1364586 3269 1738 1688 1495 533 24426 1730 1893 --
NM_032195chr211204 ------
NM_032199chr1023504 556 2939 59 ----
NM_032208chr243071 2874 1205 235 12803 1396 --
NM_032217chr451375 555 455 200 93 21303 176 11133 --
NM_032221chr202357 287 ----2731 201
NM_032229chr13--11170 ----
NM_032231chr151305 ------
NM_032236chr1--1820 ----
NM_032246chr1511106 ------
NM_032268chr16132628 2588 2479 2458 2182 2093 1121 1094 1075 803 510 477 217 23074 386 12677 --
NM_032283chr141818 1429 1234 743 41294 1256 711 260 11243 --
NM_032291chr141677 1634 542 294 ------
NM_032316chr362246 2163 1975 1912 802 322 12259 1289 1237
NM_032320chr115668 662 499 225 34 ------
NM_032321chr283193 2817 2785 2598 2052 1072 490 321 12965 ----
NM_032324chr1--1204 ----
NM_032329chr2103800 3316 2803 2765 857 827 774 470 291 86 --24009 3119 13452
NM_032352chr1431237 1178 29 ----1542
NM_032373chr1064723 4341 4005 1651 630 134 ------
NM_032434chr231315 1018 599 ------
NM_032435chr111932 1578 166 --
NM_032439chr102374 184 ----11280
NM_032440chr1032529 725 688 ----11070
NM_032445chr1542173 2020 786 35 1265 1623 --
NM_032446chr533614 3457 406 ----1389
NM_032449chr152096 798 628 533 205 2402 62 --1931
NM_032457chr443341 3200 176 134 23639 1547 ----
NM_032458chrX32371 2339 2313 33098 2116 439 ----
NM_032491chr1221152 431 ------
NM_032499chr1531354 138 120 --193 --
NM_032505chr342782 1764 858 823 --1983 --
NM_032509chr862524 2122 2086 2036 1694 385 1955 11706 --
NM_032514chr202150 93 2340 57 2299 155 2323 292
NM_032521chr2042762 2582 906 649 --1957 --
NM_032538chr641852 647 409 224 --32160 2109 2035 22773 619
NM_032557chr43658 313 83 --1192 --
NM_032569chr1611232 21342 331 ----
NM_032575chr1691931 1540 1464 1399 485 455 286 101 52 1475 31633 719 394 --
NM_032576chrY1104 1131 ----
NM_032582chr1741727 1401 428 337 11524 ----
NM_032595chr1741346 1225 1076 382 31484 1052 405 1452 --
NM_032632chr1461617 1503 1451 1327 457 34 --11244 --
NM_032663chr1231748 1726 620 1516 1630 11646
NM_032682chr353459 1280 1085 624 197 ------
NM_032717chr42842 731 --1129 --
NM_032737chr1922366 199 21929 479 1909 2939 36
NM_032765chr51851 ------
NM_032772chr101147 --1152 --
NM_032778chr332815 896 110 --12387 12673
NM_032782chr51892 2839 214 1779 --
NM_032796chrX2704 153 ------
NM_032801chr1122470 148 11961 --1926
NM_032804chr104674 359 94 45 --170 --
NM_032808chr158940 931 924 658 181 171 147 99 ------
NM_032810chr1011120 --1467 --
NM_032826chr784609 3770 3716 3684 1020 860 259 94 1324 11230 1667
NM_032828chr19124278 3795 3740 1744 1388 1106 1074 964 832 806 328 244 11843 23066 1858 11303
NM_032829chr1211142 ------
NM_032833chr12706 37 ----1631
NM_032840chr123992 894 750 1406 1124 191
NM_032846chr1451514 549 528 499 409 21360 1116 21237 1220 --
NM_032866chr1593162 2665 2625 2517 2396 2066 600 312 90 12578 ----
NM_032867chr111584 ------
NM_032873chr1144419 3143 1689 655 --1600 --
NM_032875chr172765 172 ------
NM_032898chr32340 153 1396 ----
NM_032900chr1033782 3561 1574 2253 70 23370 3360 22921 1333
NM_032905chr101808 ------
NM_032906chr4------1167
NM_032924chr73859 233 59 ------
NM_032932chr17126309 5994 5589 5197 5067 5030 4966 2526 2435 2004 1883 936 56018 5084 4253 706 60 66394 5868 5248 2429 1921 349 --
NM_032947chr54403 314 237 151 1913 1412 1962
NM_032967chrX2746 415 ------
NM_032968chrX84022 3533 3287 3087 817 731 409 398 --2692 592 --
NM_032969chrX84022 3533 3287 3087 817 731 409 398 --2692 592 --
NM_032973chrY74014 3529 3282 3082 731 409 398 --2692 592 --
NM_032975chr1833021 2907 1380 12259 ----
NM_032978chr18--1174 11098 --
NM_032979chr18--1174 11098 --
NM_032980chr1833021 2907 1380 12259 ----
NM_032981chr18--1174 11098 --
NM_032982chr762283 2046 1936 1792 943 152 --198 --
NM_032983chr753097 2860 2750 2606 966 2533 373 2912 789 --
NM_032998chr11242 --2218 82 --
NM_032999chr741106 145 125 65 ------
NM_033000chr741106 145 125 65 ------
NM_033001chr741106 145 125 65 ------
NM_033008chr33231 136 66 ------
NM_033009chr33231 136 66 ------
NM_033010chr33231 136 66 ------
NM_033017chr721679 646 11379 61442 1052 685 143 92 77 1559
NM_033020chr174563 4348 3771 1356 1130 673 493 23317 1645 --1613
NM_033023chr741219 1155 950 872 1826 ----
NM_033027chr371112 867 758 742 385 255 223 1943 1732 --
NM_033030chr251568 1233 1220 581 97 ------
NM_033044chr121247 1134 131 ----
NM_033087chr921189 972 ------
NM_033103chr192945 87 --11402 --
NM_033125chr6----143 --
NM_033133chr17123630 3584 3560 3338 3237 2625 1273 1189 1117 717 667 119 ----2933 348
NM_033136chr531809 1257 545 11788 21378 356 --
NM_033137chr531809 1257 545 11788 21378 356 --
NM_033141chr1452133 2076 1855 1416 175 --1193 --
NM_033143chr444595 4339 1342 174 --24102 3679 22912 165
NM_033158chr32249 39 ------
NM_033161chr931876 1483 1416 --1513 --
NM_033181chr663391 3198 3070 2831 1167 101 ------
NM_033211chr5----11781 --
NM_033224chr787950 7238 6894 5189 5018 2181 1714 1156 2531 365 36836 1988 452 --
NM_033225chr822492 128 22006 729 --1157
NM_033272chr2181 ------
NM_033274chr542285 1310 1191 769 32323 524 463 13026 --
NM_033285chr874458 3578 3518 1530 1324 1284 1191 ----1895
NM_033290chrX43138 1451 847 632 ------
NM_033300chr121248 988 2439 249 ----
NM_033315chr1772172 1880 1856 1769 700 440 189 1180 ----
NM_033331chr923106 2793 22747 774 --13140
NM_033360chr1234633 4374 253 11699 ----
NM_033375chr1761427 1250 597 584 504 180 31449 522 141 ----
NM_033419chr1741441 1417 282 39 --41529 369 236 22 --
NM_033425chr1143274 3098 1373 1256 32838 841 592 2971 256 --
NM_033429chr1543108 2688 716 422 1119 12192 --
NM_033449chr571845 1816 1741 1454 588 218 196 11855 ----
NM_033495chrX299 35 --1926 --
NM_033503chr1593738 3718 3578 3246 2942 2565 2515 580 303 11456 13641 --
NM_033505chr245624 4278 2254 1829 --12031 --
NM_033512chr862993 1205 857 696 69 25 ------
NM_033535chr44923 821 152 26 ------
NM_033550chr2042315 2189 1815 767 ------
NM_033551chr562678 2129 1242 697 575 351 22656 2114 ----
NM_033626chrX61757 1468 1332 1216 422 122 11819 31615 1256 1140 --
NM_033631chr1113725 3372 2854 1299 1021 970 878 581 486 470 63 12453 126 --
NM_033642chrX3474 139 109 ------
NM_033644chr521678 644 1438 ----
NM_033645chr521678 644 1438 ----
NM_033656chr2185136 4868 4275 4258 4136 4120 1967 1252 --24532 1655 15752
NM_048368chr181313 ------
NM_052834chr1842489 895 863 494 1102 ----
NM_052850chr19133 ------
NM_052864chr421856 531 ------
NM_052872chr6--153 ----
NM_052874chr161670 ------
NM_052876chr1962403 2361 2307 2100 2091 147 22562 541 31895 497 133 --
NM_052877chr13129 81 53 --188 --
NM_052885chr1263890 3600 3331 3170 1221 75 ------
NM_052886chr831428 1323 46 ------
NM_052896chr151818 992 930 635 183 ------
NM_052900chr861717 1570 1482 679 471 178 ------
NM_052906chr2274989 4708 4264 3847 1626 1103 644 34276 1000 274 14701 13584
NM_052910chr1332102 1576 1393 11523 31366 1327 557 --
NM_052911chr181943 --1925 --
NM_052913chr631046 980 775 ------
NM_052918chr1053690 1138 907 901 591 42985 1148 944 186 33701 3176 3148 --
NM_052934chr161977 1753 751 726 697 206 1618 1304 --
NM_052937chr831031 638 451 ------
NM_052944chr16189 ------
NM_052948chr192329 102 ------
NM_052954chr2111580 --1162 165
NM_052978chr141589 2485 39 ----
NM_053016chr996705 5715 5433 4868 3160 3101 2753 2372 2038 47200 7133 5602 674 37245 5708 1135 12226
NM_053023chr1162391 722 438 418 411 217 ------
NM_053024chr31421 --21102 170 1344
NM_053043chr786224 5740 5534 4259 4063 1344 1270 953 11796 ----
NM_053064chr1432540 554 270 --1498 --
NM_053281chrX1367 ------
NM_054016chr11601 1657 ----
NM_054016chr11601 1657 ----
NM_054016chr11601 1657 ----
NM_054027chr522123 1625 12179 1536 --
NM_054110chr32978 718 --1703 --
NM_054111chr61732 11012 2809 114 --
NM_054114chr61733 ------
NM_057169chr1242746 2149 1144 903 --22574 589 --
NM_057170chr1242746 2149 1144 903 --22574 589 --
NM_057175chr442565 2022 1943 860 ------
NM_057749chr81368 ------
NM_058172chr451854 1633 543 189 145 --11145 --
NM_058241chr2----11611 --
NM_058241chr2----11611 --
NM_078470chr1042633 363 257 187 ----11047
NM_078471chr1731156 1026 474 --21217 259 --
NM_078487chr933328 2051 151 1348 1234 --
NM_078625chr641029 545 486 157 --1461 --
NM_079421chr19--193 --1571
NM_080415chr172186 93 1952 1328 --
NM_080491chr1173931 3408 3237 3108 2842 415 317 12895 1106 22416 198
NM_080546chr9----1650 12138
NM_080552chr202677 619 ------
NM_080597chr18184 --11099 --
NM_080617chr20--1723 ----
NM_080628chr2051298 1237 1134 1008 989 1483 ----
NM_080629chr111549 11141 ----
NM_080630chr111549 11141 ----
NM_080654chr1141149 366 99 78 --286 52 --
NM_080669chr1783599 3574 1979 1895 1555 1433 775 680 2570 281 13890 --
NM_080676chr2033012 2162 1013 --11220 --
NM_080738chr121941 1391 11379 ----
NM_080759chr13--1403 ----
NM_080760chr13--1403 ----
NM_080867chr14105096 4703 4107 3673 3646 1848 1816 1240 905 230 --24222 121 11466
NM_080872chr873563 3540 3191 1151 699 418 211 --23652 673 22850 80
NM_080881chr52589 25 1153 ----
NM_130385chr1152662 2597 2534 275 203 12863 12131 --
NM_130386chr182543 150 1165 --1625
NM_130391chr943032 2827 2760 2272 22547 1140 11148 13318
NM_130392chr943032 2827 2760 2272 22547 1140 11148 13318
NM_130393chr943032 2827 2760 2272 22547 1140 11148 13318
NM_130436chr2111865 --11910 --
NM_130438chr2122442 301 --22487 402 1213
NM_130439chr1062251 2239 1678 1495 1452 720 --1762 --
NM_130439chr1062251 2239 1678 1495 1452 720 --1762 --
NM_130440chr121537 1314 ------
NM_130443chr112257 121 ------
NM_130781chr52543 98 ------
NM_130798chr1531399 1208 187 ------
NM_130808chr3170 ------
NM_130830chr343471 1117 136 67 ----13137
NM_130838chr1521758 405 ------
NM_130839chr1521758 405 ------
NM_130846chr1221013 291 156 1861 1729
NM_130901chr15----136 --
NM_133170chr20107677 7641 7607 6926 5826 2859 2499 1316 467 376 36945 6087 5262 17417 --
NM_133171chr203908 446 183 11079 --21160 213
NM_133264chr17123823 3775 3427 3286 3091 2691 2539 1532 1151 941 584 284 --13650 --
NM_133265chrX83019 3009 2719 2269 1325 1170 588 444 12704 11343 12239
NM_133330chr432844 1160 834 12477 ----
NM_133331chr432844 1160 834 12477 ----
NM_133334chr485666 4852 4300 3981 1421 754 393 69 14523 1526 --
NM_133335chr432844 1160 834 12477 ----
NM_133367chr693463 3367 3158 2851 2584 1029 830 634 406 22709 1227 ----
NM_133368chr16------137
NM_133370chr443565 2379 1109 99 --11027 --
NM_133372chr5--11842 ----
NM_133444chr1941672 1178 437 187 11236 --2578 136
NM_133445chr952985 2918 2812 2535 2419 33522 2484 1473 11048 13509
NM_133473chr1941880 1541 1515 153 --1208 --
NM_133476chr122343 332 ------
NM_133478chr232438 842 315 188 11855 --
NM_133496chr133493 2832 1656 13499 13646 --
NM_133499chrX1317 ------
NM_133503chr12----2767 651 1114
NM_133504chr12----2767 651 1114
NM_133505chr12----2767 651 1114
NM_133506chr12----2767 651 1114
NM_133507chr121154 --2945 829 2292 40
NM_133631chr31515 ------
NM_133638chr521183 324 ------
NM_133642chr2231267 827 141 --1188 11201
NM_133647chr1593363 3346 3304 2868 2703 2590 1167 1105 578 ------
NM_134265chr1711010 --1959 --
NM_134325chr171512 1288 562 547 286 261 232 1153 ----
NM_134442chr221626 383 11682 ----
NM_134447chr192456 140 --1134 --
NM_138270chrX33342 3196 708 --23318 1118 --
NM_138288chr1441911 1801 408 290 --1425 11925
NM_138297chr3126 ------
NM_138344chr141336 ------
NM_138357chr1041499 1206 541 108 ------
NM_138360chr14--164 1278 --
NM_138381chr351613 828 742 672 92 22244 1833 --144
NM_138395chr221048 313 ------
NM_138423chr1562236 1786 1526 880 772 56 --1777 --
NM_138444chr1364212 3503 3417 1176 100 48 11264 1279 --
NM_138453chr5--1205 ----
NM_138457chr652459 2077 1235 1071 515 23445 1257 23340 3081 --
NM_138459chr643579 3268 3067 2944 ------
NM_138468chr2105867 4789 2300 2073 1527 1471 1136 1072 919 729 44874 4588 2356 1834 25991 4271 --
NM_138471chr111388 ------
NM_138473chr12125086 4743 4375 4363 4126 4067 3330 2030 1950 1797 290 280 --13995 14556
NM_138477chr152602 327 1661 ----
NM_138558chr141040 408 269 241 ------
NM_138559chr2--11299 ----
NM_138569chr62248 204 ------
NM_138576chr1454779 3948 3172 1577 888 ------
NM_138578chr2061343 950 491 348 319 299 1117 21393 26 --
NM_138621chr253730 2716 2612 837 162 --23832 3142 --
NM_138638chr1421571 703 ------
NM_138693chr7126 ----172
NM_138694chr643350 2527 2337 256 13262 12254 --
NM_138701chr71225 ----183
NM_138713chr16107988 7458 6980 6776 5514 3157 2817 2117 1873 682 12605 35709 5500 1611 --
NM_138714chr16107988 7458 6980 6776 5514 3157 2817 2117 1873 682 12605 35709 5500 1611 --
NM_138717chr62675 214 1487 ----
NM_138730chr62129 92 ------
NM_138731chr1453569 2977 1243 747 220 ------
NM_138771chr71565 --21592 1457 --
NM_138798chr22110 32 ------
NM_138804chr23601 587 285 2550 28 192 --
NM_138927chr211346 ------
NM_138929chr123569 265 116 2254 67 1490 --
NM_138930chr123569 265 116 2254 67 1490 --
NM_138931chr31987 ----151
NM_138969chr841230 901 461 299 --1450 --
NM_138970chr1432314 1759 860 --11886 148
NM_138971chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138971chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138972chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138972chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138973chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138973chr1172995 1433 1225 1087 883 860 136 13297 ----
NM_138981chr41647 --1540 --
NM_139015chr1221424 1245 ------
NM_139035chrX----1303 --
NM_139045chr91598 ----163
NM_139062chr171439 --1132 --
NM_139068chr51672 1267 ----
NM_139069chr51672 1267 ----
NM_139070chr51541 1136 ----
NM_139072chr21237 ------
NM_139131chr11----1604 --
NM_139132chr113371 365 218 1445 2850 113 --
NM_139135chr13924 267 238 --1108 --
NM_139164chr521432 1424 11554 1300 1587
NM_139168chr51329 2732 206 ----
NM_139207chr122897 184 11820 1719 1161
NM_139239chr19------1198
NM_139244chr63614 362 142 ------
NM_139246chr932226 424 175 --2432 354 --
NM_139276chr17102385 2194 2176 1653 759 703 394 315 58 48 12247 11550 --
NM_139283chr1262482 1791 1715 757 414 195 1954 ----
NM_139312chr1041334 603 315 68 ------
NM_139318chr141279 ------
NM_144568chr14----1600 --
NM_144571chr456593 6133 5686 4567 4299 12655 16618 --
NM_144574chr141176 ------
NM_144578chr14105322 5264 5223 5155 4307 4090 3716 1620 1249 1140 13538 14488 13771
NM_144582chr272226 2138 1938 1872 1679 1013 104 --12056 12021
NM_144609chr1741279 1207 943 471 11087 ----
NM_144610chr171455 161 1392 --
NM_144628chr20112732 2657 1986 1004 979 868 775 328 253 178 128 22867 583 ----
NM_144664chr1112388 ------
NM_144723chr53598 208 156 1242 2759 326 --
NM_144767chr1554332 4289 4232 4136 3917 52846 1685 852 251 222 23081 1241 1814
NM_144775chr1794518 4039 3879 3701 3507 1275 1154 1017 654 11497 ----
NM_144778chr1332633 231 73 ----1482
NM_144963chr842539 2250 222 35 ------
NM_144967chrX2412 246 --1264 --
NM_144973chr1274971 4557 4139 1863 1745 528 500 --1897 --
NM_144976chr191436 --1134 --
NM_144979chr42526 270 ------
NM_144982chr122578 561 ------
NM_145025chr63261 55 21 1912 --1288
NM_145037chr3192 --1528 1182
NM_145055chr1841470 1189 561 295 --11014 1409
NM_145056chr191680 --180 --
NM_145112chr1441180 1004 447 382 2388 330 ----
NM_145113chr1441452 1276 188 136 1602 ----
NM_145117chr1162919 2620 2026 858 641 218 13200 ----
NM_145174chr2221037 289 ------
NM_145176chr653327 2381 938 498 417 1487 1276 12156
NM_145206chr1032583 2328 251 22193 646 12107 --
NM_145235chr101151 ------
NM_145245chr1931197 1021 807 11124 1203 1220
NM_145259chr2137011 6922 5646 5182 4530 4460 2408 1965 1790 1654 1419 1266 935 --21206 95 --
NM_145263chr432259 357 81 --12112 1845
NM_145268chr731081 1026 109 ------
NM_145296chr19186 --1617 --
NM_145303chr61474 ------
NM_145307chr1034433 3090 1269 --13062 --
NM_145320chr763566 3012 2564 1132 1056 183 1434 11007 --
NM_145321chr763566 3012 2564 1132 1056 183 1434 11007 --
NM_145322chr763566 3012 2564 1132 1056 183 1434 11007 --
NM_145331chr61633 ------
NM_145332chr62781 76 ------
NM_145333chr62781 76 ------
NM_145341chr1021245 252 ------
NM_145351chr1782326 938 869 839 660 609 421 202 1551 1456 --
NM_145686chr273374 3239 2155 1184 966 900 249 ------
NM_145687chr273374 3239 2155 1184 966 900 249 ------
NM_145698chr1041751 1455 309 222 1543 22008 252 --
NM_145716chr11155 ------
NM_145733chr225944 804 789 375 209 2795 355 1293 --
NM_145735chr1322376 2155 11967 ----
NM_145808chr742528 481 463 81 ------
NM_145861chr121941 1391 11379 ----
NM_145888chr1981854 1249 776 409 318 197 185 133 --11656 --
NM_145899chr671172 1144 965 922 890 489 481 ----11071
NM_145901chr671172 1144 965 922 890 489 481 ----11071
NM_145902chr671172 1144 965 922 890 489 481 ----11071
NM_145903chr671172 1144 965 922 890 489 481 ----11071
NM_145904chr671172 1144 965 922 890 489 481 ----11071
NM_145905chr671172 1144 965 922 890 489 481 ----11071
NM_146388chr1931033 1006 254 21044 932 1993 --
NM_147150chr933325 2949 942 ----13800
NM_147156chr10--11026 1487 --
NM_147161chr121168 167 1460 --11044
NM_147171chr71392 ------
NM_147181chr441335 997 986 49 1350 ----
NM_147182chr441335 997 986 49 1350 ----
NM_147183chr441335 997 986 49 1350 ----
NM_147185chr71392 ------
NM_148174chr832231 1774 233 --11454 --
NM_148894chr421269 842 ----1913
NM_148898chr72934 766 --1792 --
NM_148899chr72934 766 --1792 --
NM_148921chr1752220 1994 1920 1767 722 ----11621
NM_148923chr181210 ------
NM_148957chr1342491 1045 839 264 12185 12179 --
NM_152133chr61733 ------
NM_152233chr1441664 1628 1234 334 ------
NM_152244chr1731131 913 474 --11069 --
NM_152253chr22103978 3613 3394 3299 2920 2655 1432 1199 920 811 193 1899 --
NM_152263chr1135910 5317 5001 4946 4724 4122 2219 1951 1930 1130 1074 579 373 15530 25795 34 --
NM_152265chr141244 1140 1122 482 ------
NM_152277chr52866 70 ------
NM_152280chr153481 2955 2834 2381 1244 --1310 --
NM_152296chr19------1243
NM_152305chr352183 2060 2052 1980 1569 --1261 --
NM_152310chr10------1285
NM_152352chr1843093 1171 1069 632 ------
NM_152376chr141813 1385 728 531 21529 675 ----
NM_152380chr131228 1221 224 1377 11294 --
NM_152384chr241890 1489 1314 824 --61694 1657 1518 1481 1343 785 11307
NM_152388chr263870 3770 3352 3337 1046 583 ------
NM_152409chr562815 2512 2335 2227 1318 1011 --12497 --
NM_152411chr73923 674 619 ------
NM_152414chr8------11392
NM_152417chr81904 1929 1423 --
NM_152422chr921661 379 ------
NM_152424chrX84212 4063 3656 3336 3181 932 482 168 23143 2954 --23402 204
NM_152437chr122353 330 11743 ----
NM_152442chr1211081 11400 ----
NM_152450chr1542136 1947 202 151 ----11442
NM_152451chr152864 807 ------
NM_152487chr151402 1357 496 323 265 137 ----
NM_152519chr262075 2022 1886 1615 852 536 ------
NM_152520chr21778 ------
NM_152522chr21250 ----181
NM_152527chr262151 1864 1845 491 299 49 1657 --1853
NM_152529chr263227 3171 2716 1778 624 462 1520 --11565
NM_152538chr321267 517 --11183 --
NM_152542chr432162 1943 772 ------
NM_152556chr752483 1852 1024 738 145 1664 ----
NM_152588chr1221449 1184 1226 ----
NM_152594chr151600 ------
NM_152605chr1931110 895 499 --1978 --
NM_152608chr182036 1931 1863 707 563 354 128 41 --1293 22383 281
NM_152624chr577127 6901 6854 5305 2444 2281 203 --1350 11021
NM_152629chr953894 2850 1130 747 607 12988 21626 357 1921
NM_152630chrX31331 1142 998 ------
NM_152636chr1122424 1087 12470 --185
NM_152641chr1221161 596 12068 ----
NM_152671chr2--1376 1122 --
NM_152678chr322625 751 1598 ----
NM_152694chrX4699 626 610 581 1189 ----
NM_152699chr363506 3380 2934 1303 912 491 23059 1296 12339 --
NM_152704chr132880 263 ------
NM_152716chr1171516 1486 1476 633 607 325 220 ------
NM_152721chr18272 66 --1566 --
NM_152734chr6104768 4595 3787 1791 828 452 407 298 238 117 23905 2124 25129 4044 12144
NM_152739chr72440 348 1911 1313 --
NM_152744chr763423 3304 1134 681 393 136 --1419 --
NM_152748chr71504 ------
NM_152753chr671518 620 403 304 199 187 74 31287 297 226 31897 1593 632 --
NM_152754chr732746 435 375 ------
NM_152774chr742724 2487 2463 910 --1841 12306
NM_152780chrX------21297 415
NM_152787chrX43422 1511 1398 711 ------
NM_152789chr721293 469 ------
NM_152829chr7158 138 ----
NM_152835chr132075 1025 566 --2571 101 --
NM_152838chr202757 397 12504 ----
NM_152860chr1241232 1029 611 34 --188 --
NM_152890chr121091 490 ------
NM_152896chr92709 284 ------
NM_152903chr1332634 948 639 22705 695 ----
NM_152924chr15116908 6830 6758 6614 5783 5551 5496 4427 4417 2058 1875 --36251 4361 1956 --
NM_152989chr122575 289 1645 ----
NM_152991chr111716 ------
NM_152999chr7114953 4936 4334 3952 3844 3365 3313 2015 1821 1314 844 24354 1759 24659 1556 141
NM_153026chr12----1185 --
NM_153029chr16114061 3953 3674 3643 3637 3577 3570 3447 2643 287 243 --23547 481 --
NM_153035chr162102 1994 1152 1106 512 57 --1478 --
NM_153040chr15--1152 ----
NM_153042chr61442 ------
NM_153182chr332815 896 110 --12387 12673
NM_153184chr341401 716 97 83 ------
NM_153188chr594940 4060 3970 2181 1613 996 965 695 91 ----23750 303
NM_153207chr1242484 741 637 505 ------
NM_153252chrX261 47 ------
NM_153257chr1911271 --1412 --
NM_153261chr1631325 1032 140 ------
NM_153262chr162811 2731 2355 472 120 69 23041 1066 12222 --
NM_153267chr92659 634 ------
NM_153280chrX1130 --1158 --
NM_153321chr171694 ----1355
NM_153322chr171694 ----1355
NM_153331chr31683 --1270 --
NM_153332chr852808 2529 1137 869 538 ------
NM_153347chr1141848 803 726 713 22043 1074 2540 256 --
NM_153354chr52817 286 ------
NM_153358chr192458 230 ------
NM_153362chr61349 ------
NM_153367chr1072497 1564 1327 767 414 190 69 --23614 2471 --
NM_153371chr1321518 836 --1707 --
NM_153374chr15----1136 --
NM_153456chr1394866 4440 2396 2363 1634 1549 1209 1150 791 11955 14551 15350
NM_153487chr6124829 4476 4375 4104 3788 3673 3576 3327 3235 1422 982 262 11773 23722 390 14309
NM_153498chr103738 682 156 ------
NM_153605chr311620 1381 ----
NM_153616chr151272 12016 12201 --
NM_153617chr151272 12016 12201 --
NM_153618chr151272 12016 12201 --
NM_153619chr1532512 2302 336 23254 520 13439 --
NM_153620chr731386 383 60 1450 21150 365 --
NM_153634chr1221356 1077 ------
NM_153640chr20197 ------
NM_153686chr432143 780 400 ----11930
NM_153687chr122355 229 ------
NM_153693chr121790 1674 1519 --
NM_153712chr283424 3188 2638 2484 1366 1302 913 451 --1658 --
NM_153810chr1064190 3723 3261 1416 1329 1301 --1594 --
NM_153828chr22584 252 ------
NM_153831chr82365 29 ------
NM_170607chr1731009 302 121 21046 232 31411 1181 985 11211
NM_170665chr1263911 3644 3556 3201 582 495 12827 ----
NM_170674chr1511234 2230 143 ----
NM_170675chr151910 ------
NM_170676chr151910 ------
NM_170677chr1511234 2230 143 ----
NM_170692chr12423 65 ----11087
NM_170706chr154225 3982 2967 2903 971 24018 3864 33696 3106 1518 --
NM_170707chr16598 377 287 229 220 73 --2978 365 --
NM_170708chr16598 377 287 229 220 73 --2978 365 --
NM_170709chr81711 ----1326
NM_170711chr191721 ------
NM_170719chr1321049 423 ------
NM_170724chr611003 1967 1989 --
NM_170731chr1121910 934 ----22478 1869
NM_170732chr1121910 934 ----22478 1869
NM_170733chr1121910 934 ----22478 1869
NM_170734chr1121910 934 ----22478 1869
NM_170735chr1121910 934 ----22478 1869
NM_170750chrX1360 ------
NM_170751chr641378 1328 1037 444 ------
NM_170752chr641378 1328 1037 444 ------
NM_170768chr11135 --1270 --
NM_170774chr20103941 1617 981 779 766 754 296 190 176 138 11482 23846 1600 --
NM_170782chr11206 2500 31 ----
NM_171825chr582770 2635 2362 2277 2016 1214 1041 780 21988 672 --12760
NM_171998chrX31802 694 452 ------
NM_172020chr7102062 1852 816 789 663 428 293 244 230 106 --11800 --
NM_172037chr8131 --11350 1997
NM_172058chr851541 610 475 259 144 ------
NM_172059chr851541 610 475 259 144 ------
NM_172060chr851541 610 475 259 144 ------
NM_172071chr186546 6361 5997 4959 4942 4858 4735 4654 --36370 5001 4601 --
NM_172103chr61306 1414 11990 --
NM_172105chr61306 1414 11990 --
NM_172127chr422055 2032 --11833 --
NM_172128chr422011 1988 --11789 --
NM_172169chr1031662 1501 485 --11304 --
NM_172170chr1031662 1501 485 --11304 --
NM_172171chr1031662 1501 485 --11304 --
NM_172173chr1031662 1501 485 --11304 --
NM_172208chr64929 888 848 396 --3977 917 415 --
NM_172315chr1511234 2230 143 ----
NM_172316chr1511234 2230 143 ----
NM_173054chr71678 ------
NM_173082chr621459 460 ----11222
NM_173156chr121971 1867 11778 --11874
NM_173172chr23419 301 36 --1238 --
NM_173198chr962222 2148 886 828 811 305 ------
NM_173200chr962222 2148 886 828 811 305 ------
NM_173214chr16107988 7458 6980 6776 5514 3157 2817 2117 1873 682 12605 35709 5500 1611 --
NM_173216chr332201 1080 295 22705 1000 2956 672 --
NM_173217chr332201 1080 295 22705 1000 2956 672 --
NM_173354chr2122117 1590 1425 ----
NM_173454chr151801 --1959 --
NM_173460chr202160 48 ------
NM_173468chr475775 4635 4588 4500 1730 870 517 1463 ----
NM_173470chrX52351 1835 575 554 81 ------
NM_173475chr1681652 1342 1297 1121 121 104 43 35 ------
NM_173491chr521459 1107 ------
NM_173496chr1033005 586 262 --32649 1918 1185 --
NM_173505chr1831180 465 455 ------
NM_173511chr242781 961 761 248 1879 53699 2411 1215 979 166 --
NM_173546chr32613 202 1619 ----
NM_173560chr62416 48 --1453 --
NM_173563chr61276 --140 --
NM_173582chr1185926 5428 5264 4518 1405 1350 754 96 --14081 --
NM_173595chr12164987 4528 4478 3913 3748 3698 3641 3254 3206 1142 1075 1039 819 711 372 238 45207 1666 1639 912 24273 698 13338
NM_173602chr1242764 2711 642 404 1447 23652 3301 12770
NM_173631chr1931225 868 374 --21283 921 --
NM_173642chr1148903 8789 8721 8577 8413 6544 5611 2591 2031 1739 1579 1026 913 870 59085 1706 1452 1100 1059 11559 --
NM_173645chr22549 210 ------
NM_173683chr831792 667 369 11555 ----
NM_173694chrX22312 204 ----22203 579
NM_173797chr5174 ------
NM_173808chr124000 1450 23258 3091 1167 --
NM_173822chr221686 204 ------
NM_173824chr3147 --1227 --
NM_173825chr362832 2667 1147 410 129 116 --21089 456 --
NM_173829chr555976 4210 3856 3751 2414 25982 1563 14393 1349
NM_173851chr843365 2618 808 400 11065 1520 --
NM_174911chr83727 660 387 11217 ----
NM_174916chr1541970 1922 1467 595 --11697 --
NM_174921chr421035 801 11092 ----
NM_174934chr1193345 1445 1268 1015 942 781 597 581 315 2161 152 ----
NM_175052chr511025 --1152 --
NM_175056chr3--1503 11609 --
NM_175061chr721641 1376 11425 --11782
NM_175573chr20195 ------
NM_175607chr331676 1183 530 1691 ----
NM_175610chr1531049 1008 69 ------
NM_175612chr331676 1183 530 1691 ----
NM_175709chr2282588 851 675 417 263 176 155 140 --31099 605 556 --
NM_175733chr1152179 1644 1521 1387 471 32071 1970 719 1354 --
NM_175736chr12257115 6741 6636 6350 6086 6077 6031 5907 5887 5680 5618 5358 5300 5251 5018 2997 2299 1859 1805 1362 1295 1289 1121 540 145 27061 5465 66100 5721 5276 2637 2333 773 26580 555
NM_175748chr1421945 240 ------
NM_175767chr551867 1210 758 263 176 1201 --11278
NM_175847chr1931347 1122 131 --1554 --
NM_175848chr2041423 956 917 316 --1560 --
NM_175848chr2041423 956 917 316 --1560 --
NM_175849chr2041423 956 917 316 --1560 --
NM_175849chr2041423 956 917 316 --1560 --
NM_175850chr2041423 956 917 316 --1560 --
NM_175850chr2041423 956 917 316 --1560 --
NM_175852chr182838 2288 2100 1933 1226 1145 641 381 12394 ----
NM_175856chr54624 214 137 43 ------
NM_175859chrX11334 --11628 11746
NM_175861chr1285411 5354 5309 5150 4430 2241 2200 1648 --1749 --
NM_175862chr31440 --31513 554 41 21388 382
NM_175863chr61135 --1120 --
NM_175884chr7----1344 --
NM_175900chr1641649 346 205 90 ----1666
NM_175921chr5124087 3371 2855 2610 1660 1527 1087 1004 698 585 379 339 11152 44043 1454 1273 836 1901
NM_175931chr1651602 1490 1428 769 159 41636 1542 492 221 21313 377 1329
NM_176787chr18----2621 108 --
NM_176814chr721310 1059 1255 ----
NM_176823chr1103873 2478 1532 1366 1121 875 438 424 251 226 --1914 --
NM_176863chr1772143 2048 1832 1617 1568 683 169 12033 --1767
NM_177424chr141282 576 493 359 ------
NM_177438chr1434104 2921 1479 --11096 --
NM_177452chr1442307 1002 892 165 11845 ----
NM_177549chr204973 777 418 76 ------
NM_177951chr14--1910 ----
NM_177952chr14128 ------
NM_177968chr232011 656 538 ------
NM_177972chr1164098 4077 3732 3587 3356 80 11483 22707 1670 --
NM_177974chr1562236 1786 1526 880 772 56 --1777 --
NM_177985chr232045 1499 54 --12144 11829
NM_177989chr31352 --124 --
NM_177990chr2021986 1611 ------
NM_177995chr921661 379 ------
NM_177999chr973593 3099 1002 766 412 326 96 --2503 457 13350
NM_178010chr122575 289 1645 ----
NM_178011chr1043025 2294 1037 575 21303 279 13266 --
NM_178013chr1462912 2116 1175 583 346 289 12863 11001 --
NM_178042chr31352 --124 --
NM_178123chr22879 260 ------
NM_178140chr541844 709 518 249 ------
NM_178151chrX67503 6160 5760 2761 1054 839 --46796 5498 3029 3021 25164 2604
NM_178152chrX67503 6160 5760 2761 1054 839 --46796 5498 3029 3021 25164 2604
NM_178153chrX67503 6160 5760 2761 1054 839 --46796 5498 3029 3021 25164 2604
NM_178154chr141263 ------
NM_178155chr141263 ------
NM_178156chr141263 ------
NM_178157chr141263 ------
NM_178169chr122414 120 ----1470
NM_178229chr16998 817 429 376 352 318 122 1929 11029
NM_178234chr8135 ------
NM_178426chr11734 ------
NM_178427chr11634 ------
NM_178441chr1411383 ------
NM_178454chr11638 --1512 --
NM_178460chr201165 ------
NM_178500chr17183 ------
NM_178509chr1723868 1226 12968 11079 --
NM_178554chr3103392 2701 2612 1134 1057 1038 896 144 125 22 11248 ----
NM_178565chr821470 61 1361 --1106
NM_178582chr2031303 398 376 11361 1972 --
NM_178585chr453314 2539 1246 1128 1012 22739 337 32569 2170 1146 --
NM_178586chr1421714 298 11518 1747 --
NM_178812chr811234 ----11387
NM_178815chr1051991 1901 1857 669 510 --12692 --
NM_180976chr64671 290 269 54 1119 ----
NM_180977chr64671 290 269 54 1119 ----
NM_180989chr1352408 2297 2285 2114 588 32465 924 910 ----
NM_181077chr1512220 1110 ----
NM_181291chr14----1612 --
NM_181302chr141176 ------
NM_181308chr141176 ------
NM_181332chrX2274 25 --133 --
NM_181349chr792928 2659 2475 2392 2055 1982 1152 572 200 --12182 12484
NM_181351chr1152922 2372 1165 705 387 12874 --12399
NM_181354chr811700 ------
NM_181356chr63856 293 89 ------
NM_181358chr133583 314 36 --189 --
NM_181361chr321266 508 ------
NM_181457chr2------1255
NM_181458chr2194 ----1388
NM_181459chr2------1154
NM_181460chr2------1201
NM_181481chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_181482chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_181483chr18126930 6921 6765 6118 5464 4775 4529 1725 1419 968 900 744 25028 1399 12519 --
NM_181491chr943174 2386 965 38 33134 2575 930 22006 782 1901
NM_181504chr531676 1390 362 33732 3688 1598 --12668
NM_181509chr202150 93 2340 57 2299 155 2323 292
NM_181523chr531676 1390 362 33732 3688 1598 --12668
NM_181524chr531676 1390 362 33732 3688 1598 --12668
NM_181598chr141302 ------
NM_181655chr172715 113 --170 --
NM_181656chr173924 322 51 --1279 --
NM_181659chr2042548 2481 1287 325 13072 12601 --
NM_181659chr2042548 2481 1287 325 13072 12601 --
NM_181670chr122480 444 ------
NM_181671chr172938 86 --2266 213 --
NM_181672chrX21689 26 11399 ----
NM_181673chrX21689 26 11399 ----
NM_181701chr941917 806 583 53 11575 1939 --
NM_181702chr821017 991 ------
NM_181715chr1----188 --
NM_181723chr811644 11613 12342 --
NM_181741chr21132 --1454 --
NM_181742chr21132 --1454 --
NM_181746chr14263 243 180 52 ------
NM_181762chrX3795 147 70 --1156 --
NM_181777chrX3795 147 70 --1156 --
NM_181782chr652304 2089 1478 1424 123 --11559 --
NM_181784chr252514 2462 1636 838 634 --1659 --
NM_181809chr1123988 3650 3495 3304 3229 3219 1559 1210 969 887 629 387 11588 23717 200 --
NM_181836chr521033 489 12097 2270 245 --
NM_181838chr52631 128 ----1519
NM_181871chr13464 134 32 ------
NM_181876chr442127 782 333 164 22650 2017 ----
NM_181886chr41131 ------
NM_181887chr41131 ------
NM_181888chr41131 ------
NM_181889chr41131 ------
NM_181890chr41131 ------
NM_181891chr41131 ------
NM_181892chr42178 55 ------
NM_181893chr41131 ------
NM_182485chr442525 2459 1343 394 12724 1382 --
NM_182503chr655332 4209 3704 1965 1490 --14751 24803 1061
NM_182515chr1976548 5701 4714 4660 4310 4113 908 34170 963 884 22353 88 --
NM_182557chr1172067 1983 1647 1457 483 283 239 11441 ----
NM_182580chr132309 631 233 --21870 650 --
NM_182594chr52353 317 ------
NM_182641chr1741974 1395 431 95 ------
NM_182646chr442525 2459 1343 394 12724 1382 --
NM_182666chr31530 ------
NM_182678chr22439 432 --2475 114 --
NM_182701chr62371 32 2140 106 ----
NM_182715chr71905 ------
NM_182717chr1021215 1042 ------
NM_182720chr1021215 1042 ------
NM_182721chr1021215 1042 ------
NM_182722chr1021215 1042 ------
NM_182723chr1021215 1042 ------
NM_182757chr653398 2976 2663 1082 967 11140 22954 1048 1981
NM_182763chr142279 2150 2098 351 12108 ----
NM_182764chr203908 446 183 11079 --21160 213
NM_182789chr54895 319 231 156 ------
NM_182830chr1431448 532 518 1681 ----
NM_182835chr14130 ------
NM_182853chr1021215 1042 ------
NM_182898chr776027 4441 4122 1737 1564 1432 204 15989 ----
NM_182899chr776027 4441 4122 1737 1564 1432 204 15989 ----
NM_182907chr682448 2252 2159 1878 1593 840 792 767 1680 --12310
NM_182911chr2------1213
NM_182920chr32925 209 11306 11236 --
NM_182931chr71468 ------
NM_182943chr3----11074 --
NM_182964chr1162919 2620 2026 858 641 218 13200 ----
NM_182972chr141753 1106 997 34 --1528 12112
NM_182978chr181143 ------
NM_183006chr2051565 1555 1229 424 332 ----11167
NM_183011chr1021215 1042 ------
NM_183012chr1021215 1042 ------
NM_183013chr1021215 1042 ------
NM_183075chr462417 2200 1873 818 753 459 --2847 362 12973
NM_183078chr683689 3445 3373 3260 2615 619 412 154 --12841 11239
NM_183234chr1521903 1632 --11680 --
NM_183235chr1521903 1632 --11680 --
NM_183236chr1521903 1632 --11680 --
NM_183237chr341119 800 292 27 ----1376
NM_183238chr1253078 2903 1137 741 213 --13306 --
NM_183323chr54895 319 231 156 ------
NM_183353chrX1307 11192 11121 --
NM_183376chr154983 892 792 62 --1738 --
NM_183380chr61914 ------
NM_183397chr20125100 4990 4942 4758 4726 4072 3547 1824 1614 660 489 151 ------
NM_183419chr811238 ------
NM_194071chr764735 1169 959 700 641 40 13829 43668 1039 626 510 13521
NM_194247chr284537 3637 3355 2870 1462 901 845 119 13086 ----
NM_194282chr442726 2514 2090 1026 --12907 --
NM_194283chr563689 1676 1643 1175 620 194 ------
NM_194285chr1132820 2325 399 --11144 --
NM_194286chr1266049 4648 967 190 65 21 54899 1904 1783 1623 1051 --26119 1004
NM_194291chr812722 --22222 440 11151
NM_194298chr1041647 601 329 188 ------
NM_194301chr1431189 259 83 ------
NM_194317chr222583 2508 ------
NM_194328chr932955 2689 102 163 1369 --
NM_194329chr932955 2689 102 163 1369 --
NM_194330chr932955 2689 102 163 1369 --
NM_194332chr932955 2689 102 163 1369 --
NM_194434chr1844967 3880 481 66 35176 4714 1619 21375 912 --
NM_194442chr111105 ------
NM_194449chr181203 ------
NM_197941chr552682 2515 2238 311 107 --1956 --
NM_197956chr941744 799 373 27 1383 --11574
NM_197970chr251568 1233 1220 581 97 ------
NM_198042chr8173 ------
NM_198057chrX2792 46 ------
NM_198066chr1433036 2650 2093 --1780 --
NM_198081chr632007 407 59 22750 434 --22373 860
NM_198089chr191103 ------
NM_198123chr861717 1570 1482 679 471 178 ------
NM_198124chr861717 1570 1482 679 471 178 ------
NM_198181chr1522604 1170 12390 22112 1791 --
NM_198186chr93563 242 208 ----1576
NM_198187chr93563 242 208 ----1576
NM_198196chr362427 1912 867 850 376 271 22282 1969 22124 1789 --
NM_198204chr1731009 302 121 21046 232 31411 1181 985 11211
NM_198205chr1731009 302 121 21046 232 31411 1181 985 11211
NM_198215chr1041315 1246 507 63 ------
NM_198243chr152683 657 --1330 --
NM_198268chr133583 314 36 --189 --
NM_198269chr133583 314 36 --189 --
NM_198270chrX23020 524 11193 ----
NM_198336chr751780 1172 696 117 95 ----1155
NM_198390chr1631552 1457 1211 ------
NM_198391chr202304 78 11132 ----
NM_198395chr51486 ------
NM_198396chr171372 ------
NM_198399chr351856 1712 1624 1415 589 --1375 --
NM_198400chr1552593 2540 504 348 330 ------
NM_198404chr133686 345 157 ------
NM_198468chr694282 4118 3992 3843 3403 3049 2794 933 438 14519 33890 1378 227 13070
NM_198484chr395975 5260 5023 4974 4404 4143 2123 2001 1474 16119 12274 11634
NM_198503chr141710 1680 878 565 ------
NM_198504chr31923 --1778 --
NM_198511chrX2190 41 --1568 --
NM_198513chr831491 576 138 ------
NM_198560chr393845 3180 3160 1434 1107 1001 959 507 124 --2968 58 --
NM_198563chr32144 82 --3130 106 93 --
NM_198568chr62111 55 --196 --
NM_198569chr632672 814 800 11696 --22032 1967
NM_198581chr2147236 6967 6953 6518 6495 5926 5550 4923 2929 1599 1534 451 280 74 21540 1227 25835 5708 --
NM_198595chr474978 3527 3331 1032 593 413 175 --11235 23763 85
NM_198686chr1451655 1646 917 869 275 32347 1669 645 11016 1881
NM_198715chr1116249 5406 4579 4070 4010 1643 1487 1368 999 977 228 32124 1596 658 14655 --
NM_198793chr383947 3437 3210 2983 1248 1171 491 372 1385 ----
NM_198794chr141179 ----11398
NM_198834chr17102047 1942 1678 869 587 484 324 225 206 26 ------
NM_198836chr17102047 1942 1678 869 587 484 324 225 206 26 ------
NM_198837chr17102047 1942 1678 869 587 484 324 225 206 26 ------
NM_198838chr17102047 1942 1678 869 587 484 324 225 206 26 ------
NM_198839chr17102047 1942 1678 869 587 484 324 225 206 26 ------
NM_198859chr395071 3887 3860 3787 3152 1668 1519 1009 230 24758 1338 23294 884 --
NM_198880chr31572 ------
NM_198883chr1----136 --
NM_198889chr451375 555 455 200 93 21303 176 11133 --
NM_198896chr113489 423 407 ------
NM_198900chr12257115 6741 6636 6350 6086 6077 6031 5907 5887 5680 5618 5358 5300 5251 5018 2997 2299 1859 1805 1362 1295 1289 1121 540 145 27061 5465 66100 5721 5276 2637 2333 773 26580 555
NM_198902chr151165 ------
NM_198935chr2022558 2330 ------
NM_198963chr2--130 174 --
NM_198990chr742788 1032 354 215 22564 1311 --199
NM_198992chr1211333 ------
NM_198995chr182528 472 ------
NM_199000chr741891 1559 625 551 12012 ----
NM_199039chr431017 894 66 ------
NM_199051chr11234 ------
NM_199054chr19111662 1558 1521 1468 1454 755 433 340 308 105 95 11542 1487 1352
NM_199129chr2071232 887 432 307 249 231 62 ----1280
NM_199138chr132880 263 ------
NM_199160chr931909 1828 721 31806 562 70 --11383
NM_199205chr8--1675 ----
NM_199235chr2--1260 ----
NM_199245chr1262588 2351 2304 1688 615 395 22031 752 1462 --
NM_199320chr41768 1880 12844 --
NM_199320chr41768 1880 12844 --
NM_199324chr443044 1125 1014 784 ------
NM_199355chr1621584 1324 ------
NM_199421chr14105096 4703 4107 3673 3646 1848 1816 1240 905 230 --24222 121 11466
NM_199423chr1631280 552 410 1138 --11338
NM_199436chr241132 620 435 281 ------
NM_199440chr2121 ------
NM_199454chr1124190 3600 3500 3140 3065 1640 1400 1107 820 792 658 595 23623 3376 ----
NM_199462chr1114865 3308 3176 2009 1772 1434 1145 1121 1047 805 217 14287 ----
NM_201263chr152137 1564 1299 822 41 --11638 --
NM_201266chr232011 572 192 ------
NM_201279chr232011 572 192 ------
NM_201280chr631195 405 145 11251 ----
NM_201413chr211196 156 ----
NM_201414chr211196 156 ----
NM_201432chr17106481 4385 4181 2579 1913 1360 941 767 638 209 --25166 2153 --
NM_201433chr17106481 4385 4181 2579 1913 1360 941 767 638 209 --25166 2153 --
NM_201436chr72792 639 ------
NM_201516chr72848 695 ------
NM_201517chr72792 639 ------
NM_201567chr331387 557 141 11378 154 --
NM_201568chr121971 1867 11778 --11874
NM_201569chr121971 1867 11778 --11874
NM_201591chr4124 1219 ----
NM_201592chr4124 1219 ----
NM_201599chrX1853 192 2444 421 --
NM_201632chr571565 1510 565 511 363 256 53 1754 --1575
NM_201634chr5101664 1609 664 610 462 355 152 106 67 50 ----1674
NM_201999chr421246 154 ------
NM_203301chr1441481 1130 300 140 ------
NM_203304chr191665 ------
NM_203305chr942368 2339 1818 1731 1983 2966 397 1900
NM_203318chr1731156 1026 474 --21217 259 --
NM_203327chr201852 12889 24136 3962 34031 3484 3367
NM_203341chr12828 98 ------
NM_203349chr1521744 743 ------
NM_203365chr2130 ------
NM_203390chr821211 436 11779 1370 11543
NM_203394chr1221849 1052 ----12451
NM_203413chr175999 988 754 420 118 ------
NM_203434chr941195 1126 321 246 ------
NM_203446chr2111204 ----12137
NM_203453chr931619 1460 707 --11357 1609
NM_203459chr141733 1712 1608 820 ------
NM_203487chr131641 ------
NM_203499chr173729 142 109 ------
NM_203504chr442468 2383 1687 356 --22435 760 --
NM_203505chr442468 2383 1687 356 --22435 760 --
NM_205842chr2276 52 ------
NM_205848chr122474 2437 12724 ----
NM_205861chr162120 1913 1592 867 39 33 --41758 564 426 377 --
NM_206594chr183310 2427 1330 1211 1068 350 328 189 ------
NM_206595chr183310 2427 1330 1211 1068 350 328 189 ------
NM_206853chr633497 3462 1154 ------
NM_206854chr634758 4723 92 ------
NM_206855chr645723 5688 4125 1057 ------
NM_206866chr2152286 957 729 711 119 13233 --12167
NM_206876chr243586 3531 3138 520 22689 796 ----
NM_206907chr543022 2953 2874 1240 ------
NM_206909chr888147 7775 7369 7184 2025 1841 1757 866 11224 26069 1990 11278
NM_206914chr1251834 1720 518 280 221 12263 ----
NM_206943chr22780 90 --1826 --
NM_206944chr9------1548
NM_206945chr9------1548
NM_206946chr9------1548
NM_206947chr9------1548
NM_206996chr11345 ------
NM_207012chr1043408 3112 2791 1233 1903 12839 --
NM_207111chr762704 1711 908 814 278 235 1582 22521 2032 --
NM_207116chr762704 1711 908 814 278 235 1582 22521 2032 --
NM_207171chr141990 1836 1818 370 ------
NM_207303chr1043225 2638 945 215 1687 --13632
NM_207304chr1322520 118 ----1369
NM_207313chr174971 308 191 121 --3669 270 201 11006
NM_207317chr5260 21 --1365 --
NM_207325chr192484 200 ------
NM_207344chr1241088 404 271 156 --21312 434 --
NM_207351chr33268 216 34 --