TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-199b-3p
miRNA Sequence: ACAGUAGUCUGCACAUUGGUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000068chr1921332 440 11146 11336 --
NM_000092chr254216 3988 3078 876 378 1236 13251 24142 328
NM_000109chrX72660 2654 2592 1070 798 625 615 --12639 --
NM_000125chr674152 1346 1270 1052 642 335 40 23236 1667 --14157
NM_000161chr143620 587 229 --11993 --
NM_000165chr631598 1250 557 ----11130
NM_000176chr543395 2404 988 868 11224 1512 --
NM_000202chrX33601 2808 1216 1264 22658 2574 --
NM_000212chr1772478 2299 2167 2159 1781 941 588 --2869 504 --
NM_000216chrX23865 96 33758 3276 291 --23070 891
NM_000217chr1275211 4436 3462 3300 1017 578 211 14725 --15065
NM_000220chr112975 182 1413 ----
NM_000245chr721433 109 --1139 1474
NM_000264chr952391 491 356 137 72 ------
NM_000267chr1733283 2173 328 --1335 1701
NM_000280chr11----1836 --
NM_000305chr71365 ----1386
NM_000321chr1361764 1619 1601 1490 544 341 1713 1576 1674
NM_000332chr6106525 5339 4867 4573 4427 2549 2373 1842 1107 792 15009 26670 58 --
NM_000346chr171544 --21655 1652 --
NM_000378chr113990 281 55 --11115 --
NM_000391chr1141339 514 370 324 187 21092 108 1102
NM_000408chr253116 2232 1350 778 630 2487 419 23286 762 --
NM_000430chr1783796 3151 2942 2586 2539 1454 869 795 12314 22639 2480 --
NM_000437chr141631 1528 578 360 --1135 --
NM_000458chr171143 1359 ----
NM_000461chr343957 2829 1473 1453 --2182 40 --
NM_000462chr1531147 463 404 --41473 564 561 352 11263
NM_000489chrX43438 3262 2607 2423 12378 2747 606 --
NM_000492chr7----11512 --
NM_000533chrX21218 548 ----1628
NM_000555chrX87472 6474 5453 2934 2328 1586 1421 90 21598 852 --11777
NM_000599chr224560 4367 --24265 487 --
NM_000601chr7----1110 --
NM_000610chr1121898 563 191 12189 --
NM_000618chr1286535 6354 5891 5745 4587 4201 1714 366 14329 --15870
NM_000627chr2----1315 --
NM_000676chr171339 ------
NM_000681chr1041026 936 490 158 --1267 --
NM_000683chr41506 ----1457
NM_000684chr10----21294 884 --
NM_000685chr32643 95 1282 1828 --
NM_000719chr1266489 6221 5216 4859 4265 2576 14218 26645 1876 --
NM_000793chr14135053 4513 4398 4231 3452 3420 1664 1226 972 370 353 165 92 24473 101 --14868
NM_000806chr511381 --11575 --
NM_000807chr42539 83 --1644 --
NM_000812chr43379 45 31 --2148 83 --
NM_000813chr555475 4870 4359 4159 446 1474 24163 1893 --
NM_000814chr1583847 2689 1629 1457 1236 1158 1113 54 13430 ----
NM_000826chr452447 2408 2378 851 812 12502 1450 --
NM_000834chr123807 469 156 ------
NM_000838chr6102749 2568 2552 2143 2121 1023 699 225 142 128 12025 1146 --
NM_000901chr442290 1769 853 662 --1715 --
NM_000912chr873161 2652 2544 1423 1128 457 316 23567 1246 23195 79 --
NM_000922chr1131088 199 153 ------
NM_000933chr2031205 616 218 ----11319
NM_000944chr481977 1904 1512 506 485 408 373 323 ------
NM_000945chr241298 784 717 654 ------
NM_000949chr55949 917 857 261 100 --1849 --
NM_000964chr1721389 1364 ------
NM_000965chr32522 79 --2439 82 --
NM_001001132chr2131195 213 129 ------
NM_001001323chr1232022 1068 683 1869 1830 --
NM_001001395chr1282788 2528 2359 2297 2089 1954 581 408 21040 95 1288 --
NM_001001396chr173903 3891 3803 1725 1342 1247 385 --24476 4160 13603
NM_001001433chr2063166 3160 2611 2240 888 729 --22851 233 --
NM_001001481chr8123376 3336 3248 2641 2606 934 921 620 484 441 131 120 142 ----
NM_001001484chr1061996 1720 1706 928 413 319 1599 --1692
NM_001001890chr2153681 3106 2702 1613 210 13873 34220 1558 738 11673
NM_001001928chr22108364 8292 7569 7293 6195 5506 5143 2990 2109 758 --1386 --
NM_001001933chr1----182 --
NM_001001973chr10------1122
NM_001002838chrX31667 1486 1336 --31770 659 379 --
NM_001002860chr1494651 4636 4371 4096 3901 3885 1838 1219 1003 14658 ----
NM_001003688chr431197 470 228 ----135
NM_001003698chr661921 1587 1302 1274 1210 230 --11306 --
NM_001004317chr674515 3564 3189 3138 3037 1681 109 23147 1622 23567 113 1969
NM_001004360chr232013 426 174 ------
NM_001005353chr11490 --2986 796 11056
NM_001005386chr272084 2008 1834 750 301 239 200 1437 32224 487 399 --
NM_001005463chr1092532 1863 1856 1606 804 721 691 578 162 --21929 789 --
NM_001005473chr546105 4902 4428 179 --26232 5936 --
NM_001005743chr14--1332 ----
NM_001006600chr562145 1862 798 748 440 80 ------
NM_001006618chr91243 --158 --
NM_001006658chr1169 --1553 --
NM_001007033chr122594 305 ----137
NM_001007097chr941940 1759 1015 352 13348 21076 84 14710
NM_001007214chr121916 150 21863 359 --11446
NM_001007245chr74620 539 424 23 ----1152
NM_001007466chr695201 4955 4897 4770 4170 1667 1641 396 356 1847 24774 1091 15138
NM_001007467chr22----1126 --
NM_001008239chr1853837 3582 3379 3175 639 11525 ----
NM_001008388chr42722 68 --2117 72 --
NM_001008391chr112272 144 --1504 --
NM_001008408chr7116036 5439 5079 4646 2546 1452 1341 1195 1119 1064 908 24891 1984 26278 4994 --
NM_001008491chr221967 1899 11428 12077 --
NM_001008539chr884069 3710 3414 2000 1628 1033 664 317 14555 15355 --
NM_001008660chr1131574 377 25 --184 --
NM_001008707chr1431882 1844 1320 --11886 --
NM_001009552chr81236 --1522 --
NM_001009555chr4181 1528 ----
NM_001009899chr366237 6152 5996 4495 2418 1758 21032 380 16257 15942
NM_001010854chr141508 1224 1538 --
NM_001010891chr5126962 6735 6607 6419 6077 5210 4976 2067 1527 1187 861 148 25691 836 22293 1244 --
NM_001010924chr1041133 399 175 127 ------
NM_001010934chr721022 273 1770 2890 306 --
NM_001010942chr1251278 1161 428 383 147 --21041 260 --
NM_001011537chr31897 --11790 --
NM_001011553chr72702 283 --1648 --
NM_001011663chr1021015 803 ------
NM_001011713chr14--1276 11480 --
NM_001012279chr62230 126 --1387 --
NM_001012398chr163863 334 185 --1994 --
NM_001012418chr684034 4003 1640 1175 1078 425 170 48 --32680 1605 36 --
NM_001012423chr1572927 2691 2675 494 423 324 310 --22914 723 --
NM_001012755chrX44214 4001 1874 1034 11845 1977 21909 1678
NM_001012968chrX42757 2314 780 183 22210 988 21958 693 --
NM_001013415chr441282 1079 614 213 --1506 --
NM_001013438chr31338 ----1863
NM_001013620chr12128423 8356 7840 7220 7073 3295 3154 2787 2332 427 365 332 11985 25187 2130 16300
NM_001014812chr153461 430 409 ------
NM_001014831chr19----1607 1155
NM_001014972chr21238 ------
NM_001015045chr432055 1766 49 ------
NM_001015880chr1021646 266 --11544 --
NM_001015887chr351693 1599 1425 1251 228 --1718 --
NM_001017371chr231397 562 350 ------
NM_001017415chr12749 100 ----1155
NM_001017523chr121125 ----1689
NM_001017926chr841721 677 501 59 --21452 175 --
NM_001017979chr42245 143 --1636 --
NM_001017999chr12490 23 --2448 422 --
NM_001018054chr131443 987 273 ----1278
NM_001018056chr92380 164 --1568 --
NM_001018064chr92500 336 --31954 814 555 --
NM_001023567chr1542319 2078 504 108 --12306 --
NM_001024455chrX32243 1882 63 --12648 --
NM_001024460chr61889 131 --1910
NM_001024947chr51709 --2835 82 --
NM_001024948chr163244 2918 2838 2760 384 186 --12133 --
NM_001025068chr341751 1708 1632 1271 1530 11728 --
NM_001025076chr10105902 4685 2109 1701 1655 1646 1566 1015 767 458 55987 5536 2329 2082 173 34326 2432 2429 --
NM_001025366chr621751 1331 --1488 --
NM_001025579chr175997 979 422 362 235 ------
NM_001025580chrX93941 3878 3855 3188 1677 1658 710 536 90 11415 24290 4157 --
NM_001025616chr441940 1844 1524 192 11882 ----
NM_001025780chr931248 1236 22 ------
NM_001029835chr73379 346 151 ------
NM_001029858chr643229 3172 681 320 --3764 372 251 --
NM_001029863chr643005 2587 967 75 12861 ----
NM_001029998chr42420 326 --1196 --
NM_001030001chr141299 ------
NM_001030007chr16103983 3811 3130 1590 1565 1049 538 401 220 147 ----2151 124
NM_001030055chr14124689 3983 3824 3734 3574 3511 1743 1732 1647 1554 1200 242 1496 21783 1214 --
NM_001030272chr11179 --149 --
NM_001031723chr42366 151 ------
NM_001031732chr453211 2885 2396 743 646 --13670 --
NM_001031803chr17140 ----145
NM_001031804chr1653093 2753 1340 1178 904 --24437 1617 14019
NM_001031812chr52924 49 ----2928 521
NM_001032293chr17----1137 --
NM_001032380chr1031932 396 71 --11585 --
NM_001033030chr3----146 --
NM_001033049chr2141984 895 350 274 1313 ----
NM_001033057chr32807 568 --21309 572 --
NM_001033081chr141703 1512 1499 1425 11666 --11885
NM_001033085chr2----1226 --
NM_001033557chr241078 902 312 46 2569 384 ----
NM_001033561chr171733 ------
NM_001033578chr81764 1288 12225 --
NM_001033925chr1021741 318 --11659 --
NM_001034841chr1655170 1693 1118 1015 430 --14241 --
NM_001034845chr431283 532 385 ----1277
NM_001034852chr1432067 1761 423 1266 ----
NM_001034915chr821300 307 --11158 11527
NM_001037339chr111221 11651 --11481
NM_001037738chr51242 --1206 --
NM_001037872chr23649 525 197 ------
NM_001037954chr1173275 3195 2836 2721 2504 1372 476 13104 13386 --
NM_001039479chr1472375 2097 1806 1682 1652 580 419 2907 383 12028 1799
NM_001039577chr153880 2941 1727 550 139 1592 1249 --
NM_001039580chr431974 1547 1113 1125 23555 3209 14146
NM_001039590chrX73807 3403 3111 3065 2469 740 100 13787 11222 --
NM_001039618chr11115669 4949 4451 3968 2368 1469 1395 1304 1193 327 194 23720 1814 11695 --
NM_001039675chr15145 --1235 --
NM_001039690chr1642388 2051 1970 1825 ------
NM_001039840chrX134805 4577 4144 2356 1766 1628 1468 1100 903 700 620 394 371 --26017 4791 --
NM_001039937chr1344067 3464 2630 1016 --24004 1227 --
NM_001040001chr661990 1930 1888 1712 1433 439 12082 21911 449 --
NM_001040057chr741294 1010 180 128 ----11298
NM_001040100chr31411 --174 11008
NM_001040101chr43604 362 255 --1473 183
NM_001040107chr121642 --3602 581 570 --
NM_001040142chr262400 2334 526 462 449 263 12115 11642 1240
NM_001040152chr794655 4431 3708 3616 3383 3350 1239 737 549 --24922 2003 --
NM_001040153chr134959 781 257 123 --1971 --
NM_001040158chr5181 --1205 --
NM_001040202chr472328 2169 2067 901 194 172 70 --12186 --
NM_001040214chr672120 1949 1923 1576 896 637 452 --11622 --
NM_001040272chr952315 2125 2068 795 372 --11842 --
NM_001040284chr1695397 4341 4325 4072 3814 2019 1183 730 676 24533 4269 31616 1130 577 12324
NM_001040429chr1333423 2323 2217 23636 481 --1167
NM_001040450chr1532815 2035 777 --12564 --
NM_001040709chr152357 2305 2220 1924 305 --11585 --
NM_001040712chr993087 3063 2679 2644 2392 1023 441 127 114 13038 12630 1529
NM_001042475chr6149 ----1260
NM_001042510chr862066 1908 1351 761 540 44 ------
NM_001042555chr1264629 1561 1289 1155 1012 202 --13767 --
NM_001042599chr2127766 7390 6550 6295 5962 5504 4780 4752 2698 1401 910 791 26981 6945 37415 7188 6650 24963 985
NM_001042601chr383081 3043 2978 377 262 184 60 50 12688 12108 11060
NM_001042603chr1275152 3973 3935 3610 1244 993 253 34184 860 561 --11173
NM_001042604chr3104573 4435 4196 3568 3167 1792 1007 661 562 93 23007 448 --23108 1396
NM_001042681chr132047 1739 579 --1583 1636
NM_001042724chr191689 ----1709
NM_001042749chrX61826 1798 1358 1262 391 362 ----11672
NM_001044385chr293738 3201 2819 2747 2494 1508 1424 1210 289 22778 421 --11038
NM_001049chr1432346 866 513 ----22181 1840
NM_001071775chr1321573 330 --190 --
NM_001100108chr1118315 8265 6218 5580 5390 2990 2960 2862 2831 1526 523 27050 5859 12634 26505 2466
NM_001106chr3139763 9593 8874 8022 6954 6392 3156 2593 2185 1286 836 725 218 17443 27246 1161 19278
NM_001107chr14----172 --
NM_001121chr1031632 285 214 --21790 1578 --
NM_001146chr872108 2047 1663 1550 1469 684 290 --1294 1268
NM_001148chr43763 707 607 ------
NM_001149chr1051266 946 455 394 37 --11172 --
NM_001186chr2183001 2796 2591 2247 2092 2063 1096 489 13165 12006 --
NM_001200chr201320 ------
NM_001201chr413308 12789 13743 --
NM_001204chr2117007 6051 5571 5442 4991 4796 2634 2405 1477 1082 84 --26187 6029 16517
NM_001206chr932581 2544 122 --12684 --
NM_001219chr711909 181 ----
NM_001222chr1041844 1229 599 193 --11232 --
NM_001241chr242102 746 209 195 1862 ----
NM_001263chr4----1139 --
NM_001271chr1562403 1201 1097 656 416 113 33279 969 480 13243 --
NM_001300chr10------1320
NM_001304chr1733019 1056 808 31416 941 452 --22830 1231
NM_001310chr1232565 2260 101 21028 965 12718 1450
NM_001321chr12----182 --
NM_001349chr2----1557 --
NM_001364chr1143604 3032 1298 69 11149 ----
NM_001390chr1833603 2908 375 12417 23499 3413 --
NM_001396chr2132785 2263 1964 1659 12266 --
NM_001400chr121135 108 --21235 91 --
NM_001406chr1731734 1407 135 11089 ----
NM_001408chr121324 420 ----21680 1547
NM_001412chrX22898 1179 --23749 2613 --
NM_001422chr111322 --21344 911 --
NM_001430chr221631 104 21955 1788 ----
NM_001432chr442754 1326 870 166 12536 11344 13772
NM_001438chr163693 3379 3241 3194 2707 875 1536 12350 --
NM_001463chr23781 139 103 --186 --
NM_001498chr651129 974 869 356 288 ------
NM_001514chr11377 --1134 --
NM_001546chr641425 1108 1075 441 --1248 --
NM_001560chrX52452 2185 2073 1060 683 1471 21786 100 --
NM_001614chr171649 ------
NM_001616chr273162 2292 1266 567 509 166 69 --53393 3072 2601 465 371 --
NM_001620chr11--1333 --1280
NM_001642chr1121129 242 --1149 --
NM_001650chr18104127 3517 3051 1605 1280 1111 538 357 184 127 21291 704 --12606
NM_001656chr521806 518 --11948 --
NM_001664chr331039 332 207 --174 --
NM_001668chr11849 --1852 --
NM_001670chr223739 725 280 1223 1808 --
NM_001677chr12252 198 ------
NM_001678chr1721810 1314 ------
NM_001690chr31436 11921 3883 345 262 --
NM_001695chr812942 23319 417 32717 1523 324 --
NM_001709chr1142829 2327 518 454 --1941 --
NM_001743chr23451 162 95 --2465 414 --
NM_001745chr52360 131 ----1192
NM_001753chr7--11816 21780 494 --
NM_001755chr1622130 1946 ----1561
NM_001797chr161538 ----1542
NM_001830chrX53866 3616 3464 968 242 1462 2711 246 13704
NM_001858chr664957 4701 4388 4143 3924 495 11476 11623 1651
NM_001859chr933732 3390 680 11286 13894 11437
NM_001860chr92933 239 1284 11123 --
NM_001903chr53833 591 577 --1810 --
NM_001914chr18133 ----138
NM_001920chr122534 237 --1538 --
NM_001931chr1111174 --11146 1153
NM_001938chr131843 779 151 ----1190
NM_001939chrX43509 3103 1401 538 23622 2351 ----
NM_001949chr653070 2331 2032 907 382 1934 1550 --
NM_001964chr54473 199 158 141 11040 ----
NM_001969chr1433508 3475 2946 --1136 --
NM_001991chr1732088 1860 689 1843 170 --
NM_002006chr4125752 5736 4834 4785 4730 4031 3609 1629 1062 591 382 217 25576 4940 1514 --
NM_002009chr151559 ----1125
NM_002013chr14----193 --
NM_002017chr11139 --1267 --
NM_002026chr21434 ------
NM_002035chr1863955 3655 3303 2797 2703 615 13242 1945 --
NM_002039chr41368 --1272 --
NM_002040chr21103220 2844 2819 2293 2059 976 678 529 404 372 ----176
NM_002041chr15------135
NM_002061chr151869 1393 774 634 77 11664 2717 214 --
NM_002063chrX31033 999 904 ------
NM_002077chr93768 742 370 --12103 --
NM_002078chr32464 110 --2600 83 --
NM_002080chr161637 2704 56 11031 --
NM_002109chr5144 ------
NM_002111chr473699 3298 2867 2713 1076 379 299 23376 1400 13856 --
NM_002145chr17153 ----1123
NM_002146chr17----11232 --
NM_002156chr24312 279 175 142 --1178 --
NM_002166chr21271 ------
NM_002187chr511204 --1283 --
NM_002196chr2021124 1117 ------
NM_002210chr273005 2666 2591 1298 320 289 102 21256 1019 --1106
NM_002211chr101741 11140 --1269
NM_002214chr765577 5260 5246 4926 4810 241 1178 2735 209 --
NM_002228chr11860 ------
NM_002247chr101941 11803 12317 --
NM_002253chr431368 1147 266 11187 ----
NM_002265chr1711170 1436 ----
NM_002267chr1342135 1515 763 606 ------
NM_002270chr575685 4660 4338 3503 1827 1246 147 35557 5353 4293 15108 --
NM_002296chr12545 333 1312 ----
NM_002310chr596490 5233 4493 4328 4156 1645 915 601 48 14195 15907 --
NM_002315chr11----1276 --
NM_002356chr642861 2708 2237 957 --1813 --
NM_002372chr52663 97 ------
NM_002373chr1551342 1296 844 553 60 --11177 165
NM_002381chr21940 --1135 1406
NM_002395chr631189 452 316 --1562 --
NM_002399chr1521280 368 --1572 --
NM_002408chr14----2820 544 --
NM_002430chr2252414 944 734 483 373 --1108 --
NM_002442chr123499 168 128 11435 ----
NM_002444chrX41495 1290 716 320 11409 11653 --
NM_002500chr231163 814 411 1968 3149 95 92 --
NM_002515chr1451945 1751 1687 1472 784 --1365 1751
NM_002519chr1121407 442 ------
NM_002522chr1763888 3881 3563 2962 904 741 ------
NM_002524chr12419 128 2969 360 1395 --
NM_002546chr8--1225 1246 --
NM_002556chr1132154 1745 803 --11828 11670
NM_002576chr111794 --11205 --
NM_002577chr332969 132 73 --24022 1376 --
NM_002583chr122631 458 ----2404 43
NM_002595chr1231848 738 429 1248 51575 1519 748 432 333 --
NM_002605chr153802 342 216 --1179 1455
NM_002628chr351217 1075 1045 994 290 --1972 --
NM_002635chr121155 --1117 --
NM_002641chrX51899 1509 1498 1342 750 ----1257
NM_002645chr1132436 551 513 12694 12734 --
NM_002655chr825184 309 13966 25053 4335 24838 1808
NM_002709chr22751 499 --11408 --
NM_002717chr82487 446 ----1696
NM_002731chr133076 2149 572 --23111 1146 --
NM_002740chr341083 939 761 188 --12768 --
NM_002745chr2294499 3569 1452 1329 945 728 648 437 262 21236 356 24203 1367 11174
NM_002753chr43699 624 607 ------
NM_002755chr152612 185 --2321 168 --
NM_002763chr11429 ------
NM_002825chr7----158 --
NM_002828chr181786 ------
NM_002841chr33619 522 244 1169 ----
NM_002843chr1153334 1337 1170 415 335 --23228 1326 --
NM_002851chr7------1559
NM_002852chr32585 568 ------
NM_002874chr911738 --3935 751 611 --
NM_002886chr375087 4838 3967 3282 1636 1374 785 24384 748 24139 1494 --
NM_002892chr141385 --1388 11546
NM_002918chr193989 973 85 --1815 --
NM_002923chr1------1129
NM_002942chr321079 105 ------
NM_002956chr1211037 ------
NM_002959chr151479 1413 1018 433 120 --14207 --
NM_002994chr441842 1731 542 350 1268 ----
NM_002998chr821623 661 21522 728 22169 2115 --
NM_002999chr2031557 1514 162 11934 ----
NM_003010chr1742328 2049 1949 342 ----1524
NM_003016chr171242 --1450 --
NM_003030chr321812 455 ------
NM_003042chr32822 368 --11930 --
NM_003045chr1334857 4503 138 14692 14086 --
NM_003051chr12809 64 --21979 1864 --
NM_003060chr52350 240 11288 ----
NM_003069chrX2611 181 2588 107 ----
NM_003070chr91599 1661 ----
NM_003071chr32776 635 ----1140
NM_003075chr12----1329 --
NM_003079chr172714 647 11007 --1231
NM_003106chr32761 264 --1870 --
NM_003108chr256922 6236 5657 5091 358 15179 15660 --
NM_003128chr251139 949 806 598 80 --1925 --
NM_003137chr641631 1518 541 395 12212 ----
NM_003161chr1752934 2575 1132 1123 805 --13455 --
NM_003178chr311459 --1512 --
NM_003211chr121650 --21522 1396 --
NM_003244chr18--1133 ----
NM_003246chr1531958 1599 327 --22047 560 --
NM_003257chr1531248 545 279 ------
NM_003262chr3114946 4854 3761 3733 3285 1979 1732 1604 520 327 175 21849 113 21736 1126 --
NM_003292chr131535 1404 367 --1823 11786
NM_003304chr311559 --11348 --
NM_003319chr21897 ------
NM_003340chr431437 337 198 --157 --
NM_003344chr741102 463 98 33 21457 286 ----
NM_003369chr1142484 2466 778 567 --11045 --
NM_003390chr112396 85 1114 1771 --
NM_003404chr201315 11677 1247 11293
NM_003419chr192477 203 ----1356
NM_003442chr11----1707 --
NM_003453chr13--1533 ----
NM_003454chr16--1346 1445 --
NM_003463chr652963 2850 2094 2079 22 12540 ----
NM_003468chr253402 3317 1486 507 217 --24046 1613 13862
NM_003472chr651240 988 958 365 125 ----1129
NM_003473chr102212 68 ------
NM_003474chr1051896 892 856 135 116 --11845 11826
NM_003483chr1222522 534 --32308 282 238 --
NM_003489chr2183189 2973 2634 2531 2270 726 642 137 ----1199
NM_003498chr1662669 2434 895 696 300 81 11784 1304 --
NM_003558chr9----1684 --
NM_003567chr1169 ------
NM_003574chr18135736 5128 5078 4801 3633 2169 2157 1671 1650 1624 1008 975 190 15501 ----
NM_003603chr432006 534 163 11742 21966 769 --
NM_003615chr363990 3927 1482 952 878 211 24009 2528 ----
NM_003618chr2----1459 --
NM_003622chr1242050 1809 120 98 --12637 --
NM_003633chr542202 1636 445 141 12451 12098 --
NM_003645chr151206 ------
NM_003655chr172760 520 --1723 --
NM_003664chr51221 --264 61 --
NM_003672chr171968 1794 1220 687 426 357 184 --11727 --
NM_003702chr84683 300 146 95 ----1788
NM_003709chr2----1319 --
NM_003713chr121135 305 11247 11092 143
NM_003714chr552446 2392 2327 1139 703 32416 2306 2162 --11195
NM_003743chr221845 1825 12177 ----
NM_003750chr103957 922 721 --1628 --
NM_003758chr1541199 503 382 218 ------
NM_003768chr131398 1325 128 --11482 --
NM_003772chr1121226 932 ----11082
NM_003787chr183221 201 92 1362 21507 586 --
NM_003800chr632340 2231 812 ----22438 1712
NM_003822chr183097 2402 2065 1948 1279 1229 833 98 ----12759
NM_003831chr18----11793 11425
NM_003872chr253048 2970 2012 556 246 --11012 --
NM_003877chr123986 975 900 --1978 --
NM_003901chr1062614 2488 2389 1735 911 840 ----11992
NM_003902chr1----1704 1170
NM_003913chr674335 3559 2741 1212 1163 969 942 ------
NM_003916chrX--11313 2340 111 --
NM_003927chr181287 1886 ----
NM_003939chr1044047 2800 418 211 12986 1106 12849
NM_003946chr16160 --1559 --
NM_004035chr1784965 4213 4200 4075 3492 1882 633 584 21824 265 23337 828 1312
NM_004050chr1442589 1765 784 677 11941 ----
NM_004083chr12--165 1187 --
NM_004085chrX3797 635 298 --1258 --
NM_004090chr1763087 2676 2509 2393 925 722 --12490 --
NM_004093chr1332777 2678 495 --2767 247 --
NM_004094chr1462896 2457 2082 1199 924 741 --13038 --
NM_004113chr321602 349 --1811 --
NM_004114chrX31013 406 134 --1827 --
NM_004136chr1542660 2569 1320 1061 13269 1374 --
NM_004170chr931673 405 67 --11849 --
NM_004171chr11119463 7007 6673 6136 6119 3799 3226 2990 2620 999 248 13445 19561 25989 1804
NM_004232chr1853270 2839 2632 2408 105 ----13130
NM_004241chr102131 45 2571 140 ----
NM_004253chr93857 685 331 ----1169
NM_004272chr521544 626 ----1492
NM_004274chr1422195 565 ----1670
NM_004290chr54883 540 407 93 ----1158
NM_004316chr1221110 1028 --11092 --
NM_004331chr852509 2246 2155 1926 236 ------
NM_004342chr752114 1970 1614 755 550 1259 --12021
NM_004364chr1911142 1324 ----
NM_004370chr631819 1697 315 ----12213
NM_004392chr1342628 1684 1075 267 --1254 --
NM_004397chr1134012 3958 442 24264 1438 32787 2622 242 --
NM_004405chr2--1961 ----
NM_004419chr1021057 962 --1233 --
NM_004420chr1131533 199 92 ----1315
NM_004432chr941645 697 249 123 11610 22206 880 --
NM_004440chr62507 408 --11301 --
NM_004458chrX21763 432 --11738 --
NM_004459chr1731906 721 57 --1234 --
NM_004469chrX----1446 --
NM_004481chr142337 2046 877 792 --32578 2050 796 --
NM_004494chr161339 1188 320 302 57 41 ------
NM_004497chr193505 227 121 1668 1138 --
NM_004504chr292962 2650 2187 781 772 635 445 365 21 12239 --22209 973
NM_004505chr1741980 1802 1451 760 --11828 --
NM_004514chr1773008 2653 2519 1050 620 320 233 1488 ----
NM_004525chr221488 974 31523 313 288 --11424
NM_004529chr9----133 --
NM_004537chr1221377 494 --21176 957 --
NM_004575chr441392 1316 620 408 ------
NM_004577chr7------1206
NM_004586chrX105352 5120 4346 1652 1237 1011 557 495 136 127 --34241 3403 2019 --
NM_004588chr1144054 3339 3156 1075 --13987 --
NM_004593chr32274 135 1307 --1261
NM_004686chr82272 113 11565 ----
NM_004690chr61704 --1678 --
NM_004713chr141653 ----1637
NM_004717chr751295 1197 556 393 341 ------
NM_004719chr1232355 1922 609 12849 12750 --
NM_004723chr11396 --1364 147
NM_004730chr531950 825 275 11473 21462 363 --
NM_004733chr31590 ----1524
NM_004734chr1353058 2182 855 520 60 22964 272 22298 2150 13297
NM_004741chr102384 46 ----1331
NM_004745chr8106477 6163 5675 5260 4991 2553 2216 2113 1424 1316 ------
NM_004772chr521397 353 11540 --11504
NM_004781chr141531 1405 302 88 --2406 26 1503
NM_004788chr1162606 2530 2479 1040 322 144 11971 22020 362 --
NM_004834chr223375 2112 12663 23394 25 --
NM_004852chr181814193 13713 12741 12569 12353 11119 10830 10319 9340 9234 8789 8698 4860 1917 1662 1348 1048 840 ----1570
NM_004859chr1752376 1950 1127 882 275 --22648 903 13028
NM_004863chr14104524 4463 4301 3721 1116 938 905 763 373 176 1125 1377 1578
NM_004883chr52212 68 ------
NM_004884chr1531293 373 72 ------
NM_004902chr201102 ------
NM_004929chr841535 1299 566 452 ------
NM_004947chr342499 1652 596 146 21767 572 12606 --
NM_004956chr7104408 3774 3736 3514 1742 1112 1058 490 423 264 23403 3066 11061 --
NM_004969chr101101 ------
NM_004992chrX88299 7618 7081 6825 6362 5659 2177 1383 35834 2536 1437 27716 684 2987 293
NM_004996chr161384 11276 ----
NM_005020chr7--1468 ----
NM_005026chr12555 388 ------
NM_005044chrX34531 961 273 33578 3235 3015 14534 --
NM_005063chr1042685 2605 1118 799 33022 2803 1319 11208 174
NM_005065chr1495137 3754 1508 1224 1169 1113 1024 294 51 11412 15090 --
NM_005109chr322553 65 11646 182 --
NM_005110chr5----1256 --
NM_005116chr2023790 147 24210 3543 11173 --
NM_005121chr1733162 2920 121 2990 188 33731 3585 2977 --
NM_005126chr361730 1714 1641 488 422 408 1761 ----
NM_005156chr9125328 4803 4789 4566 4189 3944 3735 3294 1406 850 656 402 --23852 1026 24793 1469
NM_005160chr22126520 6278 6231 5850 5838 4808 4791 4177 1880 1612 1541 1308 14324 1419 2391 191
NM_005161chr1162171 1680 513 336 147 84 11434 ----
NM_005171chr122982 468 --11282 --
NM_005188chr11168068 7372 6917 6867 6101 5807 5342 3208 2773 2279 1813 1543 781 499 423 54 27032 687 43189 3164 1462 1418 --
NM_005221chr7----139 --
NM_005252chr14--1570 ----
NM_005264chr101853 1918 1871 --
NM_005295chr7----173 --
NM_005296chrX1728 11070 --1394
NM_005302chr7----1129 --
NM_005308chr101351 ------
NM_005328chr81253 --1108 --
NM_005334chrX21222 1204 11670 21704 698 --
NM_005375chr621154 439 ------
NM_005398chr1031415 229 91 ------
NM_005400chr23994 331 91 --22239 1051 --
NM_005402chr741317 1296 392 90 1653 ----
NM_005436chr1053675 2989 2803 946 821 ----1398
NM_005458chr942429 2269 1637 65 12197 ----
NM_005465chr12255 244 --11953 147
NM_005477chr1532216 516 199 ------
NM_005493chr61559 170 --1233
NM_005502chr942733 2297 1145 134 1843 22691 826 11993
NM_005509chr531765 1624 1315 --1693 --
NM_005578chr364739 4199 3722 3428 1731 501 ------
NM_005595chr11613 --1623 --
NM_005596chr966371 6350 2577 2160 1982 496 --46401 5435 2231 1136 --
NM_005611chr1611294 --21114 223 --
NM_005639chr1241558 1447 1416 1405 1535 ----
NM_005665chr164872 4649 3207 1291 1119 365 24702 1350 14652 23740 262
NM_005668chr553656 3567 3253 3055 2820 14484 23482 1434 --
NM_005704chr1------11058
NM_005725chr171732 1693 1687 1604 1547 823 803 11612 2833 158 --
NM_005731chr2156 --1314 --
NM_005737chr262867 2530 1932 908 761 322 21076 276 22870 880 12317
NM_005746chr762304 2187 1999 657 600 590 --1953 --
NM_005748chr1231174 732 488 --2441 324 --
NM_005751chr71393 1362 --1317
NM_005754chr51109 ----1349
NM_005776chr144844 752 723 667 ----1316
NM_005795chr272536 2528 2399 1198 828 568 243 ------
NM_005796chr162134 58 1281 ----
NM_005822chr622291 1546 --1613 --
NM_005824chr72740 589 --1202 --
NM_005828chr1784932 4438 4233 3974 3783 3124 1958 1041 --14174 --
NM_005832chr32995 547 ------
NM_005859chr511535 11213 21575 1302 --
NM_005862chr31791 11066 1238 --
NM_005868chr722047 262 12105 --1767
NM_005885chr541582 611 330 161 --2191 188 --
NM_005906chr661684 1479 1362 1273 661 242 21216 94 --11443
NM_005909chr543816 3067 1656 1623 1252 11193 --
NM_005915chr25434 418 403 356 300 1325 ----
NM_005920chr163890 3500 1494 1448 1278 1216 ------
NM_005922chr61147 --145 1462
NM_005923chr6----1466 1609
NM_005930chr144737 326 228 206 --164 --
NM_005933chr1152671 2219 815 753 248 12573 ----
NM_005935chr464263 4025 3330 1942 1424 37 --44931 4598 4231 700 --
NM_005955chr184982 4752 4463 4240 3832 1763 176 105 13936 23916 698 --
NM_006015chr11305 ----1462
NM_006016chr651975 1581 1554 1512 245 --12238 --
NM_006054chr1121561 1480 ------
NM_006055chr272941 2910 2853 2135 2063 384 329 ----13066
NM_006060chr761721 1544 1257 594 449 231 --12773 --
NM_006064chrX----1366 --
NM_006080chr712835 --12970 1599
NM_006096chr8----21626 1363 --
NM_006106chr1152906 2710 2240 448 169 --21144 255 --
NM_006107chr17----141 --
NM_006135chr161037 969 504 375 310 203 2426 348 ----
NM_006141chr1632824 2583 2335 --12796 --
NM_006154chr1572832 2594 1092 548 503 82 32 1765 --2476 373
NM_006158chr841787 1384 1252 613 1645 --1513
NM_006164chr2265 46 ------
NM_006166chr1241742 1727 1692 685 --1293 --
NM_006206chr452522 2055 1938 666 473 11844 21982 670 --
NM_006216chr2138 --1639 1259
NM_006224chr1762438 2399 2101 1727 681 139 --11680 --
NM_006228chr8--1445 ----
NM_006246chr14125 11208 11171 --
NM_006253chr12----11252 --
NM_006256chr132613 2197 903 --32179 488 420 --
NM_006265chr811341 --21291 342 --
NM_006267chr21655 --1439 1293
NM_006283chr8134952 4914 4485 3056 1961 1898 1597 1297 718 580 544 450 133 1269 24828 136 --
NM_006310chr1741298 1273 311 32 1174 11013 --
NM_006320chr43372 281 95 ------
NM_006325chr121299 --1255 --
NM_006352chr1----32048 1605 689 --
NM_006353chr651254 949 523 57 43 1955 ----
NM_006371chr384902 4870 4438 4140 3988 1646 1067 319 11830 14352 --
NM_006375chrX31595 576 410 --1307 --
NM_006380chr1784325 4076 3955 3759 2785 1366 1064 333 --23334 2991 --
NM_006389chr1141162 940 867 274 ------
NM_006390chr125563 512 472 200 108 --11274 --
NM_006421chr821033 115 1801 ----
NM_006449chr222211 1476 --1615 --
NM_006451chr51232 --1363 --
NM_006496chr131503 574 553 --1749 1753
NM_006504chr10------22724 1176
NM_006516chr141595 1302 662 470 --11444 1249
NM_006517chrX21518 362 1605 ----
NM_006526chr2032138 584 501 2335 105 21997 1986 11585
NM_006532chr1941908 1869 542 354 --11310 --
NM_006538chr273962 3890 3482 2830 2671 992 715 23741 3283 24147 543 --
NM_006544chr14105398 4933 4107 4071 3790 1711 1356 1181 694 627 26027 4748 24843 1630 11446
NM_006546chr1776472 6382 6131 4128 4109 2043 2033 ------
NM_006555chr741610 1530 1489 1328 --21950 1556 11406
NM_006565chr1621268 229 11084 11271 --
NM_006577chr241195 1169 949 390 --11212 --
NM_006595chr113692 519 114 3426 396 55 21507 153 --
NM_006599chr16128232 5888 5069 2591 2528 2274 2063 1991 1579 901 865 76 15806 37283 3275 913 --
NM_006601chr123940 913 436 --1760 --
NM_006609chr242758 2558 2061 665 --12573 --
NM_006624chr1031337 470 35 1683 11506 --
NM_006682chr782513 2495 2385 1796 1010 496 298 287 22604 273 21092 1079 --
NM_006690chr2051574 943 544 450 239 --1703 --
NM_006713chr53639 199 96 ------
NM_006726chr42886 198 --1993 --
NM_006738chr1594329 4058 3925 3918 3723 3181 1271 102 61 ------
NM_006749chr82378 279 --1203 --
NM_006750chr16137733 7267 6681 5904 5164 4894 3061 1854 1183 894 724 500 278 37664 6700 6103 11202 1133
NM_006751chr22922 280 --1343 --
NM_006754chr7----1384 --
NM_006761chr171211 1848 2800 275 --
NM_006763chr141643 1551 574 468 ------
NM_006775chr662723 2169 1924 679 381 360 163 1777 1714
NM_006777chrX72509 2115 1990 1929 1839 963 376 12429 --1380
NM_006805chr531306 1099 266 ------
NM_006807chr17----1420 --
NM_006813chr62827 739 ------
NM_006818chr12759 102 ------
NM_006823chr831286 1014 473 --31418 570 476 --
NM_006826chr211080 --3916 336 204 --
NM_006874chr42891 136 --21229 420 --
NM_006885chr1654066 3353 3275 2923 654 1694 1271 11575
NM_006888chr1453191 2974 2881 2590 1258 33363 1236 447 --12679
NM_006895chr21454 21711 406 1180 11555
NM_006898chr2----1790 --
NM_006912chr132488 1810 785 --12309 --
NM_006914chr92511 343 --194 --
NM_006920chr252016 1973 1381 448 213 ----1239
NM_006936chr2121098 923 --11304 --
NM_006939chr1441155 1137 837 785 2409 125 ----
NM_006941chr22----11083 --
NM_006948chr213937 874 395 --12378 --
NM_006997chr102455 186 --2114 61 --
NM_007005chr911323 21244 164 ----
NM_007007chr1274124 3888 3814 3205 1346 944 534 14536 21539 262 14469
NM_007011chr1576818 6664 5550 4545 4486 2051 198 21066 597 --16151
NM_007034chr12977 317 168 1953 1654
NM_007040chr192769 438 ----1797
NM_007047chr652498 2470 2451 940 342 11546 22432 982 --
NM_007085chr332077 518 315 ----12652
NM_007106chr1372642 2417 2120 2048 1139 594 51 --22011 483 --
NM_007114chr352408 2172 272 208 109 12550 1458 11148
NM_007124chr641651 1640 439 414 1139 ----
NM_007146chr1752867 2609 2382 2124 326 --11991 --
NM_007159chr361727 1153 1103 546 521 201 ------
NM_007218chr83177 154 142 ------
NM_007220chrX74324 3998 3542 1018 965 254 76 13782 ----
NM_007236chr1542042 1914 709 367 1268 2115 112 12150
NM_007246chr4----1855 --
NM_007249chr1389112 7498 6300 5952 3086 2138 1810 1151 26066 2430 25945 802 --
NM_007269chr11190 --1154 --
NM_007353chr7--22679 200 --1226
NM_007358chr1--1471 ----
NM_007361chr141655 --1184 --
NM_007373chr1051789 1458 1343 1317 1201 11136 11729 --
NM_007375chr142737 2619 2468 702 --21102 238 --
NM_012082chr8----1746 --
NM_012095chr1052860 2645 802 781 63 12309 21121 575 --
NM_012096chr353556 1294 1246 1239 822 --2727 724 1255
NM_012120chr672989 2489 2167 1112 624 422 380 11852 --1265
NM_012137chr192636 2622 2484 2422 2310 2293 684 107 92 --11060 1897
NM_012164chr976451 5509 4818 3031 2901 2540 2241 26347 871 27046 6015 24627 2545
NM_012189chr18----1580 --
NM_012197chr9----11595 1186
NM_012214chr2115079 4782 4690 1427 1178 1148 1001 935 372 252 110 34666 3919 1652 12093 --
NM_012215chr103708 310 164 ------
NM_012238chr1021665 1105 --11437 --
NM_012242chr101812 --1197 --
NM_012249chr273027 2696 2662 1378 1338 559 322 32714 2563 2435 ----
NM_012257chr72840 397 --1375 --
NM_012259chr651403 1299 923 583 568 1550 11380 --
NM_012262chr1124677 4281 4019 3840 3432 3358 3176 1316 1088 1060 895 530 34135 3258 425 14066 11568
NM_012281chr722051 985 1260 1889 12270
NM_012294chr774105 4071 3722 3256 1045 866 200 --33558 1594 414 21512 635
NM_012297chr462042 2011 857 719 348 325 --32449 2390 1883 12633
NM_012300chr511681 22537 2359 22254 48 --
NM_012304chr542394 1855 651 455 ------
NM_012309chr1153938 3043 1823 1682 30 11114 23430 3408 --
NM_012311chr10179 --1132 --
NM_012316chr1104780 4503 4106 3626 3430 1950 1630 1463 1451 114 1835 --11467
NM_012320chr164512 396 357 44 1234 1248 --
NM_012329chr1741584 432 387 319 11395 1133 --
NM_012334chr564242 3704 3445 1857 849 229 23225 342 ----
NM_012402chr1111306 2982 891 ----
NM_012412chr7--1641 1120 --
NM_012428chr152899 208 --1361 --
NM_012471chrX1179 21347 623 ----
NM_012474chr12219 64 --2223 97 --
NM_012479chr792619 2544 2214 2203 1996 1099 990 929 37 12221 141 --
NM_013230chrY41666 556 475 222 ------
NM_013261chr453579 2652 1273 1186 1004 1200 23336 76 13564
NM_013275chr16----2774 57 --
NM_013281chr202184 79 21203 306 21138 187 --
NM_013357chr82764 234 ----1246
NM_013372chr1552759 2645 2368 1178 1077 23171 1134 11225 --
NM_013374chr362274 2163 952 923 473 193 --22121 520 --
NM_013381chr1232023 942 203 --1603 --
NM_013396chr2121403 285 11478 11091 --
NM_013433chr1951980 1813 1724 1666 570 --154 --
NM_013437chr831194 931 185 1296 ----
NM_013441chr11437 ------
NM_014011chr241687 727 175 144 21748 321 11697 --
NM_014016chr361596 1536 1512 1176 419 166 2289 66 21202 189 --
NM_014112chr885163 5074 4067 1668 1661 1414 1235 993 --13917 --
NM_014154chr32394 340 1321 ----
NM_014155chr1196104 5893 5175 2881 2358 1782 997 686 649 35612 1567 1226 32396 1513 689 1268
NM_014181chr252866 2232 1163 832 775 --1728 12915
NM_014216chr1451664 1025 497 232 81 ----11687
NM_014240chr384184 4128 3347 3148 3099 2931 1109 54 --13204 --
NM_014243chr431845 1444 759 1657 --22115 1816
NM_014278chr41303 ------
NM_014283chr1----1258 --
NM_014290chr91207 ------
NM_014319chr1231832 1486 1465 --11216 --
NM_014323chr2211084 1758 145 --
NM_014382chr34477 371 156 104 11480 ----
NM_014393chr852171 2105 1468 587 447 --11859 --
NM_014405chr17----12340 --
NM_014423chr585580 4625 3883 3712 3604 1708 1591 908 15672 ----
NM_014452chr621011 31 ------
NM_014454chr62792 418 --31070 839 162 --
NM_014487chr4--1257 ----
NM_014498chr3--174 ----
NM_014571chr132842 2584 1998 --1995 --
NM_014572chr1371802 1763 1643 1531 1136 333 120 1731 ----
NM_014584chr1411023 --21602 191 --
NM_014600chr231546 1369 1265 --11637 --
NM_014607chr252060 334 219 84 68 21465 588 ----
NM_014612chr911416 21525 597 31470 1072 420 --
NM_014613chr542286 1231 1165 406 23038 2247 1149 --
NM_014615chr1673322 2638 2517 1422 1124 832 654 --2981 842 --
NM_014633chr113460 206 140 ------
NM_014636chr943928 820 681 329 ----13148
NM_014646chr1833032 2241 270 21175 75 22245 437 --
NM_014667chr341905 944 611 290 12055 2947 488 1553
NM_014670chr21272 ------
NM_014682chr832026 320 79 --11612 --
NM_014686chr1941608 805 775 348 --12582 1744
NM_014701chr1573095 2801 2675 2560 1193 1142 1024 --23080 820 --
NM_014705chr71669 22126 361 1595 --
NM_014707chr772187 2017 1982 1606 645 611 276 --1335 --
NM_014717chr191131 --2309 135 --
NM_014738chr1731050 690 673 ------
NM_014747chr164053 3662 3514 124 107 49 --11249 --
NM_014755chr263951 3711 3096 1464 1022 492 --1535 --
NM_014757chr552320 1823 369 217 76 ------
NM_014767chr1033634 3328 259 12522 --13433
NM_014774chr142807 2580 2550 789 1845 32810 2553 102 --
NM_014782chrX3322 275 78 ------
NM_014795chr2----21201 70 --
NM_014797chr632738 851 22 1905 ----
NM_014803chr1042901 2715 2269 1979 ------
NM_014820chr331645 804 782 --11996 --
NM_014824chr1111244 --2369 25 1341
NM_014827chr12601 64 --21275 644 --
NM_014832chr1351811 1725 1402 775 669 1531 1560 --
NM_014841chr631273 1051 903 1266 1883 --
NM_014873chr173346 3297 3285 1702 1671 974 900 ----13869
NM_014899chr522812 2329 --12038 --
NM_014903chr1252462 2380 1947 1840 245 --1565 --
NM_014906chr1753763 3118 991 951 830 --13352 11102
NM_014912chr1063083 2939 2871 2599 854 331 ----1170
NM_014918chr1521577 1325 --11118 --
NM_014924chr1442327 1273 1055 714 12888 23208 2183 12664
NM_014939chr1841577 1563 407 298 --11235 --
NM_014943chr82486 120 --3852 222 25 --
NM_014947chr143009 906 165 124 12417 12967 1381
NM_014949chr11424 1930 3804 656 376 --
NM_014959chr1941077 1002 523 258 1165 ----
NM_014961chr411597 --12152 --
NM_014969chr13808 444 205 ----154
NM_014974chr10----1226 --
NM_014978chr1021806 56 ------
NM_014989chr631892 1746 1557 ------
NM_014994chr1562025 1749 1541 1477 1464 815 --1347 --
NM_015011chr1331137 1098 448 143 ----
NM_015020chr1653897 3160 1287 1127 657 23275 707 13119 12927
NM_015026chr1244659 4407 4241 88 1944 13577 11640
NM_015032chr1362492 1833 826 660 490 438 1360 --1112
NM_015040chr242430 1240 1047 998 32738 2351 414 13172 --
NM_015042chr1593990 3597 3192 2800 1276 923 819 358 332 13624 1261 --
NM_015045chr1042278 1428 652 341 1413 2562 356 --
NM_015071chr542438 2279 1893 386 25408 1160 36015 4529 1651 36299 55 25
NM_015072chr14------1601
NM_015076chr6114429 4103 3623 3531 2937 1802 1562 1470 1110 543 523 21688 1190 --11656
NM_015077chr1784680 4021 3506 3283 2952 1354 852 27 21525 336 13390 --
NM_015093chr641200 637 437 81 1217 --1337
NM_015097chr392342 2277 2253 1954 1628 1588 1551 647 431 1748 21964 104 12351
NM_015101chr162879 2787 2712 2335 926 280 ------
NM_015138chr1532769 2562 2101 --22038 775 --
NM_015155chr1032629 2502 2474 --13290 --
NM_015156chr1453924 3411 3107 2535 665 11342 23247 37 --
NM_015170chr82199 122 2264 231 --1155
NM_015172chr141501 1390 398 168 11374 ----
NM_015173chr431739 1726 664 --21764 233 --
NM_015176chr1----1593 --
NM_015191chr1162634 2581 2362 2240 910 382 22462 536 22690 851 --
NM_015192chr2052772 2415 2379 2291 755 ----22591 416
NM_015199chr3122871 2670 2530 2522 2353 1892 1193 904 893 831 708 683 12318 1323 --
NM_015215chr163185 3109 2871 2122 839 725 --12150 --
NM_015227chr2163508 2600 1384 1145 955 784 12863 12603 --
NM_015238chr51159 ------
NM_015239chr9----1478 --
NM_015271chr493573 3340 3176 3110 2845 2619 518 474 398 22660 212 ----
NM_015278chr673011 3002 2900 1218 1117 925 894 --13086 1463
NM_015294chr1721052 376 ----11004
NM_015313chr1194667 4306 4298 3565 3216 3105 1235 584 459 23758 811 --21104 1066
NM_015315chr532247 1123 554 --11165 1712
NM_015317chr21118 --1651 --
NM_015336chr1242593 2441 1899 522 1319 ----
NM_015344chr841962 1887 612 154 1255 2383 21 --
NM_015347chr124944 846 250 181 2989 785 1157 --
NM_015349chr632598 2273 424 1655 12192 1905
NM_015355chr1731787 1232 496 ------
NM_015374chr22122 --11468 --
NM_015375chr164285 3717 3091 1903 1090 500 --14547 --
NM_015396chr321216 234 1498 ----
NM_015397chr921582 519 --11851 --
NM_015435chr8172 11279 11495 --
NM_015443chr1731142 455 252 1301 138 --
NM_015460chr331904 1838 307 1737 32115 1731 392 --
NM_015461chr181705 --1746 --
NM_015464chr73997 654 349 --185 --
NM_015472chr32532 486 ------
NM_015483chr711096 1792 1867 --
NM_015497chr152928 716 1176 3980 770 231 --
NM_015530chr23867 847 336 1961 1635 --
NM_015534chr11933 --11002 --
NM_015542chr10------1295
NM_015550chr763114 3013 2930 657 508 239 --12902 11214
NM_015564chr541163 389 348 312 21441 324 ----
NM_015565chr2142248 1582 1408 101 1815 --1843
NM_015567chr1321271 1092 --11096 --
NM_015570chr711401 ------
NM_015576chr31465 ----12189
NM_015609chr152896 2517 2411 913 666 ------
NM_015626chr1711011 168 1922 --
NM_015630chr21348 ------
NM_015641chr721276 59 ------
NM_015657chr22792 303 1199 ----
NM_015660chr71286 1297 ----
NM_015687chr6138 --3439 200 42 --
NM_015892chr1031944 1527 827 11626 --12043
NM_015902chr83886 732 35 --1323 --
NM_015906chr1104539 4527 3684 3435 3288 2962 1840 1643 1337 1228 33571 675 321 1913 22997 1845
NM_015915chr14----1306 --
NM_016009chr183740 3524 3156 1777 910 783 344 294 24093 3472 14900 1604
NM_016018chr852854 2484 1988 998 732 32698 2658 1854 ----
NM_016019chr72914 864 --155 --
NM_016021chr682298 2004 1993 670 607 360 223 37 22603 1868 ----
NM_016023chr83728 520 129 188 ----
NM_016040chr142740 2305 2002 1721 1175 11945 --
NM_016048chr52282 26 --2999 390 --
NM_016072chr1242169 2123 1672 515 12145 12356 --
NM_016081chr462180 2031 1540 1472 761 424 --11839 --
NM_016083chr683937 3818 3664 3549 3367 3177 1302 71 13397 1877 --
NM_016107chr541363 1234 1024 1012 ----11114
NM_016120chrX31187 904 789 1253 ----
NM_016121chr12904 139 159 ----
NM_016125chr17--1540 --159
NM_016131chr241946 1850 723 159 ------
NM_016132chr1593079 2853 2630 1362 1166 758 698 656 549 21288 1020 1441 --
NM_016133chr251526 1392 664 620 472 --1168 --
NM_016213chr15162 ------
NM_016230chr6------1197
NM_016231chr1741503 1429 1174 130 ----124
NM_016255chr6113146 2999 2847 2651 1326 1103 1056 967 866 623 130 --1737 --
NM_016269chr43995 216 164 ------
NM_016270chr19----1395 --
NM_016279chr51425 --1429 --
NM_016289chr252160 854 755 170 105 --194 --
NM_016315chr261768 749 454 233 192 69 ----1160
NM_016322chr9103147 2619 2530 1169 1056 474 442 159 95 68 1960 32027 1090 729 --
NM_016351chr7------1214
NM_016353chr831693 631 388 ----1868
NM_016374chr141244 341 182 100 ------
NM_016396chr152940 719 --2943 80 --
NM_016410chr92491 418 --1523 --
NM_016422chr1193065 2635 2522 1113 839 477 457 198 30 22589 2515 2597 318 --
NM_016424chr1751804 755 484 465 77 --11546 --
NM_016441chr232247 412 135 --11577 --
NM_016505chr1----1669 --
NM_016519chr42355 22 --1455 --
NM_016530chr1533939 2830 1536 2543 104 1473 --
NM_016578chr11----1575 --
NM_016605chr562592 2371 2125 1985 1951 52 21001 917 11069 12295
NM_016620chr11526 ----11134
NM_016623chr8285 24 1263 ----
NM_017415chr573937 3556 1759 1663 474 382 111 23983 3233 21278 582 1399
NM_017420chr1473670 3603 3046 2988 2893 2563 743 11278 ----
NM_017423chr492014 2006 1992 1784 776 640 200 186 77 21673 34 21519 86 --
NM_017426chr43698 609 47 1137 2268 147 --
NM_017435chr122613 314 --1730 --
NM_017508chr1131791 1648 350 12276 ----
NM_017544chrX3922 639 200 1384 ----
NM_017548chr381600 1565 494 439 404 163 133 83 11946 --1606
NM_017580chr1052174 1931 1730 1629 171 ------
NM_017599chr1241775 1391 816 383 --1229 --
NM_017610chr1581898 1838 1658 1529 767 506 397 233 12089 1698 --
NM_017635chr1151618 1610 1328 100 34 --1126 --
NM_017637chr968830 6333 6042 5784 3116 1650 15979 1882 --
NM_017643chr1732337 89 83 11258 --12447
NM_017644chr365196 3419 1512 1334 1153 898 13392 1581 --
NM_017650chr785234 4694 4043 3913 2040 1956 807 186 25647 4549 25591 811 --
NM_017658chr1474119 3831 3472 2840 1249 666 442 12923 11651 --
NM_017666chrX21838 797 --1407 --
NM_017680chr91212 ----1179
NM_017714chr203145 126 109 --1913 --
NM_017739chr11135 --1426 --
NM_017752chrX41697 1682 640 359 2654 629 21761 827 1392
NM_017754chr644238 3963 3445 1760 14374 14891 --
NM_017761chr121053 267 ----1437
NM_017769chr1453049 2769 2572 2483 1218 146 --1551
NM_017778chr811160 --11106 --
NM_017780chr83889 617 56 ------
NM_017810chr166732 708 681 473 203 62 1106 1112 --
NM_017812chr71631 ------
NM_017848chrX84391 3869 3828 3154 1587 1149 768 131 --11639 --
NM_017910chr22103 74 ----1353
NM_018011chr13----1448 --
NM_018013chr633042 2090 234 --33045 1980 429 --
NM_018030chr1831017 930 230 1298 1257 --
NM_018051chr72401 351 --1304 --
NM_018061chr121409 521 ------
NM_018084chr213185 1278 1210 --
NM_018086chr22772 324 ----1689
NM_018092chr1651339 547 333 226 132 --1625 --
NM_018103chr1--1297 ----
NM_018120chr831364 543 424 --11068 1413
NM_018121chr1063207 2500 2251 2245 1001 573 22904 2514 12370 --
NM_018131chr103902 248 157 1241 ----
NM_018133chr331669 1636 526 ------
NM_018184chr331992 1678 1543 11934 --1143
NM_018214chr641145 812 139 42 1381 1253 --
NM_018221chr2143 1134 ----
NM_018241chr43964 277 31 --1136 --
NM_018247chr673047 2344 2227 2015 896 798 309 ----1229
NM_018275chr71568 1145 1545 --
NM_018312chr113753 624 352 123 31955 1755 96 --
NM_018323chr471670 1593 1501 1392 604 292 76 ------
NM_018325chr921114 675 11090 2415 302 --
NM_018330chr1031647 1314 457 --11069 1211
NM_018360chrX----2130 70 --
NM_018362chr1164015 2612 1199 831 738 230 1370 13441 --
NM_018364chr193910 3763 2669 1484 1010 912 839 773 223 ----1958
NM_018374chr795043 4750 4632 4025 3938 1753 1656 405 221 140 11757 33369 393 323
NM_018383chr242025 1697 1670 1468 --1168 --
NM_018403chr393336 3300 3227 3194 2917 1591 1469 1300 1281 11106 13874 --
NM_018433chr21185 --1490 --
NM_018444chr831804 1779 72 1696 21547 884 --
NM_018445chr151483 ----1411
NM_018466chrX3626 528 198 --1676 --
NM_018482chr852387 2171 715 213 89 1397 2305 49 --
NM_018489chr152043 1659 1637 797 287 --1595 --
NM_018553chr171135 --1374 --
NM_018557chr2151 2491 240 11465 21553 171
NM_018566chr163691 3639 3585 2065 2035 228 21809 263 25014 3127 --
NM_018638chr12104829 4312 4129 3878 2075 2026 1436 1063 774 188 --35423 2091 1735 14406
NM_018650chr11762 --1556 --
NM_018667chr1632827 1862 366 11845 12595 --
NM_018704chr132172 769 503 1202 ----
NM_018712chr1141575 1361 1001 200 --2409 406 --
NM_018717chr472772 2373 856 779 735 666 350 1549 ----
NM_018834chr54952 709 395 260 1977 1102 --
NM_018945chr643081 2942 2758 2383 2814 623 1946 1387
NM_018948chr1----11245 11294
NM_018963chr2151540 1534 1172 260 89 ----11480
NM_018970chr742859 1951 939 440 43076 1142 188 50 1444 --
NM_018976chr1261852 1098 1083 714 432 62 --12275 --
NM_018979chr1242314 921 436 92 12374 1857 --
NM_018999chr1084800 4044 3900 1758 1471 1322 1138 807 23463 1030 1173 --
NM_019004chr742427 1637 959 812 --11878 1945
NM_019012chr123806 616 581 --1814 --
NM_019042chr711246 ------
NM_019048chr2169 --180 --
NM_019049chr12189 94 ------
NM_019058chr10--1296 --1514
NM_019063chr232092 413 396 1466 22136 257 --
NM_019084chr1062490 2314 2271 2221 733 34 --12225 --
NM_019087chr521352 449 ----1205
NM_019091chr241019 943 850 51 --165 --
NM_019094chr1243316 3137 1042 342 12475 33504 3319 3203 --
NM_019106chr2282690 2585 2526 2435 2108 2098 703 675 --1678 12207
NM_019116chr1653536 2576 1492 1346 660 23585 3311 13713 --
NM_019117chrX52651 1308 1015 545 269 --23218 706 --
NM_019555chr341611 1573 277 202 --1315 --
NM_019556chrX31500 1168 1001 ----1103
NM_019596chr2132509 593 262 12240 --12115
NM_019600chr151714 --1739 --
NM_019885chr282748 2661 2649 1863 1811 591 583 329 1704 12449 --
NM_019886chrX2649 439 1164 1150 --
NM_020066chr13845 650 164 1374 ----
NM_020122chr274865 3659 1882 725 711 346 311 --22341 369 12354
NM_020144chr761752 1662 1425 690 455 130 1370 1469 --
NM_020148chr1842156 628 298 276 21058 510 22862 2525 12987
NM_020180chr18----11120 --
NM_020182chr2053571 3431 3310 2825 621 12764 ----
NM_020205chr173367 3355 3091 2862 2300 973 208 23286 481 23405 2601 --
NM_020310chr1762643 957 642 374 365 181 1942 --12705
NM_020337chr432979 2230 56 --21975 142 --
NM_020338chr1033271 2895 2666 --13685 --
NM_020341chr2051997 1577 1469 1294 1254 11613 22030 1879 --
NM_020342chr22590 109 ----1637
NM_020346chr1141562 528 351 301 ------
NM_020357chr32334 305 1453 --1461
NM_020381chr61161 --124 --
NM_020386chr3--1140 ----
NM_020403chr1341758 1610 474 419 --1281 --
NM_020432chr742142 1738 846 159 1839 11899 --
NM_020438chr93369 245 207 11193 11403 --
NM_020474chr1811900 1364 ----
NM_020640chr341718 1592 855 76 --12121 --
NM_020699chr153301 1387 1299 1254 1231 15326 1201 --
NM_020708chr2022484 2314 --12321 --
NM_020715chr1421606 106 1296 179 --
NM_020718chr16116302 5146 4430 4026 2552 1905 1742 1619 833 663 429 15111 ----
NM_020734chr1262933 2868 2457 2231 2195 534 --13306 --
NM_020748chr1731981 1837 221 --11608 --
NM_020768chr533077 969 794 13219 1139 --
NM_020771chr611444 --21089 441 130
NM_020778chr15114510 3359 3301 3019 1945 1864 1672 1488 724 518 474 --23529 304 --
NM_020783chr1812049 ------
NM_020791chr17--21243 1096 1494 11436
NM_020794chr111260 --11015 --
NM_020801chr562627 2354 788 668 185 106 1814 ----
NM_020809chr1121659 161 --22226 1816 --
NM_020824chr101156 --140 --
NM_020854chr184992 490 412 147 --2161 158 --
NM_020858chr1552014 1791 1732 702 169 11647 ----
NM_020860chr43732 164 48 --1461 1218
NM_020870chr422107 1956 ------
NM_020871chrX32245 2005 1814 --12345 --
NM_020888chr131801 1552 299 --21758 1487 128
NM_020918chr1063549 3504 3372 2897 1331 394 11085 1329 --
NM_020929chr111152 ------
NM_020972chr45991 955 378 313 108 --1984 --
NM_020975chr1011892 ----11943
NM_021033chr1322583 2326 1788 1313 32989 2887 1223
NM_021038chr333251 2218 1295 13223 23345 2819 --
NM_021072chr532529 1919 555 --12215 --
NM_021097chr212206 1106 --12964
NM_021109chrX------1149
NM_021116chr7107826 7667 7633 7610 2326 2197 1602 1448 1349 654 19055 ----
NM_021136chr141668 --175 --
NM_021140chrX61051 852 795 761 167 97 --11158 1276
NM_021144chr9--148 1185 --
NM_021183chrX11849 --12596 11687
NM_021190chr12332 195 --1464 --
NM_021191chr1262333 1784 1014 999 945 380 1610 --12179
NM_021229chr122360 252 ------
NM_021238chr1241935 1498 646 478 ----1776
NM_021239chr1451112 898 510 411 251 1287 21389 226 --
NM_021248chr201769 ------
NM_021249chr1411592 ----1499
NM_021255chr1484119 3605 3232 1575 1561 1484 1280 41 --14068 --
NM_021633chr14967 951 943 261 --21074 1024 --
NM_021637chrX51045 876 330 252 138 11053 --1257
NM_021638chr474979 3772 1732 1283 921 687 176 13306 34105 3499 924 11631
NM_021639chr1----1724 --
NM_021643chr221400 600 --1743 --
NM_021784chr20----1451 --
NM_021809chr202268 259 22329 190 22461 2221 --
NM_021813chr654626 4165 3796 2333 81 --25773 4174 --
NM_021814chr641467 1214 689 86 --2602 263 --
NM_021821chr121155 ----1840
NM_021914chr1432370 1572 931 ----1677
NM_021947chr1721307 327 1921 1845 --
NM_021954chr1352836 2754 2742 2628 921 11472 11092 13160
NM_021961chr1136122 5166 4816 12374 36947 4600 1984 --
NM_021964chr396186 5041 4445 4141 2449 1199 641 625 224 25763 5106 15802 --
NM_021977chr653796 3684 2601 1439 677 --12660 --
NM_021998chrX51460 1029 560 182 49 ------
NM_022041chr1631672 893 436 --2999 360 --
NM_022048chr1576200 5446 2328 644 319 240 227 --26395 1671 --
NM_022051chr13477 230 50 --1167 --
NM_022060chr14----11357 --
NM_022103chr191399 --1240 --
NM_022133chr851824 1298 583 64 34 --2318 180 --
NM_022144chrX1117 --133 --
NM_022351chr853649 3499 509 368 96 ------
NM_022444chr741272 771 148 119 21586 668 --11925
NM_022459chr1356198 4535 4040 1740 184 15892 25251 1174 --
NM_022461chr331222 519 227 ----11231
NM_022465chr1242181 2123 1127 594 --23044 108 --
NM_022482chr2061979 1732 898 640 431 212 --1315 --
NM_022552chr2----1843 --
NM_022728chr72577 229 --1135 --
NM_022735chr11732 11254 ----
NM_022755chr952243 995 784 745 516 --31887 1853 434 --
NM_022763chr333083 2549 811 --12333 --
NM_022780chr211612 --1693 --
NM_022824chr5--21568 396 ----
NM_022826chr231114 189 72 --1328 --
NM_022831chr141181 486 459 285 ------
NM_022841chr153596 496 92 12696 11712 --
NM_022893chr243110 2957 2583 957 --1287 --
NM_022897chr531116 985 786 --21043 914 --
NM_022898chr1494587 4524 4322 3967 3935 3330 1907 1578 1282 11239 --11911
NM_022903chr31241 ------
NM_023016chr262520 2464 2163 1843 840 709 ----1506
NM_023037chr131822 1274 --1771
NM_023076chr1652122 2022 1120 933 28 --1346 --
NM_024015chr1721045 873 ------
NM_024046chr31823 11298 ----
NM_024095chr121576 21521 1479 ----
NM_024295chr851671 1458 829 314 201 --1204 --
NM_024345chr964071 2312 2081 1094 811 524 1234 35601 4948 4361 --
NM_024492chr61137 --21010 355 --
NM_024492chr61137 --21010 355 --
NM_024604chr12--158 ----
NM_024617chr91629 ------
NM_024631chr111514 --1518 --
NM_024632chr51282 ------
NM_024656chr193436 275 183 2361 60 ----
NM_024665chr3113890 3696 3473 3417 2890 1859 1673 1409 1316 231 77 --23700 965 --
NM_024689chrX21851 707 ----1623
NM_024700chr11118 --1312 124
NM_024713chr151116 --21238 302 11376
NM_024721chr822520 558 ------
NM_024742chr16111412 1398 1364 1214 722 661 351 292 139 115 81 ------
NM_024745chr1621064 861 --166 11025
NM_024749chr12824 85 --1391 --
NM_024757chr9------1747
NM_024761chr91334 --1885 --
NM_024792chr171857 --1200 --
NM_024824chr1441335 1228 573 411 --1281 --
NM_024835chr17----149 --
NM_024850chr5----1114 --
NM_024874chr14992 362 98 83 --21365 1357 --
NM_024923chr351413 1367 489 391 72 ------
NM_024939chr1621620 617 --11026 --
NM_024953chr1252307 1995 1766 1059 503 --12403 12441
NM_024956chr15------1163
NM_024993chr241221 571 168 30 ----11505
NM_024996chr33806 773 757 2211 90 --1262
NM_025010chr332286 1097 423 22215 1020 22345 1027 --
NM_025054chr8104214 3964 3817 3078 3032 2876 1675 1495 1135 996 33140 2815 226 1179 --
NM_025076chr2----1606 --
NM_025083chr153677 39 29 --1737 --
NM_025133chr21824 --2923 214 --
NM_025134chr1622535 138 199 --2507 341
NM_025138chr1311050 ----21328 550
NM_025146chr342417 1089 699 650 --22600 996 --
NM_025179chr184896 4465 4340 3712 3679 3439 3204 841 34972 3787 1923 1306 --
NM_025191chr143173 3038 2561 819 --23396 1056 23526 280
NM_025222chr372711 2421 2167 1889 457 256 169 1330 12843 --
NM_025244chr21263 ----1255
NM_030579chr1683683 3540 3140 2972 2729 2684 2400 1332 --12348 --
NM_030627chr564101 3901 3873 3630 3484 2911 11108 11640 1783
NM_030629chr16----11895 --
NM_030637chr14----2589 535 --
NM_030647chr786229 5829 5654 5246 4881 4145 1255 1057 1888 22507 1028 --
NM_030648chr4125460 4544 4149 4013 3526 3449 2202 1069 1048 438 167 89 24195 213 ----
NM_030751chr1011163 11336 1113 --
NM_030762chr1231760 1385 1374 ------
NM_030806chr198755 7475 6214 5913 3142 2939 1937 760 32 11697 136 17050
NM_030885chr321735 26 2927 162 12335 --
NM_030939chr6----21044 280 --
NM_030958chr81413 ------
NM_030964chr563487 3442 3402 1169 680 576 1761 13676 --
NM_031208chr161268 --2978 744 --
NM_031445chr221361 858 33257 2776 748 2273 102 1721
NM_031461chr842201 1711 101 35 --21811 81 12221
NM_031483chr2043147 2680 2414 1347 --23432 509 --
NM_031966chr53491 380 153 --172 --
NM_032120chr72477 88 --191 --
NM_032128chr421037 395 ------
NM_032149chr4----1168 --
NM_032172chr71326 ----1230
NM_032181chr2----1604 --
NM_032199chr102933 493 12872 13802 --
NM_032208chr2--22938 653 12231 --
NM_032217chr451301 996 556 534 313 195 ----
NM_032229chr1331168 809 729 1799 ----
NM_032256chr123709 402 191 ----1246
NM_032289chr511382 11516 21903 1398 --
NM_032291chr121697 577 ------
NM_032352chr1431269 1193 556 ----11305
NM_032373chr1045408 2328 2119 42 22190 200 ----
NM_032379chr113256 102 36 ------
NM_032439chr102311 195 1376 1524 --
NM_032440chr1041863 712 614 93 --248 25 --
NM_032445chr1551759 1638 1036 391 263 137 11955 --
NM_032457chr473845 3736 3254 3201 1545 807 177 --13726 --
NM_032458chrX93433 3096 2735 2638 1270 651 573 435 383 13138 12154 --
NM_032466chr811463 ----195
NM_032576chrY1129 ----170
NM_032582chr1721814 1474 --11840 --
NM_032632chr1451485 353 225 192 135 --1238 --
NM_032682chr323558 3150 --13198 13653
NM_032804chr1052460 981 833 508 95 ------
NM_032810chr1011289 --1173 1477
NM_032838chr191448 ----11193
NM_032839chr31158 ------
NM_032867chr111120 ----1521
NM_032905chr103835 809 241 ------
NM_032968chrX123675 3255 3006 2788 1339 1234 947 844 747 577 558 268 32834 1572 1112 14172 23492 320
NM_032973chrY123667 3250 3001 2783 1339 1234 947 844 747 577 558 268 32829 1571 1112 14164 23488 320
NM_033055chr11711 ------
NM_033058chr81357 --1130 --
NM_033081chr20----1122 --
NM_033092chr111326 --1298 --
NM_033127chr1------1694
NM_033132chr1372155 1847 1566 804 764 708 553 ----1655
NM_033211chr521879 1315 --166 11286
NM_033225chr852879 1158 1000 129 104 --22691 984 --
NM_033285chr854240 3403 3183 797 364 21532 1286 ----
NM_033394chr241640 1539 1160 353 --11612 --
NM_044472chr14581 261 219 30 --2265 48 --
NM_052840chr1511045 --1359 --
NM_052845chr1233169 3007 2571 --1893 13232
NM_052879chr1222788 428 ------
NM_052880chr2231106 563 268 1487 11368 --
NM_052903chr151547 ----1612
NM_052911chr18--2396 39 2974 899 --
NM_052937chr852567 1944 1709 592 447 129 ----
NM_052953chr32260 228 ------
NM_053002chr321135 821 --11029 1424
NM_053056chr1132043 969 828 --12183 --
NM_057175chr462564 2183 2023 511 346 73 21701 152 --12193
NM_058172chr411121 ------
NM_080422chr182299 274 ------
NM_080738chr11618 11393 1735 --
NM_080743chr622215 323 --12342 11669
NM_080927chr342209 244 192 147 --1232 --
NM_101395chr2143453 2931 2632 393 11327 12934 --
NM_130387chr32890 65 --147 --
NM_133264chr1773310 3088 2871 2734 1531 764 581 ----12752
NM_133334chr465195 4739 1215 361 111 28 15258 16209 --
NM_133367chr693377 3280 3159 2864 2852 2707 1149 849 515 13065 ----
NM_133496chr174325 4316 1291 1193 459 433 421 11266 11044 --
NM_134424chr125501 279 264 86 56 --1789 1273
NM_138290chr71117 --165 --
NM_138335chr4----1847 --
NM_138340chr181141 ------
NM_138357chr1011487 1531 11277 11785
NM_138375chr1821152 941 --168 --
NM_138423chr1542323 2052 1597 1458 ------
NM_138444chr13124901 4456 4408 4213 3605 3504 1330 1203 807 759 330 97 ----14461
NM_138459chr693580 3315 3285 3192 2597 2434 1331 1110 328 1462 --11291
NM_138463chr17------1135
NM_138473chr12104581 4478 4204 3947 3759 3593 3310 2054 2031 770 --11152 23924 893
NM_138479chr131854 1780 653 ----1432
NM_138773chr51899 --1903 --
NM_138927chr213909 758 71 ------
NM_138959chr195128 4773 4698 4253 1769 1689 1574 1367 652 16229 36125 2217 1067 --
NM_139136chr123858 439 402 1132 --170
NM_139279chr253510 3050 2705 2529 633 1269 42903 2855 99 96 --
NM_139283chr1262559 1943 1718 1626 171 70 ------
NM_144571chr4146929 6882 6718 6503 6384 6366 5883 5725 5549 2123 1444 1315 1181 197 26625 937 ----
NM_144664chr1112374 --1658 12522
NM_144775chr1743768 3742 3336 3110 11482 44635 3698 3129 1399 --
NM_144778chr1372374 2112 1992 1830 1694 1043 61 --21091 466 --
NM_144982chr122774 756 --1637 --
NM_145056chr19----1774 --
NM_145206chr1053149 2789 1304 731 597 --1675 --
NM_145284chrX31981 598 133 --32480 1553 34 --
NM_145307chr1074624 4215 3593 3551 3360 3097 509 13205 ----
NM_145808chr782811 2027 1026 989 796 482 413 210 11105 157 --
NM_147128chr711536 1181 21619 1197 --
NM_147190chr12----1717 --
NM_147223chr222028 2008 22360 175 ----
NM_148894chr41340 11238 1168 --
NM_152261chr1232026 867 740 --1113 --
NM_152265chr1----11161 --
NM_152275chr241899 1701 1642 391 --11902 --
NM_152390chr21203 --1177 1129
NM_152415chr82417 199 ------
NM_152446chr143946 742 701 --1344 --
NM_152448chr15----1504 --
NM_152450chr153786 711 340 11949 11434 --
NM_152520chr22774 186 ------
NM_152556chr732157 1834 281 1539 1224 --
NM_152594chr1531899 1529 601 ------
NM_152624chr5136184 5923 5541 5197 4546 2939 2073 1855 1683 869 772 753 313 26970 2446 57207 5967 5951 2076 707 14687
NM_152641chr1232896 1152 972 163 1226 --
NM_152653chr31509 ----1561
NM_152665chr12969 76 ------
NM_152682chr461592 1131 560 477 221 70 ----1464
NM_152688chr63741 135 125 ------
NM_152699chr333405 3032 2629 --2177 121 --
NM_152716chr1161567 1268 1066 324 209 177 21488 378 21055 52 --
NM_152739chr721013 789 11101 ----
NM_152753chr622091 200 --11818 --
NM_152756chr573855 3287 3114 1685 1546 548 133 --1491 1158
NM_152758chr83889 384 251 ------
NM_152780chrX2845 73 2258 54 ----
NM_152787chrX53763 3541 2515 770 316 12654 13505 1320
NM_152835chr122701 2236 1705 12763 --
NM_153035chr163162 2213 2071 2024 602 352 --1719 --
NM_153184chr34742 693 211 122 1610 1180 --
NM_153207chr1211424 --31296 659 211 --
NM_153235chr622362 2146 --11898 --
NM_153252chrX148 ------
NM_153260chr1531480 1258 1086 11034 11292 --
NM_153261chr16--11034 31282 612 334 --
NM_153262chr153180 2841 2664 2595 2236 22733 2006 22759 61 --
NM_153267chr93841 214 138 1775 ----
NM_153341chr1------1320
NM_153354chr52796 244 1811 ----
NM_153371chr1342280 2077 909 837 21812 97 21890 105 --
NM_153607chr543206 2924 2554 208 21231 1047 ----
NM_153634chr1271529 1422 1416 1357 1300 393 345 11583 ----
NM_153685chr121755 --11200 --
NM_153712chr221156 372 ----13547
NM_170662chr3------2627 598
NM_172070chr262260 1828 1617 757 667 360 --12172 --
NM_172071chr185703 5177 5107 2077 1651 1355 1212 151 25066 1466 25877 4946 --
NM_172127chr422139 1638 --31941 376 261 --
NM_172193chr1431071 315 280 --11327 --
NM_173039chr11----1167 --
NM_173083chr11149 --3839 353 94 --
NM_173156chr131498 561 475 12218 2781 245 --
NM_173468chr4135774 5572 5459 5103 4587 4208 3937 1951 1017 544 475 458 169 15901 14120 --
NM_173470chrX52489 2430 2194 693 683 --1385 --
NM_173475chr161706 ----184
NM_173496chr1073006 2974 2948 496 437 356 337 12661 12952 21137 908
NM_173511chr243206 3179 760 424 --33579 3562 746 --
NM_173582chr1195420 5263 4318 4119 3979 1404 1181 677 617 24957 646 55495 4623 4132 2046 2032 --
NM_173595chr1295329 4537 4037 4011 3563 2080 1141 378 314 --1632 --
NM_173642chr1208904 8823 8772 7598 7334 7270 6963 6924 6892 6530 6087 2853 1773 1687 931 883 463 287 241 39 47029 2464 979 915 17123 --
NM_173644chr2011437 11444 11873 --
NM_173653chr341319 589 321 278 --1234 1550
NM_173667chr522061 1541 ------
NM_173698chrX41852 1676 1449 118 ------
NM_173822chr211380 --2552 435 --
NM_173826chr31210 11345 1117 11073
NM_173827chr472976 2775 2563 2535 2239 1101 318 33027 2678 601 1640 1899
NM_174890chr105669 536 150 73 21 ------
NM_174937chr101255 --1155 --
NM_175607chr341293 1255 529 450 --1110 --
NM_175733chr1121943 717 ------
NM_175736chr12147457 7282 7102 6677 6573 6526 6338 4937 2414 1954 1646 1363 1094 834 16394 17842 --
NM_175767chr53500 262 199 --1629 --
NM_175856chr52234 136 1216 ----
NM_175866chr11490 ------
NM_176814chr71985 --21370 144 --
NM_176816chr541802 1631 1620 712 --21953 517 --
NM_176823chr153150 2645 1511 1257 1120 --13844 --
NM_177424chr12594 134 2276 196 ----
NM_177538chr2128694 8066 7919 6678 5517 2883 2857 2246 2018 1684 968 187 22206 909 11337 12371
NM_177968chr242232 1730 1539 657 ------
NM_178013chr144892 865 347 299 13038 12823 --
NM_178148chr6160 --1598 --
NM_178426chr11949 --2952 108 --
NM_178818chr164983 963 906 512 22310 196 12479 --
NM_181054chr142121 104 ------
NM_181077chr1542312 2076 504 108 ----12300
NM_181358chr12639 471 13160 11492 34044 1201 654
NM_181670chr1251514 1122 1015 959 104 ------
NM_181672chrX42002 1559 797 193 --11977 --
NM_181704chr2151425 1280 1114 1045 235 ------
NM_181783chr122292 66 ------
NM_181836chr532356 1806 322 --22584 1977 11949
NM_182760chr31722 ------
NM_182765chr1071695 1679 1525 894 376 367 55 --12089 --
NM_182830chr143894 870 676 ----1113
NM_182920chr31521 --1349 --
NM_194247chr274332 4080 1519 1463 898 497 157 2545 227 23548 866 --
NM_194282chr472782 2533 2484 2377 2219 2063 765 --2756 87 --
NM_194285chr1173201 3092 2565 2326 710 328 42 21121 378 ----
NM_194314chr195153 4543 4159 4026 3950 3699 1053 908 811 35264 281 158 ----
NM_194449chr181875 --1878 --
NM_197939chr1711030 --1148 --
NM_197941chr542632 703 468 266 21923 989 22509 630 --
NM_198077chr13437 423 29 --1444 --
NM_198141chr1531448 1055 278 ----1944
NM_198270chrX53208 1001 525 379 113 11121 ----
NM_198281chr453214 2386 2192 1125 950 1897 1413 --
NM_198404chr133682 649 119 1193 1131 --
NM_198504chr33722 145 63 --2801 25 --
NM_198531chr181613 2887 587 1617 --
NM_198563chr3----1155 1495
NM_198568chr62927 110 --1784 --
NM_198581chr2127541 7298 7237 5951 4722 2928 2546 1704 1222 728 378 56 22935 1579 22628 731 16167
NM_198859chr374482 3894 3455 3447 2059 2018 851 35136 4504 1356 24468 1028 --
NM_199000chr72855 693 ----1668
NM_199168chr1011514 --21355 257 --
NM_199320chr482904 2806 2117 1786 878 666 627 234 --11820 11118
NM_199328chr213481 97 60 --2438 304 --
NM_199461chr1072614 2212 1421 1191 972 466 301 --13328 1717
NM_203282chr1941456 408 276 61 1138 11368 --
NM_203349chr1541745 1717 1506 885 --1332 --
NM_203364chr1111205 1297 --21135 875
NM_203394chr1252591 2554 2224 821 423 --2799 762 --
NM_203446chr2132497 939 600 12659 32672 322 283 --
NM_203454chr13378 168 152 2542 408 ----
NM_203459chr142299 1921 1609 1597 12249 ----
NM_206853chr674070 3675 3662 763 685 421 224 --33559 2636 617 --
NM_206855chr676296 5901 5888 2450 1730 1624 1547 --25785 4862 2905 256
NM_207111chr751852 1801 781 315 155 --22748 797 --
NM_207371chr1061415 976 333 291 233 145 ------
NM_207422chrX31309 1207 114 --21141 33 --
NM_207517chr1561889 1874 1401 793 787 27 21447 724 21943 1597 --
NM_207577chr1142816 2394 2367 794 ------
NM_207645chr1131308 960 911 --11018 --
NM_213589chr295458 5029 4876 4687 1999 1593 1488 1243 42 --25509 732 15425