TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1972
miRNA Sequence: UCAGGCCAGGCACAGUGGCUCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1262444 2240 1971 1834 814 352 2777 603 1196 --
NM_000038chr51175 11341 ----
NM_000051chr1143356 2619 1150 178 ------
NM_000053chr134775 610 212 177 --1182 --
NM_000084chrX66929 5879 5293 4318 1276 1152 ----25749 2137
NM_000088chr1711143 ------
NM_000089chr71324 ------
NM_000092chr223899 257 --14530 --
NM_000093chr91625 --11948 --
NM_000104chr232408 2124 398 ------
NM_000109chrX2832 557 1661 ----
NM_000110chr111107 ------
NM_000125chr663703 3318 1364 694 353 121 --13006 --
NM_000129chr641471 1285 354 38 ------
NM_000138chr1552517 2411 1024 928 760 ------
NM_000141chr1031116 1049 495 ------
NM_000163chr521720 360 ------
NM_000167chrX1152 ------
NM_000168chr712426 12095 ----
NM_000189chr242237 1566 927 99 --11490 --
NM_000212chr1761863 1634 957 510 176 154 1476 1720 --
NM_000214chr2041538 291 134 44 ------
NM_000216chrX1242 --13887 --
NM_000217chr1251120 797 779 735 262 ------
NM_000222chr441941 1916 369 52 ------
NM_000232chr462537 2501 2262 2188 1292 136 1311 ----
NM_000234chr192145 22 ------
NM_000237chr831832 1697 1506 1579 1618 --
NM_000248chr322543 879 ------
NM_000252chrX21305 993 ------
NM_000258chr32229 79 ------
NM_000259chr1546019 5478 4606 1751 ------
NM_000266chrX122 --2930 925 --
NM_000271chr181531 ------
NM_000278chr1032220 1981 851 --21548 758 --
NM_000296chr163732 717 344 ------
NM_000314chr10--22293 853 ----
NM_000321chr1331437 1130 331 ------
NM_000330chrX42109 2053 1591 412 ------
NM_000332chr652845 2594 1881 1707 1161 1675 25328 4610 --
NM_000333chr31960 ----1256
NM_000334chr1741834 1568 1462 408 1226 2355 301 1826
NM_000337chr5105883 5798 5651 4824 4131 1660 1590 857 598 51 14001 --1806
NM_000338chr151274 ----11104
NM_000345chr42858 240 ------
NM_000368chr954430 4199 3619 1402 926 195 24045 1348 --
NM_000378chr112858 180 ------
NM_000386chr171662 ------
NM_000391chr112450 415 --127 --
NM_000393chr231698 150 136 ------
NM_000399chr101893 1283 1472 --
NM_000406chr422518 537 ------
NM_000408chr223237 2711 ------
NM_000429chr1071680 1576 1365 1285 1263 403 21 11381 21660 1396 --
NM_000430chr1733015 702 383 11293 ----
NM_000434chr6273 62 ------
NM_000439chr542534 1608 1558 720 ----11727
NM_000451chrX2735 401 1144 ----
NM_000461chr354069 3938 3252 521 445 ------
NM_000484chr212751 215 ------
NM_000489chrX23014 1078 ------
NM_000520chr151467 ------
NM_000533chrX2703 472 ------
NM_000555chrX86202 5483 5253 5149 5135 4863 4785 2477 22129 908 11606 --
NM_000599chr273976 3740 3528 3502 3389 3084 3060 --1425 --
NM_000609chr102525 70 ------
NM_000611chr11106473 6454 5402 4758 2709 2320 2301 1899 1755 735 181 15416 11532
NM_000612chr1163096 3054 2675 394 358 234 23233 3024 1546 23404 2797
NM_000615chr1142214 2026 1921 1143 --12411 --
NM_000626chr174441 176 107 42 ------
NM_000633chr1883415 1862 1357 1150 1075 1042 1009 449 ----1568
NM_000635chr1941432 1382 582 360 ------
NM_000681chr1041301 1118 554 528 ------
NM_000693chr1521780 1489 ------
NM_000721chr141650 729 348 291 --2631 518 --
NM_000726chr211019 ------
NM_000738chr114936 881 626 109 ------
NM_000756chr8------1334
NM_000767chr1921249 434 ------
NM_000793chr1464166 3607 1124 1068 1055 96 ------
NM_000794chr52243 65 ------
NM_000800chr51242 ------
NM_000801chr202988 716 ------
NM_000813chr534042 831 127 11361 ----
NM_000814chr151556 1883 --13602
NM_000817chr21269 ------
NM_000826chr422586 586 ------
NM_000827chr542432 2151 1788 907 --11677 --
NM_000831chr1116070 5777 5620 5013 4151 1445 1351 1153 1012 93 29 15662 15759 --
NM_000832chr92617 310 176 ----
NM_000838chr642743 2505 2427 2114 ------
NM_000839chr31489 ------
NM_000841chr61732 --1123 --
NM_000842chr112212 26 ------
NM_000859chr51528 --11140 --
NM_000865chr61202 ------
NM_000868chrX21811 79 --11625 --
NM_000875chr1575953 5262 5124 4470 4413 1914 926 --36117 4655 4424 16109
NM_000876chr611082 --11352 --
NM_000891chr1732522 1262 45 ------
NM_000895chr121106 ------
NM_000899chr1243690 3363 1632 418 1594 ----
NM_000901chr432171 1696 671 --12260 --
NM_000919chr51156 ------
NM_000921chr121442 ------
NM_000924chr1231266 963 451 ------
NM_000926chr1178038 7956 6675 3400 2497 2373 771 18134 17882 --
NM_000933chr2011193 --1452 --
NM_000944chr421776 968 --1817 --
NM_000945chr231725 375 266 ------
NM_000960chr191525 1622 1240 --
NM_000984chr172427 124 ------
NM_001001132chr211272 133 ----
NM_001001323chr1223030 2570 ------
NM_001001331chr332475 2430 498 --1466 --
NM_001001342chr1041412 1401 1154 1037 ------
NM_001001344chrX31822 943 519 --12444 --
NM_001001394chr21685 ------
NM_001001396chr153964 3900 3205 1253 795 12944 14167 --
NM_001001433chr2033027 1290 58 --22432 63 --
NM_001001436chr162563 172 ------
NM_001001481chr81842 --12522 --
NM_001001484chr1021664 622 ------
NM_001001523chr171237 1197 1191 959 440 168 148 --21084 37 --
NM_001001549chr732227 822 62 --22686 284 --
NM_001001550chr732227 822 62 --22686 284 --
NM_001001555chr732227 822 62 --22686 284 --
NM_001001557chr84870 704 331 68 ------
NM_001001560chr223732 214 116 ------
NM_001001664chr233451 2988 588 --12840 --
NM_001001924chr8150 --11375 --
NM_001001925chr8150 --11375 --
NM_001001931chr8150 --11375 --
NM_001002033chr172623 182 ------
NM_001002252chr124263 205 113 61 ------
NM_001002257chr233521 3244 2466 --1971 --
NM_001002264chr13195 ------
NM_001002265chr102276 127 ------
NM_001002266chr102276 127 ------
NM_001002295chr101869 1411 ----
NM_001002838chrX21820 1265 ------
NM_001002860chr1413055 --14716 --
NM_001002862chr2242246 2138 218 160 --11783 --
NM_001002876chr222422 164 ------
NM_001002909chr171424 --1137 --
NM_001002914chr1761040 963 800 419 366 299 --2448 443 1454
NM_001003406chr2293151 3008 2735 2690 2682 951 741 355 167 22313 2037 42670 2500 2161 921 --
NM_001003674chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_001003675chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_001003676chr112291 119 1138 2907 636 --
NM_001003679chr12627 274 ------
NM_001003681chr225638 546 313 243 86 ------
NM_001003694chr31105 ------
NM_001003712chr1242859 2747 1018 76 --149 --
NM_001003760chr621392 149 ------
NM_001003792chr331167 185 71 ----1198
NM_001003793chr331167 185 71 ----1198
NM_001003794chr3102984 2638 2587 1908 1209 1096 1090 1084 437 65 12175 280 31 --
NM_001003800chr943737 3529 932 478 --1712 --
NM_001003937chr221676 1450 --3472 413 327 --
NM_001003940chr1593801 3727 3074 3049 2937 2529 2483 1091 776 --33369 2949 2721 --
NM_001003942chr1593801 3727 3074 3049 2937 2529 2483 1091 776 --33369 2949 2721 --
NM_001003943chr1593805 3731 3078 3053 2941 2533 2487 1095 780 --33373 2953 2725 --
NM_001004065chr963414 3383 2734 2713 1401 1217 ------
NM_001004127chr131248 1408 ----
NM_001004128chr15606 500 477 257 47 ------
NM_001004196chr341120 950 210 38 ------
NM_001004304chr1231131 1098 600 ----22959 69
NM_001004308chrX21485 451 --1429 --
NM_001004317chr654144 4050 3210 3161 1560 --23109 821 --
NM_001004342chr1106019 5269 4889 4803 4520 3812 2433 2041 640 379 --11726 --
NM_001004439chr1541051 881 111 70 ------
NM_001004720chr21683 ------
NM_001004722chr21852 ------
NM_001005209chr24731 524 84 57 --1122 1164
NM_001005242chr122258 229 ------
NM_001005266chr151617 --1757 --
NM_001005267chr151617 --1757 --
NM_001005268chr151617 --1757 --
NM_001005269chr151617 --1757 --
NM_001005271chr173866 406 72 --11109 --
NM_001005273chr173866 406 72 --11109 --
NM_001005290chr12450 105 --1420 --
NM_001005375chrY21391 1368 ------
NM_001005386chr241870 1800 759 602 ------
NM_001005404chr1741096 636 339 219 21251 480 ----
NM_001005417chr13664 599 574 ------
NM_001005463chr1022288 1026 ------
NM_001005473chr525146 1756 11307 15042 --
NM_001005505chr321458 1359 --1144 --
NM_001005609chrX31273 1136 164 --23710 579 --
NM_001005611chrX2475 28 ------
NM_001005743chr1411280 --1412 --
NM_001005744chr1411280 --1412 --
NM_001005745chr1411280 --1412 --
NM_001005746chr211019 ------
NM_001005747chr211019 ------
NM_001005781chr2199 ------
NM_001005782chr21280 --1702 --
NM_001005845chr821833 30 ------
NM_001006115chr382672 2399 2364 2000 1845 1768 970 275 1553 ----
NM_001006600chr51477 ------
NM_001006610chr1611007 ------
NM_001006617chr91217 ------
NM_001006619chr91217 ------
NM_001006620chr91217 ------
NM_001006621chr91217 ------
NM_001006634chr162212 140 --1510 --
NM_001006636chr21666 --1293 --
NM_001006657chr232229 1167 975 ------
NM_001006665chr12801 578 ------
NM_001007023chr1464166 3607 1124 1068 1055 96 ------
NM_001007024chr1743729 3479 2761 736 13508 151 13279
NM_001007025chr1743729 3479 2761 736 13508 151 13279
NM_001007097chr964563 3684 3636 1387 992 91 1653 11012 --
NM_001007099chr1----1247 --
NM_001007100chr1----1247 --
NM_001007156chr1521775 1363 11214 ----
NM_001007226chr1711114 11150 1232 --
NM_001007227chr1711114 11150 1232 --
NM_001007228chr1711114 11150 1232 --
NM_001007229chr1711114 11150 1232 --
NM_001007230chr1711114 11150 1232 --
NM_001007257chr111438 ------
NM_001007271chr102762 396 ------
NM_001007466chr644517 4492 3255 1638 13164 1974 --
NM_001007538chr1341746 1475 631 115 ------
NM_001007553chr1--1994 ----
NM_001007559chr1821832 535 ------
NM_001007565chr32330 45 ------
NM_001007794chr11592 ------
NM_001008220chr543604 820 393 110 23615 1539 1442 --
NM_001008222chrX4949 337 265 121 ------
NM_001008239chr1843733 1294 927 869 ------
NM_001008388chr42407 57 ------
NM_001008495chr84914 744 238 229 ------
NM_001008529chr1721268 1067 --11303 --
NM_001008541chr1012119 1874 ----
NM_001008541chr1012119 1874 ----
NM_001008564chr1311875 ------
NM_001008660chr11------11387
NM_001008701chr1972972 2825 2572 2337 2151 838 808 1172 32380 2047 1045 --
NM_001008738chr532668 2016 168 --12504 --
NM_001008895chr1321458 1342 ------
NM_001009185chr52674 643 ------
NM_001009552chr8147 ------
NM_001009555chr421733 1418 ------
NM_001009566chr111179 1982 ----
NM_001009880chr22104732 4349 3315 3170 3136 1101 1039 1028 558 88 11592 --14277
NM_001009881chr1128 ------
NM_001009882chr1128 ------
NM_001009899chr3125254 4715 4590 4076 3960 2519 2189 2118 1623 1543 1250 892 15905 ----
NM_001009909chr1133950 3325 2594 1845 1254 --
NM_001009944chr163732 717 344 ------
NM_001009958chr71232 ------
NM_001009960chr742271 2101 891 877 ------
NM_001009993chr274065 3888 3774 2850 1559 675 190 13000 13708 13634
NM_001010852chr6------1154
NM_001010853chr652295 1175 1137 805 722 ------
NM_001010854chr14164 ------
NM_001010861chr121071 729 ------
NM_001010867chr1176358 5570 5467 5364 2333 2194 1742 1688 1449 1113 804 596 510 499 420 58 45 --21629 1478 --
NM_001010888chrX64025 3691 664 640 626 523 ------
NM_001010891chr586435 6015 5687 5111 4983 2714 661 422 ------
NM_001010926chr11101 --1539 --
NM_001010938chr34548 516 322 27 1261 ----
NM_001010942chr1211265 136 ----
NM_001010971chr11926 ------
NM_001010983chr3------1328
NM_001010986chrX41976 1952 1758 223 ------
NM_001011513chr433926 1096 166 ----13181
NM_001011545chr21----1208 --
NM_001011666chr762354 1554 1531 1031 121 22 ------
NM_001011708chr212456 --1340 11094
NM_001011713chr1411065 ------
NM_001012329chr192335 2270 2116 2108 1749 636 520 328 200 2724 395 ----
NM_001012393chr1153875 2039 1731 1392 253 ------
NM_001012420chr1522001 184 11135 ----
NM_001012423chr1522001 184 11135 ----
NM_001012426chr6113279 3220 3177 2904 2850 2535 1041 817 758 733 209 --1522 --
NM_001012427chr6113279 3220 3177 2904 2850 2535 1041 817 758 733 209 --1522 --
NM_001012755chrX43350 3322 1396 562 ------
NM_001012756chr1952894 2714 2676 2549 1133 12760 ----
NM_001012989chrX----1639 --
NM_001013031chr10--13444 2925 920 --
NM_001013399chr611109 ------
NM_001013415chr4----1128 --
NM_001013437chr181111 ------
NM_001013438chr3----1628 --
NM_001013620chr1268384 6003 5965 3039 1670 942 ----12104
NM_001013635chr121974 ------
NM_001013690chr1272358 2197 1873 1864 1590 542 134 --12489 --
NM_001013693chr132383 1136 923 --1342 --
NM_001013693chr132383 1136 923 --1342 --
NM_001014797chr1058026 7316 7061 2254 1036 17281 12776 --
NM_001014809chr41650 --1689 1811
NM_001014839chr13878 220 131 --1790 --
NM_001014841chr13878 220 131 --1790 --
NM_001014987chr162168 39 ------
NM_001014988chr162168 39 ------
NM_001014989chr162168 39 ------
NM_001015048chr1452690 2682 2599 2446 2029 22979 482 ----
NM_001015049chr1452690 2682 2599 2446 2029 22979 482 ----
NM_001015053chr172575 160 11324 21507 613 --
NM_001015877chrX23040 1036 --11206 --
NM_001015881chrX31119 356 275 ------
NM_001015887chr331550 1281 312 --11273 --
NM_001017371chr211223 ------
NM_001017395chr353182 2734 2543 1113 527 --12888 1320
NM_001017415chr11115 ------
NM_001017416chr11115 ------
NM_001017916chr1751676 1597 1432 632 388 --11945 --
NM_001017917chr1751676 1597 1432 632 388 --11945 --
NM_001017923chr142507 255 ------
NM_001017924chr10131 ------
NM_001017926chr821438 1426 11750 --11598
NM_001017989chr195963 851 804 65 21 --1785 --
NM_001017995chr5103764 1945 1919 1530 1332 1111 1021 620 463 45 23986 184 24013 379 --
NM_001018003chr83551 482 252 ------
NM_001018050chr2252900 2723 2538 1382 764 ------
NM_001018052chr2252900 2723 2538 1382 764 ------
NM_001018053chr12410 133 ------
NM_001018054chr131335 905 99 ------
NM_001018057chr111307 ----1130
NM_001018064chr942108 818 578 326 ------
NM_001018065chr955932 5757 4765 4655 305 1997 11492 --
NM_001018066chr955932 5757 4765 4655 305 1997 11492 --
NM_001018067chr145035 4275 3855 3474 ------
NM_001018068chr145035 4275 3855 3474 ------
NM_001018069chr145035 4275 3855 3474 ------
NM_001018090chr151826 ----2843 247
NM_001018091chr151936 ----2953 357
NM_001018102chr151826 ----2843 247
NM_001018111chr773843 3796 3585 2574 1614 1297 772 13919 11377 --
NM_001018115chr31634 ------
NM_001024024chr141175 ------
NM_001024070chr141171 ------
NM_001024218chr14--1267 ----
NM_001024226chr131061 350 307 ------
NM_001024227chr131061 350 307 ------
NM_001024228chr131061 350 307 ------
NM_001024380chr8--12042 ----
NM_001024381chr8--12042 ----
NM_001024401chr1642747 397 210 195 --12573 --
NM_001024455chrX42425 965 578 285 11053 ----
NM_001024649chr53777 725 333 --1795 --
NM_001024660chr321103 364 1159 ----
NM_001024680chr211331 ------
NM_001024688chr841444 703 578 119 ----11787
NM_001024847chr3----12228 --
NM_001024855chr31216 ------
NM_001024858chr1452645 1848 733 264 66 --32833 2825 2226 --
NM_001024934chr61191 ------
NM_001024935chr61191 ------
NM_001024936chr61191 ------
NM_001024948chr11619 1142 13532 --
NM_001024959chr32211 25 ------
NM_001024960chr32211 25 ------
NM_001025076chr1056225 5093 2242 1253 511 --1977 --
NM_001025077chr1077583 6451 2611 1869 830 564 500 --24866 2335 14979
NM_001025079chr352645 795 415 325 79 ------
NM_001025108chr252970 2938 2744 1487 35 11520 13008 --
NM_001025201chr21707 ------
NM_001025205chr31139 ------
NM_001025252chr823190 1239 ------
NM_001025253chr823190 1239 ------
NM_001025266chr394272 4039 3928 3699 3018 1795 1447 877 521 ------
NM_001025579chr17----135 --
NM_001025580chrX74244 4189 3348 3251 3163 677 73 ------
NM_001025595chr411479 ------
NM_001025780chr921160 1127 ------
NM_001029882chr1146 ------
NM_001029882chr1146 ------
NM_001029989chr152967 610 ------
NM_001030006chr171284 ------
NM_001030007chr1643584 2480 1597 1303 --21084 324 --
NM_001030055chr1443933 3623 1148 789 ------
NM_001031623chr62703 33 ----11305
NM_001031679chr1252308 1195 419 332 283 ------
NM_001031680chr13838 654 114 --11888 --
NM_001031684chr211263 --11324 1191
NM_001031690chr772871 2385 1959 674 590 278 196 --23076 2440 --
NM_001031695chr2255381 1614 1403 501 51 ------
NM_001031732chr463227 2811 2794 1295 1281 926 --1682 22236 1403
NM_001031740chr141366 496 352 51 ------
NM_001031804chr1663818 3459 1567 1430 827 70 12801 22691 1040 --
NM_001032282chr82897 38 ------
NM_001032283chr123998 870 32 ------
NM_001032284chr123998 870 32 ------
NM_001032288chr203638 439 363 11302 ----
NM_001032293chr171220 ------
NM_001032296chr1332379 2356 1151 --22448 892 --
NM_001032363chr171892 1752 1548 1499 265 244 203 ----1445
NM_001032363chr171892 1752 1548 1499 265 244 203 ----1445
NM_001032380chr1021976 1715 --1360 --
NM_001032393chrX1216 ------
NM_001033026chr193468 276 190 144 ----
NM_001033045chr221303 164 ------
NM_001033047chr422639 850 --1154 1498
NM_001033059chr621822 394 ------
NM_001033081chr161549 658 444 276 240 159 11831 ----
NM_001033082chr161549 658 444 276 240 159 11831 ----
NM_001033087chr2033127 968 525 1950 11024 1302
NM_001033112chr51789 ----1216
NM_001033117chr374672 3384 687 287 96 69 60 ------
NM_001033507chr151688 1566 1424 1248 70 --21346 1262 --
NM_001033518chr73422 193 45 ------
NM_001033519chr73422 193 45 ------
NM_001033520chr73422 193 45 ------
NM_001033557chr2----21180 24 --
NM_001033561chr171286 --128 --
NM_001033564chr611425 128 --1426
NM_001033566chr171278 ------
NM_001033568chr171278 ------
NM_001033667chr13772 572 285 --1217 --
NM_001033925chr10--11805 22082 1592 --
NM_001034954chr1032210 2057 790 --1865 --
NM_001034955chr1032210 2057 790 --1865 --
NM_001034956chr1032210 2057 790 --1865 --
NM_001034957chr1032210 2057 790 --1865 --
NM_001035254chr942231 2081 1043 428 2877 854 ----
NM_001035511chr131384 328 253 ------
NM_001035512chr131491 435 360 ------
NM_001035513chr131491 435 360 ------
NM_001035521chr23276 125 111 1266 ----
NM_001037164chr731426 601 194 ----2291 48
NM_001037317chr121071 729 ------
NM_001037324chr32747 256 ------
NM_001037332chr52669 157 --12203 --
NM_001037333chr52669 157 --12203 --
NM_001037339chr131417 1196 114 ----1265
NM_001037340chr131417 1196 114 ----1265
NM_001037341chr131417 1196 114 ----1265
NM_001037341chr131417 1196 114 ----1265
NM_001037533chr12608 303 ----1276
NM_001037558chr113644 602 219 ------
NM_001037582chr42419 52 ------
NM_001037954chr1132174 2138 391 ------
NM_001038640chr151251 --1722 --
NM_001038702chr522780 959 --32715 924 621 --
NM_001038707chr13873 417 148 1279 1334 --
NM_001038707chr13873 417 148 1279 1334 --
NM_001039140chr204481 335 123 82 ------
NM_001039199chr2074905 3444 3272 3070 1576 1251 1126 13091 1798 --
NM_001039457chr1194 ------
NM_001039479chr1422284 845 --1788 --
NM_001039538chr243258 2722 2685 213 --13290 --
NM_001039550chr25700 690 647 326 121 ------
NM_001039574chr11880 1174 ----
NM_001039577chr163939 3503 3251 1391 1264 981 13951 33364 3354 1440 --
NM_001039583chr222539 99 --2188 107 --
NM_001039584chr222539 99 --2188 107 --
NM_001039590chrX33571 2628 661 ----1214
NM_001039591chrX33571 2628 661 ----1214
NM_001039618chr1164364 4237 4033 3888 1647 562 14553 ----
NM_001039690chr1692339 2152 784 763 487 349 342 285 237 12075 31914 725 611 --
NM_001039711chr11365 --1847 --
NM_001039712chr11365 --1847 --
NM_001039840chrX55364 4801 4316 189 79 ------
NM_001039845chr21626 ----1697
NM_001039877chr193728 235 101 ------
NM_001039933chr174441 176 107 42 ------
NM_001039937chr1322634 1163 ----11200
NM_001040113chr16149 ------
NM_001040144chr1692339 2152 784 763 487 349 342 285 237 12075 31914 725 611 --
NM_001040146chr1692339 2152 784 763 487 349 342 285 237 12075 31914 725 611 --
NM_001040151chr1124479 4405 14180 --131
NM_001040152chr723886 1967 11838 14562 --
NM_001040157chr43936 898 630 1336 ----
NM_001040214chr64919 834 366 61 ------
NM_001040284chr1674671 4384 1620 1240 1059 1008 312 --24715 1362 14911
NM_001040402chr41397 ----1930
NM_001040409chr21743 ----1838
NM_001040429chr1312920 ------
NM_001040440chr51209 ------
NM_001040441chr114097 ----1229
NM_001040455chr1151292 1025 838 210 147 1451 1152 --
NM_001040624chr812560 1123 12297 --
NM_001040625chr812560 1123 12297 --
NM_001040626chr812560 1123 12297 --
NM_001040627chr812560 1123 12297 --
NM_001040628chr812560 1123 12297 --
NM_001040629chr812560 1123 12297 --
NM_001040630chr812560 1123 12297 --
NM_001040633chr71187 ------
NM_001040709chr151908 839 555 177 113 12323 ----
NM_001040712chr933333 2332 389 --13444 --
NM_001040715chr1641040 824 345 190 ----1480
NM_001042353chr203493 386 198 ------
NM_001042361chr1021492 585 --1202 --
NM_001042364chr1021492 585 --1202 --
NM_001042365chr1021492 585 --1202 --
NM_001042387chr1021492 585 --1202 --
NM_001042393chr1021492 585 --1202 --
NM_001042396chr1021492 585 --1202 --
NM_001042397chr1021492 585 --1202 --
NM_001042404chr121892 1375 ------
NM_001042413chr953086 2697 1262 676 493 12495 ----
NM_001042424chr461248 1202 1116 1092 825 725 ------
NM_001042483chr161100 ------
NM_001042486chr2041448 1283 1121 157 ------
NM_001042498chrX2119 93 ------
NM_001042537chrX----1506 12207
NM_001042550chr931621 666 612 ------
NM_001042552chr131129 585 161 ----1936
NM_001042555chr1254242 582 482 436 334 ----13449
NM_001042595chr192108 49 ------
NM_001042599chr232257 703 76 --17346 11371
NM_001042601chr32834 658 12218 ----
NM_001042603chr12114932 4783 4144 4020 1473 1297 1057 739 341 141 113 --14032 --
NM_001042604chr324398 325 ------
NM_001042632chr2051938 1893 1037 548 298 ------
NM_001042633chr2051938 1893 1037 548 298 ------
NM_001042681chr192202 2013 1824 968 742 730 523 405 289 ----11964
NM_001042682chr192202 2013 1824 968 742 730 523 405 289 ----11964
NM_001042682chr192202 2013 1824 968 742 730 523 405 289 ----11964
NM_001042683chr621148 150 ------
NM_001042749chrX1258 ------
NM_001042750chrX1258 ------
NM_001042751chrX1258 ------
NM_001043318chr1443175 2827 1461 1020 --1679 --
NM_001043351chr121609 449 --12106 --
NM_001044305chr6----1147 --
NM_001050chr1731227 101 73 ------
NM_001068chr3186 --1215 --
NM_001071775chr131168 --11963 --
NM_001077628chr12204 28 1219 ----
NM_001079874chr111910 --1194 --
NM_001083620chr422584 585 ------
NM_001092chr1732342 1732 526 --1586 --
NM_001095chr1261942 1741 1656 1487 1212 399 11694 11782 --
NM_001096chr172536 106 ------
NM_001106chr3149489 7637 6944 6783 6246 3787 3289 2813 2790 2106 1546 1387 1101 869 --13623 12693
NM_001117chr181972 1442 ----
NM_001128chr1643584 2480 1597 1303 --21084 324 --
NM_001144chr162130 62 199 ----
NM_001146chr811913 ------
NM_001148chr441938 1690 838 255 ------
NM_001163chr91990 ------
NM_001173chr1443933 3623 1148 789 ------
NM_001174chrX2456 283 ------
NM_001177chr1222291 2153 --1717 --
NM_001191chr202423 211 11326 31277 1143 1093 --
NM_001198chr632339 2036 975 --174 --
NM_001204chr237754 7068 285 ------
NM_001206chr942837 2282 1185 434 ------
NM_001219chr721952 1739 ------
NM_001222chr1041736 1408 625 388 174 1478 11723
NM_001241chr232218 1862 456 1890 1952 --
NM_001241chr232218 1862 456 1890 1952 --
NM_001256chr1732486 2177 2095 ------
NM_001257chr1611263 ------
NM_001258chr171365 ----1545
NM_001259chr755495 4622 1261 1047 52 1383 11577 --
NM_001271chr1552687 2584 965 716 237 --22851 2073 159
NM_001280chr193696 444 173 ------
NM_001282chr171284 ------
NM_001295chr321042 273 --1151 --
NM_001304chr172576 340 ------
NM_001313chr41650 --1689 1811
NM_001326chr111338 ------
NM_001329chr10192 ------
NM_001331chr1162152 2043 1060 962 920 314 --21086 773 --
NM_001343chr52208 49 ------
NM_001356chrX1969 1833 ----
NM_001357chr11278 ------
NM_001362chr14--11029 1259 --
NM_001364chr1111038 ------
NM_001365chr172616 219 --258 21 --
NM_001386chr82699 687 --12129 --
NM_001389chr211474 ------
NM_001390chr1863087 2843 2700 1011 991 658 --1649 --
NM_001391chr18----11115 --
NM_001396chr2152737 835 816 742 322 1806 ----
NM_001397chr162587 2567 2441 2356 1020 268 --11809 --
NM_001399chrX31273 1136 164 --23710 579 --
NM_001402chr611401 ----11998
NM_001406chr1741415 1403 481 429 --1672 --
NM_001407chr32575 537 --21588 1427 --
NM_001408chr121466 455 21254 1203 11245 --
NM_001419chr1954778 4578 3211 1840 1378 ------
NM_001420chr1933120 429 177 --1362 --
NM_001421chrX1197 --1423 --
NM_001427chr731723 623 433 --1465 --
NM_001430chr22638 155 ------
NM_001438chr122263 962 ------
NM_001440chr872771 2509 785 626 540 526 184 ----32272 2185 1005
NM_001451chr1611336 1231 ----
NM_001453chr621640 1443 --11124 --
NM_001460chr133320 604 166 ------
NM_001482chr152225 29 ------
NM_001493chrX1540 --1141 --
NM_001494chr103670 228 84 ------
NM_001497chr952576 2514 2338 656 137 ------
NM_001498chr6----2851 252 --
NM_001521chr23276 125 111 1266 ----
NM_001552chr17--1275 --11044
NM_001555chrX1107 ------
NM_001567chr111503 --1603 --
NM_001616chr212147 --1773 --
NM_001634chr621822 394 ------
NM_001642chr111429 ------
NM_001655chr1121958 1644 ------
NM_001658chr131061 350 307 ------
NM_001660chr33532 53 46 ------
NM_001661chr17142 --2760 613 --
NM_001663chr143437 219 152 ------
NM_001668chr121482 1398 --1361 --
NM_001670chr22145 1207 ----
NM_001678chr1751772 1366 1304 713 630 ------
NM_001682chr1222744 2284 ------
NM_001683chr332475 2430 498 --1466 --
NM_001684chr153681 3617 2922 970 512 12661 13884 --
NM_001694chr161112 --1310 --
NM_001695chr854269 3858 3088 936 211 --23171 144 --
NM_001699chr1931298 626 529 ------
NM_001709chr1152696 2644 2605 877 522 ------
NM_001730chr131223 ------
NM_001730chr131223 ------
NM_001731chr121732 ------
NM_001742chr71713 ------
NM_001743chr21220 ------
NM_001746chr53777 725 333 --1795 --
NM_001753chr711698 ------
NM_001773chr131225 622 583 ------
NM_001777chr352645 795 415 325 79 ------
NM_001792chr18------11017
NM_001800chr191128 ------
NM_001806chr1912904 12745 --137
NM_001822chr21707 ------
NM_001829chr41309 --1353 --
NM_001834chr52256 42 ------
NM_001839chr11641 --1625 --
NM_001845chr13--11182 1444 11035
NM_001858chr633294 894 368 ------
NM_001873chr4162 ------
NM_001893chr172401 65 ------
NM_001896chr16122 ------
NM_001901chr62918 263 ------
NM_001903chr51739 ------
NM_001915chr1751676 1597 1432 632 388 --11945 --
NM_001918chr1138576 8175 8135 7115 6636 6335 3673 3138 2068 1763 1100 877 405 --27198 3652 1267
NM_001920chr121742 ------
NM_001933chr1431270 1174 115 11199 ----
NM_001938chr111714 ------
NM_001949chr631049 453 366 --32959 379 331 --
NM_001955chr641024 703 215 190 ------
NM_001956chr12503 71 ------
NM_001964chr511142 ----1804
NM_001967chr32234 184 ------
NM_001969chr1453204 1586 1460 953 98 --22625 147 --
NM_001970chr171217 --2393 75 --
NM_001977chr42330 66 11307 ----
NM_001978chr82958 756 ------
NM_001991chr175810 324 252 203 50 --32229 1520 487 --
NM_001995chr431324 1285 63 ------
NM_001999chr511499 ------
NM_002006chr434150 2070 695 13869 13889 --
NM_002009chr1522539 853 ------
NM_002010chr131145 --1464 --
NM_002013chr142189 53 ------
NM_002014chr122642 133 ------
NM_002015chr1323056 2464 --23292 2438 --
NM_002018chr17126 ------
NM_002023chr121261 68 ----152
NM_002025chrX119103 8846 8678 7885 7515 7317 6963 6179 2757 878 371 16362 12949 22151 1061
NM_002035chr1832867 635 78 ------
NM_002040chr2152816 1950 846 636 365 ------
NM_002048chr9----187 --
NM_002051chr101869 1411 ----
NM_002063chrX1375 ------
NM_002069chr71361 ------
NM_002073chr2251185 496 451 351 129 --1517 11302
NM_002074chr121574 1513 ------
NM_002079chr101446 ------
NM_002085chr192156 75 --1147 --
NM_002086chr1731974 1586 610 ------
NM_002092chr474378 3925 3312 1077 833 737 265 --24583 4365 --
NM_002095chr8--172 ----
NM_002111chr443431 2553 2403 642 --31516 488 426 --
NM_002114chr61450 ------
NM_002126chr1743655 3458 2574 24 ----12863
NM_002130chr511651 11116 1208 --
NM_002131chr64438 420 404 223 ------
NM_002133chr224569 563 206 84 ------
NM_002137chr71292 ------
NM_002146chr1731005 909 132 180 --1159
NM_002147chr174882 743 666 144 --1671 --
NM_002149chr22113 40 --2753 732 --
NM_002163chr16--21196 454 21113 206 --
NM_002167chr12349 341 ----1195
NM_002187chr511084 ------
NM_002193chr23595 534 522 1144 21667 703 --
NM_002196chr202375 361 ------
NM_002196chr202375 361 ------
NM_002198chr54662 575 285 168 ------
NM_002199chr4141 ------
NM_002202chr51989 ------
NM_002207chr3150 ------
NM_002214chr715470 ------
NM_002224chr6----1572 1739
NM_002230chr171848 --1160 1250
NM_002232chr1----159 --
NM_002241chr152647 2397 930 271 33 1897 32812 456 137 --
NM_002242chr211504 ------
NM_002249chr11400 ------
NM_002253chr421052 177 ------
NM_002254chr232258 2136 313 11486 --11686
NM_002264chr333761 771 515 --14974 --
NM_002265chr171426 1130 ----
NM_002270chr545071 4406 4387 2188 --14966 --
NM_002271chr1342467 2159 953 670 --1697 --
NM_002285chr252970 2938 2744 1487 35 11520 13008 --
NM_002309chr2293033 2630 2120 1960 1202 863 683 651 66 1753 11207 --
NM_002336chr1214041 ------
NM_002356chr612696 ------
NM_002359chr1784242 4171 3530 2945 1621 1533 1452 273 34150 593 508 23621 1299 --
NM_002373chr1511218 1520 1851 --
NM_002374chr243258 2722 2685 213 --13290 --
NM_002375chr331911 1574 379 11692 11494 --
NM_002381chr21890 1838 ----
NM_002383chr161789 ------
NM_002384chr181294 1307 2731 136 --
NM_002387chr534115 3863 1878 --1310 --
NM_002397chr52743 647 ------
NM_002401chr1782472 2235 1791 1670 851 812 342 133 --1928 --
NM_002406chr52263 81 --1795 --
NM_002451chr923696 2505 --12668 12920
NM_002465chr121223 ------
NM_002480chr1231338 1282 468 ------
NM_002481chr1147849 7547 6383 6284 6191 5669 5575 5193 4979 3159 2998 1739 1601 673 15595 15210 --
NM_002485chr841444 703 578 119 ----11787
NM_002499chr1522443 2410 1684 1538 --
NM_002501chr1933916 1433 433 --11524 --
NM_002505chr621219 480 ------
NM_002509chr201602 --1639 --
NM_002518chr241126 869 375 100 ------
NM_002519chr1111452 ------
NM_002522chr1761206 984 866 782 769 399 22603 1224 --13493
NM_002537chr152846 391 --2993 341 --
NM_002541chr71359 ----11043
NM_002545chr1153875 2039 1731 1392 253 ------
NM_002547chrX73704 3404 1365 1336 653 226 27 --13189 --
NM_002553chr7----1164 --
NM_002570chr152910 279 ------
NM_002572chr112398 346 ------
NM_002576chr11----11158 1990
NM_002577chr353884 2783 2739 2701 819 11454 23688 100 --
NM_002581chr945226 725 128 92 1773 ----
NM_002586chr631085 1073 207 ------
NM_002588chr521760 479 ------
NM_002594chr2032269 1778 391 ------
NM_002595chr121383 ------
NM_002599chr1131053 1005 961 --157 1921
NM_002600chr131417 1196 114 ----1265
NM_002603chr81211 ------
NM_002609chr521368 169 1295 2597 67 173
NM_002613chr16145258 5111 3992 3687 2063 1888 1875 1838 1661 1404 1310 751 568 57 2992 935 24981 1395 --
NM_002618chr2----1164 --
NM_002641chrX1653 ------
NM_002643chr21202 ------
NM_002646chr162076 1641 1605 881 650 136 ------
NM_002651chr11616 --1228 --
NM_002655chr835332 5258 5011 ------
NM_002657chr2053787 3413 1141 933 767 --12698 --
NM_002658chr102641 176 ------
NM_002673chr34432 247 148 21 --142 --
NM_002677chr8127 ------
NM_002687chr1411069 ------
NM_002697chr1193 ------
NM_002698chr1962862 2736 2029 1103 183 127 22435 913 22515 58 --
NM_002699chr12544 66 ------
NM_002707chr21124 ------
NM_002709chr21832 ------
NM_002710chr121964 1886 ----
NM_002714chr62256 72 1806 1715 --
NM_002716chr1123191 2563 --23058 521 --
NM_002717chr81476 --1453 --
NM_002718chr341842 830 545 153 ------
NM_002719chr1432347 2336 2107 ------
NM_002721chr91538 ------
NM_002731chr112866 ----32923 1007 429
NM_002734chr1712142 --11966 --
NM_002736chr72517 511 ------
NM_002737chr1766113 4892 4407 4142 2014 1147 1120 ----
NM_002740chr332623 2420 2028 --1679 --
NM_002750chr102216 78 ------
NM_002751chr224909 119 47 41 --21043 68 --
NM_002755chr151213 ------
NM_002756chr171284 --1686 1856
NM_002760chrY55475 4955 4916 4425 1701 1287 25089 937 11129
NM_002763chr1--1443 ----
NM_002779chr103510 371 156 --1376 --
NM_002786chr111201 ------
NM_002806chr14143 ------
NM_002809chr17----1322 --
NM_002811chr161351 ----1548
NM_002819chr194429 324 294 276 --11356 --
NM_002821chr63518 297 146 1136 126 --
NM_002826chr17910 804 781 715 351 269 102 --1649 --
NM_002829chr941125 923 255 211 ------
NM_002839chr933333 2332 389 --13444 --
NM_002840chr141172 1148 1063 1013 ------
NM_002843chr1132501 2443 1132 --12128 13425
NM_002844chr621282 505 ------
NM_002849chr121709 ------
NM_002850chr1931163 784 77 ------
NM_002851chr71619 ------
NM_002854chr22123 ------
NM_002855chr1172812 1242 989 921 682 235 174 12777 --12969
NM_002857chr152699 1080 933 490 184 ------
NM_002859chr1261814 1564 1387 1307 565 383 11650 1302 --
NM_002865chr81101 ------
NM_002868chr1292283 2205 2146 2059 932 921 600 219 196 --11832 --
NM_002869chr1112144 --22158 342 188
NM_002874chr91432 ------
NM_002883chr223868 183 121 --2735 29 --
NM_002886chr343703 3309 1179 136 ------
NM_002888chr3140 ------
NM_002893chrX3359 114 107 ------
NM_002897chr22764 693 ------
NM_002902chr151147 ------
NM_002906chr111728 ------
NM_002907chr121420 ------
NM_002918chr193883 390 72 ------
NM_002923chr11637 ----1238
NM_002924chr11402 ------
NM_002938chr421380 1239 ------
NM_002941chr31630 11410 ----
NM_002942chr311336 --1356 --
NM_002945chr17--1624 ----
NM_002953chr12801 578 ------
NM_002956chr12128 1547 ----
NM_002968chr162236 60 ------
NM_002977chr222838 426 --13203 --
NM_002979chr1----1247 --
NM_002998chr821931 370 ------
NM_002999chr2061719 1712 1674 1577 395 230 --124 --
NM_003001chr131491 435 360 ------
NM_003010chr17--1426 --11629
NM_003011chr921190 582 ------
NM_003012chr832462 1136 132 --12451 --
NM_003013chr42329 31 ------
NM_003016chr1721334 163 ------
NM_003028chr993764 3428 2934 2744 2493 2454 1211 781 179 ----13245
NM_003031chr1611007 ------
NM_003034chr1267576 3202 1418 759 433 394 --1165 17019
NM_003039chr1154 --2211 31 --
NM_003045chr13135063 4851 4269 3838 3486 1708 1552 1343 1041 771 703 606 543 ------
NM_003069chrX1599 ------
NM_003070chr91694 ------
NM_003071chr3------1218
NM_003076chr124414 332 246 84 --1594 --
NM_003077chr173801 656 198 ----1696
NM_003081chr202185 85 ------
NM_003088chr731083 911 224 ------
NM_003098chr202212 155 ----151
NM_003101chr121023 409 --11626 --
NM_003106chr31710 ------
NM_003108chr265664 5438 2657 2427 1990 1947 --17172 --
NM_003110chr173448 221 96 ------
NM_003111chr211223 ------
NM_003112chr722176 117 ------
NM_003128chr211023 22257 998 ----
NM_003130chr7----21199 1032 --
NM_003131chr662036 1857 1796 1606 552 169 ------
NM_003139chr113798 665 127 ------
NM_003144chr641991 1759 596 255 160 ----
NM_003155chr83976 915 528 ------
NM_003156chr1131292 1267 126 --1197 --
NM_003157chr33635 206 57 ------
NM_003161chr1752892 2518 1285 1244 881 --13323 --
NM_003162chr21224 1290 ----
NM_003178chr311577 --12096 --
NM_003179chrX61261 1176 529 494 406 57 --21266 1070 11047
NM_003185chr2031102 238 186 ------
NM_003189chr163253 3114 2555 2541 564 168 --42069 977 422 311 12270
NM_003199chr1854014 3902 3813 1828 791 ------
NM_003200chr1992112 2031 1722 1582 960 591 462 219 204 --11905 11458
NM_003204chr1721200 692 ------
NM_003211chr1231749 1096 601 ------
NM_003215chr421115 63 1431 11439 --
NM_003216chr2293253 2724 2480 2457 1309 1293 838 610 597 --21053 164 12823
NM_003217chr1231478 1256 191 --1569 11632
NM_003221chr673881 3795 3441 2616 1254 693 92 ------
NM_003222chr201900 --21062 92 --
NM_003236chr242237 1360 765 744 12168 1117 --
NM_003242chr3----12228 --
NM_003246chr153777 651 104 173 ----
NM_003247chr6182 ------
NM_003253chr212584 573 1270 ----
NM_003255chr1762192 2165 2025 924 362 172 12153 1718 --
NM_003257chr152388 342 ------
NM_003262chr355090 4327 4171 3539 320 ----11438
NM_003275chr931479 1336 319 ------
NM_003288chr2041485 1278 1007 182 --11228 --
NM_003291chr131163 ------
NM_003295chr13149 ------
NM_003298chr3136213 5603 5304 5234 5037 4995 4960 4614 4566 3937 1171 1023 754 14582 ----
NM_003300chr14162 ------
NM_003304chr321270 201 --11302 --
NM_003320chr1173916 3565 1629 1423 1291 1192 489 11568 33746 1455 627 --
NM_003325chr221290 1181 ----
NM_003334chrX177 ------
NM_003336chrX21032 448 ------
NM_003339chr521391 647 ------
NM_003342chr1753085 2872 2864 2652 1141 ------
NM_003344chr71460 1236 ----
NM_003347chr2272086 2077 2041 756 731 476 162 --41558 1553 702 697 --
NM_003349chr203638 439 363 11302 ----
NM_003352chr21280 --1702 --
NM_003356chr1121017 170 ------
NM_003368chr11115 ------
NM_003370chr193488 158 48 ------
NM_003379chr611020 1209 1316 --
NM_003387chr221957 397 22152 851 ----
NM_003390chr1111075 ------
NM_003392chr323013 2746 ----1837
NM_003400chr21794 ------
NM_003404chr2021318 645 ------
NM_003406chr81289 --11708 --
NM_003409chr1811065 ------
NM_003410chrX4814 627 566 37 ------
NM_003411chrY21325 34 ------
NM_003412chr332453 456 225 ------
NM_003413chrX1341 ------
NM_003420chr32634 257 ------
NM_003432chr52491 484 ------
NM_003442chr111786 ------
NM_003453chr131692 ------
NM_003455chr1131584 1210 496 ------
NM_003457chr171220 ------
NM_003458chr352762 2641 1109 391 76 12453 --13323
NM_003463chr622497 81 1753 ----
NM_003468chr21382 ------
NM_003472chr621483 1150 ------
NM_003473chr10----1282 --
NM_003474chr104728 586 516 282 ------
NM_003478chr1123202 2336 ------
NM_003482chr1232197 1878 1855 ------
NM_003483chr1222152 95 11189 ----
NM_003485chr1431267 1030 65 137 1274 --
NM_003488chr174962 822 226 52 ------
NM_003489chr211842 ------
NM_003502chr161131 ------
NM_003507chr242008 798 652 87 --1385 --
NM_003558chr91501 ------
NM_003562chr172366 59 --1138 --
NM_003563chr1711114 11150 1232 --
NM_003564chr12558 228 1643 1635 --
NM_003576chr1332379 2356 1151 --22448 892 --
NM_003581chr21683 ------
NM_003583chr1253562 3479 3050 2861 2595 --23647 2578 --
NM_003589chr1321458 1342 ------
NM_003590chr213251 ------
NM_003607chr111370 194 14111 --
NM_003615chr323826 3658 ------
NM_003626chr1111122 ------
NM_003627chr11174 2440 45 ----
NM_003629chr1113452 3115 3084 3033 2796 2769 2520 2452 1392 1285 518 2306 175 12253 11000
NM_003633chr542195 2073 2026 545 12394 ----
NM_003637chr121493 1333 11461 --1460
NM_003644chr1765758 1901 1555 906 585 541 --15249 11294
NM_003656chr3143 ------
NM_003663chr312615 ------
NM_003670chr32405 399 --1367 --
NM_003671chr932890 481 344 12253 42884 2656 983 297 12902
NM_003677chr1232325 857 647 ----132
NM_003679chr123129 854 12444 12410 --
NM_003690chr22663 179 --1470 --
NM_003693chr173652 572 182 ------
NM_003705chr21780 ------
NM_003707chr3183 --2113 50 --
NM_003713chr12339 152 ------
NM_003716chr311028 ------
NM_003722chr332378 2264 187 --1467 --
NM_003725chr121405 ------
NM_003735chr521760 479 ------
NM_003736chr521760 479 ------
NM_003740chr681381 681 656 649 626 518 366 36 11763 ----
NM_003741chr3--142 1282 --
NM_003743chr231480 541 303 ------
NM_003744chr1411280 --1412 --
NM_003745chr162343 94 ------
NM_003749chr132431 302 ------
NM_003750chr101928 ------
NM_003760chr11728 ------
NM_003763chr2033027 1290 58 --22432 63 --
NM_003768chr111570 ------
NM_003774chr122540 246 ------
NM_003779chr11334 ------
NM_003780chr13664 599 574 ------
NM_003787chr18187 ------
NM_003795chr61496 ------
NM_003796chr191634 ------
NM_003800chr612084 --1555 1101
NM_003822chr132949 2511 851 ------
NM_003825chr1511023 ------
NM_003829chr91359 ------
NM_003860chr111371 ------
NM_003872chr2----22558 352 --
NM_003877chr121834 ------
NM_003884chr311233 ------
NM_003904chr111227 ----1133
NM_003913chr64490 458 349 338 11649 ----
NM_003924chr43309 236 114 ------
NM_003927chr18180 --1997 --
NM_003930chr722391 696 --12363 --
NM_003931chr61191 ------
NM_003932chr2221831 278 ------
NM_003934chr9----1373 --
NM_003948chr432045 981 688 ------
NM_003951chrX2279 111 ------
NM_003953chr162382 2339 2136 1156 472 381 ------
NM_003961chr16--1180 ----
NM_003966chr5107318 6112 4749 4743 2573 2174 1344 1102 50 21 --22901 792 --
NM_003969chr192302 120 --1233 --
NM_003980chr631322 342 234 --11336 --
NM_003981chr15131 1262 ----
NM_003982chr143246 115 44 ------
NM_003983chr1654160 1436 1427 339 27 1435 1998 --
NM_003987chr1032220 1981 851 --21548 758 --
NM_003988chr1032297 2058 928 --21625 835 --
NM_003989chr1032156 1917 787 --21484 694 --
NM_003990chr1032156 1917 787 --21484 694 --
NM_003994chr1243690 3363 1632 418 1594 ----
NM_004006chrX2832 557 1661 ----
NM_004007chrX2832 557 1661 ----
NM_004009chrX2832 557 1661 ----
NM_004010chrX2832 557 1661 ----
NM_004011chrX2832 557 1661 ----
NM_004012chrX2832 557 1661 ----
NM_004013chrX2832 557 1661 ----
NM_004014chrX2832 557 1661 ----
NM_004015chrX2832 557 1661 ----
NM_004016chrX2746 471 1575 ----
NM_004017chrX2832 557 1661 ----
NM_004018chrX2746 471 1575 ----
NM_004020chrX2832 557 1661 ----
NM_004021chrX2746 471 1575 ----
NM_004022chrX2746 471 1575 ----
NM_004023chrX2746 471 1575 ----
NM_004035chr1765058 4520 3314 1261 1045 448 --13997 --
NM_004037chr12308 80 ----1546
NM_004047chr1194 ------
NM_004050chr1432188 1109 737 --12193 --
NM_004068chr31139 ------
NM_004081chrY21391 1368 ------
NM_004086chr141673 ------
NM_004089chrX31119 356 275 ------
NM_004093chr1332856 1098 997 ------
NM_004094chr1431216 271 223 --11064 --
NM_004097chr25786 741 202 188 112 1136 ----
NM_004100chr621770 199 ------
NM_004112chr1721474 647 --21661 464 1655
NM_004114chrX1836 ----1463
NM_004124chr1412319 13416 ----
NM_004156chr8147 ------
NM_004157chr31854 ------
NM_004161chr211405 ------
NM_004171chr1179212 7485 6784 3068 2191 2155 1852 --18260 29357 2611
NM_004180chr21599 ------
NM_004183chr111726 ------
NM_004187chrX11129 ------
NM_004200chr1153284 2331 1157 591 441 182 ----
NM_004209chr162946 840 --1274 --
NM_004227chr732902 2389 1945 12546 ----
NM_004229chrX1380 ------
NM_004232chr1832598 2520 701 ------
NM_004235chr91203 ------
NM_004238chr21124 ------
NM_004240chr19197 ------
NM_004241chr101763 --1730 --
NM_004263chr271696 1535 1337 1320 1143 167 79 --11542 --
NM_004273chr1095043 5004 4462 4022 3626 3073 1044 262 41 21429 1421 34607 3814 1345 14628
NM_004290chr531179 1139 1057 ------
NM_004296chr1473947 3635 3097 2726 2580 813 27 --12602 12953
NM_004309chr172714 321 --2940 141 --
NM_004311chr1052864 2425 1960 1914 894 --12869 --
NM_004319chr142514 939 431 214 --169 --
NM_004321chr283361 2904 2648 2564 2508 2344 2332 1427 --23424 1210 12239
NM_004326chr13969 947 352 ------
NM_004331chr8------1203
NM_004337chr811739 --12083 178
NM_004338chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_004349chr811005 ------
NM_004350chr13838 654 114 --11888 --
NM_004364chr1961276 1233 1215 968 211 83 11111 1140 --
NM_004367chr641755 1749 1110 178 11136 ----
NM_004370chr611389 --1404 --
NM_004373chr122173 141 ------
NM_004379chr2----148 --
NM_004380chr1632182 1870 192 --12481 --
NM_004385chr51525 1704 ----
NM_004386chr1932256 2099 549 --1289 11559
NM_004392chr13--1300 ----
NM_004393chr32139 42 --22161 80 --
NM_004395chr51224 1163 ----
NM_004397chr1154164 3627 3180 2724 1164 ------
NM_004414chr2111275 --1377 --
NM_004416chr1221078 942 ------
NM_004419chr101144 ------
NM_004420chr1152172 2062 1800 906 275 --11848 --
NM_004423chr332104 805 650 1757 ----
NM_004427chr161092 1003 432 376 251 141 --1899 1864
NM_004429chrX41106 500 127 42 --21023 966 --
NM_004430chr841797 1719 693 107 --12812 --
NM_004431chr1158 ----1160
NM_004432chr912040 ------
NM_004437chr143184 3140 1182 732 22888 1201 ----
NM_004438chr283250 2582 2045 844 668 588 478 468 22589 683 ----
NM_004440chr621499 56 --11259 --
NM_004441chr331147 859 97 ------
NM_004442chr11311 ------
NM_004443chr32153 91 --1694 --
NM_004449chr2141359 1270 1047 303 ------
NM_004450chr14137 ------
NM_004451chr11185 ------
NM_004454chr3--12210 ----
NM_004458chrX1998 ------
NM_004474chr11814 --1994 --
NM_004481chr121094 755 ----1127
NM_004491chr19113715 3683 3426 3171 1424 1286 1253 871 362 189 62 11559 42858 2684 437 213 1864
NM_004494chr141192 436 427 309 11029 178 --
NM_004501chr143456 2707 2520 759 13744 ----
NM_004502chr171403 ------
NM_004503chr122631 238 ------
NM_004504chr222646 675 ------
NM_004505chr1721553 1323 ------
NM_004514chr1732346 2152 140 ------
NM_004516chr192863 116 ------
NM_004521chr10----1149 --
NM_004535chr2031444 687 182 --1414 --
NM_004537chr12141 ------
NM_004560chr95904 846 386 215 120 ------
NM_004566chr1051934 1776 896 805 634 11869 1641 --
NM_004575chr411660 --11500 --
NM_004577chr72497 435 ------
NM_004578chr11838 ------
NM_004580chr1521727 667 ------
NM_004586chrX54051 3806 3667 3644 1285 ------
NM_004588chr1143362 973 647 371 11490 33572 441 361 --
NM_004596chr191200 ------
NM_004598chr543088 2980 552 248 ------
NM_004612chr944665 2952 1518 290 13079 ----
NM_004621chr1111258 ------
NM_004622chr231918 1822 23 --22479 1890 --
NM_004626chr114283 174 132 73 ------
NM_004630chr11147 ------
NM_004631chr131335 905 99 ------
NM_004634chr31105 ------
NM_004635chr34918 392 308 28 11018 11011 --
NM_004637chr33425 417 250 ------
NM_004660chrY2925 408 ------
NM_004663chr1531352 332 203 153 ----
NM_004666chr61212 11528 ----
NM_004687chr1741950 1807 1349 235 ------
NM_004690chr61682 144 ----
NM_004709chrX11422 ------
NM_004713chr14------1621
NM_004714chr193324 141 125 ------
NM_004716chr114797 738 265 193 1596 ----
NM_004718chr22279 97 --1169 --
NM_004726chrX55422 4967 4800 2168 2081 ------
NM_004730chr51536 11833 --11507
NM_004734chr1312215 --12936 --
NM_004736chr1----12184 --
NM_004745chr896287 5905 5186 5012 4814 4621 2414 2208 1476 --25927 230 --
NM_004748chr152865 818 --12579 --
NM_004755chr142434 98 ------
NM_004762chr1741714 1611 712 581 --31767 586 25 --
NM_004763chr21851 6818 766 710 430 374 318 1927 --
NM_004765chr16145 ------
NM_004768chr11469 ------
NM_004772chr51258 ----11380
NM_004774chr1721249 126 22656 96 1929 --
NM_004776chr2052407 1178 847 402 231 ------
NM_004788chr1112231 --1202 --
NM_004796chr1451896 914 602 373 319 ------
NM_004801chr21548 ------
NM_004805chr241012 953 305 225 ------
NM_004807chr261999 1965 1655 856 515 290 22050 179 ----
NM_004808chr1052489 2333 2309 2295 1338 --12460 --
NM_004822chr17143210 2563 2548 2519 1565 1305 1281 1249 1134 1115 1083 703 601 311 11074 43104 2695 1310 1120 --
NM_004824chr621065 480 ------
NM_004827chr42782 249 ------
NM_004840chrX2273 92 --12028 1531
NM_004849chr62289 169 ----11624
NM_004850chr221522 1263 --11663 --
NM_004856chr15------1406
NM_004861chr22122 ------
NM_004863chr1495299 5016 3662 3516 3335 1189 980 613 56 --25245 926 --
NM_004866chr51637 14528 1464 --
NM_004869chr1831144 619 315 11634 ----
NM_004871chr1743729 3479 2761 736 13508 151 13279
NM_004873chr1452690 2682 2599 2446 2029 22979 482 ----
NM_004897chr101773 ------
NM_004904chr762354 1554 1531 1031 121 22 ------
NM_004905chr12282 129 ------
NM_004922chr101957 1942 1917 --
NM_004924chr192908 50 --2963 231 --
NM_004926chr1421678 728 ----1221
NM_004929chr821484 509 ------
NM_004943chr1941125 878 335 194 ------
NM_004947chr342049 617 204 107 163 11813 --
NM_004952chr13125 67 43 ------
NM_004953chr3----1157 --
NM_004956chr733651 3008 279 --1158 --
NM_004958chr12817 708 1208 ----
NM_004959chr931098 196 53 ------
NM_004962chr10--1275 --2305 235
NM_004965chr211707 ------
NM_004973chr631632 1584 472 ------
NM_004975chr202375 331 ------
NM_004976chr11115025 4527 4519 4282 4018 3999 1683 1406 1328 1266 208 --12076 --
NM_004978chr141543 473 435 391 --1150 --
NM_004979chrX4961 455 249 91 ------
NM_004992chrX117828 6760 6050 5692 5368 2786 2655 2232 1941 277 151 26385 3040 56055 1642 1452 819 540 35906 1042 701
NM_004992chrX117828 6760 6050 5692 5368 2786 2655 2232 1941 277 151 26385 3040 56055 1642 1452 819 540 35906 1042 701
NM_004993chr142956 409 ------
NM_004998chr153639 294 114 ------
NM_004999chr62955 808 ----1456
NM_005006chr22836 290 ------
NM_005020chr71157 1384 ----
NM_005023chr531274 552 145 ------
NM_005029chr10--1101 182 --
NM_005030chr161276 ------
NM_005032chrX183 ------
NM_005056chr12115176 5027 4388 4264 1717 1541 1301 983 585 385 357 --14276 --
NM_005060chr171237 1197 1191 959 440 168 148 --21084 37 --
NM_005066chr1----2815 140 --
NM_005067chr32851 148 --1193 --
NM_005072chr161159 1481 263 23 --
NM_005076chr154148 4049 3620 1308 828 --11433 2720 85
NM_005078chr1541458 727 564 182 ------
NM_005079chr823190 1239 ------
NM_005095chr12677 524 ------
NM_005096chrX5990 337 222 201 158 --11185 --
NM_005105chr131639 1545 1500 11922 ----
NM_005109chr352351 1806 969 889 69 --32147 1922 757 --
NM_005113chr14--1454 ----
NM_005116chr2094484 3865 3192 1324 1288 1276 729 594 338 23822 1527 21585 23 --
NM_005119chr1----1832 --
NM_005121chr172550 372 --13249 --
NM_005124chr62867 307 ------
NM_005137chr2262296 1677 888 813 493 28 21891 713 21638 184 --
NM_005154chr151575 ------
NM_005155chr63565 157 55 ------
NM_005156chr924550 1125 --14941 --
NM_005160chr2285501 4911 2642 2262 1899 1877 931 138 --15787 --
NM_005168chr221237 1220 ------
NM_005184chr1911375 1254 ----
NM_005187chr163709 437 82 12010 61911 1879 1847 1815 1783 97 --
NM_005190chr611109 ------
NM_005194chr202476 438 ------
NM_005197chr1411656 ----15485
NM_005202chr151473 671 278 118 30 ----1189
NM_005207chr2263546 1410 869 786 485 400 23197 2347 12755 --
NM_005219chr531434 1353 438 1213 1139 --
NM_005224chr192714 46 ------
NM_005233chr322550 352 ------
NM_005234chr194335 310 104 35 ------
NM_005235chr232257 703 76 --17346 11371
NM_005238chr1152838 2781 635 424 273 ------
NM_005239chr2151909 1609 1586 703 133 ------
NM_005241chr31942 ------
NM_005252chr142291 285 ----1594
NM_005259chr211124 ------
NM_005264chr101875 ------
NM_005273chr71294 ------
NM_005277chr411794 ------
NM_005279chr2133 ------
NM_005284chr61167 ------
NM_005308chr101184 ------
NM_005311chr732227 822 62 --22686 284 --
NM_005324chr171855 ----11990
NM_005329chr1611968 ----1164
NM_005336chr262209 2073 1622 684 298 178 1628 ----
NM_005349chr41587 ------
NM_005359chr1876468 6157 4835 4299 2374 2330 2292 25416 4892 --14240
NM_005374chr1742070 2027 1725 150 1867 ----
NM_005381chr21121 ------
NM_005386chr201740 ------
NM_005387chr11----1525 --
NM_005388chr941734 1439 533 85 ------
NM_005397chr773843 3796 3585 2574 1614 1297 772 13919 11377 --
NM_005398chr105916 198 171 60 24 1418 ----
NM_005402chr72385 183 ------
NM_005406chr1811329 ------
NM_005410chr51137 ------
NM_005417chr2061933 1905 1308 738 68 33 ----2567 180
NM_005425chr16----122 --
NM_005430chr121991 ------
NM_005433chr1821880 1101 ------
NM_005436chr1043008 2972 487 329 13739 ----
NM_005437chr10--196 --1451
NM_005438chr112513 206 1658 178 --
NM_005440chr1743100 2842 842 560 --1889 --
NM_005443chr42579 492 --1147 --
NM_005455chr11452 ------
NM_005458chr92117 62 22333 1574 ----
NM_005461chr2021285 352 ------
NM_005474chr172575 160 11324 21507 613 --
NM_005475chr1252855 1040 462 200 159 --21015 727 --
NM_005477chr1552413 2210 1945 810 730 ------
NM_005477chr1552413 2210 1945 810 730 ------
NM_005479chr1031241 1073 97 --11402 --
NM_005487chr225638 546 313 243 86 ------
NM_005493chr61606 ------
NM_005497chr1765481 4909 3765 2318 1833 461 --35779 4829 2466 13951
NM_005505chr123827 196 33 2300 47 1350 --
NM_005512chr1131930 680 105 1410 ----
NM_005517chr11575 ------
NM_005520chr51664 ------
NM_005523chr741446 1437 1378 293 --21550 150 --
NM_005529chr131032 1001 387 --1335 --
NM_005530chr1551327 1290 1138 176 126 11115 ----
NM_005537chr13----1199 --
NM_005539chr1031416 480 292 ------
NM_005550chr163575 482 225 124 145 --
NM_005561chr131852 --1935 --
NM_005563chr12337 213 ------
NM_005576chr151274 ------
NM_005577chr6--1172 ----
NM_005578chr31326 1401 13880 --
NM_005586chr61629 196 ----
NM_005587chr151214 ------
NM_005594chr12194 ------
NM_005595chr1----1741 --
NM_005596chr945552 5380 2299 2132 --12319 --
NM_005602chr311224 ------
NM_005603chr1831731 347 227 ------
NM_005604chr632048 844 798 --12346 --
NM_005610chr11888 1177 ----
NM_005627chr61622 ------
NM_005637chr1821832 535 ------
NM_005638chrX11725 ------
NM_005639chr1221892 719 ------
NM_005644chr11299 ------
NM_005647chrX73121 2607 2520 2403 1340 1140 627 11125 23256 2796 --
NM_005650chr2221250 982 ------
NM_005652chr161300 ------
NM_005655chr82897 38 ------
NM_005659chr222424 58 ------
NM_005662chr82364 69 ------
NM_005664chr153839 231 23 ------
NM_005668chr544106 3061 908 872 ------
NM_005688chr311012 --1137 --
NM_005715chr6125 ----22681 502
NM_005718chr32211 25 ------
NM_005722chr241870 1800 759 602 ------
NM_005724chr155608 135 77 64 30 ------
NM_005730chr1283383 2625 2416 1454 1094 850 816 418 --22265 926 --
NM_005735chr22284 72 ------
NM_005736chr102277 206 11294 --1200
NM_005737chr242735 2093 1984 1868 --1683 --
NM_005738chr731426 601 194 ----2291 48
NM_005746chr72736 524 ------
NM_005748chr1233064 996 204 13167 ----
NM_005759chr244560 3756 1385 525 --13339 --
NM_005775chr83551 482 252 ------
NM_005779chr563279 2965 2564 2370 885 183 ------
NM_005780chr13150 ------
NM_005781chr34548 516 322 27 1261 ----
NM_005786chr18163 ----169
NM_005795chr21572 --11897 --
NM_005814chr141323 946 246 62 --2503 162 11068
NM_005822chr632053 742 438 ------
NM_005826chr13568 207 79 ------
NM_005828chr1744872 4290 3455 756 11580 13920 --
NM_005840chrX107293 7156 6814 6408 5973 5008 2707 1622 1431 1220 ----12805
NM_005852chr173866 406 72 --11109 --
NM_005859chr5--11128 ----
NM_005868chr72686 168 --145 --
NM_005871chr101126 ------
NM_005876chr24696 689 173 93 ------
NM_005880chr1621422 116 ------
NM_005896chr2----2745 659 1665
NM_005897chr121205 155 --11101 11012
NM_005898chr11------1325
NM_005902chr1584160 3278 2990 1264 1249 857 259 33 ------
NM_005905chr131342 --157 --
NM_005909chr554056 1309 1216 1150 515 ------
NM_005911chr221278 179 ------
NM_005920chr152864 2767 2712 1041 970 22575 475 22928 1083 --
NM_005933chr1122278 493 1334 ----
NM_005935chr474902 4416 3527 1805 987 770 285 13618 11740 1582
NM_005938chrX51364 1183 951 346 122 1500 ----
NM_005941chr853652 2569 1504 901 100 ------
NM_005944chr341120 950 210 38 ------
NM_005955chr173969 2195 2138 2056 854 791 637 --34556 3772 879 11450
NM_005962chr1012119 1874 ----
NM_005962chr1012119 1874 ----
NM_005966chr21361 ------
NM_005967chr123751 615 180 ------
NM_005999chr1195 11003 ----
NM_006007chr933861 3690 1753 --1686 --
NM_006011chr1524010 693 --1347 --
NM_006015chr121266 351 ------
NM_006016chr611680 ------
NM_006030chr321458 1359 --1144 --
NM_006033chr184768 582 463 140 ----12215
NM_006035chr1431023 499 43 ------
NM_006037chr224144 555 14549 21835 1292 33448 824 637
NM_006038chr204646 558 444 100 --1452 --
NM_006039chr1731138 333 95 1235 ----
NM_006047chr2022943 947 --13452 --
NM_006048chr12968 321 ------
NM_006070chr32330 45 ------
NM_006079chr61261 ------
NM_006089chrX21815 1445 ------
NM_006090chr11592 ------
NM_006091chr1521768 1133 11127 ----
NM_006095chr424451 712 ------
NM_006099chr14764 651 209 139 ------
NM_006106chr1122666 1234 ----1454
NM_006113chr111910 --1194 --
NM_006116chr2291589 1538 1389 1321 647 593 293 231 33 21341 1029 11356 --
NM_006133chr11122283 2267 2144 2067 2050 1923 1580 758 731 634 565 542 22189 1636 31676 989 506 --
NM_006141chr1652800 2446 1817 1723 904 --1150 11095
NM_006145chr191250 ------
NM_006148chr1742882 2439 1150 879 --42909 2856 1823 287 --
NM_006158chr841632 1499 731 207 --1216 --
NM_006160chr1721390 504 11420 1170 --
NM_006178chr1741414 1257 421 58 ------
NM_006180chr942108 818 578 326 ------
NM_006191chr122850 185 ------
NM_006194chr1411125 --11214 --
NM_006201chrX----3232 186 166 --
NM_006203chr545299 4790 4231 3838 ------
NM_006206chr412434 12511 12566 --
NM_006216chr2----1644 --
NM_006224chr1732319 2118 701 --12072 11888
NM_006243chr11867 ------
NM_006244chr115582 401 177 114 100 ------
NM_006245chr611007 ------
NM_006251chr532116 708 556 ------
NM_006267chr221814 1465 --11732 --
NM_006272chr217731 618 502 495 209 181 69 ------
NM_006275chr2031893 440 79 ------
NM_006282chr2054553 3995 1729 723 626 11473 162 --
NM_006283chr833920 1263 446 --24307 4297 24363 1777
NM_006287chr221629 194 ----12450
NM_006292chr111159 ------
NM_006296chr21110 ------
NM_006306chrX64451 4196 4026 2205 207 169 25490 1171 15103 --
NM_006310chr1741235 968 912 507 ------
NM_006313chr1211533 ------
NM_006321chr341373 786 658 212 --22033 576 --
NM_006336chr961494 1327 1251 1223 1180 395 ------
NM_006352chr121760 293 ------
NM_006353chr62402 97 21124 560 ----
NM_006359chrX----1506 12207
NM_006366chr621273 111 --1970 --
NM_006367chr121051 849 ------
NM_006371chr3124992 3800 3423 1946 1669 1663 1495 915 833 742 462 424 14661 1652 21798 846
NM_006375chrX31575 1218 562 ------
NM_006380chr1723799 2734 ------
NM_006383chr153229 171 68 ------
NM_006386chr2242330 2288 2128 552 ----12050
NM_006393chr1034539 4390 533 11536 ----
NM_006401chr91388 ------
NM_006407chr311381 ------
NM_006415chr921143 23 ----181
NM_006421chr81199 1947 ----
NM_006430chr21112 --1415 --
NM_006434chr1032210 2057 790 --1865 --
NM_006454chr492994 2778 2745 2592 1929 756 498 269 168 --126 --
NM_006457chr433926 1096 166 ----13181
NM_006458chr11165 --125 --
NM_006459chr1031455 692 184 11355 1597 --
NM_006460chr1721800 130 ------
NM_006469chr12638 196 ------
NM_006480chr51460 ------
NM_006482chr1253562 3479 3050 2861 2595 --23647 2578 --
NM_006483chr193324 141 125 ------
NM_006484chr193324 141 125 ------
NM_006517chrX31717 515 255 ------
NM_006520chrX11576 ------
NM_006534chr201638 --22192 1142 12990
NM_006538chr254083 1162 1129 996 623 ------
NM_006540chr821093 132 11027 ----
NM_006544chr1455355 4089 2204 1112 1046 ------
NM_006546chr17105254 5210 5145 5053 5014 4421 4295 4162 2138 1894 22526 77 35895 5259 4036 --
NM_006547chr731804 1463 349 ------
NM_006548chr311513 --1437 --
NM_006555chr751693 1486 617 543 263 --1673 11841
NM_006559chr12386 173 ------
NM_006561chr1056225 5093 2242 1253 511 --1977 --
NM_006565chr162355 91 ------
NM_006566chr183370 364 323 ------
NM_006570chr91392 ------
NM_006572chr1722277 233 ----1639
NM_006578chr1531595 1485 1462 --21478 463 --
NM_006587chr431718 338 51 ------
NM_006599chr1688100 7715 7321 5160 2432 1488 917 419 --12880 --
NM_006601chr1221000 909 ------
NM_006602chr201697 ------
NM_006603chrX1258 ------
NM_006609chr2----12405 --
NM_006618chr111405 ------
NM_006624chr1011826 --11925 --
NM_006625chr11732 --1341 1100
NM_006625chr11732 --1341 1100
NM_006625chr11732 --1341 1100
NM_006628chr1594393 3943 3648 3132 1678 1566 967 517 314 --23417 2916 --
NM_006634chr2153 ------
NM_006636chr21743 ----1838
NM_006640chr1721838 276 11414 11698 --
NM_006650chr543604 820 393 110 23615 1539 1442 --
NM_006651chr42510 419 --11123 --
NM_006654chr1254242 582 482 436 334 ----13449
NM_006670chr6172 ------
NM_006675chr1283384 3240 3200 2866 2424 2292 789 442 12631 ----
NM_006677chr33223 215 33 ------
NM_006690chr2031977 1525 147 31934 653 64 133 --
NM_006693chr72817 310 ------
NM_006696chr5166 ------
NM_006698chr201210 --1132 1984
NM_006699chr11370 --1968 --
NM_006705chr9------125
NM_006706chr5------1341
NM_006713chr52261 67 --1682 --
NM_006717chr922162 1157 ------
NM_006722chr322543 879 ------
NM_006729chrX44706 4199 3694 1876 --11495 11074
NM_006734chr621410 213 --11057 --
NM_006736chr251710 1700 1657 1336 368 148 ----
NM_006738chr1594583 4315 3854 2972 1579 1534 1430 1220 275 34219 681 350 ----
NM_006742chr1681852 1769 1544 1290 695 381 306 174 11421 21927 242 --
NM_006743chrX1728 ------
NM_006749chr81882 --141 --
NM_006761chr171113 ------
NM_006763chr141997 1910 632 199 ------
NM_006764chr32456 77 ------
NM_006769chr11490 ------
NM_006777chrX52798 1166 821 689 625 ----12914
NM_006788chr1842095 1938 616 297 --31997 1992 772 --
NM_006791chr15----1526 --
NM_006802chr151123 915 836 427 115 ------
NM_006807chr1711096 1502 --195
NM_006809chr203783 316 136 ------
NM_006816chr52250 22 ------
NM_006823chr811280 --1220 --
NM_006826chr221032 183 ------
NM_006827chr1422698 69 --13230 --
NM_006832chr141788 ------
NM_006836chr12--1454 1430 --
NM_006851chr1222825 52 ------
NM_006852chr1762608 2588 2580 1845 992 703 ------
NM_006854chr741815 1638 1579 1418 ------
NM_006861chr1271887 1785 1601 733 620 553 336 ------
NM_006874chr421137 819 ------
NM_006876chr112574 181 164 ----
NM_006885chr1611336 --2464 276 --
NM_006892chr201290 ------
NM_006892chr201290 ------
NM_006898chr2------1594
NM_006906chr112228 86 1244 --1142
NM_006908chr711315 ------
NM_006914chr91539 ------
NM_006915chrX22278 1924 ------
NM_006922chr222026 590 ------
NM_006924chr1713435 13958 ----
NM_006927chr1632230 260 153 ------
NM_006940chr1221729 170 --1386 --
NM_006941chr222314 80 1415 ----
NM_006946chr112547 108 ------
NM_006950chrX2770 720 ------
NM_006955chr1031218 181 77 ------
NM_006959chr192350 327 ------
NM_006981chr912026 --12031 --
NM_006991chr32872 147 ------
NM_006999chr561852 1787 1588 1445 1414 758 --11950 --
NM_007010chr173729 647 234 11596 ----
NM_007039chr1432182 1492 247 ------
NM_007052chrX2557 65 ------
NM_007054chr532935 2859 2428 12509 --22949 2634
NM_007064chr321103 364 1159 ----
NM_007067chr1721290 1166 ------
NM_007074chr161100 ------
NM_007078chr1052942 2009 1123 964 845 --1972 --
NM_007084chr1351408 1248 959 354 201 1487 ----
NM_007097chr52256 42 ------
NM_007111chr132726 90 ------
NM_007118chr52862 617 ------
NM_007137chrX95042 4662 4489 4262 3980 3617 1986 1659 1258 24638 1267 ----
NM_007144chr1721302 1221 ------
NM_007158chr1--1994 ----
NM_007159chr31277 ----11318
NM_007166chr11------11387
NM_007170chr13712 354 241 ------
NM_007173chr111167 ------
NM_007185chr151021 730 394 355 239 ------
NM_007191chr12------2625 109
NM_007197chr122752 341 ------
NM_007200chr1594583 4315 3854 2972 1579 1534 1430 1220 275 34219 681 350 ----
NM_007203chr963414 3383 2734 2713 1401 1217 ------
NM_007207chr11666 ------
NM_007216chr111357 ------
NM_007218chr81185 ------
NM_007219chr202921 861 ------
NM_007222chr821438 1426 11750 --11598
NM_007235chr12188 ------
NM_007236chr1571938 1896 1688 957 801 739 576 ------
NM_007245chr162297 105 ------
NM_007246chr41910 ------
NM_007249chr1376614 2770 2738 2240 2021 732 209 18714 16896 23211 161
NM_007271chr61565 ------
NM_007275chr32802 72 --21136 320 --
NM_007278chr171136 ------
NM_007280chr15191 ----1339
NM_007283chr3102984 2638 2587 1908 1209 1096 1090 1084 437 65 12175 280 31 --
NM_007292chr1765058 4520 3314 1261 1045 448 --13997 --
NM_007294chr172336 60 --1361 --
NM_007295chr172336 60 --1361 --
NM_007296chr172336 60 --1361 --
NM_007297chr172336 60 --1361 --
NM_007298chr172336 60 --1361 --
NM_007299chr172336 60 --1361 --
NM_007300chr172336 60 --1361 --
NM_007302chr172336 60 --1361 --
NM_007303chr172336 60 --1361 --
NM_007304chr172336 60 --1361 --
NM_007305chr172336 60 --1361 --
NM_007308chr41240 ------
NM_007331chr452457 1956 1704 1099 487 ------
NM_007347chr1552442 1960 989 879 429 12800 ----
NM_007358chr1177 ------
NM_007363chrX1256 1934 ----
NM_007365chr11550 ------
NM_007373chr1031795 1370 1174 ------
NM_007375chr122650 920 11975 11751 --
NM_012095chr1043347 2667 2232 339 ------
NM_012098chr921293 550 ------
NM_012099chr1931256 902 227 --1124 --
NM_012102chr192202 2013 1824 968 742 730 523 405 289 ----11964
NM_012104chr1143356 2669 2578 2488 12974 13613 --
NM_012104chr1143356 2669 2578 2488 12974 13613 --
NM_012134chr131396 321 139 11519 1557 --
NM_012141chr1322634 1163 ----11200
NM_012154chr81799 1600 ----
NM_012156chr2032656 1375 1303 --22249 1308 23247 2294
NM_012193chr1165189 4139 3287 1964 1550 1182 25056 3519 24220 1316 --
NM_012199chr1124681 4008 3644 3513 3316 2995 2948 1770 1760 1143 1109 1051 1425 ----
NM_012207chr1021023 45 ------
NM_012215chr1021840 1782 11617 11806 --
NM_012218chr1952907 2220 933 796 552 12988 12309 12143
NM_012224chr4153 ------
NM_012232chr1752172 1485 764 757 714 22140 1741 --12130
NM_012238chr101686 ------
NM_012249chr233592 3520 328 --11375 --
NM_012250chr11----11053 --
NM_012257chr71940 1268 ----
NM_012262chr134006 3731 1994 --14641 15067
NM_012281chr711870 ------
NM_012285chr175442 429 329 77 23 --1111 --
NM_012287chr324103 1447 13697 1118 --
NM_012288chr674732 4490 3778 636 448 269 169 ------
NM_012296chr1193908 3473 2926 2890 1197 908 790 749 573 1177 11450 --
NM_012297chr442478 2464 711 78 ------
NM_012300chr542511 2098 1774 352 ------
NM_012302chr12837 370 ----166
NM_012306chr1283566 3500 3239 2544 2310 725 570 398 1618 12826 --
NM_012307chr182817 325 --1701 --
NM_012308chr1141841 1716 1009 477 ------
NM_012309chr1164027 3912 1748 1627 458 289 1560 1510 --
NM_012316chr164299 2107 1436 1427 1206 1080 11298 55364 4520 4407 2245 1751 11393
NM_012324chr223746 131 80 ------
NM_012325chr2031614 1555 573 ------
NM_012329chr1721403 1287 ------
NM_012347chr642414 1939 802 559 ----12620
NM_012382chr563957 3603 3502 3338 771 229 ------
NM_012385chr161100 ------
NM_012392chr1148 1212 1473 --
NM_012402chr112491 173 1132 1106 --
NM_012407chr222539 99 --2188 107 --
NM_012419chr61136 ------
NM_012425chr102280 25 ------
NM_012428chr15--1218 ----
NM_012437chr11357 ----1477
NM_012448chr1742038 1954 941 643 --11628 --
NM_012453chr741400 574 316 47 11103 ----
NM_012478chr17173 1112 ----
NM_013230chrY--21453 1115 --1296
NM_013233chr21348 ------
NM_013240chr2143666 2521 1354 1302 11198 34102 3931 1030 --
NM_013245chr162707 96 ------
NM_013253chr111307 ----1130
NM_013261chr412428 ------
NM_013267chr121418 ------
NM_013279chr1132290 945 624 1742 1530 --
NM_013281chr2011397 ------
NM_013304chr16----150 --
NM_013309chr1512175 ------
NM_013316chr71692 ------
NM_013323chr172463 415 ----11217
NM_013336chr361758 1616 1359 1299 596 503 ------
NM_013341chr212456 --1340 11094
NM_013357chr81803 ------
NM_013365chr223732 214 116 ------
NM_013368chr192589 112 --150 --
NM_013372chr1533321 2523 85 --1314 --
NM_013381chr1232157 1950 893 ------
NM_013382chr1421840 620 --1849 --
NM_013388chr23534 156 64 --1446 --
NM_013401chr113819 184 86 --1378 --
NM_013403chr193728 235 101 ------
NM_013411chr121978 1121 ------
NM_013433chr1931966 1908 1415 ------
NM_013446chr731209 540 140 --129 --
NM_013449chr1212766 ------
NM_013943chr112740 ------
NM_013952chr232591 2127 851 ------
NM_013953chr232591 2127 851 ------
NM_013989chr1464166 3607 1124 1068 1055 96 ------
NM_013992chr232591 2127 851 ------
NM_014001chr1721039 295 ------
NM_014010chr93593 572 77 ------
NM_014011chr212487 ------
NM_014016chr33571 178 25 --130 --
NM_014021chr113185 ----1109
NM_014038chr72421 86 ------
NM_014042chr112254 21 1203 ----
NM_014089chr1311875 ------
NM_014106chr155783 575 390 88 29 ------
NM_014112chr81583 --14008 --
NM_014117chr1632142 444 187 ------
NM_014153chr162621 170 ------
NM_014154chr321477 365 ------
NM_014155chr11117437 6959 6670 6647 6197 2442 1501 1464 1028 324 288 --11808 1672
NM_014181chr222336 854 --21920 59 --
NM_014182chr121629 ------
NM_014191chr12----11047 --
NM_014213chr22224 164 ------
NM_014216chr1491653 1487 1436 1050 610 501 439 353 285 ------
NM_014225chr19127 ----1113
NM_014231chr1231869 1532 648 1490 ----
NM_014232chr1721177 395 --1188 --
NM_014232chr1721177 395 --1188 --
NM_014233chr1772125 1696 1508 839 727 428 104 ------
NM_014238chr171323 --31424 456 197 --
NM_014240chr332971 1266 1217 --13476 --
NM_014250chr225638 546 313 243 86 ------
NM_014255chr12------128
NM_014275chr54767 255 136 126 --1595 --
NM_014283chr11487 11407 ----
NM_014284chr13878 220 131 --1790 --
NM_014286chr9102967 2589 2582 2555 2412 2357 2332 1280 1132 423 --1801 --
NM_014292chr2251729 1702 1465 1337 27 1488 ----
NM_014299chr1951844 1685 1387 727 137 --11517 --
NM_014309chr2255371 1604 1393 491 41 ------
NM_014319chr1231277 570 59 ------
NM_014323chr221170 ------
NM_014331chr477150 6809 6567 5182 2589 2386 1359 ----15675
NM_014333chr1132312 889 134 --11137 --
NM_014338chr225921 841 408 331 98 ------
NM_014345chr63793 342 41 --11030 --
NM_014368chr941775 617 383 154 ------
NM_014372chr121433 1296 ------
NM_014376chr52669 157 --12203 --
NM_014382chr321088 214 ------
NM_014393chr832305 278 95 ------
NM_014399chr72265 203 ------
NM_014405chr1761672 606 563 298 147 124 --22245 656 --
NM_014415chr321406 389 ------
NM_014423chr544291 3828 1854 1508 11731 ----
NM_014426chr20----1617 --
NM_014447chr411478 ------
NM_014456chr101536 ------
NM_014469chr112848 289 ------
NM_014470chr123311 301 128 ------
NM_014482chr21100 ------
NM_014491chr71285 ------
NM_014494chr1622042 1546 ------
NM_014496chrX155 ------
NM_014498chr31331 ------
NM_014502chr111384 ----2151 139
NM_014504chr72830 221 ------
NM_014505chr12----1361 --
NM_014507chr2251137 893 793 336 203 ------
NM_014515chr121136 1234 ----
NM_014517chr331297 693 390 1611 ----
NM_014554chr12----1878 --
NM_014572chr131571 ------
NM_014574chr142989 53 --1230 --
NM_014577chr22----2707 667 --
NM_014604chr174554 226 134 80 --2170 139 --
NM_014608chr151403 ------
NM_014614chr21479 ------
NM_014630chr1532931 1178 227 23777 320 ----
NM_014636chr963533 797 750 142 136 56 1862 33542 1629 825 --
NM_014646chr1872817 999 392 231 217 177 30 ------
NM_014647chr1641894 762 630 564 ------
NM_014663chr11317 --1448 --
NM_014665chr843622 1111 415 347 ------
NM_014666chr51413 ------
NM_014667chr322229 287 --12392 --
NM_014671chr721406 321 1409 1619 --
NM_014680chr17----1142 --
NM_014682chr8--11591 ----
NM_014686chr1952586 2334 248 237 180 1373 ----
NM_014690chr772871 2385 1959 674 590 278 196 --23076 2440 --
NM_014693chr32747 256 ------
NM_014702chr633271 1250 756 ------
NM_014709chr21253 --1487 --
NM_014723chr2052791 2192 2075 1305 794 42900 2186 360 35 --22244 498
NM_014729chr821645 643 ----1387
NM_014730chr1265186 4974 4927 3759 3457 1068 1423 34938 4319 4303 --
NM_014730chr1265186 4974 4927 3759 3457 1068 1423 34938 4319 4303 --
NM_014731chr2051511 1312 1186 431 352 --2616 539 --
NM_014736chr152992 635 ------
NM_014737chr2043509 1663 1637 929 --1937 --
NM_014739chr653776 2577 1129 754 665 12631 ----
NM_014743chr422161 508 --12593 1460
NM_014748chr22357 313 --1368 --
NM_014757chr551975 928 680 157 140 --199 --
NM_014762chr172193 2088 1800 1710 805 685 151 --22597 1625 --
NM_014764chr122390 301 ------
NM_014765chr132716 1917 300 --12403 --
NM_014766chr763489 2407 2397 752 488 110 ------
NM_014767chr1052751 2685 2593 2292 798 --22983 519 --
NM_014771chr1631073 788 244 1258 ----
NM_014774chr122346 1211 --22995 2944 --
NM_014781chr82302 155 ------
NM_014784chr1--1891 2283 168 156
NM_014786chr112298 187 ------
NM_014787chr142805 2534 2214 445 --21064 901 --
NM_014803chr1022559 916 ------
NM_014806chr9123 --183 --
NM_014807chr111729 --1828 --
NM_014810chr143048 2997 2478 397 --1863 --
NM_014812chr121892 1375 ------
NM_014819chr542011 735 709 312 1884 ----
NM_014822chr41468 ------
NM_014824chr112416 46 --2283 142 --
NM_014826chr111370 194 14111 --
NM_014832chr1311796 ------
NM_014836chr1021976 1715 --1360 --
NM_014840chr1232979 2401 440 --1944 13212
NM_014841chr611332 --11109 --
NM_014850chr374672 3384 687 287 96 69 60 ------
NM_014857chr1178 ------
NM_014871chr12169 ------
NM_014873chr144417 3236 1415 1043 ------
NM_014876chr2282217 1957 1555 821 783 410 76 62 32145 1501 396 ----
NM_014877chr1766792 6118 5608 1738 1291 898 15397 15308 --
NM_014897chr1753120 2676 2052 939 358 ------
NM_014901chr541864 1828 667 96 ------
NM_014902chr2041448 1283 1121 157 ------
NM_014903chr122682 126 ------
NM_014904chr1033776 3513 1047 ------
NM_014905chr21275 ------
NM_014906chr1723022 1114 --12752 1390
NM_014921chr1972972 2825 2572 2337 2151 838 808 1172 32380 2047 1045 --
NM_014923chr1352267 1869 1620 787 657 ------
NM_014926chr32852 448 ------
NM_014931chr19--1621 ----
NM_014932chr32483 69 ------
NM_014934chr1343570 3072 1202 143 --11565 --
NM_014935chr183678 3160 3116 3061 2700 2452 1042 687 23103 260 12794 13795
NM_014937chr102496 30 ------
NM_014938chr1251991 1930 371 328 175 1158 2461 319 --
NM_014944chr111179 1982 ----
NM_014946chr243048 2535 1238 273 ------
NM_014947chr112933 ------
NM_014949chr13995 756 84 ------
NM_014950chr1411598 ------
NM_014952chr1551551 1283 705 580 531 --21277 115 --
NM_014961chr412170 ------
NM_014962chr2012663 ------
NM_014964chr1762078 1986 1935 1801 729 351 --1199 --
NM_014967chr1521095 405 11051 ----
NM_014969chr11327 ----1862
NM_014978chr1051355 668 629 527 295 ------
NM_014982chr1425230 4286 ------
NM_014989chr631642 1283 165 ------
NM_014990chr142905 92 ------
NM_014991chr421325 594 --22581 33 --
NM_014996chr32699 80 ------
NM_014999chr122560 448 ----1293
NM_015000chr122321 58 ------
NM_015002chr1211480 --1245 --
NM_015005chr1421706 672 1378 1425 --
NM_015008chr353182 2734 2543 1113 527 --12888 1320
NM_015015chr1931886 788 439 --1690 --
NM_015017chr111249 ------
NM_015018chr6------1167
NM_015023chr131376 467 171 --2420 293 --
NM_015024chr8183 ----1485
NM_015026chr1231420 166 118 --11896 --
NM_015032chr132700 511 ------
NM_015033chr943298 2934 1170 555 --1712 --
NM_015035chr20126167 6106 5761 5634 4962 4580 4516 1886 1165 1091 623 174 --12263 15130
NM_015039chr154164 4043 3220 1663 1360 ------
NM_015042chr15114310 3884 3842 3811 2767 1464 902 685 311 267 52 1427 33931 3800 355 --
NM_015044chr1653230 3143 2692 421 231 --12960 11283
NM_015049chr21485 --173 179
NM_015051chr931130 1116 987 12232 ----
NM_015052chr71259 ------
NM_015060chr71190 ------
NM_015063chr193366 146 77 ------
NM_015064chr1242891 2814 560 193 1999 22584 973 --
NM_015068chr722738 819 1690 13414 --
NM_015069chr16138 --1601 --
NM_015071chr576473 5947 5269 4661 1881 1214 862 21854 1287 34203 1449 592 --
NM_015074chr1114714 4490 3760 3173 1768 734 521 493 353 223 108 ------
NM_015075chrX32172 1703 1463 --21438 247 --
NM_015076chr644403 3520 2950 991 13861 ----
NM_015082chr552041 963 941 911 131 12231 12387 --
NM_015087chr132609 192 --12604 --
NM_015090chr172183 1763 1232 900 647 314 127 15072 --15960
NM_015092chr1624500 4020 1812 1203 --
NM_015094chr2273790 3304 3138 961 577 323 267 1697 ----
NM_015097chr311727 ------
NM_015100chr142000 1527 680 551 ------
NM_015101chr162784 2603 1154 741 503 417 --1621 12261
NM_015107chrX2611 519 ------
NM_015110chr922114 1782 ------
NM_015115chr41397 ----1930
NM_015132chr72517 452 ------
NM_015138chr1532727 2523 228 1769 ----
NM_015144chr1623314 838 13501 12579 1354
NM_015149chr131685 710 628 --21904 368 --
NM_015150chr31303 --1114 1120
NM_015155chr1073135 2730 2281 2211 470 449 113 --1398 --
NM_015156chr1473132 1338 1198 1078 618 441 251 --32837 1240 385 --
NM_015161chr1631105 1098 212 --1379 --
NM_015167chr172200 56 199 170 --
NM_015170chr822327 257 ------
NM_015171chr162178 106 ------
NM_015172chr131544 1398 463 --195 --
NM_015173chr41123 ------
NM_015191chr111145 22338 1995 1856 --
NM_015192chr2022447 204 --1526 1794
NM_015193chr82243 49 ------
NM_015196chr4140 ------
NM_015199chr332990 2226 2220 --12585 --
NM_015200chr4----11022 --
NM_015206chr1543880 2773 1001 430 --23823 2513 --
NM_015215chr111982 --11259 --
NM_015234chr621197 1005 ------
NM_015236chr421448 294 ------
NM_015238chr52731 645 ------
NM_015250chr932039 1831 416 ------
NM_015251chr1632103 2070 743 ------
NM_015256chr52674 643 ------
NM_015260chr1931544 451 178 ------
NM_015264chr22104732 4349 3315 3170 3136 1101 1039 1028 558 88 11592 --14277
NM_015265chr272378 1630 1040 663 580 561 114 ------
NM_015267chr1211992 --1684 --
NM_015268chr31545 ------
NM_015269chr1128 ------
NM_015271chr474046 2755 1553 1370 1352 253 33 --13747 --
NM_015272chr1631814 1618 1467 ------
NM_015275chr1221393 491 ------
NM_015278chr652937 2594 2099 742 115 22534 2233 --12627
NM_015285chr1822389 98 ------
NM_015288chr563842 3574 3309 2456 614 186 ------
NM_015293chr61157 ------
NM_015299chr1463720 2992 2711 1543 535 528 ----13127
NM_015305chr1461712 1385 1315 1196 535 163 ------
NM_015310chr848022 5494 3275 2976 17072 --12123
NM_015313chr1144710 4139 3907 2934 ------
NM_015315chr553248 2735 1375 1014 104 125 11295 --
NM_015316chr143395 99 27 ------
NM_015317chr232856 2534 2336 ------
NM_015326chr132704 2675 2140 ------
NM_015327chr131242 1226 1005 ------
NM_015335chr122579 297 --1421 --
NM_015336chr12--1670 ----
NM_015343chr171108 ------
NM_015346chr1431559 710 554 ----134
NM_015347chr1242297 2186 767 187 ------
NM_015349chr621100 100 ------
NM_015354chr91384 ------
NM_015355chr1721374 426 ------
NM_015358chr211995 ------
NM_015361chr2----163 --
NM_015365chrX74244 4189 3348 3251 3163 677 73 ------
NM_015374chr2251270 1171 932 386 309 11200 11302 --
NM_015375chr184497 3990 3912 3906 3364 1574 1275 274 --34684 3274 1795 --
NM_015382chr141668 ------
NM_015385chr1032210 2057 790 --1865 --
NM_015387chr231871 1525 784 ------
NM_015397chr931191 304 237 --11219 --
NM_015404chr9168 ------
NM_015443chr173955 623 377 --2446 257 --
NM_015446chr12334 229 ------
NM_015455chr511073 --11508 --
NM_015460chr331608 252 110 ------
NM_015461chr182309 236 ------
NM_015465chr51201 ------
NM_015470chr231212 1180 794 --11076 --
NM_015477chr152886 330 ------
NM_015481chr1221007 993 ------
NM_015483chr71712 ------
NM_015497chr151932 ------
NM_015508chr31341 --1335 --
NM_015530chr21260 --1248 --
NM_015532chr151826 ----2843 247
NM_015535chr273399 2596 2558 1383 1128 1090 183 ------
NM_015537chr941117 851 844 744 11063 ----
NM_015550chr713176 ------
NM_015554chr1511833 ------
NM_015555chr62703 33 ----11305
NM_015557chr183573 3062 2986 2707 1351 1205 1052 791 13363 13565 --
NM_015565chr2132085 1649 530 ------
NM_015567chr131446 ------
NM_015568chr2074300 3949 3910 3783 3603 233 224 1275 ----
NM_015570chr711446 162 ----
NM_015575chr2103479 3355 3286 2991 2709 2489 2449 1464 1200 417 1530 31363 1183 754 --
NM_015577chr571514 1435 1397 426 319 264 108 ------
NM_015605chr1021492 585 --1202 --
NM_015609chr122561 1117 --12369 11102
NM_015610chr73422 193 45 ------
NM_015630chr21810 ------
NM_015640chr145035 4275 3855 3474 ------
NM_015641chr72884 846 --2966 48 --
NM_015642chr33293 247 238 ------
NM_015646chr1211265 136 ----
NM_015657chr2141 ------
NM_015678chr13------1555
NM_015686chrX51856 1674 1622 1577 968 1710 ----
NM_015691chrX42782 2713 2542 184 ----12488
NM_015695chr63595 274 188 ------
NM_015726chr11244 --21778 1190 --
NM_015844chr181294 1307 2731 136 --
NM_015846chr181294 1307 2731 136 --
NM_015847chr181294 1307 2731 136 --
NM_015850chr851783 1694 1576 977 501 --2366 145 --
NM_015866chr111438 ------
NM_015872chr151699 1266 560 356 91 ----21400 645
NM_015874chr41587 ------
NM_015878chr812226 ----11854
NM_015881chr111307 ----1130
NM_015888chr133026 3016 289 12604 ----
NM_015892chr101403 --1291 11722
NM_015906chr174503 4284 3356 3306 3284 1864 670 ------
NM_015912chr832472 2232 321 ------
NM_015932chr13----1560 --
NM_015949chr72975 642 ------
NM_015976chr1----1240 --
NM_015995chr15145428 5003 4761 4307 3965 2120 1515 1471 998 885 550 524 423 52 --15435 1487
NM_016003chr73422 193 45 ------
NM_016009chr144723 3259 1304 133 ------
NM_016021chr622743 2246 --1808 --
NM_016023chr822010 882 ------
NM_016025chr1631973 564 64 ------
NM_016032chrX4949 337 265 121 ------
NM_016037chr13999 466 442 ------
NM_016038chr7----176 --
NM_016059chr63380 124 97 ------
NM_016061chr211604 --1492 --
NM_016073chr1511146 ------
NM_016076chr132785 564 469 ----1534
NM_016132chr1512634 ------
NM_016141chr31741 ------
NM_016144chr51123 ------
NM_016185chr172623 182 ------
NM_016194chr1531595 1485 1462 --21478 463 --
NM_016201chr352150 2050 754 681 281 ------
NM_016203chr71187 ------
NM_016206chr359048 7636 7600 6199 1233 --16428 --
NM_016227chr11487 11407 ----
NM_016230chr61166 ------
NM_016231chr1711314 --11145 --
NM_016250chr142711 617 ------
NM_016256chr16154 --1238 --
NM_016258chr11256 ------
NM_016260chr225968 802 --1233 11195
NM_016269chr42761 111 ------
NM_016270chr191302 ------
NM_016271chr182851 743 ------
NM_016272chr2251996 1789 1003 307 214 1553 ----
NM_016277chr611386 ------
NM_016315chr211596 ------
NM_016322chr911166 ------
NM_016351chr71182 ------
NM_016374chr12628 473 ------
NM_016374chr12628 473 ------
NM_016376chr1754276 3706 2797 618 435 --11199 --
NM_016395chr1531368 579 21 ------
NM_016396chr1512971 ----22373 929
NM_016418chr2243361 3160 3042 43 11194 11303 --
NM_016422chr1123088 758 ------
NM_016424chr1721491 1382 --11819 --
NM_016431chr223746 131 80 ------
NM_016433chr121186 --199 --
NM_016436chr2031710 732 636 ------
NM_016453chr3160 --1184 --
NM_016463chr5155 ------
NM_016470chr20143 --1549 --
NM_016480chr51789 ----1216
NM_016488chr1221719 358 --11693 --
NM_016490chr2136 ------
NM_016507chr1721961 499 --1526 --
NM_016512chr81230 ------
NM_016522chr111270 ------
NM_016530chr1553978 3823 3811 2545 166 --1450 --
NM_016531chr4------1118
NM_016559chr331440 1319 994 ------
NM_016575chr12105075 4500 4025 3779 3754 3376 3338 1502 1464 986 175 24622 1547 --
NM_016577chr363548 3013 1668 1309 645 21 13364 13262 --
NM_016580chr51329 2103 42 ----
NM_016603chr5------11963
NM_016604chr52813 247 ------
NM_016605chr53791 612 299 11794 ----
NM_016619chr41237 ------
NM_016621chr1163992 3970 3205 3066 1707 1637 ------
NM_016626chr181183 ------
NM_016628chr101136 ------
NM_016631chr211880 ------
NM_016644chr5----1555 --
NM_016836chr22764 693 ------
NM_016839chr22764 693 ------
NM_016929chr653515 1098 840 670 183 ----11184
NM_016936chr1662137 2048 1486 272 34 21 ------
NM_016946chr142342 2306 1018 931 13592 32835 1446 214 --
NM_016952chr1153958 2850 1259 412 61 --1724 11100
NM_017412chr81967 ------
NM_017413chrX32255 1848 449 1746 166 --
NM_017415chr573446 1134 923 778 754 205 103 --11036 --
NM_017420chr1423521 1002 ------
NM_017423chr41489 1337 --1696
NM_017437chr1442204 882 331 194 ------
NM_017447chr2133081 753 42 --11425 11528
NM_017449chr11311 ------
NM_017455chr15--1218 ----
NM_017456chr1741714 1611 712 581 --31767 586 25 --
NM_017482chr241537 1060 973 246 --21572 1440 --
NM_017488chr221513 1178 1153 ----
NM_017519chr611291 ------
NM_017522chr131335 905 99 ------
NM_017553chr15164 --176 --
NM_017582chr121718 466 --2695 625 --
NM_017593chr4--1359 ----
NM_017596chr1104210 3724 3714 1505 1461 1417 973 722 260 146 --54026 3980 3800 3174 1704 --
NM_017602chrX3738 661 77 ------
NM_017610chr1531923 341 285 ------
NM_017622chr172684 104 ------
NM_017629chr141918 1888 1597 104 ------
NM_017633chr643615 2992 567 518 ------
NM_017635chr1131179 534 450 ------
NM_017637chr9108732 3358 3154 2704 1948 1417 1361 709 366 44 18610 1938 --
NM_017640chr61228 ------
NM_017658chr1413211 --11103 11032
NM_017681chrX1848 ------
NM_017682chr19173 ------
NM_017703chr191179 1389 ----
NM_017709chr144197 1426 1232 92 ------
NM_017712chr19126203 6065 5972 5892 5885 5143 4590 2514 2464 1978 503 400 --31679 1302 295 --
NM_017715chr7--1560 ----
NM_017719chr32465 160 ------
NM_017730chr33597 290 277 ------
NM_017737chr11371 --12241 --
NM_017740chr163530 464 242 160 ----
NM_017742chr1821449 189 ------
NM_017749chr112689 182 ------
NM_017752chrX12141 ------
NM_017753chr91882 ------
NM_017754chr644074 1043 362 220 11682 ----
NM_017755chr5150 --199 --
NM_017758chr1731254 1064 941 11328 ----
NM_017770chr622288 2006 --148 --
NM_017772chr611633 11657 ----
NM_017778chr8--174 ----
NM_017780chr81664 ------
NM_017786chr8----1555 --
NM_017811chr932240 2106 964 --1328 --
NM_017814chr19134 ------
NM_017824chr1021980 1707 ------
NM_017848chrX33811 653 438 23232 2961 54628 3220 1853 1687 186 1554
NM_017849chr242529 2025 1279 1069 --32846 2492 1012 --
NM_017851chr155986 970 962 268 137 --1924 --
NM_017857chr112676 636 ------
NM_017895chr20----175 --
NM_017896chr2071386 1379 1138 813 738 568 156 --1555 --
NM_017902chr1074893 4334 2149 1991 1294 820 608 ------
NM_017907chr114482 415 342 192 ------
NM_017922chr141249 ------
NM_017926chr141889 ------
NM_017929chr2231202 954 395 ------
NM_017933chr211436 --11065 --
NM_017938chrX21740 38 --1119 --
NM_017945chr331217 878 281 ------
NM_017955chr141823 ------
NM_017964chr22667 44 ------
NM_017972chr141889 ------
NM_017987chr1042003 1655 632 552 ------
NM_017988chr12----3670 321 80 --
NM_017994chr752454 2446 746 487 74 --22321 2026 --
NM_017998chr911022 ------
NM_018011chr13------1262
NM_018014chr21158 --164 --
NM_018024chr82583 568 --196 --
NM_018027chr1032037 2002 362 ----12777
NM_018032chr163728 234 63 1705 ----
NM_018045chr141232 994 987 384 1369 12359 --
NM_018046chr51693 ------
NM_018047chr52869 809 ------
NM_018053chr11106 --1668 1729
NM_018054chr162212 140 --1510 --
NM_018061chr111181 ------
NM_018064chr62256 227 ------
NM_018067chr11462 --1102 --
NM_018072chr1----1161 --
NM_018084chr2--22410 1241 ----
NM_018085chr168099 6530 3219 2298 125 69 16666 --16634
NM_018092chr1611244 ------
NM_018116chr11548 --1503 --
NM_018133chr311564 ------
NM_018155chr331387 394 171 ------
NM_018167chr141368 ------
NM_018171chr121825 ------
NM_018179chr123614 551 50 ------
NM_018181chr1821898 772 ------
NM_018184chr332159 1495 328 --1572 --
NM_018198chr161084 1070 1037 950 473 344 ------
NM_018200chr1522255 682 ------
NM_018211chr121678 718 --12054 --
NM_018214chr61192 ------
NM_018222chr1131485 1308 472 ------
NM_018240chr12866 201 ------
NM_018241chr42956 178 ------
NM_018243chr463128 3055 2641 1610 595 282 ----1582
NM_018244chr204850 373 364 36 ----2935 95
NM_018254chr11429 --12199 --
NM_018265chr151994 1891 804 725 241 ------
NM_018268chr51349 ----1621
NM_018275chr71117 --1518 --
NM_018287chr10----11273 --
NM_018293chr34326 176 112 95 ----11104
NM_018299chr81842 --12522 --
NM_018302chr422455 497 ------
NM_018307chr171278 ------
NM_018312chr1161905 1882 1863 1840 1776 804 --1771 --
NM_018315chr4----1128 --
NM_018327chr2021351 654 ------
NM_018330chr10--21461 646 ----
NM_018334chr71201 ------
NM_018351chr1234630 3976 3461 ------
NM_018362chr1123614 2763 ------
NM_018364chr153925 3851 3652 220 72 ------
NM_018368chr61223 ------
NM_018371chr821132 1125 ------
NM_018374chr721691 750 11441 ----
NM_018388chrX31308 341 53 ----1939
NM_018400chr1124479 4405 14180 --131
NM_018403chr333149 1529 1500 --12681 --
NM_018416chr1242597 2336 2180 887 1498 1756 11809
NM_018424chr921597 69 --1413 --
NM_018440chr865570 3367 2023 970 503 288 12802 --25986 1927
NM_018444chr81851 --11946 --
NM_018446chr3------1328
NM_018448chr121145 ------
NM_018451chr131793 ------
NM_018452chr6_random12770 --2714 534 --
NM_018462chr32759 142 ----1542
NM_018469chr1731374 281 86 ------
NM_018482chr841939 936 327 309 ------
NM_018488chr171617 1648 165 --
NM_018490chr1111445 ------
NM_018492chr8----127 --
NM_018566chr143439 1491 845 815 --13705 --
NM_018569chr411557 ------
NM_018590chr10------1647
NM_018602chr154412 307 149 87 ------
NM_018638chr1211432 ------
NM_018639chr122398 87 ------
NM_018644chr11145 11496 12191 11835
NM_018650chr122237 1508 --187 --
NM_018652chr151251 --1722 --
NM_018657chr31176 ------
NM_018683chr2011703 --11080 --
NM_018695chr51477 ------
NM_018711chr1241451 1027 281 26 11111 --1489
NM_018715chr132158 2012 1905 --11559 --
NM_018718chr731958 1743 752 ------
NM_018719chr731231 1199 361 ------
NM_018841chr132589 338 232 --13335 --
NM_018890chr711315 ------
NM_018898chr5----1221 --
NM_018899chr5----1221 --
NM_018900chr5----1221 --
NM_018901chr5----1221 --
NM_018902chr5----1221 --
NM_018903chr5----1221 --
NM_018904chr5----1221 --
NM_018905chr5----1221 --
NM_018906chr5----1221 --
NM_018907chr5----1221 --
NM_018908chr5----1221 --
NM_018909chr5----1221 --
NM_018910chr5----1221 --
NM_018911chr5----1221 --
NM_018912chr521760 479 ------
NM_018913chr521760 479 ------
NM_018914chr521760 479 ------
NM_018915chr521760 479 ------
NM_018916chr521760 479 ------
NM_018917chr521760 479 ------
NM_018918chr521760 479 ------
NM_018919chr521760 479 ------
NM_018920chr521760 479 ------
NM_018921chr521760 479 ------
NM_018922chr521760 479 ------
NM_018923chr521760 479 ------
NM_018924chr521760 479 ------
NM_018925chr521760 479 ------
NM_018926chr521760 479 ------
NM_018927chr521760 479 ------
NM_018928chr521760 479 ------
NM_018929chr521760 479 ------
NM_018945chr633672 2420 437 13269 ----
NM_018948chr12984 494 ------
NM_018963chr2111006 --21022 247 --
NM_018976chr1211114 --12840 --
NM_018992chr1631543 1390 422 ------
NM_018993chr2051392 1362 1139 397 286 ------
NM_018994chr12392 33 ------
NM_018999chr10104543 4374 4331 4054 3741 3048 1589 1075 967 683 11576 --13494
NM_019001chr324398 325 ------
NM_019004chr71378 1321 ----
NM_019042chr711093 ------
NM_019045chrX2958 370 ------
NM_019046chr102832 238 ------
NM_019053chr1021033 375 ------
NM_019074chr155868 683 362 310 280 ------
NM_019084chr101354 ------
NM_019094chr1253707 2906 2824 1448 960 --13791 --
NM_019096chr64778 753 712 352 --1273 --
NM_019106chr2252593 2112 1198 697 102 --1508 --
NM_019114chr922361 1996 --12001 1149
NM_019116chr1643292 3151 858 64 --11276 --
NM_019555chr331805 1749 32 ------
NM_019557chr12352 196 ------
NM_019592chr91601 ------
NM_019594chr921223 618 11623 ----
NM_019597chrX1216 ------
NM_019605chr11482 --1622 --
NM_019610chr121513 1407 ------
NM_019613chr172882 120 --1931 --
NM_019850chr23594 494 34 --1117 --
NM_019854chr121708 ------
NM_019860chr101609 ------
NM_020039chr1261942 1741 1656 1487 1212 399 11694 11782 --
NM_020064chr91624 --1577 --
NM_020066chr11787 ------
NM_020122chr245044 4837 1779 101 --14021 --
NM_020140chr12182 ------
NM_020142chr121459 ----1210
NM_020144chr721429 134 ------
NM_020148chr1843117 2554 2397 258 22481 104 --12303
NM_020178chr171828 --1835 --
NM_020179chr112136 74 ------
NM_020182chr2042954 2916 2682 2538 23561 2585 12520 1164
NM_020193chr1121068 256 ------
NM_020199chr511156 ------
NM_020205chr112774 --23126 2521 --
NM_020228chr1132196 2057 276 1446 ----
NM_020239chr13873 417 148 1279 1334 --
NM_020240chr522780 959 --32715 924 621 --
NM_020245chr644423 4398 3161 1544 --1880 --
NM_020248chr192335 2270 2116 2108 1749 636 520 328 200 2724 395 ----
NM_020309chr19------161
NM_020336chr2043565 3307 2458 697 --13250 --
NM_020338chr1082946 1502 1419 1390 1286 790 689 206 22969 263 21480 239 --
NM_020342chr232453 1688 817 --1102 --
NM_020346chr1111101 ------
NM_020362chr13807 150 133 ------
NM_020363chrY21391 1368 ------
NM_020381chr621723 1260 1809 2509 341 --
NM_020382chr121202 --1441 --
NM_020384chrX41658 1498 451 37 ------
NM_020405chr17183 --34456 1610 789 --
NM_020420chrY21391 1368 ------
NM_020429chr732515 2156 264 --1965 --
NM_020438chr92327 204 --1526 --
NM_020443chr152386 1501 1279 967 239 15497 ----
NM_020456chr1332284 1844 75 ----11443
NM_020463chr2133 ------
NM_020466chr634253 3988 3075 ------
NM_020473chrX1653 ------
NM_020474chr1821888 1287 ------
NM_020526chr141800 1723 1296 679 ------
NM_020630chr101681 --1667 165
NM_020640chr332023 1442 191 ------
NM_020647chr82211 124 ------
NM_020651chr2----11182 --
NM_020673chr20107408 6627 6180 5958 5250 4714 2892 1450 1237 236 --17435 --
NM_020689chr201622 ----1310
NM_020697chr821264 230 ------
NM_020699chr145136 2085 1877 1814 ------
NM_020708chr2052478 2339 1746 773 712 11906 ----
NM_020715chr1442153 643 569 531 ------
NM_020717chrX43522 1591 858 418 --31922 1306 1095 --
NM_020718chr1666142 5333 5300 4640 4364 4223 ------
NM_020724chr442286 554 524 205 22566 736 ----
NM_020727chr2133459 3141 2489 11156 ----
NM_020728chr743029 2244 1957 311 ------
NM_020732chr611291 ------
NM_020734chr1223159 2937 ------
NM_020738chr21200 ------
NM_020739chr152865 818 --12579 --
NM_020747chr51291 ------
NM_020748chr1731431 1407 294 ------
NM_020749chr8150 --11375 --
NM_020750chr62262 132 ------
NM_020752chr10----1706 --
NM_020760chr2----1599 --
NM_020762chr121120 --1405 --
NM_020764chr1631326 1064 888 ------
NM_020765chr11228 --142 --
NM_020766chrX23684 1580 --23778 830 1214
NM_020769chrX2836 710 ------
NM_020771chr611501 ------
NM_020772chr1758144 6019 5923 817 738 ----27635 1407
NM_020773chr452387 1868 1845 1784 135 --12184 11835
NM_020774chr1834813 1966 249 1874 ----
NM_020779chr232229 1167 975 ------
NM_020791chr1721143 366 ------
NM_020794chr111096 ------
NM_020795chr1751801 1705 1546 1483 83 ------
NM_020796chr562739 2519 2385 2130 985 108 --1910 --
NM_020801chr521858 929 --11790 --
NM_020804chr672579 2473 2048 1845 1053 863 203 11744 1388 --
NM_020805chr1811691 ------
NM_020806chr14--1267 ----
NM_020808chr1----2954 298 --
NM_020810chr1421345 477 --23424 471 --
NM_020819chr61307 ------
NM_020820chr2051456 1356 1111 286 75 11010 ----
NM_020824chr101689 ------
NM_020830chr21199 --1602 --
NM_020839chr321529 577 --11273 --
NM_020841chr1242859 2747 1018 76 --149 --
NM_020850chr1663089 2853 2718 2576 217 127 ------
NM_020854chr18----1219 --
NM_020856chr191525 ------
NM_020858chr152365 29 ------
NM_020859chr463465 3401 1556 947 415 354 ------
NM_020860chr41359 ------
NM_020865chr3------122
NM_020866chr131288 ------
NM_020896chr116985 861 713 348 227 196 ------
NM_020899chr1791979 1727 1566 839 647 518 470 230 74 ------
NM_020917chr1943589 1323 865 574 ------
NM_020922chrX21820 1265 ------
NM_020927chr1622328 1484 ------
NM_020935chr2114367 4272 4251 4186 3565 3026 1821 1171 1131 463 189 --13076 --
NM_020939chr651109 440 364 168 33 21025 499 187 --
NM_020956chr1964723 4354 3160 1220 1002 182 13584 14144 --
NM_020967chr204523 475 267 44 ------
NM_020971chr191887 ------
NM_020977chr441938 1690 838 255 ------
NM_021020chr883327 3193 847 526 288 253 227 151 ------
NM_021025chr51352 ------
NM_021033chr132773 671 --12192 --
NM_021035chr2021206 118 ------
NM_021044chr122141 48 ------
NM_021047chr192487 449 ------
NM_021064chr631796 1369 316 ------
NM_021065chr6123 ------
NM_021072chr542521 2247 1757 130 ----1873
NM_021077chr15134 ------
NM_021079chr1783261 3129 2687 2532 573 502 394 209 13089 43057 2301 1060 761 --
NM_021090chr2274515 4324 3497 3200 1743 1217 895 11810 1338 13396
NM_021096chr2293151 3008 2735 2690 2682 951 741 355 167 22313 2037 42670 2500 2161 921 --
NM_021097chr21336 --11000 --
NM_021106chr93766 616 148 ------
NM_021120chrX53185 2408 2295 1145 373 12447 ----
NM_021132chr1041340 979 433 233 1158 11250 --
NM_021137chr1762000 1783 1733 909 732 147 1430 ----
NM_021141chr22669 256 ------
NM_021148chr732275 1988 1638 ------
NM_021155chr1941938 867 784 524 11833 22545 1151 --
NM_021156chr201136 --161 --
NM_021174chr8----1759 --
NM_021183chrX31959 909 172 ------
NM_021184chr61490 ------
NM_021189chr11232 1872 ----
NM_021190chr11922 --1469 --
NM_021192chr21309 ------
NM_021198chr221444 556 --11431 --
NM_021202chr2032811 1137 624 --1327 --
NM_021215chr2032046 458 405 ------
NM_021224chr91311 --166 --
NM_021238chr1221388 290 ------
NM_021240chr91207 ------
NM_021249chr1421331 1262 ------
NM_021253chr62908 436 1334 21089 1074 --
NM_021570chr93450 332 24 1417 ----
NM_021602chr174441 176 107 42 ------
NM_021627chr31795 --11242 1903
NM_021629chr365074 4072 4020 3671 1728 1459 ------
NM_021637chrX----1143 --
NM_021639chr1----2321 151 --
NM_021643chr221860 1339 ------
NM_021644chr1021023 45 ------
NM_021648chr652375 1690 562 239 164 11975 1311 --
NM_021705chr621219 480 ------
NM_021723chr71182 ------
NM_021783chrX11723 2720 90 ----
NM_021813chr665601 1840 1556 1403 1388 1323 --11728 11426
NM_021814chr62606 101 ------
NM_021825chr11133 ------
NM_021905chr641738 260 128 33 --1423 --
NM_021911chr534042 831 127 11361 ----
NM_021912chr151556 1883 --13602
NM_021913chr1931298 626 529 ------
NM_021940chr6----1147 --
NM_021943chr662008 1740 851 840 541 399 --21946 768 --
NM_021945chr643237 1419 508 33 ------
NM_021946chrX71241 1230 1203 1170 954 350 308 --1357 --
NM_021949chrX22117 814 --12739 --
NM_021960chr122496 2407 --1565 --
NM_021961chr1167178 6897 6865 5677 2906 2814 --12011 --
NM_021962chr1732342 1732 526 --1586 --
NM_021964chr336481 4046 465 ------
NM_021966chr143305 172 130 2581 45 1701 --
NM_021988chr203638 439 363 11302 ----
NM_021991chr171551 1200 ----
NM_021998chrX11289 ------
NM_022037chr2------134
NM_022048chr1545529 4569 1764 564 11560 24084 1407 --
NM_022054chr141783 1188 ----
NM_022085chr62998 418 --11012 --
NM_022107chr6138 ------
NM_022118chr131609 ------
NM_022123chr14----1610 --
NM_022130chr54950 273 134 108 ------
NM_022131chr3----11325 --
NM_022133chr811755 ------
NM_022138chr631172 336 182 --11141 --
NM_022140chr541840 1584 1484 357 --11953 --
NM_022153chr10113657 3516 3015 1376 1109 1031 679 515 89 80 38 ----13156
NM_022166chr1685408 5335 5128 4890 3864 2457 1838 803 170 ----
NM_022170chr721140 109 --11369 --
NM_022171chr341596 1077 48 41 ------
NM_022173chr2------134
NM_022334chr21851 6818 766 710 430 374 318 1927 --
NM_022336chr252332 2025 1550 841 157 --2822 806 --
NM_022340chr363570 3385 3191 2659 1199 38 ------
NM_022343chr931296 1245 974 ------
NM_022351chr8------12807
NM_022362chr10192 ------
NM_022368chrX------128
NM_022373chr71236 135 ----
NM_022374chr2184 1448 ----
NM_022442chr203638 439 363 11302 ----
NM_022459chr1356285 5219 2529 1048 676 --24128 1120 --
NM_022462chr1973631 3543 2869 1097 496 313 197 13660 1816 --
NM_022465chr122893 839 ------
NM_022469chr122693 2621 --21090 895 --
NM_022474chr1442643 2102 2062 205 1570 ----
NM_022475chr41679 ------
NM_022477chr2021308 85 ------
NM_022496chr12--1105 ----
NM_022497chr373649 2906 2839 1458 365 355 272 2297 173 ----
NM_022553chr62183 127 ------
NM_022574chr731599 648 555 ------
NM_022644chr172399 180 ------
NM_022648chr2134641 4034 3140 2965 2935 1844 1838 1451 1338 1294 858 655 44 ------
NM_022659chr81127 ------
NM_022720chr2241591 1349 695 567 1223 11295 --
NM_022726chr6--2592 340 ----
NM_022730chr24712 681 293 34 ------
NM_022731chr11238 ----1106
NM_022733chr12997 352 ------
NM_022735chr12506 436 ----1119
NM_022737chr1921286 989 176 ----
NM_022744chr1671270 981 951 521 508 300 277 --11018 --
NM_022749chr831069 419 201 --1495 --
NM_022750chr72673 494 --2678 522 --
NM_022755chr932323 1798 937 ------
NM_022756chr131311 1119 1049 ------
NM_022758chr652443 2255 2249 1994 898 22688 46 1682 12944
NM_022763chr322699 2143 ------
NM_022766chr2232629 800 256 2883 372 12090 --
NM_022768chr11116 ------
NM_022771chr122948 727 ------
NM_022776chr321340 1221 ------
NM_022780chr21207 ------
NM_022781chr952685 2652 2544 2385 85 13204 ----
NM_022802chr10192 ------
NM_022810chrX2279 111 ------
NM_022822chr113581 178 74 --1287 --
NM_022823chr22174 128 ------
NM_022826chr211190 11094 ----
NM_022832chr442540 1893 359 329 --1125 --
NM_022841chr15--21093 482 ----
NM_022842chr352989 2906 2573 2385 336 1279 12866 --
NM_022843chr1331428 1083 983 ------
NM_022844chr16149 ------
NM_022893chr243094 3071 2887 2223 ------
NM_022898chr1474685 4016 3684 3485 3410 2938 1415 --1985 11041
NM_022912chr262749 2718 694 528 521 187 ------
NM_022917chr941095 854 303 113 --11234 --
NM_022970chr1031116 1049 495 ------
NM_022977chrX1998 ------
NM_023009chr11594 ------
NM_023034chr81225 ------
NM_023037chr13193 ------
NM_023067chr31382 ----1250
NM_023074chr191867 ------
NM_023076chr1642546 2191 1829 287 --11087 1169
NM_023079chr1721542 167 1179 11678 --
NM_023105chr851783 1694 1576 977 501 --2366 145 --
NM_023106chr851783 1694 1576 977 501 --2366 145 --
NM_023110chr851783 1694 1576 977 501 --2366 145 --
NM_023111chr851783 1694 1576 977 501 --2366 145 --
NM_023927chr521170 1137 ------
NM_023929chr832723 2089 81 --12310 --
NM_023940chr44981 860 134 31 2196 50 ----
NM_023943chr31201 ------
NM_024007chr532967 2869 821 ----12562
NM_024019chr41171 ------
NM_024046chr331255 930 241 ------
NM_024061chr71232 ------
NM_024076chr1942233 1552 960 794 11784 2745 122 --
NM_024086chr1743288 2439 1359 953 --155 --
NM_024094chr82884 277 ------
NM_024107chr17131 ------
NM_024117chr91217 ------
NM_024294chr652443 2255 2249 1994 898 22688 46 1682 12944
NM_024295chr831305 833 490 ------
NM_024306chr162755 426 --193 --
NM_024408chr141291 1092 876 572 --13295 --
NM_024424chr112858 180 ------
NM_024425chr112858 180 ------
NM_024426chr112858 180 ------
NM_024429chr71187 ------
NM_024503chr1130 ------
NM_024523chr711242 ------
NM_024529chr12875 166 ------
NM_024532chr2--145 ----
NM_024539chrX21096 151 ------
NM_024551chr1252430 2339 296 243 43 1758 ----
NM_024551chr1252430 2339 296 243 43 1758 ----
NM_024554chr121091 93 --1105 --
NM_024556chr112420 344 ------
NM_024563chr521350 726 ------
NM_024565chr52619 128 1491 1243 --
NM_024569chr152459 2416 2213 549 458 ------
NM_024586chr11550 ------
NM_024595chr12893 470 --1860 --
NM_024599chr173609 207 47 --1534 --
NM_024612chr173825 282 117 ------
NM_024617chr9--1826 ----
NM_024635chr91215 ------
NM_024645chr811407 ------
NM_024659chr21666 --1293 --
NM_024664chr1177 ------
NM_024665chr321554 811 ------
NM_024674chr142336 935 832 119 --22299 302 --
NM_024704chr203369 245 94 ------
NM_024721chr811979 --1979 --
NM_024742chr1631596 1580 1265 --51922 1287 754 422 228 --
NM_024751chr412031 ------
NM_024757chr91459 --1950 --
NM_024779chr1211146 --11394 --
NM_024787chr82228 129 ------
NM_024811chr111280 ------
NM_024852chr1--1135 ----
NM_024881chr1963322 3246 3187 3163 3149 997 --13393 --
NM_024887chr12769 235 11796 --11862
NM_024920chr411402 ------
NM_024939chr1621261 348 --1104 1248
NM_024944chr2111278 ----184
NM_024946chr1611737 --1315 --
NM_024947chr399531 8701 8167 7552 6900 6076 2287 1736 78 28096 7028 26400 2545 --
NM_024949chr434814 3828 3649 --1832 --
NM_024953chr1232704 1999 1952 --21736 409 --
NM_024954chr104618 601 557 461 ------
NM_024958chr202822 451 1773 ----
NM_024979chr1321373 474 1377 ----
NM_024989chr267449 7023 6309 2391 1572 727 ------
NM_024991chr1032210 2057 790 --1865 --
NM_025027chr192487 250 ------
NM_025054chr822991 968 12793 1722 --
NM_025076chr2161 ------
NM_025079chr11502 ------
NM_025106chr121750 126 --11873 --
NM_025141chr15----1512 --
NM_025146chr32783 629 ------
NM_025160chr121735 1639 1403 161 --
NM_025176chr20----1153 --
NM_025179chr174555 4496 4075 4012 1973 1032 895 --13833 --
NM_025182chr9--199 ----
NM_025187chr1611003 --31377 1242 200 --
NM_025222chr342505 2046 1011 125 1686 ----
NM_025230chr145689 430 374 262 179 ------
NM_025235chr1041922 774 108 59 --11396 --
NM_025248chr1793080 2406 1978 1250 982 727 629 536 282 32977 1176 1017 42006 1201 963 778 --
NM_025251chr821123 869 --2422 364 1167
NM_030576chr1782464 1713 570 555 213 114 81 38 11039 22291 757 --
NM_030594chr152232 97 --126 --
NM_030621chr1424022 2972 ------
NM_030623chr221358 183 ------
NM_030627chr521656 1115 ------
NM_030629chr161575 ------
NM_030637chr142738 26 ------
NM_030645chr12357 335 1403 11077 126
NM_030647chr714427 1265 ----
NM_030648chr435344 962 510 14402 22027 1468 --
NM_030650chr243884 2847 2808 1544 --13045 --
NM_030660chr142956 409 ------
NM_030661chr721415 1391 ------
NM_030664chr1021664 622 ------
NM_030665chr1731242 452 269 11159 ----
NM_030674chr1264511 4321 3581 1565 621 298 ----1797
NM_030753chr17--1267 ----
NM_030758chr2221470 84 ------
NM_030762chr1221977 378 ----11933
NM_030774chr1131315 1160 600 ----139
NM_030777chr204997 964 97 37 11849 2838 131 1509
NM_030796chr72647 51 1661 --1759
NM_030806chr1148600 8520 8462 8292 8202 7324 6317 6209 3051 3023 2837 1419 926 674 29360 968 28971 2685 --
NM_030809chr1211880 --1636 --
NM_030810chr62998 418 --11012 --
NM_030820chr621066 50 ------
NM_030877chr20178 ------
NM_030881chr2242330 2288 2128 552 ----12050
NM_030884chr331911 1574 379 11692 11494 --
NM_030906chr111218 ------
NM_030915chr252191 1963 928 696 587 ------
NM_030918chr184501 4270 4259 2056 2042 1668 498 54 --13869 --
NM_030923chr21136 ------
NM_030927chr1031030 1014 478 1307 11172 --
NM_030937chr12467 215 1915 2328 318 --
NM_030938chr173880 368 265 ------
NM_030939chr61338 ------
NM_030962chr111185 1110 ----
NM_030963chr61242 --1611 --
NM_030964chr51902 12812 22786 2665 --
NM_030978chr91464 ------
NM_030981chr1141017 231 208 110 ------
NM_031216chr1821916 780 ------
NM_031231chr202233 115 1472 ----
NM_031232chr202233 115 1472 ----
NM_031243chr71292 ------
NM_031268chr16145258 5111 3992 3687 2063 1888 1875 1838 1661 1404 1310 751 568 57 2992 935 24981 1395 --
NM_031272chr171260 ----134
NM_031296chr441958 997 555 474 ------
NM_031309chr852095 1684 843 492 421 ------
NM_031371chr12628 473 ------
NM_031371chr12628 473 ------
NM_031372chr431449 1258 73 ------
NM_031409chr641755 1749 1110 178 11136 ----
NM_031411chr5----1221 --
NM_031412chr121234 ------
NM_031417chr1972780 2742 2520 2147 228 185 163 --1106 --
NM_031424chr203493 386 198 ------
NM_031426chr922692 744 ------
NM_031427chr1455811 3662 2154 1839 413 --1884 14501
NM_031439chr81143 1118 ----
NM_031445chr233336 1005 965 --32916 2903 2858 --
NM_031450chr113628 622 524 ----1443
NM_031459chr131635 337 114 21492 1068 1503 --
NM_031477chr16263 39 --1265 --
NM_031478chr161271 ------
NM_031483chr2042277 1423 473 188 ------
NM_031844chr143456 2707 2520 759 13744 ----
NM_031845chr243258 2722 2685 213 --13290 --
NM_031847chr243258 2722 2685 213 --13290 --
NM_031849chr5----1221 --
NM_031857chr5----1221 --
NM_031860chr5----1221 --
NM_031890chr2242202 1936 916 162 11985 21166 938 --
NM_031914chr14------1159
NM_031940chr8--12042 ----
NM_031990chr194429 324 294 276 --11356 --
NM_031991chr194429 324 294 276 --11356 --
NM_031992chr721140 109 --11369 --
NM_032012chr944922 1164 570 132 --23975 3292 2285 250
NM_032013chr2021308 85 ------
NM_032017chr141894 1858 1566 796 11777 ----
NM_032041chr812560 1123 12297 --
NM_032042chr522573 2216 ------
NM_032047chr311616 --1840 --
NM_032050chr221170 ------
NM_032052chr221555 1375 ----
NM_032088chr521760 479 ------
NM_032092chr521760 479 ------
NM_032102chr1122654 338 --1630 12799
NM_032105chr1137982 7680 6516 6417 6324 5802 5708 5326 5112 3131 1872 1734 806 15728 15343 --
NM_032121chrX31086 855 524 ------
NM_032139chr191924 ----1109
NM_032144chr2----1192 --
NM_032153chr322105 1070 --12308 12678
NM_032160chr1833824 2993 172 ----23670 3492
NM_032175chr531757 1303 1175 ------
NM_032182chr1021446 1414 ------
NM_032192chr17--1724 1144 --
NM_032199chr1033374 2881 72 --11195 --
NM_032207chr1921156 793 1472 11111 --
NM_032208chr241136 872 783 429 ------
NM_032211chr1051121 863 215 209 195 ------
NM_032217chr411031 ------
NM_032221chr2021742 1266 ------
NM_032233chr142850 342 ------
NM_032268chr1631164 1072 288 ------
NM_032272chr83392 344 321 ------
NM_032281chr1933120 429 177 --1362 --
NM_032283chr11140 --2458 32 11502
NM_032289chr531461 543 450 ------
NM_032294chr1721337 412 --21681 320 1251
NM_032295chr71143 11174 ----
NM_032316chr362350 2312 1851 1550 628 29 1659 ----
NM_032325chr1151957 1647 1609 1474 59 ------
NM_032327chr103406 379 113 ------
NM_032329chr2104117 4006 3912 3624 3616 3288 3250 2848 799 218 11644 13182 --
NM_032345chr122107 58 ------
NM_032352chr1421124 988 ------
NM_032364chr122368 330 ------
NM_032373chr1024191 900 ------
NM_032375chr192217 74 ------
NM_032376chr17----2671 102 --
NM_032389chr1151159 903 445 322 136 --1908 11176
NM_032403chr521760 479 ------
NM_032408chr72979 81 ------
NM_032430chr191295 ------
NM_032439chr1021048 336 ------
NM_032440chr102770 213 ------
NM_032445chr152896 773 ------
NM_032446chr553681 3656 3512 1349 1082 ------
NM_032449chr162217 1836 1145 926 452 367 ------
NM_032452chr1431364 504 27 --11435 --
NM_032457chr41889 --13251 --
NM_032458chrX33370 1366 152 ------
NM_032509chr832299 2268 1751 1945 ----
NM_032510chr1812424 1224 ----
NM_032521chr2022124 700 12647 ----
NM_032538chr652766 2605 2492 1981 222 22085 640 ----
NM_032547chr43960 563 94 ------
NM_032560chr14191 ------
NM_032569chr1661315 1261 711 682 349 74 11225 ----
NM_032575chr1661672 1396 1387 657 452 162 --1190 --
NM_032578chr10--11501 ----
NM_032580chr171145 ------
NM_032582chr1721576 1342 ------
NM_032590chr121193 ------
NM_032595chr1731283 1143 608 --2278 191 --
NM_032596chr91118 ------
NM_032603chr2--151 ----
NM_032638chr31490 --31458 1287 1103 1382
NM_032682chr331156 836 672 ------
NM_032689chr1931532 1076 98 ------
NM_032701chr191625 ------
NM_032711chr1784242 4171 3530 2945 1621 1533 1452 273 34150 593 508 23621 1299 --
NM_032731chr1731495 1174 1083 ------
NM_032737chr1942393 1785 297 70 --22149 1845 12460
NM_032781chr112228 86 1244 --1142
NM_032788chr221241 1094 ------
NM_032800chr122562 239 ------
NM_032802chr15----1219 --
NM_032808chr155879 861 656 624 53 --1726 --
NM_032812chr101305 ------
NM_032826chr765188 4395 4273 4048 3787 330 160 --14849
NM_032828chr19124212 4061 3647 3329 3196 1502 1488 1461 1003 937 428 347 --13277 --
NM_032829chr1241069 959 849 233 ------
NM_032833chr132592 1925 1811 --1490 --
NM_032838chr191504 ------
NM_032857chr151155 ------
NM_032869chr82208 60 ------
NM_032871chr1141938 344 326 139 ------
NM_032873chr1133129 1657 1347 ------
NM_032875chr171220 ------
NM_032876chr1471730 878 773 433 389 213 100 ------
NM_032880chr11115 ------
NM_032975chr1863087 2843 2700 1011 991 658 --1649 --
NM_032978chr18----11115 --
NM_032979chr18----11115 --
NM_032980chr1863087 2843 2700 1011 991 658 --1649 --
NM_032981chr18----11115 --
NM_032998chr11365 --1847 --
NM_033018chrX----3232 186 166 --
NM_033020chr174503 4284 3356 3306 3284 1864 670 ------
NM_033030chr211385 ------
NM_033036chr1131387 1232 654 41618 411 267 111 ----
NM_033071chr61157 ------
NM_033089chr2021458 469 ----1543
NM_033116chr142232 89 ------
NM_033117chr9139 ------
NM_033121chr12189 --1269 --
NM_033129chr202639 536 1804 11455 --
NM_033133chr1762373 2345 1445 1414 1324 1195 --23299 856 --
NM_033136chr52423 90 ------
NM_033137chr52423 90 ------
NM_033211chr511332 ------
NM_033222chr911204 ------
NM_033224chr767246 6945 6808 3077 2929 1423 --17924 26653 2627
NM_033225chr8199 --13107 --
NM_033226chr162188 101 ------
NM_033255chr133339 151 25 ------
NM_033259chr3--1703 1361 --
NM_033266chr16268 28 ------
NM_033278chr11165 --125 --
NM_033285chr834068 3981 1154 ----11686
NM_033290chrX43135 2852 2671 2562 --13657 --
NM_033300chr131335 905 99 ------
NM_033310chr111278 --165 --
NM_033315chr1732139 1853 205 1113 11435 --
NM_033326chr1142339 1862 853 116 ------
NM_033331chr932890 481 344 12253 42884 2656 983 297 12902
NM_033340chr1041221 977 582 81 ------
NM_033343chr12345 293 ----139
NM_033360chr1212869 ------
NM_033389chr1764740 4099 3628 1831 1759 692 13261 ----
NM_033394chr221546 280 ------
NM_033401chr162138 107 ------
NM_033420chr1941004 895 812 219 1345 ----
NM_033425chr1132174 2138 391 ------
NM_033429chr1531228 1019 768 134 2861 272 --
NM_033449chr551873 1685 1406 566 494 ----1444
NM_033480chr642414 1939 802 559 ----12620
NM_033481chr642414 1939 802 559 ----12620
NM_033503chr1593801 3727 3074 3049 2937 2529 2483 1091 776 --33369 2949 2721 --
NM_033505chr276425 6362 5798 4552 4529 4484 533 --26471 5962 --
NM_033512chr8102900 2627 2236 1982 1900 783 549 509 294 87 --2563 556 12006
NM_033549chr55802 758 261 225 180 ------
NM_033551chr553248 2735 1375 1014 104 125 11295 --
NM_033624chr1211480 --1245 --
NM_033626chrX71625 1589 1374 1330 1250 1214 1134 --1575 1546
NM_033631chr153710 3001 1382 613 551 1862 ----
NM_033632chr4----1128 --
NM_033642chrX1836 ----1463
NM_033644chr542511 2098 1774 352 ------
NM_033645chr542511 2098 1774 352 ------
NM_033656chr2145712 5442 1728 174 --15073 --
NM_044472chr1----1284 --
NM_052828chr641364 616 403 386 --11427 --
NM_052834chr1822389 98 ------
NM_052840chr1511420 ----11491
NM_052846chr202497 346 1307 1447 1936
NM_052851chr1322050 1898 12003 ----
NM_052875chr1162174 2146 850 795 650 172 ------
NM_052877chr1148 ------
NM_052879chr1253316 3295 2916 2585 484 ----1457
NM_052880chr2231331 908 363 2926 384 ----
NM_052885chr1264265 3904 1274 911 470 436 --11680 --
NM_052896chr132175 1860 1623 1316 12479 --
NM_052898chr831766 224 164 ------
NM_052905chr231879 1823 1176 ------
NM_052907chr1254144 4128 3784 1419 114 ----1406
NM_052910chr1321900 321 1163 ----
NM_052911chr182980 312 ------
NM_052918chr10--13643 21124 1119 --
NM_052932chr111547 ------
NM_052936chrX128 --1874 --
NM_052939chr11141 ------
NM_052971chr51152 ------
NM_052978chr1431386 480 463 2741 240 1171 --
NM_052996chr1631584 1483 601 11494 ----
NM_053002chr3--1792 1463 1892
NM_053016chr986903 6595 6222 6211 5371 5152 1920 584 ----26322 1705
NM_053023chr1121031 112 ------
NM_053024chr3--1315 ----
NM_053025chr31653 ------
NM_053026chr31653 ------
NM_053027chr31653 ------
NM_053028chr31653 ------
NM_053031chr31653 ------
NM_053032chr31653 ------
NM_053064chr1432342 2277 551 ------
NM_053279chr852718 2709 2522 2426 42 32729 1850 1104 ----
NM_053281chrX1289 ------
NM_054013chr54767 255 136 126 --1595 --
NM_054025chr11145 11496 12191 11835
NM_054035chr172568 196 132 ----
NM_057175chr4------1869
NM_058241chr232118 1762 356 1790 1852 --
NM_058241chr232118 1762 356 1790 1852 --
NM_078471chr173911 253 40 --31063 879 290 --
NM_078473chr8--12042 ----
NM_078474chr15----1512 --
NM_079421chr191128 ------
NM_080415chr171830 ------
NM_080491chr1193908 3473 2926 2890 1197 908 790 749 573 1177 11450 --
NM_080544chr331319 1194 545 ------
NM_080546chr91231 ------
NM_080645chr611389 --1404 --
NM_080654chr11--1176 31295 126 36 --
NM_080664chr1421905 511 --12007 --
NM_080669chr17134787 4577 3476 3139 1947 1861 1270 1258 1252 953 565 501 64 ------
NM_080670chr53785 681 376 2645 288 ----
NM_080671chr252047 1747 1733 348 262 ------
NM_080676chr2033127 968 525 1950 11024 1302
NM_080679chr6----1667 --
NM_080680chr6----1667 --
NM_080681chr6----1667 --
NM_080686chr6134 ------
NM_080738chr121278 26 ------
NM_080759chr13--1300 ----
NM_080760chr13--1300 ----
NM_080764chr2252780 2691 746 512 219 --12789 --
NM_080792chr2031662 581 553 11567 22287 1936 --
NM_080827chr20168 ------
NM_080867chr1454971 4192 3775 3280 1151 --24716 4289 --
NM_080872chr853903 3246 3021 2911 460 ------
NM_080881chr51224 1163 ----
NM_080927chr3146 --1640 1404
NM_100264chr101136 ------
NM_100486chr101136 ------
NM_130385chr1122414 873 ------
NM_130387chr32850 61 --152 --
NM_130391chr933333 2332 389 --13444 --
NM_130392chr933333 2332 389 --13444 --
NM_130393chr933333 2332 389 --13444 --
NM_130436chr2152737 835 816 742 322 1806 ----
NM_130438chr2133314 1319 899 ------
NM_130439chr1012119 1874 ----
NM_130439chr1012119 1874 ----
NM_130440chr141172 1148 1063 1013 ------
NM_130459chr951629 1329 1159 1059 120 ------
NM_130795chr93766 616 148 ------
NM_130798chr1511023 ------
NM_130811chr202185 85 ------
NM_130846chr121709 ------
NM_133264chr1783760 3403 2924 2621 2605 1061 914 540 ------
NM_133266chr113338 181 102 ------
NM_133330chr461248 1202 1116 1092 825 725 ------
NM_133331chr461248 1202 1116 1092 825 725 ------
NM_133334chr476048 5987 5392 4898 4536 4088 1259 --11922 --
NM_133335chr461248 1202 1116 1092 825 725 ------
NM_133369chr54926 866 768 364 --1184 --
NM_133370chr463227 2811 2794 1295 1281 926 --1682 22236 1403
NM_133372chr532668 2016 168 --12504 --
NM_133433chr51359 ------
NM_133444chr1931511 343 125 --192 --
NM_133445chr921427 867 ------
NM_133452chr194998 337 252 32 --1203 --
NM_133457chr751393 1091 1044 248 168 157 21346 207 --
NM_133486chrX2370 82 ------
NM_133489chr12--2291 53 ----
NM_133496chr184489 4179 4108 3624 3115 1406 889 210 ------
NM_133498chr192119 22 ------
NM_133499chrX2840 790 ------
NM_133503chr121742 ------
NM_133504chr121742 ------
NM_133505chr121742 ------
NM_133506chr121742 ------
NM_133507chr121920 ------
NM_133625chr331263 1151 289 ------
NM_133631chr31630 11410 ----
NM_133638chr51195 ------
NM_133650chr61157 ------
NM_134325chr1----128 --
NM_134421chr22113 40 --2753 732 --
NM_134427chr93766 616 148 ------
NM_134442chr2----148 --
NM_134447chr191634 ------
NM_138270chrX23014 1078 ------
NM_138285chr21410 ------
NM_138288chr1442133 2033 1792 1440 ------
NM_138292chr1143356 2619 1150 178 ------
NM_138300chr141211 1152 1110 98 11219 ----
NM_138319chr152910 279 ------
NM_138338chr2252900 2723 2538 1382 764 ------
NM_138353chr193277 169 73 --146 1162
NM_138355chr172125 50 --123 --
NM_138395chr2122 --1339 --
NM_138415chr222551 292 --11656 --
NM_138423chr152686 648 1939 ----
NM_138426chr742473 2451 820 498 ------
NM_138430chr133520 363 109 ------
NM_138453chr5167 ------
NM_138457chr6113279 3220 3177 2904 2850 2535 1041 817 758 733 209 --1522 --
NM_138459chr621461 34 1359 ----
NM_138468chr245151 4955 775 29 --15096 --
NM_138473chr1245132 4752 4197 592 ------
NM_138479chr121733 1465 11320 ----
NM_138492chr521253 372 ------
NM_138494chr742271 2101 891 877 ------
NM_138555chr15------1406
NM_138559chr21148 --154 --
NM_138576chr1474685 4016 3684 3485 3410 2938 1415 --1985 11041
NM_138578chr202423 211 11326 31277 1143 1093 --
NM_138619chr1721039 295 ------
NM_138621chr254083 1162 1129 996 623 ------
NM_138713chr1688100 7715 7321 5160 2432 1488 917 419 --12880 --
NM_138714chr1688100 7715 7321 5160 2432 1488 917 419 --12880 --
NM_138717chr63565 157 55 ------
NM_138735chr21548 ------
NM_138766chr51156 ------
NM_138771chr7178 ------
NM_138779chr131220 ------
NM_138795chr11294 --1598 --
NM_138799chr231596 1375 806 ------
NM_138821chr51156 ------
NM_138822chr51156 ------
NM_138927chr21--1958 ----
NM_138961chr11--176 1403 --
NM_138966chr181621 ------
NM_138970chr1451896 914 602 373 319 ------
NM_138971chr1143356 2669 2578 2488 12974 13613 --
NM_138971chr1143356 2669 2578 2488 12974 13613 --
NM_138972chr1143356 2669 2578 2488 12974 13613 --
NM_138972chr1143356 2669 2578 2488 12974 13613 --
NM_138973chr1143356 2669 2578 2488 12974 13613 --
NM_138973chr1143356 2669 2578 2488 12974 13613 --
NM_138980chr41233 ------
NM_138982chr41233 ------
NM_138994chr162138 107 ------
NM_139015chr1221412 1368 --182 11620
NM_139035chrX1599 ------
NM_139045chr91694 ------
NM_139046chr102216 78 ------
NM_139047chr10182 ------
NM_139049chr10182 ------
NM_139057chr1562353 1977 1801 953 471 193 21047 43 1901 --
NM_139062chr174483 147 60 50 ------
NM_139068chr5175 1189 ----
NM_139069chr5175 1189 ----
NM_139071chr124414 332 246 84 --1594 --
NM_139125chr34482 331 120 24 ------
NM_139131chr11----1525 --
NM_139135chr121266 351 ------
NM_139156chr12308 80 ----1546
NM_139166chr8140 ------
NM_139168chr5----1266 --
NM_139169chr102424 181 ------
NM_139177chr1741233 618 387 58 ------
NM_139244chr61157 ------
NM_139245chr341364 1263 134 54 --21369 1255 --
NM_139246chr962213 1612 935 921 854 395 --1825 --
NM_139278chr841150 936 378 22 ----11071
NM_139280chr1731358 1127 128 --11189 --
NM_139283chr1262361 2349 1848 935 496 234 32583 892 726 ----
NM_139321chr2034175 3657 410 11086 ----
NM_139323chr2021318 645 ------
NM_144488chr93766 616 148 ------
NM_144489chr93766 616 148 ------
NM_144571chr435923 5594 5516 16700 ----
NM_144576chr12------1612
NM_144579chr2102831 2765 2631 2298 2213 2189 2027 1850 836 436 22469 2037 32773 2388 540 --
NM_144582chr242302 2199 324 110 --32613 2260 390 --
NM_144599chr1534971 4185 3823 --24997 128 25238 4664
NM_144600chr163623 433 362 ------
NM_144609chr17----21213 1183 --
NM_144610chr171388 ------
NM_144632chr231738 1708 341 31929 1510 293 ----
NM_144633chr331026 405 330 1275 1232 --
NM_144635chr321140 217 ------
NM_144643chr41102 ------
NM_144644chr4121 ------
NM_144664chr1142468 1575 1013 919 ------
NM_144667chr125952 773 312 195 54 ------
NM_144721chr422528 351 --12430 --
NM_144723chr52620 30 1608 ----
NM_144728chr11666 ------
NM_144729chr11666 ------
NM_144767chr1594583 4315 3854 2972 1579 1534 1430 1220 275 34219 681 350 ----
NM_144949chr212487 ------
NM_144967chrX2277 187 ------
NM_144982chr12193 --1211 --
NM_145010chr1022193 1557 --11946 --
NM_145021chr102276 127 ------
NM_145025chr621049 153 ------
NM_145049chr51123 ------
NM_145055chr1843733 1294 927 869 ------
NM_145063chr61179 ------
NM_145109chr171284 --1686 1856
NM_145119chrX------128
NM_145175chr251328 1189 1022 449 331 ------
NM_145185chr1931621 1596 522 11912 --1482
NM_145203chr131731 ------
NM_145206chr1022702 2156 22684 860 11076 --
NM_145259chr235791 5680 570 12101 15814 --
NM_145284chrX22518 1764 ------
NM_145296chr195827 742 204 34 28 ------
NM_145307chr1013754 1535 --13392
NM_145320chr713176 ------
NM_145321chr713176 ------
NM_145322chr713176 ------
NM_145341chr101536 ------
NM_145349chr1742046 1966 1576 313 ------
NM_145350chr1731398 1318 487 ------
NM_145638chr116985 861 713 348 227 196 ------
NM_145647chr81173 --1163 --
NM_145690chr81289 --11708 --
NM_145725chr14162 ------
NM_145726chr14162 ------
NM_145793chr101875 ------
NM_145804chr1121237 34 ------
NM_145808chr7147 21965 351 12066 --
NM_145861chr121278 26 ------
NM_145899chr64438 420 404 223 ------
NM_145901chr64438 420 404 223 ------
NM_145902chr64438 420 404 223 ------
NM_145903chr64438 420 404 223 ------
NM_145904chr64438 420 404 223 ------
NM_145905chr64438 420 404 223 ------
NM_145909chr63543 262 150 ------
NM_147150chr963414 3383 2734 2713 1401 1217 ------
NM_147156chr101327 ------
NM_147161chr111037 --1377 11106
NM_147168chr91118 ------
NM_147175chrX1597 ------
NM_147189chr841789 924 359 160 11528 ----
NM_147223chr241663 1527 724 486 ------
NM_147233chr231480 541 303 ------
NM_148174chr812226 ----11854
NM_148571chr1742003 1678 1409 193 --1240 --
NM_148894chr41968 ------
NM_148898chr71285 ------
NM_148899chr71285 ------
NM_148904chr11550 ------
NM_148905chr11550 ------
NM_148906chr11550 ------
NM_148907chr11550 ------
NM_148908chr11550 ------
NM_148909chr11550 ------
NM_148921chr1762078 1986 1935 1801 729 351 --1199 --
NM_148976chr111201 ------
NM_152222chr1141938 344 326 139 ------
NM_152227chr20----1617 --
NM_152233chr1421331 1262 ------
NM_152237chr2231549 281 130 --21319 59 --
NM_152238chr1----1240 --
NM_152244chr172463 415 ----11217
NM_152247chr221239 ------
NM_152253chr22113770 3625 1668 1608 1353 1170 822 293 194 185 37 1261 ----
NM_152261chr1221587 138 ------
NM_152263chr125980 4791 12414 12350 12195
NM_152265chr121129 577 ------
NM_152267chr223728 662 75 ------
NM_152271chr82975 364 ------
NM_152280chr173413 3017 2711 1311 884 730 439 12964 ----
NM_152289chr1931705 1309 99 1122 21284 1063 --
NM_152300chr173729 647 234 11596 ----
NM_152332chr1432635 2589 1879 ----12720
NM_152335chr152621 109 ------
NM_152342chr163531 488 197 ------
NM_152344chr17158 ----1548
NM_152375chr152252 2142 2108 1785 721 --12319 12473
NM_152380chr131176 656 271 ------
NM_152407chr542390 228 172 128 12566 ----
NM_152408chr5142 ------
NM_152409chr513013 --195 --
NM_152410chr61126 ------
NM_152423chrX11188 ------
NM_152424chrX33784 3151 1815 21056 36 24272 620 14281
NM_152437chr1212020 12051 ----
NM_152440chr121416 --172 --
NM_152470chr1864112 3081 1334 1143 817 724 ----12526
NM_152493chr121460 452 ------
NM_152520chr21352 ------
NM_152529chr221303 164 ------
NM_152538chr331550 1281 312 --11273 --
NM_152549chr51209 ------
NM_152574chr91158 ------
NM_152589chr121235 ------
NM_152594chr15------11493
NM_152598chr171155 --2296 251 --
NM_152624chr547402 6532 4925 1994 22812 638 15489 11491
NM_152629chr953086 2697 1262 676 493 12495 ----
NM_152641chr1222467 2110 ------
NM_152652chr163281 221 75 ------
NM_152660chr11650 ------
NM_152688chr6153 ------
NM_152695chrX11957 ------
NM_152713chr111215 ------
NM_152721chr18--1279 ----
NM_152722chr112708 37 ------
NM_152724chr102280 25 ------
NM_152733chr6116302 6242 6148 5926 4573 4270 4124 2532 1570 913 321 25936 5733 12200 35124 1976 1106
NM_152734chr674718 4529 3862 1527 1313 733 418 24861 908 21511 868 15388
NM_152742chr74459 386 216 70 ------
NM_152758chr811010 --12245 12459
NM_152787chrX23098 130 12748 23641 685 --
NM_152788chr12182 ------
NM_152829chr72884 846 --2966 48 --
NM_152835chr1----12706 --
NM_152836chr811755 ------
NM_152837chr811755 ------
NM_152838chr2022943 947 --13452 --
NM_152860chr124620 498 205 148 ------
NM_152896chr9135 ------
NM_152902chr111493 ------
NM_152932chr3------1328
NM_152989chr1221729 170 --1386 --
NM_153000chr181550 ----1217
NM_153028chr162265 205 ------
NM_153029chr1663901 2944 2562 2514 1398 1275 1794 23164 831 13045
NM_153035chr14777 577 170 49 ------
NM_153050chr2274515 4324 3497 3200 1743 1217 895 11810 1338 13396
NM_153051chr2274515 4324 3497 3200 1743 1217 895 11810 1338 13396
NM_153181chr181621 ------
NM_153183chrX21180 221 ------
NM_153188chr545071 4406 4387 2188 --14966 --
NM_153207chr1223572 944 ------
NM_153223chr511436 ------
NM_153228chr17192 ------
NM_153260chr151275 --1588 --
NM_153261chr1621014 981 ------
NM_153273chr382672 2399 2364 2000 1845 1768 970 275 1553 ----
NM_153280chrX177 ------
NM_153367chr1043493 1445 241 116 --23430 2946 --
NM_153450chr112616 62 ------
NM_153487chr693735 3693 3102 1792 1713 1398 733 429 127 23344 881 --11579
NM_153499chr1262735 2500 1943 1885 937 595 2718 497 52740 2652 2488 2034 2029 --
NM_153500chr1262735 2500 1943 1885 937 595 2718 497 52740 2652 2488 2034 2029 --
NM_153607chr522474 2264 ------
NM_153616chr152365 29 ------
NM_153617chr152365 29 ------
NM_153618chr152365 29 ------
NM_153619chr1532385 1267 175 ------
NM_153631chr721415 1391 ------
NM_153632chr721415 1391 ------
NM_153649chr121609 449 --12106 --
NM_153687chr1211499 --11146 --
NM_153693chr122631 238 ------
NM_153705chr1142373 2059 809 117 1842 ----
NM_153756chr161780 1376 768 489 404 145 11327 ----
NM_153757chr41265 ------
NM_153810chr1034541 3709 503 --13544 --
NM_170606chr7133 ------
NM_170607chr1721375 381 ------
NM_170662chr32187 129 ------
NM_170665chr1283689 2956 2791 1815 1521 885 598 542 --11070 --
NM_170679chr5------11120
NM_170706chr154164 4043 3220 1663 1360 ------
NM_170711chr194882 665 590 28 ------
NM_170731chr1152696 2644 2605 877 522 ------
NM_170732chr1152696 2644 2605 877 522 ------
NM_170733chr1152696 2644 2605 877 522 ------
NM_170734chr1152696 2644 2605 877 522 ------
NM_170735chr1152696 2644 2605 877 522 ------
NM_170751chr621065 480 ------
NM_170752chr621065 480 ------
NM_170768chr111424 21270 105 ----
NM_170774chr2043509 1663 1637 929 --1937 --
NM_170782chr11400 ------
NM_171998chrX31907 562 286 ------
NM_171999chr181139 --1763 --
NM_172016chr62908 436 1334 21089 1074 --
NM_172069chr23928 914 297 12024 ----
NM_172070chr221419 517 ------
NM_172071chr156398 6111 2620 2172 2017 --11719 --
NM_172103chr621770 199 ------
NM_172105chr621770 199 ------
NM_172169chr1041736 1408 625 388 174 1478 11723
NM_172170chr1041736 1408 625 388 174 1478 11723
NM_172171chr1041736 1408 625 388 174 1478 11723
NM_172173chr1041736 1408 625 388 174 1478 11723
NM_172206chr1721337 412 --21681 320 1251
NM_172226chr1262735 2500 1943 1885 937 595 2718 497 52740 2652 2488 2034 2029 --
NM_172375chr141266 1897 11091 --
NM_173065chr153452 3125 2672 2323 1260 --12738 --
NM_173074chr22346 83 ------
NM_173076chr2141 ------
NM_173156chr11645 11757 ----
NM_173198chr912026 --12031 --
NM_173200chr912026 --12031 --
NM_173201chr163291 265 196 ------
NM_173214chr1688100 7715 7321 5160 2432 1488 917 419 --12880 --
NM_173354chr212129 74 --11536 --
NM_173359chr32760 245 ------
NM_173468chr455000 3681 2255 732 120 1440 ----
NM_173470chrX32771 2005 418 --12812 12784
NM_173474chr16------139
NM_173475chr161460 11630 --11113
NM_173476chr1661869 1752 1586 1507 926 654 --22027 276 --
NM_173478chr1711094 ------
NM_173489chr5126 ------
NM_173500chr15----21355 498 11179
NM_173508chr111008 ------
NM_173510chr2232837 2535 1031 ------
NM_173511chr233443 3217 494 ------
NM_173515chr6----1203 --
NM_173519chr82561 36 1160 ----
NM_173525chr11160 ------
NM_173531chr1933224 2530 1563 --12663 --
NM_173552chr3--1222 2412 318 --
NM_173559chr61157 ------
NM_173564chr71585 --1688 --
NM_173595chr1275297 3997 3911 1215 850 559 183 --23881 172 24418 35
NM_173602chr1221481 1316 12818 1606 22944 1344
NM_173609chr151617 --1757 --
NM_173642chr1148569 8313 7895 6333 5956 5622 3511 3217 2460 2300 2045 1809 735 158 --19131 --
NM_173664chr551309 1089 514 141 78 ------
NM_173672chr611925 --12561 --
NM_173683chr811495 ------
NM_173694chrX42042 2018 1824 289 ------
NM_173809chr1041412 1401 1154 1037 ------
NM_173822chr21378 --11849 --
NM_173825chr322726 342 ------
NM_173851chr823395 3160 ----13842
NM_173854chr132051 1925 326 --22286 646 1202
NM_173872chr41241 --1285 --
NM_174909chr51818 ------
NM_174911chr822637 395 ------
NM_174921chr41351 ----1328
NM_174934chr1193579 2890 2681 2671 2430 1054 657 431 217 12961 23410 2224 13131
NM_175056chr322014 1874 12176 ----
NM_175061chr711674 ------
NM_175077chr2041283 1089 1066 990 1388 ----
NM_175610chr152388 342 ------
NM_175624chr1266745 5188 4719 2851 2279 540 ------
NM_175625chr1266745 5188 4719 2851 2279 540 ------
NM_175630chr23596 215 65 --3357 85 46 --
NM_175634chr811005 ------
NM_175635chr811005 ------
NM_175636chr811005 ------
NM_175709chr2252166 1879 883 438 43 12324 1625 --
NM_175733chr1162090 2039 2014 1675 1606 142 ------
NM_175747chr61376 ------
NM_175748chr1431889 1609 552 --2605 488 --
NM_175847chr194429 324 294 276 --11356 --
NM_175848chr201290 ------
NM_175848chr201290 ------
NM_175849chr201290 ------
NM_175849chr201290 ------
NM_175850chr201290 ------
NM_175850chr201290 ------
NM_175854chr1312014 12091 11014 --
NM_175856chr52630 127 ------
NM_175863chr611291 ------
NM_175873chr521184 147 1245 2301 41 --
NM_175884chr72932 230 --1354 --
NM_175907chr1842532 620 401 258 ------
NM_175931chr163709 437 82 12010 61911 1879 1847 1815 1783 97 --
NM_176792chr1031129 879 365 128 ----
NM_176795chr111422 ------
NM_176812chr201585 --2171 44 --
NM_176823chr173817 2859 2475 575 499 458 207 ------
NM_177398chr151688 1566 1424 1248 70 --21346 1262 --
NM_177399chr151688 1566 1424 1248 70 --21346 1262 --
NM_177414chr12339 152 ------
NM_177422chr1--1135 ----
NM_177438chr1424022 2972 ------
NM_177441chr17131 ------
NM_177454chr22292 183 ------
NM_177925chr12--1266 32606 2535 326 --
NM_177968chr211434 --1464 --
NM_177972chr1173916 3565 1629 1423 1291 1192 489 11568 33746 1455 627 --
NM_177974chr152686 648 1939 ----
NM_177983chr21124 ------
NM_177996chr2032656 1375 1303 --22249 1308 23247 2294
NM_177999chr9103628 3585 3443 3390 3271 2971 2675 1458 1084 823 --33148 471 192 --
NM_178006chr1322050 1898 12003 ----
NM_178007chr1322050 1898 12003 ----
NM_178010chr1221729 170 --1386 --
NM_178026chr202174 77 ----1381
NM_178037chr1242891 2814 560 193 1999 22584 973 --
NM_178038chr1242891 2814 560 193 1999 22584 973 --
NM_178126chr173689 651 501 --1126 --
NM_178135chr421111 201 ------
NM_178151chrX86202 5483 5253 5149 5135 4863 4785 2477 22129 908 11606 --
NM_178152chrX86202 5483 5253 5149 5135 4863 4785 2477 22129 908 11606 --
NM_178153chrX86202 5483 5253 5149 5135 4863 4785 2477 22129 908 11606 --
NM_178270chrX128 --1874 --
NM_178313chr2163 --11861 --
NM_178426chr121582 1498 --1461 --
NM_178427chr121482 1398 --1361 --
NM_178450chr51505 ------
NM_178454chr12635 557 ------
NM_178470chrX2240 100 ------
NM_178496chr331566 1402 1334 ------
NM_178500chr172147 100 ------
NM_178526chr1931901 1669 144 1136 21908 1291 --
NM_178539chr1251774 1731 1570 445 145 ------
NM_178565chr821341 1075 ------
NM_178566chr9----21829 578 --
NM_178585chr421325 594 --22581 33 --
NM_178586chr1432347 2336 2107 ------
NM_178812chr821490 624 --11324 --
NM_178818chr1611627 31765 684 539 32247 1582 176 --
NM_178830chr192255 71 --2200 195 --
NM_180976chr611007 ------
NM_180977chr611007 ------
NM_181050chr161131 ------
NM_181336chr62141 79 ------
NM_181349chr732515 2156 264 --1965 --
NM_181351chr1142214 2026 1921 1143 --12411 --
NM_181354chr811380 ------
NM_181357chr145689 430 374 262 179 ------
NM_181358chr123188 3078 --13269 --
NM_181425chr92123 30 --11195 --
NM_181443chr2012663 ------
NM_181457chr211249 ------
NM_181458chr221382 44 ------
NM_181460chr211195 ------
NM_181481chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_181482chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_181483chr1866964 4488 4390 2497 1751 1652 --12238 1203
NM_181492chr2221188 920 ------
NM_181504chr544026 3246 3013 988 ----23289 421
NM_181505chr17--1724 1144 --
NM_181507chr111357 ------
NM_181508chr111357 ------
NM_181521chr1666408 2082 2006 1786 1485 836 36546 5465 5320 37028 6363 4957 --
NM_181523chr544026 3246 3013 988 ----23289 421
NM_181524chr544026 3246 3013 988 ----23289 421
NM_181571chr102239 82 --1914 1890
NM_181659chr201638 --22192 1142 12990
NM_181659chr201638 --22192 1142 12990
NM_181672chrX2271 248 1258 ----
NM_181673chrX2271 248 1258 ----
NM_181689chr201740 ------
NM_181701chr931741 139 110 --12130 --
NM_181704chr2111166 ------
NM_181711chr123563 529 494 ------
NM_181712chr122075 1980 11993 ----
NM_181762chrX21032 448 ------
NM_181777chrX21032 448 ------
NM_181825chr221307 1585 ----
NM_181828chr2243361 3160 3042 43 11194 11303 --
NM_181829chr2243361 3160 3042 43 11194 11303 --
NM_181830chr2243361 3160 3042 43 11194 11303 --
NM_181832chr2243376 3175 3057 58 11209 11318 --
NM_181838chr521391 647 ------
NM_181839chr811280 --1220 --
NM_181843chr112312 287 1264 ----
NM_181844chr1761532 1371 1360 626 279 80 --1497 --
NM_181897chr341842 830 545 153 ------
NM_182314chrX31575 1218 562 ------
NM_182484chr2111166 ------
NM_182485chr42702 52 ----11373
NM_182493chr1664985 4839 3981 1918 676 90 ------
NM_182501chr283004 2965 2895 2492 1303 672 595 121 --21127 755 12281
NM_182503chr665525 5477 5339 4704 4165 1533 ------
NM_182509chr1411293 ------
NM_182520chr223909 361 339 ------
NM_182526chr1462723 1972 599 469 269 23 1372 1531 22395 859
NM_182527chr2272100 1595 1559 666 539 428 123 1860 2246 179 --
NM_182528chr22199 154 ------
NM_182537chr31303 ------
NM_182551chr233521 3244 2466 --1971 --
NM_182557chr1132198 1684 124 --21675 86 --
NM_182620chr1751689 547 396 348 120 ------
NM_182646chr42702 52 ----11373
NM_182687chr161188 ------
NM_182691chr71102 ------
NM_182692chr71102 ------
NM_182697chr71460 1236 ----
NM_182700chr741771 608 479 218 --11716 --
NM_182717chr101487 --11319 11295
NM_182718chr102239 82 --1914 1890
NM_182719chr102239 82 --1914 1890
NM_182720chr101487 --11319 11295
NM_182721chr101487 --11319 11295
NM_182722chr101487 --11319 11295
NM_182723chr101487 --11319 11295
NM_182724chr102239 82 --1914 1890
NM_182725chr102239 82 --1914 1890
NM_182756chr21417 ------
NM_182765chr10----31847 1842 506 --
NM_182769chr102239 82 --1914 1890
NM_182770chr102239 82 --1914 1890
NM_182771chr102239 82 --1914 1890
NM_182772chr102239 82 --1914 1890
NM_182797chr2011213 --1472 --
NM_182848chr131193 ------
NM_182850chr102239 82 --1914 1890
NM_182853chr101487 --11319 11295
NM_182896chr311629 ----1442
NM_182898chr762354 1554 1531 1031 121 22 ------
NM_182899chr762354 1554 1531 1031 121 22 ------
NM_182907chr632339 2036 975 --174 --
NM_182917chr3----1157 --
NM_182918chr2141359 1270 1047 303 ------
NM_182920chr311228 ------
NM_182925chr531335 485 379 1566 1345 --
NM_182948chr112866 ----32923 1007 429
NM_182961chr61157 ------
NM_182970chr20114320 3701 3447 3191 3185 3119 1651 1365 1189 1151 678 --33544 1462 35 --
NM_182972chr162561 2254 2243 1849 881 651 --11938 --
NM_183004chr1453204 1586 1460 953 98 --22625 147 --
NM_183006chr2041448 1283 1121 157 ------
NM_183011chr101487 --11319 11295
NM_183012chr101487 --11319 11295
NM_183013chr101487 --11319 11295
NM_183060chr102239 82 --1914 1890
NM_183079chr2011066 --11251 --
NM_183227chr611386 ------
NM_183234chr1521727 667 ------
NM_183235chr1521727 667 ------
NM_183236chr1521727 667 ------
NM_183393chr311028 ------
NM_183394chr311028 ------
NM_183398chr531179 1139 1057 ------
NM_183399chr531179 1139 1057 ------
NM_183400chr531179 1139 1057 ------
NM_183401chr531179 1139 1057 ------
NM_184231chr3160 --1184 --
NM_194247chr254184 3439 3428 3275 1701 ------
NM_194278chr1443175 2827 1461 1020 --1679 --
NM_194282chr423007 1157 12794 ----
NM_194285chr1122177 722 ------
NM_194286chr12166156 5428 5278 4762 4406 4271 2426 2320 1425 1413 1199 1168 962 834 307 220 13927 15211 23920 3765
NM_194314chr134179 4147 712 ------
NM_194317chr232624 2159 1725 12042 --179
NM_194328chr952685 2652 2544 2385 85 13204 ----
NM_194329chr952685 2652 2544 2385 85 13204 ----
NM_194330chr952685 2652 2544 2385 85 13204 ----
NM_194332chr952685 2652 2544 2385 85 13204 ----
NM_194356chr1242046 1866 704 380 ------
NM_194449chr181326 ------
NM_194463chrX21096 151 ------
NM_197939chr172460 195 ------
NM_197956chr96845 831 306 284 84 78 22008 816 ----
NM_197968chr131692 ------
NM_197970chr211385 ------
NM_198040chr161092 1003 432 376 251 141 --1899 1864
NM_198043chr103406 379 113 ------
NM_198044chr103406 379 113 ------
NM_198045chr103406 379 113 ------
NM_198046chr103406 379 113 ------
NM_198047chr2----1529 --
NM_198057chrX31119 356 275 ------
NM_198086chr1471730 878 773 433 389 213 100 ------
NM_198128chr182851 743 ------
NM_198147chr172950 209 ------
NM_198158chr322543 879 ------
NM_198159chr322543 879 ------
NM_198177chr322543 879 ------
NM_198178chr322543 879 ------
NM_198186chr93593 572 77 ------
NM_198187chr93593 572 77 ------
NM_198204chr1721375 381 ------
NM_198205chr1721375 381 ------
NM_198217chr13----1199 --
NM_198218chr13----1199 --
NM_198219chr13----1199 --
NM_198225chr1021976 1715 --1360 --
NM_198236chr1--1891 2283 168 156
NM_198240chr12128 1547 ----
NM_198241chr3----1157 --
NM_198242chr3----1157 --
NM_198244chr3----1157 --
NM_198268chr123188 3078 --13269 --
NM_198269chr123188 3078 --13269 --
NM_198270chrX22494 2402 ----12814
NM_198273chr511040 ------
NM_198291chr2061933 1905 1308 738 68 33 ----2567 180
NM_198390chr161575 ------
NM_198391chr2011397 ------
NM_198393chr171260 ----134
NM_198401chr851553 1415 1399 527 46 11198 ----
NM_198513chr841780 1718 507 230 ------
NM_198530chr1721208 1007 --11243 --
NM_198549chr142885 2733 2480 204 ------
NM_198560chr3113660 3427 3158 3007 1510 1443 1397 1166 804 703 565 13374 4869 745 293 169 133
NM_198567chr51197 ------
NM_198597chr101957 1942 1917 --
NM_198793chr352641 791 411 321 75 ------
NM_198829chr711315 ------
NM_198830chr172536 106 ------
NM_198844chr171904 ------
NM_198859chr385044 4978 4742 4289 3475 640 243 98 11779 --13640
NM_198880chr33597 290 277 ------
NM_198889chr411031 ------
NM_198896chr1112144 --22158 342 188
NM_198901chr7----21199 1032 --
NM_198902chr155608 135 77 64 30 ------
NM_198956chr741771 608 479 218 --11716 --
NM_198968chr1343570 3072 1202 143 --11565 --
NM_198991chr181775 ------
NM_198993chr1741704 1280 555 138 ------
NM_199040chr1253707 2906 2824 1448 960 --13791 --
NM_199141chr192312 281 1859 ----
NM_199144chr203638 439 363 11302 ----
NM_199160chr941716 558 324 95 ------
NM_199168chr101448 1154 1392 --
NM_199169chr2042954 2916 2682 2538 23561 2585 12520 1164
NM_199170chr2042954 2916 2682 2538 23561 2585 12520 1164
NM_199171chr2042954 2916 2682 2538 23561 2585 12520 1164
NM_199188chr1253316 3295 2916 2585 484 ----1457
NM_199190chr1253316 3295 2916 2585 484 ----1457
NM_199203chr203638 439 363 11302 ----
NM_199205chr8----1759 --
NM_199229chr211735 --11100 --
NM_199245chr1222275 1938 1896 1251 --
NM_199262chr1721743 837 164 11854 184
NM_199286chr121374 ------
NM_199320chr41858 ------
NM_199320chr41858 ------
NM_199321chr171904 ------
NM_199324chr41320 ------
NM_199334chr172481 416 --1486 --
NM_199359chr2041485 1278 1007 182 --11228 --
NM_199360chr2041485 1278 1007 182 --11228 --
NM_199361chr2041485 1278 1007 182 --11228 --
NM_199362chr2041485 1278 1007 182 --11228 --
NM_199363chr2041485 1278 1007 182 --11228 --
NM_199413chr15131 1262 ----
NM_199421chr1454971 4192 3775 3280 1151 --24716 4289 --
NM_199436chr243048 2535 1238 273 ------
NM_199437chr1132196 2057 276 1446 ----
NM_199438chr1132196 2057 276 1446 ----
NM_199439chr1132196 2057 276 1446 ----
NM_199461chr1022911 56 --23489 625 --
NM_199462chr184497 3990 3912 3906 3364 1574 1275 274 --34684 3274 1795 --
NM_199478chrX2703 472 ------
NM_199482chr231871 1525 784 ------
NM_199487chr204850 373 364 36 ----2935 95
NM_201266chr2----22558 352 --
NM_201279chr2----22558 352 --
NM_201280chr631603 661 381 ------
NM_201413chr212751 215 ------
NM_201414chr212751 215 ------
NM_201432chr1765758 1901 1555 906 585 541 --15249 11294
NM_201433chr1765758 1901 1555 906 585 541 --15249 11294
NM_201535chr142711 617 ------
NM_201536chr142711 617 ------
NM_201537chr142711 617 ------
NM_201538chr142711 617 ------
NM_201539chr142711 617 ------
NM_201540chr142711 617 ------
NM_201541chr142711 617 ------
NM_201548chr211191 1988 ----
NM_201568chr11645 11757 ----
NM_201569chr11645 11757 ----
NM_201591chr411794 ------
NM_201592chr411794 ------
NM_201599chrX5990 337 222 201 158 --11185 --
NM_201624chr111249 ------
NM_201628chr152623 1110 1096 906 833 12279 1822 --
NM_201999chr421137 819 ------
NM_203283chr41587 --