TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-198
miRNA Sequence: GGUCCAGAGGGGAGAUAGGUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX94447 4426 2049 1730 1682 1368 953 163 95 22738 1079 15049 --
NM_000108chr721168 122 ----1144
NM_000109chrX42323 2152 1868 1833 ----12396
NM_000112chr595194 4993 4281 3990 3418 3404 2230 1860 1651 2603 183 31137 463 326 --
NM_000138chr1532596 992 762 11832 12217 --
NM_000217chr1254679 1899 1084 809 647 11929 --12017
NM_000245chr73726 266 142 ----12122
NM_000248chr312171 21941 863 --11147
NM_000264chr942724 2262 1011 236 ----12423
NM_000314chr1042592 2570 2279 545 --1552 1617
NM_000330chrX21650 1618 --22060 646 --
NM_000332chr656673 2662 2619 2247 577 15850 26191 4366 --
NM_000333chr341153 1052 714 210 1353 176 --
NM_000346chr171289 --1372 188
NM_000408chr263041 2570 2206 841 505 437 ------
NM_000411chr2182789 2734 2524 870 444 268 185 50 1476 ----
NM_000430chr1783409 3390 3352 3004 2593 1446 1300 235 1767 2119 41 --
NM_000458chr171718 1693 1767 169
NM_000533chrX----1169 --
NM_000538chr1311744 ------
NM_000555chrX97573 6891 6127 5267 2909 2832 2456 755 727 --2450 182 --
NM_000573chr131952 697 284 12194 ----
NM_000701chr1191 --1298 --
NM_000719chr12115522 5429 4623 4565 4145 2367 2095 1728 1310 518 433 15756 --26114 1870
NM_000793chr1454181 3720 1379 962 729 --11441 13686
NM_000814chr1533467 3309 1591 --11391 --
NM_000875chr15136687 6671 6552 6516 6009 5455 5382 5155 4926 4361 2255 1963 1819 25099 795 16956 11529
NM_000885chr211398 --22018 98 1662
NM_000891chr1753021 2920 1208 640 21 --33545 1295 1063 --
NM_000945chr211656 --11711 --
NM_000965chr31932 --196 --
NM_001001323chr1252517 703 655 607 273 1637 1390 --
NM_001001395chr1242818 2791 2368 228 --1283 11790
NM_001001419chr564221 3691 1847 1763 1551 910 34199 1434 1301 13805 1802
NM_001001481chr84953 788 515 283 --1157 --
NM_001001484chr101876 ----11958
NM_001001668chr1954263 3524 3494 3267 1545 1818 192 24044 3645
NM_001001890chr2144215 1177 104 25 13068 23809 660 --
NM_001002814chr863826 3135 2985 2779 2720 1394 32515 1306 1268 --12829
NM_001003674chr1885888 5395 4627 2165 1272 831 821 60 11466 ----
NM_001003937chr221556 54 1430 1299 --
NM_001003940chr1593744 3652 3620 3372 2903 2677 1210 340 46 23228 1434 12964 13731
NM_001004065chr953868 3309 3107 2851 1043 --1342 1192
NM_001004329chr1231474 955 109 --2445 55 --
NM_001004419chr1243809 3687 1001 524 14225 11378 13797
NM_001005353chr131165 989 979 ------
NM_001005366chr12----152 1174
NM_001005386chr222421 1754 11690 ----
NM_001005739chr22248 157 --2271 67 --
NM_001005861chr32793 332 --1268 --
NM_001006115chr3102614 2255 1902 1847 967 862 586 537 435 375 1302 22710 2361 12053
NM_001006600chr552181 1674 1500 581 296 ------
NM_001006624chr141943 1817 389 308 --11421 --
NM_001006638chr1731239 253 29 1432 ----
NM_001006684chrX1151 --1592 --
NM_001007097chr974971 4165 1492 1454 147 117 70 1356 --14423
NM_001007255chr11119 ------
NM_001007257chr131261 416 208 --11147 --
NM_001007466chr6114136 4052 1936 1699 1635 1080 937 655 399 331 137 13850 --14750
NM_001007559chr182272 109 2474 233 ----
NM_001008392chr393443 3033 2891 2766 2739 2335 2304 697 38 33466 3248 964 ----
NM_001008408chr756409 6180 5328 4179 1200 21940 701 15483 24447 1141
NM_001008744chr1461562 538 331 314 219 74 --1569 --
NM_001008925chr443117 2979 432 172 --1659 --
NM_001009555chr411298 --11465 --
NM_001010861chr112677 134 1705 --
NM_001010867chr1135728 5721 4887 4225 1779 1480 1144 944 512 297 248 207 127 45963 4622 1466 1045 66447 6133 5377 5230 4761 2576 --
NM_001010888chrX24206 3823 --24028 1499 --
NM_001010908chr10144 --1576 --
NM_001012279chr62481 390 ------
NM_001012958chr1----1183 11312
NM_001013635chr12--1102 1260 --
NM_001017368chr1751938 1906 1864 1088 690 --31776 516 56 --
NM_001017395chr343290 2749 475 287 --1404 1870
NM_001017969chr9----1604 --
NM_001018025chrX2296 257 ------
NM_001018054chr1174 --159 --
NM_001023560chr64884 833 432 384 --1170 --
NM_001024218chr14194 1608 ----
NM_001024858chr1482916 2063 1996 1914 1067 633 571 173 22837 1083 1558 12536
NM_001024956chr1184156 4056 3945 3850 1798 1347 705 121 ----31847 782 619
NM_001025077chr1087615 7403 6100 4725 2878 2817 1592 1154 ------
NM_001025252chr842533 2478 513 333 --12540 12694
NM_001030007chr1662578 1087 326 298 213 52 2676 423 --12875
NM_001030055chr1443450 3363 1079 28 13029 13610 135
NM_001031677chr52410 54 --2202 71 --
NM_001031684chr231386 1375 443 --1123 --
NM_001031712chr6--1323 159 --
NM_001031804chr1664280 3821 3002 1461 805 505 1996 13781 --
NM_001032280chr611638 ------
NM_001032283chr122885 237 --1188 --
NM_001032999chr2074698 4284 4040 1935 1077 1007 939 ----1660
NM_001033057chr321347 230 ------
NM_001033059chr662020 1445 824 762 620 525 --11525 --
NM_001033081chr1121915 1629 1597 1574 1484 1439 1433 1309 1266 447 441 420 --1688 1111
NM_001033087chr2033200 667 37 --12518 1529
NM_001033117chr3114440 4293 4170 3647 3431 3396 1939 1637 1118 583 119 ----34794 1515 459
NM_001034850chr511617 --11412 21657 582
NM_001034915chr81288 1151 ----
NM_001038702chr52365 162 12154 1141 --
NM_001038707chr152321 1449 875 336 158 ----12200
NM_001039465chr141119 2494 143 --1398
NM_001039618chr1165515 3698 2362 2169 619 397 --14111 --
NM_001039690chr1692149 2034 887 804 728 614 578 537 43 12026 1543 --
NM_001039840chrX55689 5626 5459 2162 66 34707 4049 398 14633 --
NM_001040002chr1751293 1177 942 405 271 ----1374
NM_001040057chr73225 124 111 --11519 1331
NM_001040152chr744343 4311 3572 1459 34837 4445 928 11306 14194
NM_001040272chr9--1388 11946 --
NM_001040429chr13------12395
NM_001040709chr162489 2016 1938 1927 649 243 42445 2249 161 34 ----
NM_001040712chr933399 2368 849 12469 122 --
NM_001042406chr6--1150 1440 --
NM_001042555chr1274611 4435 4248 2925 1310 1004 812 13617 21600 296 --
NM_001042599chr297301 6050 5369 4996 2729 2701 2644 1130 1042 --16479 15673
NM_001042632chr2072519 2420 1915 653 545 514 399 2552 357 1325 --
NM_001042681chr162050 1985 733 430 242 198 --11025 --
NM_001043318chr1463627 3172 1470 872 708 489 11521 11481 --
NM_001066chr1102165 2089 1982 1694 1570 1337 868 444 382 327 1243 1119 --
NM_001100108chr1118079 6979 6941 5910 5549 5366 5294 5128 2837 2440 1798 47910 6056 2069 823 12936 --
NM_001106chr3199537 9079 8810 7996 7929 7393 6978 3808 2807 2666 2207 2177 2079 1852 797 683 666 184 75 28604 2146 49367 7321 1677 624 11689
NM_001121chr1041497 538 417 118 ------
NM_001144chr161256 ----1145
NM_001146chr882122 2033 1667 927 418 308 297 161 ------
NM_001201chr433519 3139 1397 ----13418
NM_001204chr266108 5845 5081 4827 2720 1909 1481 21929 344 1430
NM_001265chr134749 639 288 255 --2876 707 --
NM_001284chr52487 413 ------
NM_001364chr1184196 3741 3416 1681 1638 1459 1000 503 ------
NM_001386chr8--1542 11622 --
NM_001391chr1821075 77 11087 ----
NM_001396chr21----1848 1895
NM_001419chr1984000 3862 3686 3308 3280 979 616 148 11719 1283 --
NM_001447chr541279 995 404 45 11015 1910 --
NM_001453chr611654 ------
NM_001530chr141191 ----133
NM_001616chr222919 156 --1290 --
NM_001627chr32811 354 12212 12146 11576
NM_001655chr11----1875 --
NM_001660chr34818 771 566 99 1257 ----
NM_001731chr121902 ----1178
NM_001742chr7----1391 1668
NM_001743chr2------1230
NM_001759chr1254969 4615 4050 3312 1077 22002 661 14538 25323 1270
NM_001792chr181181 --1778 128
NM_001850chr3----1137 --
NM_001945chr551358 1183 900 485 208 --1309 --
NM_001967chr32511 22 ------
NM_002017chr1141218 1180 94 42 --151 --
NM_002024chrX21550 586 --1299 --
NM_002025chrX128205 7603 7243 6854 6591 6112 3593 3423 3152 2975 1371 880 16609 36176 2442 1071 27658 3340
NM_002072chr91117 --1631 --
NM_002107chr11331 ------
NM_002131chr6148 2276 56 1355 1972
NM_002137chr7------11856
NM_002193chr221574 1377 ------
NM_002214chr733773 2166 711 21367 404 --14775
NM_002268chr31174 1690 ----
NM_002293chr1--11959 1742 --
NM_002309chr22102627 2456 2322 2083 1209 853 762 522 265 235 --1160 --
NM_002310chr576449 6367 4702 2378 2268 1691 1300 25709 75 12113 26401 2328
NM_002317chr51163 --1133 --
NM_002336chr1274756 3695 3353 1806 602 528 68 --24127 357 --
NM_002355chr1231169 1139 367 11199 11279 --
NM_002442chr1261603 1364 1215 586 357 267 ------
NM_002515chr1411818 --11434 11706
NM_002577chr341564 918 861 435 ------
NM_002607chr71388 ----11137
NM_002646chr171407 868 661 641 561 491 189 21802 104 1462 --
NM_002655chr854832 1356 1248 1083 170 --14873 13431
NM_002657chr2073682 3539 3469 3398 2660 1096 320 --22614 828 --
NM_002660chr204405 264 122 73 1456 1204 --
NM_002699chr131358 92 69 --11349 --
NM_002717chr82483 274 ------
NM_002718chr332667 614 422 32059 2014 1929 --1157
NM_002738chr162467 162 --11129 --
NM_002745chr2284374 4341 3244 2885 1215 892 131 32 34268 4220 4207 11698 --
NM_002763chr1151 ------
NM_002819chr1911462 --11034 --
NM_002828chr181333 --1345 --
NM_002848chr1221136 814 --1190 --
NM_002856chr19186 --1100 --
NM_002874chr942490 2309 69 61 22102 425 11835 12115
NM_002892chr141133 --11085 --
NM_002906chr1142381 1587 928 918 ----11778
NM_002938chr44491 326 219 184 11641 11989 11668
NM_002941chr321178 1095 ------
NM_002959chr194456 4425 2986 2967 2755 1235 1166 509 426 12797 34026 3097 2864 --
NM_002968chr161991 --1250 --
NM_003030chr331670 281 154 1294 ----
NM_003079chr171205 --1130 --
NM_003107chr632142 1791 882 --1185 --
NM_003112chr77870 657 482 346 335 242 62 ------
NM_003204chr1761602 678 76 70 64 58 ------
NM_003221chr663957 3285 550 316 228 96 ----11575
NM_003246chr1531556 566 60 --1657 --
NM_003298chr385573 5561 3768 1957 1910 1183 1121 228 42365 1780 1672 1133 25813 3940 --
NM_003309chr661441 434 308 216 135 54 ------
NM_003340chr411046 ----1189
NM_003348chr1231589 1359 635 --1216 --
NM_003350chr8--1126 --1929
NM_003392chr334303 2643 1511 ----33264 3112 805
NM_003405chr222774 179 ------
NM_003406chr821240 426 ----1573
NM_003413chrX21427 775 ----11702
NM_003458chr3113715 3375 3084 2632 2610 1326 1111 588 514 79 64 31459 1279 225 191 --
NM_003468chr223165 1252 --23554 1259 1963
NM_003477chr11------1508
NM_003478chr1173320 3148 2978 2572 2338 581 41 --193 --
NM_003482chr1252745 2087 1838 1028 322 2644 180 --1935
NM_003489chr2142151 1240 967 25 ----33079 2929 853
NM_003566chr1243194 701 137 76 ----2281 94
NM_003574chr1854364 3854 2311 1404 1269 1195 ----
NM_003583chr1221261 468 --11103 11483
NM_003597chr242111 1964 1786 552 32165 752 499 1309 11632
NM_003617chr144378 3477 559 165 ----24971 4026
NM_003633chr54821 520 494 321 1167 12161 --
NM_003651chr121430 ----1149
NM_003654chr112646 183 ------
NM_003692chr911004 --1158 1100
NM_003718chr7138 --1351 --
NM_003743chr241477 762 327 123 1247 1314 --
NM_003749chr1352373 679 537 129 106 ----12243
NM_003850chr13----1145 --
NM_003870chr1511596 --12062 --
NM_003939chr1073290 2976 2560 1579 966 571 122 23832 2806 1994 13872
NM_003941chr711026 11775 ----
NM_004093chr1352723 2669 1980 1105 586 1155 ----
NM_004124chr1433306 3155 1135 1370 12894 23546 3133
NM_004136chr1532947 337 59 1504 ----
NM_004227chr743004 2711 2406 1978 32486 956 628 ----
NM_004311chr1062520 2170 1924 1185 1095 751 --12795 1616
NM_004373chr12----152 --
NM_004392chr1322283 966 1271 ----
NM_004397chr11123848 3432 2867 2610 1532 1269 1226 1060 1014 265 103 38 12626 1767 --
NM_004405chr23967 771 422 1778 ----
NM_004412chr1066023 6003 5976 2217 1540 134 --23694 2310 --
NM_004426chr1241843 1629 1582 199 ----21638 1236
NM_004437chr152802 2459 978 658 455 ----12373
NM_004440chr611998 --1478 --
NM_004443chr35758 507 81 74 58 ------
NM_004454chr352105 1950 782 250 122 12069 1143 --
NM_004460chr2------1236
NM_004480chr14------1695
NM_004499chr5147 1496 ----
NM_004501chr133646 2524 1405 13437 --11153
NM_004612chr964786 4722 3570 3531 777 746 --1164 13501
NM_004658chr123354 113 91 1345 ----
NM_004663chr1531576 607 237 ----1503
NM_004709chrX11322 --1147 --
NM_004730chr521960 278 --1239 --
NM_004737chr2231277 1191 1043 2479 162 1337 --
NM_004744chr412458 12577 22692 1581 1118
NM_004766chr3----184 --
NM_004772chr5----1569 --
NM_004774chr1722899 1105 1403 12195 1519
NM_004792chr2------1177
NM_004798chr2083446 3000 2936 2884 2533 528 431 192 ------
NM_004852chr181813384 12613 12520 12156 10008 9991 9572 4867 4700 4581 3676 3351 3114 2824 1854 1528 1259 807 29750 4806 312186 9520 823 --
NM_004859chr1742749 2230 906 516 ------
NM_004865chr64445 149 80 62 ------
NM_004874chr81477 1351 --1394
NM_004922chr103691 293 113 --3991 332 151 --
NM_004926chr1431680 1473 237 --11668 --
NM_004956chr763954 3020 2953 1520 845 819 --1680 11439
NM_004985chr1243111 3010 1504 1122 13879 ----
NM_004992chrX158036 7586 7010 6928 6731 5880 5807 5390 5158 2826 2791 2428 2372 1598 1101 27665 6741 16473 16945
NM_004999chr664275 3833 3388 1132 816 496 14086 1179 --
NM_005028chr1031755 652 489 ----12137
NM_005057chr121433 622 --11207 155
NM_005109chr342437 1003 957 724 --12539 --
NM_005116chr2084357 3869 3759 2833 1176 936 396 274 14612 14526 --
NM_005121chr1733455 3251 1373 23589 3533 ----
NM_005124chr64963 818 123 63 --1890 --
NM_005137chr22122244 959 885 856 847 815 777 614 401 228 98 30 --2681 465 --
NM_005156chr965118 3498 3322 1486 660 32 11757 --13670
NM_005157chr941403 1198 397 375 1674 11588 11382
NM_005160chr2266774 4120 1840 1452 1070 553 26081 4683 35914 4546 1902 15511
NM_005220chr1741472 1343 1295 289 ------
NM_005221chr7------1315
NM_005238chr1162985 2970 2878 1376 426 63 --2967 902 --
NM_005336chr272226 2219 1817 1420 837 725 87 12113 ----
NM_005342chrX61949 1915 1064 925 521 192 --12600 --
NM_005386chr202644 23 ----2305 280
NM_005387chr111194 --1247 --
NM_005389chr6--1654 1148 --
NM_005399chr154366 3561 3233 3193 3132 --33771 1617 58 --
NM_005400chr272475 2355 2143 2125 1155 1109 573 1906 22978 265 12279
NM_005436chr1043849 3538 2583 90 --13839 --
NM_005455chr111146 --164 --
NM_005465chr11291 163 ----
NM_005475chr1282987 2383 2227 2054 1316 1182 892 137 12672 12894 --
NM_005517chr121343 203 11470 1454 --
NM_005522chr741406 1166 301 126 --1168 --
NM_005563chr11641 ------
NM_005574chr11----1517 --
NM_005584chr13--1779 --1521
NM_005596chr966211 6193 4121 2135 2066 937 1188 14780 --
NM_005626chr1----1446 --
NM_005647chrX42571 2248 1005 591 11186 --1447
NM_005663chr41162 --2231 149 --
NM_005717chr12505 466 11067 --1823
NM_005721chr22978 686 --21094 74 --
NM_005730chr12103617 3511 3478 3067 2821 2541 1284 1185 847 543 ----12806
NM_005737chr242753 1086 964 510 11881 2800 606 --
NM_005779chr553453 3329 2888 1429 780 22897 174 ----
NM_005783chr22423 209 --1221 1468
NM_005795chr242633 1074 672 57 --11046 --
NM_005839chr14867 842 653 644 ------
NM_005842chr13----1540 --
NM_005845chr13----21630 54 --
NM_005859chr51209 11068 ----
NM_005885chr52173 66 --1324 --
NM_005896chr21596 --1732 --
NM_005920chr1103410 3342 2993 2764 1303 973 753 741 202 189 23295 3100 13581 --
NM_005926chr151109 --1171 --
NM_005967chr125730 652 623 264 96 ------
NM_006037chr264175 4061 3361 3213 3107 196 21405 603 14711 --
NM_006047chr2093337 3324 3098 2920 2889 2377 1096 824 209 1422 --12450
NM_006157chr111150 --1165 --
NM_006185chr111580 ------
NM_006195chr921383 1371 ------
NM_006197chr82686 324 --1299 1177
NM_006206chr442016 1086 240 34 --2411 47 --
NM_006246chr1441220 1032 966 958 --1857 2476 194
NM_006252chr165839 5516 2946 1418 722 75 ----15747
NM_006267chr231853 1472 1262 --1344 --
NM_006282chr2074590 4417 4392 2921 1379 631 344 --24771 56 --
NM_006283chr884803 4033 3816 3375 3217 3061 1300 708 --1486 24184 752
NM_006306chrX135850 5113 4939 4797 3786 3733 3720 1259 1227 1097 1042 815 171 24897 470 23689 31 163
NM_006325chr121216 --1194 --
NM_006352chr151885 1677 1668 1368 494 ------
NM_006380chr1763633 3317 2695 1405 754 597 ------
NM_006431chr12----129 --
NM_006458chr11--155 ----
NM_006472chr12358 163 161 1391 --
NM_006475chr131273 --1684 --
NM_006516chr141412 478 388 72 11217 1621 --
NM_006546chr1776210 5765 5497 5456 5185 4649 106 11478 ----
NM_006555chr751696 1548 788 687 362 11471 11241 11993
NM_006591chr1151621 1595 645 527 179 21201 435 ----
NM_006599chr1698155 6368 6290 5916 1955 1920 1877 674 323 ----11413
NM_006622chr51139 ----1187
NM_006633chr51779 --140 1260
NM_006699chr161081 658 375 308 226 93 ------
NM_006734chr631528 1171 1097 ----1357
NM_006750chr1667809 7635 7339 2306 1435 573 46834 5992 5874 5026 26950 6349 17895
NM_006756chr811139 --128 --
NM_006763chr151982 1631 489 216 23 1542 ----
NM_006775chr622475 979 22348 781 13098 --
NM_006789chr62100 71 2138 108 ----
NM_006805chr531169 471 271 ----11521
NM_006815chr1221137 384 ------
NM_006827chr1421225 424 12140 1327 --
NM_006838chr1241651 1530 1244 307 11513 --2477 147
NM_006868chr1832778 508 480 --13062 --
NM_006888chr1433440 3408 2359 --1716 --
NM_006895chr242035 161 150 115 ----11443
NM_006981chr952414 1096 856 353 74 ----1296
NM_006999chr522094 1341 ------
NM_007005chr93619 569 25 ------
NM_007006chr1673091 2913 2625 2572 2447 896 376 ----12664
NM_007030chr5105108 4581 4322 4132 1814 1299 1287 786 710 563 54721 4700 4457 526 287 13431 --
NM_007040chr191782 --1194 --
NM_007047chr632309 714 205 12502 ----
NM_007054chr513439 154 1444 --
NM_007073chr653856 3260 3077 1139 658 23309 1217 --14201
NM_007126chr92425 40 ----1149
NM_007137chrX24684 1948 14820 34953 3853 1992 14476
NM_007146chr1752067 2041 866 654 193 ------
NM_007162chr6----1145 --
NM_007195chr1873538 3210 3072 2574 1489 1180 829 1748 13633 --
NM_007197chr12----1790 --
NM_007214chr6159 --1904 --
NM_007238chr2054262 4246 1741 1176 770 2622 535 24636 1114 --
NM_007249chr1389428 7808 6340 5795 3698 3607 385 37 --17630 11834
NM_007345chr1842357 1650 633 578 ------
NM_007363chrX11027 --154 --
NM_007373chr1021744 502 --11576 --
NM_012134chr161674 1636 1177 620 560 427 21774 1767 --1243
NM_012156chr2072987 2519 1335 1096 1090 638 610 --43166 2555 625 76 12335
NM_012199chr183877 3819 3674 3154 1533 1296 1111 260 24086 28 24485 3788 --
NM_012233chr2------1439
NM_012234chr373475 2705 2672 2372 1265 697 587 23617 1391 --13043
NM_012248chr16----126 1509
NM_012262chr123908 3605 11190 34661 986 79 14830
NM_012287chr384250 4168 3825 3554 3436 3413 3319 3096 13836 14305 --
NM_012290chr2--21142 451 --1559
NM_012297chr422016 82 11808 12611 --
NM_012300chr532181 1699 874 1536 22214 556 --
NM_012301chr721778 1536 ----11828
NM_012316chr175244 5180 4929 4749 1801 1765 1363 15346 44424 4302 4027 1333 1176
NM_012320chr1691284 1247 559 399 360 287 217 120 56 --21394 1370 --
NM_012330chr101278 --21586 267 --
NM_012347chr633022 717 553 1417 22522 487 --
NM_012479chr732426 1984 1050 --1234 --
NM_013231chr1421383 990 --23272 3120 --
NM_013263chr164168 144 127 113 ------
NM_013272chr15------1360
NM_013279chr1182087 1903 1720 1691 871 547 399 65 ----11783
NM_013302chr1653922 3765 3248 1317 706 23351 2983 22878 1256 --
NM_014007chr92348 308 ----167
NM_014021chr143471 1069 250 188 --1124 1660
NM_014023chr1072689 2627 2436 2183 1975 1920 598 1290 --1227
NM_014141chr745166 1767 844 595 13357 11095 --
NM_014178chr14------1110
NM_014191chr122848 778 ----1745
NM_014243chr41393 144 1556 --
NM_014267chr113718 617 581 ------
NM_014279chr91707 ------
NM_014363chr132226 134 1386 11233 --
NM_014386chr51246 ----1198
NM_014423chr575532 5099 4708 4693 3865 3492 1015 --12174 --
NM_014426chr20--1191 --1229
NM_014452chr66861 841 794 393 217 24 ------
NM_014470chr122755 228 196 ----
NM_014515chr122844 770 ----1706
NM_014554chr1272285 2210 1947 1453 855 523 121 1666 11902 --
NM_014584chr1441251 1065 534 447 ----134
NM_014586chr2174756 4650 4313 3895 3136 921 318 24172 1901 13275 --
NM_014616chr333350 2648 2415 --13385 1950
NM_014620chr121601 --1724 --
NM_014637chr821135 1011 ----21453 378
NM_014646chr183889 214 118 1379 --12044
NM_014660chr731123 211 179 1325 1406 11154
NM_014682chr821710 735 ------
NM_014707chr712138 1339 ----
NM_014711chr1631850 297 63 --1113 --
NM_014717chr192664 315 --130 --
NM_014729chr831858 324 153 --1232 --
NM_014730chr1284830 4813 4201 2058 1073 932 559 269 13461 25197 572 --
NM_014755chr244003 3977 3758 2606 14233 23372 3116 --
NM_014786chr1141265 1083 350 338 1811 1301 --
NM_014787chr142657 2613 2000 1920 --22400 2045 --
NM_014795chr211137 ------
NM_014810chr173442 2787 2461 703 505 198 47 --23397 101 --
NM_014819chr51876 --12357 --
NM_014820chr321737 1678 --1344 --
NM_014827chr131534 153 48 --1580 --
NM_014841chr63336 221 52 --1288 --
NM_014877chr17167814 7636 7026 6804 6753 6611 5697 5566 5490 5310 5279 3063 2330 1469 1113 71 15687 16589 1708
NM_014897chr1732504 2169 2126 13269 12805 --
NM_014903chr1242364 2056 1638 310 ------
NM_014932chr331264 449 412 1601 --11734
NM_014947chr132316 2126 1120 22974 157 22058 249 --
NM_014962chr2042584 1764 540 324 --1347 --
NM_014982chr1475215 3917 3680 3332 2043 930 919 14175 --14011
NM_014991chr423083 349 ----22760 2508
NM_014997chr732811 2096 1812 --32434 1063 972 12025
NM_015000chr1212189 12467 --1498
NM_015001chr12375 278 --1411 --
NM_015026chr1244003 3229 1147 780 14455 1910 --
NM_015039chr1104153 4063 3347 3222 3124 2867 1464 1040 412 334 ----1186
NM_015042chr1534314 3905 1629 13144 33889 3169 1517 --
NM_015051chr933398 725 539 --22220 1127 1440
NM_015059chr1583763 3455 3329 3317 2689 2536 1400 356 3447 78 53 23311 1097 --
NM_015090chr1105823 5584 5530 2202 2092 2006 1766 776 660 644 --46130 5322 950 554 --
NM_015097chr331889 517 93 ------
NM_015107chrX3847 792 76 32188 961 93 ----
NM_015124chr2232357 838 125 2332 92 22228 1659 12278
NM_015156chr1473298 2963 1460 1259 843 504 272 1681 --1102
NM_015191chr1131856 1758 807 ----1964
NM_015213chr112303 144 ------
NM_015215chr112034 1922 ----
NM_015231chr112753 718 ------
NM_015252chr21110 ----1743
NM_015265chr232450 1941 278 1980 --1162
NM_015271chr454227 961 621 577 523 22956 2866 12765 --
NM_015285chr1822062 1894 --12356 --
NM_015288chr551409 1069 983 685 278 --33261 2374 1430 --
NM_015299chr14103771 3755 3631 3599 2837 1303 1197 669 478 121 --1391 12996
NM_015310chr857982 6969 6291 3210 2995 23350 390 16002 12322
NM_015313chr1174426 3909 3902 3863 3713 1900 42 11339 ----
NM_015315chr5103144 2845 2159 2151 1303 1017 1011 893 585 524 1178 41039 1001 493 324 12716
NM_015335chr1272414 2274 2224 827 581 448 389 ------
NM_015339chr202902 109 --1689 --
NM_015355chr17------11574
NM_015361chr2172 1852 ----
NM_015375chr1104936 4143 4029 3997 1580 1537 1374 947 627 446 34373 1991 161 14153 14688
NM_015396chr321415 103 --1274 --
NM_015443chr1721392 294 --1415 --
NM_015455chr564111 3869 3491 1135 1109 509 12703 1113 --
NM_015576chr332336 2145 1952 1438 1685 --
NM_015602chr131148 533 510 --1272 --
NM_015695chr641559 786 317 125 ----11403
NM_015912chr82987 160 11790 --12140
NM_015981chr552508 2311 1281 1175 785 ------
NM_016045chr2021797 543 --1344 --
NM_016076chr122561 2084 12458 22174 234 --
NM_016083chr623157 880 13304 33594 1048 776 --
NM_016192chr2243 27 ------
NM_016201chr311627 11475 ----
NM_016287chr121461 228 ------
NM_016322chr963240 2751 2575 2488 490 302 11148 ----
NM_016396chr1522727 556 --155 11948
NM_016530chr1542640 1639 695 634 11549 ----
NM_016605chr522136 602 --12289 --
NM_016628chr10--2795 109 195 --
NM_017415chr5113823 3559 3341 1659 1642 1575 1548 1038 514 385 81 1507 1447 --
NM_017542chr141150 564 285 92 --11734 --
NM_017548chr351665 782 481 442 86 ----21718 387
NM_017629chr12768 231 --11351 --
NM_017633chr653928 3798 3036 2621 2559 --11569 --
NM_017637chr998941 8802 8622 8341 8147 7829 7074 6765 5704 27875 3080 ----
NM_017643chr1753008 2114 991 614 261 12819 11143 1645
NM_017644chr344664 3296 1891 1463 1985 --13520
NM_017655chr121535 1273 ----2166 85
NM_017666chrX--1480 --12057
NM_017734chr11570 ----172
NM_017742chr1831691 1408 1267 --11702 --
NM_017772chr651570 1222 546 226 183 1280 1170 --
NM_017799chr1431279 283 58 11581 21545 700 --
NM_017902chr10115547 4201 1785 1579 907 667 464 381 185 148 116 --23795 482 --
NM_017983chr17152 ----1467
NM_018011chr133451 243 112 ------
NM_018013chr632945 903 206 --1480 --
NM_018043chr11--21497 1082 ----
NM_018084chr253296 2753 1322 1073 213 ----12949
NM_018086chr22442 158 --21380 575 --
NM_018113chr122361 83 135 1447 --
NM_018121chr1032646 1283 389 23066 408 1728 1852
NM_018133chr332179 1741 832 ----11440
NM_018179chr121213 2192 112 ----
NM_018181chr181376 ------
NM_018206chr16----1603 1641
NM_018243chr443595 2547 1175 215 ----1305
NM_018287chr1021246 37 1304 185 --
NM_018293chr332800 1852 777 ----11870
NM_018332chr162869 204 --1146 --
NM_018383chr232028 1449 321 --1699 2118 36
NM_018471chr21114 ----1488
NM_018509chr1741717 1392 646 43 21254 71 ----
NM_018710chr81254 ----165
NM_018945chr631465 1112 122 12912 1568 --
NM_018957chr22------1351
NM_018959chr194765 524 295 136 --1159 --
NM_018979chr1252560 1900 913 439 30 2897 706 ----
NM_018994chr1143 --169 --
NM_019022chr1822787 170 --13127 1411
NM_019057chr51129 ----1390
NM_019072chr543690 3586 2599 1417 --14272 --
NM_019084chr1042415 2180 1021 599 --1341 1294
NM_019116chr16103716 2918 2469 2333 1429 1007 890 640 92 78 12717 33202 2399 422 --
NM_019555chr331819 280 79 --1233 --
NM_019600chr152789 119 1225 ----
NM_019857chrX21647 667 ----11186
NM_020150chr1021751 1728 --141 --
NM_020198chr17----11553 --
NM_020310chr1772632 1856 866 832 725 559 444 21719 952 2813 732 --
NM_020337chr453154 2655 2293 1234 60 --21072 650 --
NM_020346chr11------11515
NM_020403chr132308 276 ------
NM_020416chr42870 561 21871 827 32597 2278 951 --
NM_020463chr221365 1327 ------
NM_020466chr694814 4566 4011 3904 3830 1987 1778 1732 1443 24659 256 11386 --
NM_020640chr35878 804 494 152 83 --1206 --
NM_020647chr831974 608 225 ----12170
NM_020673chr2077527 7413 5302 2620 1976 1706 1137 15590 12206 --
NM_020689chr2041725 1130 570 457 1681 2619 577 --
NM_020699chr195370 4993 4371 3669 2087 1971 1762 1430 748 22170 659 25027 1946 --
NM_020726chr52230 33 --1395 --
NM_020772chr17118316 7277 6868 2372 1671 1522 1230 833 754 704 620 1541 27307 1709 --
NM_020791chr17----1568 --
NM_020794chr12981 92 ----11134
NM_020801chr542263 949 935 524 ------
NM_020810chr1443052 2575 2280 1296 13647 23303 1426 --
NM_020853chr1262113 1945 1893 1863 1814 252 --1986 --
NM_020854chr1831328 307 180 11182 --1506
NM_020860chr421022 422 --11081 --
NM_020870chr431497 417 362 12224 1199 --
NM_020899chr1741571 633 603 473 --1848 12215
NM_020940chr1032387 404 379 21130 126 12894 --
NM_020956chr1994785 3877 3520 3202 3062 1186 642 394 292 33653 425 271 13017 --
NM_020964chr1874316 3716 2990 1658 1360 689 212 11426 --14709
NM_021079chr17103223 2604 2529 2370 2181 2114 1311 927 900 527 22938 653 22063 1153 125
NM_021097chr232381 2140 498 11180 1771 1517
NM_021136chr14144 126 --1710
NM_021140chrX1151 --1315 1972
NM_021155chr1942556 2021 259 68 12745 11154 12196
NM_021194chr11221 --1302 --
NM_021238chr1211719 ------
NM_021255chr1433459 834 544 1322 23137 2916 --
NM_021648chr662061 1058 559 540 314 54 1517 1192 --
NM_021728chr142986 47 153 --1797
NM_021813chr645065 2224 1762 1143 15011 --31987 1625 1177
NM_021914chr1421560 112 11881 125 --
NM_021947chr17----2914 139 --
NM_021964chr386421 5828 4695 4166 2519 2122 1471 1063 ----12564
NM_021999chr131567 --1290 --
NM_022051chr1------1258
NM_022118chr131509 ------
NM_022169chr116512 450 420 387 173 167 31324 1302 568 ----
NM_022463chr1731429 206 76 1315 11600 --
NM_022473chr1531650 1192 237 1771 32729 1254 956 1147
NM_022474chr14130 1458 12621 --
NM_022658chr121305 --1172 --
NM_022719chr2293695 3024 3001 2906 2896 2517 487 265 99 21486 798 33623 577 551 --
NM_022758chr643168 913 880 465 13141 22252 80 12625
NM_022826chr23964 888 192 ------
NM_022912chr232994 1181 844 --22918 851 --
NM_022918chr111594 --1221 --
NM_023002chr1961501 1494 637 467 377 181 192 --1220
NM_023071chr1241012 440 174 57 ------
NM_024076chr1971916 791 646 207 192 124 62 1225 ----
NM_024297chr17----1420 --
NM_024551chr1232075 1029 692 ----21945 1810
NM_024586chr13610 575 134 ------
NM_024613chr82653 456 ------
NM_024628chr321064 29 ----1128
NM_024652chr151190 11208 1788 --
NM_024665chr354552 4385 4156 328 262 ----11048
NM_024674chr172749 2469 2378 2301 1097 887 218 1306 1592 --
NM_024721chr862657 2264 1895 624 313 261 22336 562 ----
NM_024759chr82296 276 ------
NM_024779chr1231433 1298 1032 21379 367 1398 --
NM_024841chr114533 408 353 306 --2877 284 --
NM_024900chr421750 907 --21627 920 --
NM_024926chr7----1226 --
NM_024947chr388917 8651 8467 8264 7920 6402 1240 564 23762 1490 19534 --
NM_024953chr1252804 2167 1985 1113 209 --22647 1055 --
NM_024963chr7185740 5520 5499 4848 3957 3865 3791 3771 2390 1860 1740 1709 1505 1459 1054 921 596 209 65154 5102 4911 2230 1302 1173 25910 5270 --
NM_024969chr25735 579 318 107 69 1838 --1663
NM_024989chr275393 3191 3146 3123 2048 1115 99 --22002 1456 15546
NM_025134chr16139 ----12438
NM_025146chr322650 1968 22254 936 ----
NM_025160chr163816 2872 1081 797 729 373 2214 98 ----
NM_025191chr132637 367 157 ----23477 317
NM_030576chr1761716 1617 987 955 195 78 --32620 2080 1915 --
NM_030647chr7155753 4381 4279 3977 2305 2126 1966 1835 1813 1474 1272 899 409 398 34 11038 2518 186 --
NM_030761chr142253 747 429 200 12608 12624 12441
NM_030780chr821495 357 --11620 --
NM_030791chr1431157 642 246 --1700 --
NM_030816chr133133 2550 377 ----1978
NM_030877chr20------185
NM_030885chr331985 1466 696 1114 12295 11501
NM_030917chr4------171
NM_030918chr1105226 4504 3836 3769 1103 988 484 471 354 247 15183 34702 1915 60 --
NM_031216chr1831952 1647 370 --11631 1807
NM_031417chr1952794 2523 2088 668 430 32658 2272 2003 12734 --
NM_031422chr181221 --1493 --
NM_031445chr253266 2905 2370 880 547 22812 581 12626 1423
NM_031911chr421826 44 12163 --12643
NM_032017chr172126 1919 1785 1459 516 91 76 1636 1293 --
NM_032145chr621758 206 1218 ----
NM_032217chr4142 --1510 1258
NM_032316chr352315 2080 1596 826 354 31611 943 632 32418 2149 124 12131
NM_032373chr1025194 2282 --35879 4718 4549 --
NM_032413chr15------2142 78
NM_032446chr562532 2504 1267 1172 862 500 1563 12774 1122
NM_032457chr413613 ----12715
NM_032458chrX32866 2579 554 --1634 12147
NM_032466chr821543 409 --11561 --
NM_032486chr1682711 2650 2309 1936 1789 1690 319 195 12487 ----
NM_032560chr142346 225 --1305 --
NM_032581chr7----1755 11581
NM_032595chr1751395 1146 1062 605 430 2195 24 1349 --
NM_032632chr1431860 320 138 --1292 11385
NM_032638chr361470 1079 1004 523 443 240 --11208 --
NM_032765chr52379 371 21007 693 ----
NM_032804chr1042185 2000 240 82 1149 ----
NM_032859chr1331194 1016 535 --1716 --
NM_032873chr11104307 3300 3245 2774 1670 1193 717 290 231 36 --1205 --
NM_032906chr4----1280 --
NM_032918chr122974 95 --1114 11263
NM_032936chr7----1240 --
NM_033027chr33463 426 300 --21106 151 1915
NM_033081chr2031117 469 316 --1109 --
NM_033132chr133508 240 50 ------
NM_033133chr17143392 3308 2840 2795 2788 2375 2323 1174 1060 962 833 598 257 237 12367 2973 484 --
NM_033224chr776462 5644 5490 5126 1033 677 482 25165 4938 27075 6586 --
NM_033285chr861754 849 744 598 524 230 ------
NM_033296chr42865 853 ----1680
NM_033401chr16----1358 --
NM_033505chr2126653 6631 6625 6404 6207 5968 5574 5541 5019 4507 1918 389 45151 2698 1767 120 1162 11315
NM_033512chr8122931 2918 2428 2206 1938 1052 970 760 511 392 274 35 1614 2687 111 --
NM_033631chr163414 3264 2378 1365 858 267 1193 42755 2670 2413 359 --
NM_052885chr1231602 570 399 --14535 --
NM_052900chr821536 158 ------
NM_052905chr231692 1401 452 ------
NM_052925chr1921049 940 ------
NM_052927chr561597 1448 1404 902 598 314 ----1345
NM_052932chr11--1438 22221 198 1349
NM_053023chr1152778 2083 1092 885 485 --1353 --
NM_057175chr452335 1966 993 410 302 --135 --
NM_058167chr13242 169 163 172 1273 --
NM_058229chr8------172
NM_078476chr651413 589 223 139 22 --1492 --
NM_078487chr963357 2569 994 906 631 207 1169 ----
NM_080546chr932208 1774 1565 12146 21986 1718 --
NM_080743chr662520 2317 2299 2051 672 148 31876 1789 1020 ----
NM_080867chr1433502 683 78 24253 1211 --15080
NM_101395chr2122232 449 1526 --1457
NM_133496chr164359 3361 3120 1095 400 201 14238 --24473 2801
NM_138357chr1021845 479 --2668 242 --
NM_138444chr1394643 3982 3271 1761 1322 550 479 385 323 --34543 209 190 24175 1424
NM_138468chr275785 5099 4301 1774 596 480 342 33858 2442 2189 15779 --
NM_138473chr1244783 3661 3546 777 --23635 1139 --
NM_138764chr193239 58 29 123 ----
NM_139279chr262840 2410 2181 1119 1112 314 21279 223 --23561 2716
NM_139280chr1771355 1273 1245 511 293 285 201 11070 1418 197
NM_139283chr1232507 2353 562 --11851 12095
NM_144571chr4126917 5936 5735 5711 5590 4378 2783 2172 1296 650 471 238 ------
NM_144578chr1455562 5415 5074 1416 510 25448 4495 14961 --
NM_144579chr282396 2059 1151 910 886 873 510 115 12513 1232 --
NM_144582chr282328 2107 1946 832 780 583 129 54 --42517 2244 1789 545 21603 362
NM_144590chr104972 144 95 48 --32752 2630 1021 --
NM_144633chr311478 11445 ----
NM_144703chr203814 795 116 1164 1147 --
NM_144723chr52777 39 ------
NM_144778chr1322351 488 ----1137
NM_144963chr81892 1548 1948 --
NM_144973chr1285212 3526 2067 1955 1467 1093 588 120 11876 165 --
NM_145000chr53568 500 476 ------
NM_145049chr51360 189 ----
NM_145117chr1133231 2083 863 13253 11323 --
NM_145251chr1421108 168 --1273 --
NM_145313chr1071473 1299 1276 1064 562 506 484 11676 ----
NM_145735chr1341841 954 877 858 --1554 1317
NM_152253chr22133888 3756 3131 3096 2906 2849 2747 2722 1568 1404 1348 995 290 54093 3916 3159 3111 364 ----
NM_152261chr1221923 885 --193 --
NM_152263chr145260 4146 3871 2352 64970 4780 4750 1671 1217 1098 3696 78 28 --
NM_152277chr552109 1501 1352 692 309 ----12040
NM_152381chr221625 1360 ----1138
NM_152390chr21682 --1123 --
NM_152407chr553062 1084 448 111 21 ------
NM_152424chrX24739 2896 --21320 1250 14675
NM_152660chr11816 1928 ----
NM_152756chr584091 3716 3428 3306 2941 1340 1206 900 ----12638
NM_152758chr842153 2114 845 52 ----21929 1101
NM_152896chr9------143
NM_152902chr14616 456 229 217 142 --11719
NM_153184chr33750 566 509 1393 11440 --
NM_153257chr191399 ----1887
NM_153450chr111598 1668 121 1122
NM_153456chr1366050 5206 1707 1673 1586 932 35482 5440 1266 16112 1122
NM_153634chr121576 ----1519
NM_170711chr193941 700 312 --2335 129 --
NM_170768chr1131497 1462 125 --11691 --
NM_172069chr232251 462 394 ----11575
NM_172071chr187427 7181 7032 6673 2542 2456 2209 580 15007 35471 2393 288 --
NM_172240chr1211147 1975 1343 11296
NM_173074chr2------1105
NM_173359chr321306 46 1523 21188 719 11743
NM_173469chr151196 --126 --
NM_173475chr1641768 1488 75 66 --21646 1501 --
NM_173510chr2232885 2828 2822 12125 12321 --
NM_173515chr6------1950
NM_173576chr1011733 --1731 12158
NM_173595chr12105149 4935 4162 3883 3364 1420 1309 641 491 185 44369 4339 1574 1413 --14230
NM_173602chr1243471 2877 2861 1199 23756 3230 ----
NM_173642chr1108552 6538 5774 5643 3553 3513 2355 2344 2129 640 --36466 3125 74 1119
NM_173681chr711959 21567 1520 --1573
NM_173807chr1----135 --
NM_174909chr52351 154 ------
NM_175061chr721863 144 ------
NM_175069chr931061 889 253 1180 ----
NM_175854chr1332678 2016 1054 1396 11694 --
NM_178314chr121170 ----172
NM_178554chr363514 3065 2851 973 881 509 187 ----
NM_178562chr72710 93 ------
NM_178831chr762149 2060 766 419 243 113 11077 ----
NM_181491chr992669 2483 2320 970 384 325 251 186 42 22155 855 --11131
NM_181504chr573439 2743 671 453 384 122 54 --11085 --
NM_181672chrX41547 593 250 52 --1353 --
NM_181704chr21128 1269 11169 --
NM_181723chr822146 146 --1423 --
NM_182515chr1976494 5616 5597 5477 1281 1041 98 14801 ----
NM_182527chr2281911 1670 1419 613 574 502 391 96 11551 11677 --
NM_182528chr21113 ------
NM_183075chr462237 1860 1105 1058 431 114 --1257 --
NM_194247chr263693 3480 1671 1391 1303 1188 13227 ----
NM_194314chr164778 4448 2227 1805 944 30 25321 5197 1576 2716 175
NM_197941chr542588 2334 962 320 1204 ----
NM_198066chr1442671 2218 1223 107 --11217 12835
NM_198270chrX12796 --1385 1815
NM_198273chr542696 2481 2236 45 ------
NM_198465chrX12242 12130 --2285 276
NM_198504chr3144 1689 ----
NM_198560chr3103517 3271 3189 2756 1513 853 678 449 361 161 11447 --12395
NM_198904chr522091 694 1805 11774 --
NM_199262chr1772201 1777 1745 572 266 174 46 --11695 1397
NM_199355chr1621394 532 --1416 --
NM_201263chr121965 788 1348 11463 --
NM_203446chr2142452 1030 959 795 ------
NM_203459chr122374 163 1113 --11721
NM_203463chr284750 4553 3692 3148 3069 1231 854 321 11254 ----
NM_206853chr663363 3200 3139 1644 1258 474 12739 13394 --
NM_207435chr122898 742 ----194
NM_212467chr1552113 1839 1805 719 297 1983 21060 889 --
NM_212551chr121033 198 11111 ----