TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1976
miRNA Sequence: CCUCCUGCCCUCCUUGCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr284272 4248 3192 2924 1247 1168 795 623 1998 ----
NM_000170chr9----199 --
NM_000208chr1964589 3791 3603 3526 3510 3110 1457 23874 31 --
NM_000299chr182768 2741 2312 2288 1884 751 582 34 11141 32112 798 590 1905
NM_000314chr101334 ------
NM_000332chr657011 6417 1384 722 375 26874 339 45967 368 226 209 1160
NM_000337chr585933 5579 5301 2564 2160 739 580 443 21743 1365 ----
NM_000368chr9114754 4393 3728 3260 3252 1678 1381 1122 811 461 52 34081 3041 1199 11369 --
NM_000448chr1172805 2551 2279 2171 1079 683 254 13178 --1267
NM_000555chrX33113 2244 980 11131 --12468
NM_000599chr263794 3328 3005 1796 515 370 23261 436 43056 2848 1476 397 11536
NM_000701chr11108 ------
NM_000719chr1285891 4376 2199 2064 504 461 451 169 15690 22284 798 1950
NM_000831chr1115581 5552 4974 4885 4840 4039 1787 1529 1397 719 129 46087 2155 1571 617 --25685 1731
NM_000868chrX148 ------
NM_000875chr1566715 5258 5251 2272 2190 1910 16506 34266 2752 2443 1142
NM_000899chr1241246 737 260 238 1911 ----
NM_001001394chr21545 ------
NM_001001549chr71196 --21113 443 1770
NM_001001550chr71196 --21113 443 1770
NM_001001555chr71196 --21113 443 1770
NM_001001665chr253353 2636 2229 1347 781 12917 43304 3263 2210 762 12753
NM_001001684chr1732549 433 257 2843 526 1116 1964
NM_001001974chr101727 ------
NM_001002906chrY1417 ------
NM_001003652chr1857395 6953 6407 1934 1197 12015 --12426
NM_001003794chr382371 2068 2012 1984 1238 959 693 647 --12535 21162 49
NM_001003800chr993760 3046 2925 2774 733 437 204 153 67 --1116 11031
NM_001003940chr15113661 3443 3317 2614 2417 1468 1221 493 480 167 68 23040 2558 12846 --
NM_001003942chr15113661 3443 3317 2614 2417 1468 1221 493 480 167 68 23040 2558 12846 --
NM_001003943chr15113665 3447 3321 2618 2421 1472 1225 497 484 171 72 23044 2562 12850 --
NM_001004342chr1155661 5506 5301 4463 4066 3790 2202 1792 1291 1207 1189 561 400 164 95 22388 2233 22407 1368 --
NM_001005337chr182768 2741 2312 2288 1884 751 582 34 11141 32112 798 590 1905
NM_001005366chr123969 660 144 ----1406
NM_001005502chr1253652 1354 578 483 413 2832 592 --23773 1474
NM_001007097chr974232 3727 3622 3520 3494 1368 1093 --12047 11026
NM_001007102chr621459 463 ------
NM_001007466chr643588 3159 903 680 1237 11649 25063 3330
NM_001008220chr5113695 3518 3419 3307 2650 2424 931 580 324 249 134 32747 2682 466 32869 428 242 --
NM_001008408chr796166 5216 4756 4290 4279 1627 947 733 88 --45956 5860 1737 1584 --
NM_001008495chr811665 ------
NM_001010898chr142997 2509 2498 1014 33677 3279 3228 43203 2885 328 184 12896
NM_001011666chr745260 4116 1777 413 35899 5082 833 ----
NM_001013659chr1975048 4443 4411 4308 3594 3454 1894 23283 363 23736 3575 24425 3711
NM_001013693chr1172836 2661 2561 2289 2227 2030 1897 1160 1078 739 605 539 497 187 143 80 23 --42342 1116 510 474 --
NM_001013693chr1172836 2661 2561 2289 2227 2030 1897 1160 1078 739 605 539 497 187 143 80 23 --42342 1116 510 474 --
NM_001013839chr17142485 2454 2263 1928 1887 1801 1781 1751 1609 1038 524 409 334 132 --21912 591 --
NM_001014797chr10157653 7646 7473 7276 7016 6190 6170 6128 6102 5774 5697 5238 2648 1030 876 36876 6677 141 27587 6052 --
NM_001015882chr91682 ------
NM_001017440chr7137587 7324 7307 6503 5438 2992 2741 2639 2484 2197 1569 1205 189 56950 6447 2565 2553 419 22423 917 --
NM_001018050chr22143410 3354 3120 2980 2793 2625 2387 1271 1244 804 756 553 129 38 1981 21203 868 1391
NM_001018052chr22143410 3354 3120 2980 2793 2625 2387 1271 1244 804 756 553 129 38 1981 21203 868 1391
NM_001018065chr945804 5048 1336 40 --24162 557 --
NM_001018066chr945804 5048 1336 40 --24162 557 --
NM_001024401chr1682105 1128 1121 735 670 325 125 29 12304 2847 102 1878
NM_001024647chr1277527 5341 5032 2932 2293 2169 1999 36658 5323 1677 12775 --
NM_001025356chr1272317 2221 1950 1103 769 704 692 12604 ----
NM_001031679chr1253060 2649 1339 849 392 21041 746 --1863
NM_001031684chr21564 ------
NM_001031690chr7132532 2510 2477 2316 1943 1078 897 850 643 603 496 381 119 --1921 1527
NM_001031695chr2294949 4508 4352 4296 4146 3657 3304 2168 363 --11499 23487 578
NM_001031804chr1613175 ------
NM_001032283chr12------1198
NM_001032284chr12------1198
NM_001033045chr273232 2796 1767 1264 524 419 160 23563 3129 --33246 1056 538
NM_001037954chr1192933 2874 2842 2760 2733 2713 2438 1299 1078 ------
NM_001039538chr243415 2855 916 447 --156 --
NM_001039618chr11----11769 14230
NM_001039937chr1333950 3360 2956 ------
NM_001040424chr215925 833 542 460 342 ----21940 359
NM_001042403chr12----11013 --
NM_001042475chr62307 268 ------
NM_001042533chr3------13088
NM_001042573chr1792171 2158 2084 1884 1848 1509 850 740 502 --21672 899 1512
NM_001042599chr296489 5229 5089 2861 2499 2475 997 419 198 32263 2053 243 --12424
NM_001042604chr341421 1253 1155 971 1497 13746 --
NM_001042681chr162339 1700 1635 774 486 78 --1899 --
NM_001042682chr162339 1700 1635 774 486 78 --1899 --
NM_001042682chr162339 1700 1635 774 486 78 --1899 --
NM_001042749chrX1461 ------
NM_001042750chrX1461 ------
NM_001042751chrX1461 ------
NM_001044305chr61393 ------
NM_001100108chr1107325 6253 6124 5618 5043 2680 2544 787 627 328 37426 5483 195 15305 15600
NM_001106chr3109745 8799 7727 7433 6668 6197 3692 3332 3059 2598 48365 3723 2889 1046 13668 --
NM_001167chrX66233 6085 4225 4091 996 115 --14407 26200 4207
NM_001204chr265255 5029 4997 2922 2477 2170 47306 5011 4894 654 ----
NM_001237chr41955 ------
NM_001237chr41955 ------
NM_001344chr14------134
NM_001349chr21250 ------
NM_001378chr21405 ------
NM_001386chr812235 ------
NM_001401chr91230 ------
NM_001707chr71144 ------
NM_001717chr1521049 1037 ------
NM_001859chr963960 3770 3738 3635 718 583 13364 12596 23752 700
NM_001874chr1253652 1354 578 483 413 2832 592 --23773 1474
NM_001918chr198639 8003 5794 3203 2531 2429 1999 1686 1553 13011 23232 1534 47412 2545 1811 484
NM_001977chr411666 ------
NM_002006chr434558 1989 1359 11479 11970 14002
NM_002026chr22413 357 ------
NM_002129chr41292 ------
NM_002140chr911102 ------
NM_002360chr772061 1830 909 671 360 242 162 --4962 882 583 462 --
NM_002374chr243415 2855 916 447 --156 --
NM_002397chr512044 ------
NM_002478chr11----1497 2133 124
NM_002515chr141463 ------
NM_002563chr33959 417 45 ------
NM_002576chr1111135 ------
NM_002581chr91543 ----14348
NM_002635chr12190 ------
NM_003043chr373222 3155 2817 1061 894 574 463 21547 1450 54217 3732 1730 954 848 1545
NM_003045chr1384431 4418 3873 3611 3259 3248 851 62 34352 1495 1436 --11191
NM_003072chr191159 ------
NM_003099chr15116292 5546 4639 4619 4157 2152 1800 1729 1047 1019 986 44230 4190 1400 1102 14054 15512
NM_003108chr285155 2863 2793 2341 1916 1302 705 427 11789 42501 2371 2360 2323 11699
NM_003168chr171230 --1785 --
NM_003199chr1823971 865 12263 24028 597 --
NM_003216chr2272900 2830 2178 1147 907 517 425 11257 32836 565 130 12291
NM_003319chr2------1300
NM_003320chr11114293 4035 3348 2913 1388 1130 1093 835 712 598 365 --23845 1726 1184
NM_003338chr101705 ------
NM_003371chr972078 1461 840 642 493 473 349 --62002 1987 1917 1408 1380 560 21967 1468
NM_003382chr762396 2326 1499 949 750 693 32215 872 738 131 12319
NM_003412chr342986 2521 1927 1026 ------
NM_003418chr3----1334 --
NM_003482chr1252078 1093 631 333 245 --3947 799 141 127
NM_003559chr1763800 3645 3422 3001 745 57 11431 23517 3456 11118
NM_003607chr173612 2990 2759 2733 139 125 107 23393 2743 13579 --
NM_003740chr681592 1554 1406 597 318 289 276 129 --21758 486 --
NM_003799chr1874091 4001 2923 1648 830 594 115 --24135 920 --
NM_003872chr272519 2510 2324 788 619 260 225 32609 652 183 1157 22808 985
NM_003945chr5------1416
NM_003949chr1772038 1581 1554 1500 1428 659 549 11519 --11508
NM_003994chr1241246 737 260 238 1911 ----
NM_004050chr1452099 1804 812 182 51 2228 45 12448 --
NM_004093chr1331042 935 710 11175 --21089 864
NM_004171chr1169275 9129 8366 7428 2629 2380 23144 336 17848 --
NM_004238chr21113 ------
NM_004319chr12964 40 --11103 12683
NM_004392chr1312440 ------
NM_004420chr1131488 961 876 21838 739 62145 2035 1989 924 704 507 2894 621
NM_004472chr5137 ------
NM_004491chr1993482 3460 3397 3093 3048 3017 1626 1553 789 2691 27 33675 1202 99 --
NM_004503chr12------1755
NM_004614chr1631528 362 91 --42268 2148 1552 375 12188
NM_004677chrY1417 ------
NM_004768chr11386 ------
NM_004774chr1792999 2908 2632 2106 2003 975 854 815 552 ----11079
NM_004845chrX73576 3358 2631 1412 1339 99 35 --12781 --
NM_004863chr1475324 4833 4729 4267 3650 3476 1723 11463 1876 11705
NM_004866chr544595 3985 668 660 14168 --14289
NM_004904chr745260 4116 1777 413 35899 5082 833 ----
NM_004976chr11154919 4785 4396 4278 4044 3518 3430 3416 2057 1769 1640 1611 1547 934 275 1573 64116 1273 1211 457 298 268 --
NM_004992chrX128050 7538 7357 6138 6045 3242 3214 1869 1729 1668 796 662 2899 712 37601 5815 3166 1490
NM_004992chrX128050 7538 7357 6138 6045 3242 3214 1869 1729 1668 796 662 2899 712 37601 5815 3166 1490
NM_005056chr1265620 5247 5218 3440 748 625 1855 23919 160 --
NM_005076chr153224 3011 394 175 153 --22663 147 23331 895
NM_005168chr22603 117 ----11436
NM_005188chr1157740 6754 6671 5379 445 17298 179 16330
NM_005235chr296489 5229 5089 2861 2499 2475 997 419 198 32263 2053 243 --12424
NM_005311chr71196 --21113 443 1770
NM_005338chr763779 3515 2837 2589 291 98 --34051 3490 544 13632
NM_005450chr171193 ------
NM_005497chr17115674 5540 5198 5100 4428 4398 4294 3784 2359 704 514 1137 ----
NM_005499chr191187 ------
NM_005569chr225589 373 275 150 78 --41576 1325 430 24 --
NM_005578chr333161 3142 197 --13405 11174
NM_005596chr966147 5937 4569 4185 1267 526 12033 ----
NM_005647chrX63044 2686 1309 1120 939 88 1961 2945 142 --
NM_005786chr181254 ------
NM_005828chr1763834 3388 3377 2010 673 144 --131 33697 3397 3144
NM_005840chrX97667 7441 5181 4916 2984 1976 1229 971 164 1138 ----
NM_005888chr12190 ------
NM_005901chr1857395 6953 6407 1934 1197 12015 --12426
NM_005902chr1594649 3512 3072 1743 1700 1549 660 428 415 13478 2829 54 --
NM_005909chr563936 3613 3555 3458 3047 476 ----32663 376 337
NM_005933chr1142636 2316 883 650 12742 1687 22381 976
NM_005935chr464744 4270 3323 1657 778 320 --14368 --
NM_005937chr1784002 3972 3494 3207 2665 853 714 262 21376 1243 22687 531 1588
NM_005966chr211611 ------
NM_005996chr12----1257 --
NM_006016chr611802 ------
NM_006080chr732888 1001 707 ------
NM_006095chr413984 ------
NM_006122chr1582738 2029 1926 847 646 557 495 469 32429 1724 1008 21055 758 12043
NM_006203chr555295 5076 4164 1645 855 --1457 --
NM_006237chr1372195 1844 816 354 345 311 25 11464 1296 --
NM_006238chr652020 1813 1559 1272 419 --31619 1300 633 11659
NM_006252chr185935 5754 5036 4933 1593 1289 1135 123 32478 2299 2205 ----
NM_006258chr101316 ------
NM_006306chrX115658 5642 5425 5140 4219 4191 3636 1837 797 778 494 14173 25729 5594 --
NM_006451chr5----1394 --
NM_006465chr1582067 1958 1914 1802 455 336 200 181 --11442 11620
NM_006489chr141463 ------
NM_006496chr11499 ------
NM_006517chrX92248 2013 1904 1827 1627 1609 1452 458 375 21923 1888 ----
NM_006546chr1785416 4963 4869 4856 4506 4367 1928 846 24540 4321 11066 12599
NM_006557chr9----1477 --
NM_006603chrX1461 ------
NM_006650chr5113695 3518 3419 3307 2650 2424 931 580 324 249 134 32747 2682 466 32869 428 242 --
NM_006699chr152221 2133 1802 545 213 11095 1357 --
NM_006729chrX65611 5064 4774 1234 996 947 ----11913
NM_006750chr16106845 6815 5942 5910 3124 2550 1596 1232 779 379 2928 787 16796 12481
NM_006790chr51387 ------
NM_006826chr21480 ------
NM_006838chr1241787 1695 727 657 ------
NM_006874chr41219 ------
NM_006885chr1653895 3871 3683 3375 296 --11379 13695
NM_006940chr1211524 ------
NM_007023chr211057 ------
NM_007030chr5124565 3924 3854 3644 3315 1670 1423 1025 672 383 344 46 53867 3832 3762 3622 3237 33229 1082 401 --
NM_007050chr20177374 7362 6498 6231 5853 5819 5410 3163 3018 2510 1993 810 791 736 487 392 87 22220 1384 15252 --
NM_007078chr10122789 2714 2598 2384 2323 2002 1928 1871 1104 439 189 69 ------
NM_007249chr1367795 6580 6131 1459 133 64 23524 883 --12496
NM_007283chr382371 2068 2012 1984 1238 959 693 647 --12535 21162 49
NM_007347chr15--13124 --22207 538
NM_012095chr1063204 3069 2587 565 255 155 --13284 13186
NM_012102chr162339 1700 1635 774 486 78 --1899 --
NM_012104chr113982 229 191 13568 13170 42553 1076 455 74
NM_012104chr113982 229 191 13568 13170 42553 1076 455 74
NM_012141chr1333950 3360 2956 ------
NM_012199chr1104089 3988 3978 3220 3085 1730 571 461 116 54 ------
NM_012287chr353881 3646 3567 1748 289 ----1178
NM_012290chr211659 ------
NM_012296chr11193948 3857 3479 2671 2633 2397 1560 1510 1431 1351 1335 1238 1004 942 745 660 629 260 27 1901 --33459 1063 519
NM_012306chr12103288 3235 2963 2721 2639 1349 1295 809 520 310 22705 610 2701 688 32732 2208 326
NM_012316chr195141 4818 4683 3903 1292 1243 293 285 74 14800 12219 25123 791
NM_012399chr2211595 ------
NM_013261chr413109 ------
NM_013279chr1151513 1504 921 600 39 --41854 1589 1495 433 --
NM_013313chr2283477 3126 2352 1256 729 697 534 431 12974 22334 72 1548
NM_014153chr161147 ------
NM_014240chr353746 2857 1574 1206 628 --21391 110 23862 32
NM_014289chrX1289 ------
NM_014309chr2294939 4498 4342 4286 4136 3647 3294 2158 353 --11489 23477 568
NM_014338chr221131 ----1997
NM_014372chr11189 ------
NM_014500chrX1101 ------
NM_014661chr10123436 2964 2937 2865 2642 1379 1014 972 928 802 403 22 32429 922 543 33745 2731 1003 --
NM_014690chr7132532 2510 2477 2316 1943 1078 897 850 643 603 496 381 119 --1921 1527
NM_014730chr12104741 4452 4422 4411 3925 1579 1013 1007 953 369 13863 24725 3701 --
NM_014730chr12104741 4452 4422 4411 3925 1579 1013 1007 953 369 13863 24725 3701 --
NM_014755chr233642 3162 3144 --12814 1956
NM_014766chr793674 3429 3252 1480 1296 1179 870 781 365 1687 12940 --
NM_014826chr173612 2990 2759 2733 139 125 107 23393 2743 13579 --
NM_014832chr131696 --11773 --
NM_014873chr134075 3875 3358 --135 --
NM_014909chr14213669 3582 3552 3538 3237 3105 2851 2560 2544 2441 1354 1174 1076 1057 935 897 866 558 513 119 104 1609 22447 519 --
NM_014912chr1011116 ------
NM_014926chr311011 ------
NM_014953chr1344301 3044 1754 588 --11248 --
NM_014989chr6----11910 --
NM_015023chr111306 21821 69 51789 1593 381 229 60 --
NM_015035chr20135976 5851 5473 5441 5338 4882 4501 4488 4315 2350 1656 496 239 56251 5904 5121 4832 1717 36522 5819 2641 14767
NM_015054chr12143 ------
NM_015074chr194267 4109 3291 3264 3068 1278 1144 920 870 1802 11009 24030 1260
NM_015076chr664420 3393 3356 3233 3195 151 11251 ----
NM_015082chr592470 2345 2310 2288 2268 2254 2058 2004 423 --1429 --
NM_015090chr1136117 5496 4634 4150 4102 2298 1758 1678 1458 1432 1169 827 683 44791 1426 1264 470 12057 --
NM_015094chr2294229 3993 3808 1269 716 454 370 263 199 21435 850 53823 3715 1260 760 84 --
NM_015203chr1----154 --
NM_015213chr112328 26 --192 199
NM_015219chr17142485 2454 2263 1928 1887 1801 1781 1751 1609 1038 524 409 334 132 --21912 591 --
NM_015275chr1211361 ------
NM_015299chr1483837 3237 3218 2562 1509 601 344 335 23111 2454 ----
NM_015310chr876879 6135 5861 2784 815 615 591 15256 16726 15955
NM_015313chr1163509 3308 3024 1921 951 294 --1990 --
NM_015375chr1114895 4291 4188 3861 3579 1941 1194 1069 866 344 147 34324 3940 3417 --34305 1923 880
NM_015520chr321957 495 ----3542 473 398
NM_015550chr722576 761 ----12620
NM_015569chr111303 ------
NM_015576chr322039 2032 12449 ----
NM_015578chr1911951 ----11419
NM_015686chrX62314 1573 817 629 366 95 22110 215 1227 12154
NM_015879chr1867328 6543 6498 5441 386 175 26398 5906 --16315
NM_015981chr582294 2284 2149 2067 1998 910 513 354 ----22738 2417
NM_016002chr11142 ------
NM_016009chr154326 3530 3427 1224 443 11884 --13544
NM_016125chr171125 ------
NM_016132chr1512287 --1774 13110
NM_016169chr1083075 2933 2834 2295 2233 2151 192 31 --52705 2262 2162 760 374 --
NM_016206chr358090 3219 2552 2533 2518 25845 1439 17138 --
NM_016239chr173858 801 268 --4771 581 221 133 --
NM_016290chr5----140 --
NM_016396chr1521881 44 12298 --12670
NM_016424chr1711540 ------
NM_016569chr12----1257 --
NM_016577chr384307 3877 3822 3001 1755 1690 1645 133 --14286 --
NM_016621chr11134397 4248 4213 4179 4129 4070 4063 3912 1802 1572 1139 815 362 13897 21812 558 --
NM_016733chr225589 373 275 150 78 --41576 1325 430 24 --
NM_017412chr81445 ----1503
NM_017415chr534127 66 22 ----43995 1685 1533 1299
NM_017596chr1114408 4400 4275 3284 3136 3075 3039 2858 1667 767 577 21812 222 14068 --
NM_017637chr975789 3446 2250 2125 1543 1227 630 27978 3214 --18540
NM_017644chr354279 1431 1183 936 308 1448 1917 1646
NM_017739chr1176 ----1225
NM_017741chr442139 898 761 346 32256 379 360 11003 --
NM_017784chr3147 ------
NM_017848chrX74603 4561 3472 3458 3277 3086 1359 ------
NM_017849chr231102 1086 101 23000 135 1652 12245
NM_017902chr10115301 5169 5072 4974 4249 3635 1920 1404 489 159 135 174 14241 --
NM_017919chr985505 4832 4816 4339 3960 1935 1474 1383 ----24299 661
NM_018014chr221024 22 --2562 527 1554
NM_018036chr1443612 1368 1149 46 1425 --13116
NM_018085chr1178031 7668 7205 6641 6605 6307 5853 5511 2985 2848 2740 1767 1664 1241 495 363 356 22500 1781 --26289 1360
NM_018155chr31140 ------
NM_018191chr1331982 1516 147 --1381 --
NM_018362chr1111099 ------
NM_018373chr1472088 1714 1676 1452 1349 1232 661 1797 15890 11466
NM_018374chr7--23588 83 11330 13552
NM_018475chr41580 ------
NM_018477chr14177 ------
NM_018691chr51803 ----1119
NM_018947chr714202 15002 24012 938 14318
NM_019001chr341421 1253 1155 971 1497 13746 --
NM_019044chr231421 1243 904 24381 857 24195 1104 11680
NM_019557chr11714 ------
NM_019592chr93911 878 96 ------
NM_020135chr61323 ------
NM_020245chr633494 809 586 22020 143 11555 24969 3236
NM_020440chr173036 2363 2136 939 888 545 40 1879 21216 1046 --
NM_020443chr185669 4676 1885 1654 955 425 120 109 25596 5213 ----
NM_020449chrX----1666 --
NM_020466chr643388 1159 369 337 24318 1184 24749 4216 1487
NM_020717chrX64857 4617 3576 1774 1653 1150 44754 4439 634 173 11928 34871 3177 506
NM_020718chr1656370 5519 5152 452 416 ----15179
NM_020727chr2132599 1592 1331 ------
NM_020772chr1757739 7577 2791 604 562 17331 18165 17900
NM_020854chr181528 ------
NM_021003chr141768 ------
NM_021072chr5------1575
NM_021116chr7308209 7977 7703 7569 6978 6609 6450 6418 6310 6084 6049 5934 5788 3497 3299 3146 2912 2480 2182 1899 1806 1787 1766 1723 1499 1424 1198 1085 713 105 28141 6717 47738 6394 5871 1677 12843
NM_021155chr1922015 1143 ------
NM_021165chr11771 ------
NM_021192chr21314 ------
NM_021622chr101727 ------
NM_021785chrX1335 ------
NM_021813chr664189 4138 2152 1484 1348 1002 --1174 --
NM_021914chr14----1690 --
NM_021940chr61393 ------
NM_021945chr662692 1328 1134 589 409 85 --11050 22740 446
NM_022062chr1141456 268 90 54 --1493 138
NM_022166chr1674908 4446 2182 1535 799 164 31 45505 2218 1310 672 21789 1324 --
NM_022340chr383093 980 723 130 96 75 59 34 2845 613 145 1962
NM_022351chr823300 2456 ----12624
NM_022456chr1277527 5341 5032 2932 2293 2169 1999 36658 5323 1677 12775 --
NM_022497chr363161 2598 2566 1395 1034 684 --23045 2579 --
NM_022719chr22123303 2924 2807 2733 2477 1245 1236 1119 998 770 124 47 --23458 3054 --
NM_022753chr122219 547 ----1559
NM_022758chr653199 2652 2628 2138 528 --23112 2222 13014
NM_022841chr1532191 520 143 ------
NM_022913chr51205 ------
NM_024052chr1762742 2572 2170 2112 701 481 21157 88 ----
NM_024294chr653199 2652 2628 2138 528 --23112 2222 13014
NM_024345chr974528 2295 1747 1715 1612 1424 1170 --1392 1411
NM_024408chr121387 118 178 --1768
NM_024491chr33538 407 61 --1488 --
NM_024594chr531714 1646 1216 --11251 --
NM_024607chr863223 1787 1755 1148 777 761 23785 1021 --21769 1139
NM_024613chr811600 ------
NM_024674chr163020 2836 2605 842 431 230 22939 1089 13013 23080 2619
NM_024698chr116967 904 488 139 132 37 --2126 117 --
NM_024759chr82853 740 ------
NM_024770chr2106711 6263 5793 4263 2683 2121 2089 1983 1058 715 24891 819 --12103
NM_024963chr7165415 5221 5189 5083 4767 4633 3933 3624 2375 2164 2141 1731 1283 1091 988 697 24664 3779 55202 5064 2341 2171 51 24781 1105
NM_025079chr11165 ------
NM_025129chr19----1102 --
NM_025222chr392688 2459 2325 2178 2072 1958 1845 587 48 11209 1715 12441
NM_030799chr531352 600 570 ----2584 465
NM_030918chr1114772 4716 4518 4300 4247 3329 2143 1746 1591 1049 410 34662 4332 214 ----
NM_031262chr911045 ------
NM_031263chr911102 ------
NM_031427chr14125885 4670 4340 4308 4204 3994 3740 1730 1698 1595 1268 1224 ----24322 1712
NM_031468chr7137587 7324 7307 6503 5438 2992 2741 2639 2484 2197 1569 1205 189 56950 6447 2565 2553 419 22423 917 --
NM_031845chr243415 2855 916 447 --156 --
NM_031847chr243415 2855 916 447 --156 --
NM_031886chr1972387 2043 1040 536 394 59 22 22326 1939 --22351 2057
NM_031915chr131231 ------
NM_031918chr1991913 1873 1567 1516 1239 737 621 279 51 --31815 1798 1459 21954 1612
NM_032147chr12----11013 --
NM_032208chr242591 2468 715 434 23613 44 --12655
NM_032373chr1055379 4505 4097 3963 174 --15259 14079
NM_032438chr621459 463 ------
NM_032557chr4----1645 --
NM_032778chr3------13088
NM_032932chr17196260 5827 5705 5295 5046 5023 4999 4557 4387 4378 4076 3979 3918 3894 1677 1488 1131 449 288 24302 1088 34151 2409 823 15008
NM_033056chr10------1519
NM_033083chr363187 3054 2998 2547 2476 709 --2955 116 1415
NM_033222chr911158 ------
NM_033224chr777874 6492 6433 3232 2946 1861 1659 ----37346 5263 4973
NM_033387chr992644 2144 1941 1888 896 557 376 350 203 --22303 356 --
NM_033425chr1192933 2874 2842 2760 2733 2713 2438 1299 1078 ------
NM_033503chr15113661 3443 3317 2614 2417 1468 1221 493 480 167 68 23040 2558 12846 --
NM_052876chr1992551 2313 2180 1056 1034 903 819 422 188 42281 840 305 177 12251 12261
NM_052896chr181928 1033 899 807 646 532 70 64 1918 31811 1671 795 --
NM_052906chr22134797 4741 4670 4661 4020 3766 3566 3201 1923 1046 860 427 298 44480 3704 819 110 64637 3630 3227 3106 1895 1830 --
NM_053016chr997691 7629 7476 6797 6015 5994 5636 3057 2871 27673 3166 46813 6778 6635 3204 13179
NM_053025chr31689 ------
NM_053026chr31689 ------
NM_053027chr31689 ------
NM_053028chr31689 ------
NM_053031chr31689 ------
NM_053032chr31689 ------
NM_053042chr443173 1138 146 129 ------
NM_053043chr796166 5216 4756 4290 4279 1627 947 733 88 --45956 5860 1737 1584 --
NM_057159chr91230 ------
NM_058237chr142331 195 ----143
NM_080491chr11193948 3857 3479 2671 2633 2397 1560 1510 1431 1351 1335 1238 1004 942 745 660 629 260 27 1901 --33459 1063 519
NM_080759chr1312440 ------
NM_080760chr1312440 ------
NM_080797chr20113244 3148 2908 2473 2411 949 872 598 337 136 89 32828 403 186 23415 82 --
NM_080836chr20114442 4418 4398 4360 3112 1850 1246 788 779 560 274 34387 3225 666 33787 3443 1683 --
NM_080862chr331122 498 44 1974 1417 1359
NM_130395chr61323 ------
NM_130446chr3143760 3382 3347 3337 3248 2895 2685 1607 894 697 591 479 410 208 1117 33434 3282 710 --
NM_133170chr20177374 7362 6498 6231 5853 5819 5410 3163 3018 2510 1993 810 791 736 487 392 87 22220 1384 15252 --
NM_133334chr4116347 5823 5773 4420 1809 1641 1264 1237 508 424 302 --11733 --
NM_133378chr2------1300
NM_133432chr2------1300
NM_133437chr2------1300
NM_138288chr1421649 540 ----11867
NM_138338chr22143410 3354 3120 2980 2793 2625 2387 1271 1244 804 756 553 129 38 1981 21203 868 1391
NM_138468chr2105654 5304 5288 5116 4253 4193 3926 2360 1564 682 11429 --23908 1546
NM_138559chr211014 --2552 517 1544
NM_138638chr14----1690 --
NM_138799chr241901 1329 784 492 --11408 12018
NM_138959chr196464 6139 5699 4812 4559 4332 2302 2119 1387 42193 928 493 382 34825 879 172 11374
NM_138971chr113982 229 191 13568 13170 42553 1076 455 74
NM_138971chr113982 229 191 13568 13170 42553 1076 455 74
NM_138972chr113982 229 191 13568 13170 42553 1076 455 74
NM_138972chr113982 229 191 13568 13170 42553 1076 455 74
NM_138973chr113982 229 191 13568 13170 42553 1076 455 74
NM_138973chr113982 229 191 13568 13170 42553 1076 455 74
NM_144568chr141142 ------
NM_144579chr282890 2677 1051 980 814 784 85 57 --32788 1934 406 --
NM_144660chr10------1321
NM_144973chr1264357 3865 3357 1794 1127 650 24654 1703 34946 3338 95 11808
NM_145025chr6190 ------
NM_145176chr632275 227 47 1510 12522 --
NM_145313chr1071652 1335 1141 1085 524 499 204 --21184 645 --
NM_145320chr722576 761 ----12620
NM_145321chr722576 761 ----12620
NM_145322chr722576 761 ----12620
NM_145644chr2----1352 --
NM_147156chr1011344 ------
NM_147202chr9122453 2101 2035 1003 896 815 654 363 323 219 156 52 ------
NM_148955chr15116292 5546 4639 4619 4157 2152 1800 1729 1047 1019 986 44230 4190 1400 1102 14054 15512
NM_148960chr171923 1891 1788 1285 1258 583 375 21607 325 21447 542 11905
NM_152287chr1652319 2287 996 395 326 1522 22036 1913 32301 1870 1038
NM_152305chr341582 859 595 469 --2831 557 --
NM_152470chr1873624 3461 3174 3137 3000 380 264 1775 23394 679 1230
NM_152529chr273232 2796 1767 1264 524 419 160 23563 3129 --33246 1056 538
NM_152624chr527201 105 16097 --11552
NM_152688chr61253 ------
NM_152826chr15116292 5546 4639 4619 4157 2152 1800 1729 1047 1019 986 44230 4190 1400 1102 14054 15512
NM_152854chr203179 118 21 2315 32 --3603 152 86
NM_152989chr1211524 ------
NM_153035chr143065 2597 484 175 1162 22380 2323 22522 2499
NM_153182chr3------13088
NM_153223chr521341 1154 ----1305
NM_153608chr191638 ----1530
NM_153693chr12------1755
NM_171825chr582294 2284 2149 2067 1998 910 513 354 ----22738 2417
NM_172071chr137154 7038 1107 14719 12652 21578 64
NM_173495chrX21837 329 11704 1843 12024
NM_173582chr1185545 5301 5269 4267 1660 1442 1410 1307 25168 1841 11641 25283 1424
NM_173596chr12----181 --
NM_173832chr8162832 2624 2589 2538 2516 1348 1323 1298 1273 1248 1223 1198 1173 1148 1123 97 12477 --1367
NM_173848chr8------1887
NM_174934chr1183277 2260 1165 883 562 420 328 29 2233 208 12986 --
NM_175611chr21121 ------
NM_175623chr1277527 5341 5032 2932 2293 2169 1999 36658 5323 1677 12775 --
NM_175624chr1277622 5436 5127 3027 2388 2264 2094 36753 5418 1772 12870 --
NM_175625chr1277622 5436 5127 3027 2388 2264 2094 36753 5418 1772 12870 --
NM_176871chr8113244 3210 3198 3076 2591 2464 2226 814 693 206 145 --12509 1359
NM_177952chr141768 ------
NM_177963chr1152046 1736 565 514 446 21832 1724 51812 1447 1339 494 342 --
NM_177972chr11114293 4035 3348 2913 1388 1130 1093 835 712 598 365 --23845 1726 1184
NM_177977chr1772038 1581 1554 1500 1428 659 549 11519 --11508
NM_177999chr973692 3603 3115 2960 2671 2626 2385 --13487 22665 1059
NM_178010chr1211524 ------
NM_178123chr21324 ------
NM_178151chrX33113 2244 980 11131 --12468
NM_178152chrX33113 2244 980 11131 --12468
NM_178153chrX33113 2244 980 11131 --12468
NM_181354chr811125 ----128
NM_181521chr1686639 5675 5489 5199 5002 2185 1688 1375 ------
NM_182515chr1986704 4751 4719 4617 4206 4174 4079 865 ----34733 981 31
NM_182688chr2142010 1908 871 839 42193 1775 424 362 --21890 853
NM_182758chr1532787 1096 802 21315 1135 121 13716
NM_182789chr5----1394 --
NM_182898chr745260 4116 1777 413 35899 5082 833 ----
NM_182899chr745260 4116 1777 413 35899 5082 833 ----
NM_182970chr20123747 3635 3571 2945 2657 1632 1493 973 646 500 90 75 33075 2618 1440 24137 1195 11095
NM_182972chr11555 ------
NM_183323chr5----1394 --
NM_194285chr1132775 1346 1089 ----23118 2894
NM_194286chr12125731 4003 2463 2415 1981 1848 1709 1464 781 633 375 182 25591 627 --11158
NM_194314chr155603 4371 3557 2201 636 ------
NM_198320chr1253652 1354 578 483 413 2832 592 --23773 1474
NM_198490chr383324 3124 2920 1286 1255 894 186 154 --42892 2753 2335 283 13139
NM_199044chr152625 2393 2361 1092 660 1313 12374 12737
NM_199133chr51274 ------
NM_199462chr1114895 4291 4188 3861 3579 1941 1194 1069 866 344 147 34324 3940 3417 --34305 1923 880
NM_201266chr272519 2510 2324 788 619 260 225 32609 652 183 1157 22808 985
NM_201279chr272519 2510 2324 788 619 260 225 32609 652 183 1157 22808 985
NM_201999chr41219 ------
NM_206832chr17------1309
NM_206853chr623937 3770 --12927 --
NM_206909chr876879 6135 5861 2784 815 615 591 15256 16726 15955
NM_207012chr1063204 3069 2587 565 255 155 --13284 13186
NM_207380chr15123560 3259 3149 3103 2894 2760 2708 2691 2570 1159 682 559 21181 475 31171 1118 1067 12619
NM_207445chr1531907 1785 532 126 --1282
NM_212464chr1581776 1596 1363 814 717 599 99 42 1112 1742 --
NM_212467chr1552353 2173 1940 393 176 --11823 11666
NM_212474chr22413 357 ------
NM_212475chr22413 357 ------
NM_212476chr22413 357 ------
NM_212478chr22413 357 ------
NM_212482chr22413 357 ------
NM_213611chr12190 ------